You are on page 1of 53

CSS/HRT 451 CSS/HRT 451 CSS/HRT 451 CSS/HRT 451

CSS451
Agrobacterium-mediated transformation
Guo-qing Song
G D li S t m Gene Delivery System
Agrobacterium
Viral vectors
Biolistic
Microinjection
PEG - Polyethylene Glycol PEG Polyethylene Glycol
Electroporation
2
Biolistic Transformation Biolistic Transformation
------- Advantage and Disadvantage
Advantage:
This method can be use to transform all plant species.
No binary vector is required.
T f ti t l i l ti l i l Transformation protocol is relatively simple.
Disadvantage: g
Difficulty in obtaining single copy transgenic events.
High cost of the equipment and microcarriers High cost of the equipment and microcarriers.
Intracellular target is random (cytoplasm, nucleus, vacuole,
plastid, etc.).
3
Transfer DNA is not protected.
Learning Objectives
Understand what key changes had to be made to the
Agro tumor-inducing (Ti) or root-inducing (Ri) plasmid
for the transfer of novel genes into plants for the transfer of novel genes into plants
Understand the binary plasmid transformation system
Understand some mechanisms of gene transfer
4
OUTLINE
CSS451
Agrobacterium Tumefaciens & Crown Gall Disease
Mechanism Mechanism of of Gene Transfer using Gene Transfer using A. tumefaciens A. tumefaciens
Ti pl smid Ti-plasmid
Chromosomal and Vir Genes
T-DNA Transfer
T-DNA Integration
Engineering binary vectors for plant transformation Engineering binary vectors for plant transformation
T-DNA Integration
Transformation protocols using Transformation protocols using Agrobacterium Agrobacterium
Factors influencing transformation efficiency Factors influencing transformation efficiency
5
CSS451
Why Agrobacterium?
Agrobacteria are naturally occurring, ubiquitous soil borne
pathogens.
A. tumefaciens causes crown gall disease (tumors)
A. rhizogenes causes root hair disease (hairy root)
Other bacterial groups also contain species capable of
A b i f i A b i
g p p p
interkingdom genetic exchange (Gelvin 2005).
Agrobacterium tumefaciens- or Agrobacterium
rhizogenes-mediated transformation is to date
the most commonly used method for obtaining
l transgenic plants.
The tumorigenic host plant species for range A.
t f i i l d L b f di t d
6
tumefaciens include: Large number of dicots and
some monocots and Gymnosperms.
CSS451
7
A.Tumefaciens & Crown Gall Disease A.Tumefaciens & Crown Gall Disease
CSS451
8
Stanton B. Gelvin. Nature 433:
583-584 (2005).
http://arabidopsis.info/students/agrobacterium/
Gene Transfer using Agrobacterium Gene Transfer using Agrobacterium
Ti Ti l id l id
GGCAGGATATTCAATTGTAAAT
Ti Ti--plasmid plasmid
GGCAGGATATTCAATTGTAAAT
GGCAGGATATTCAATTGTAAAT
Left T-DNA border
Right T-DNA border
9
Right and left border (RB, LB) sequences are the only parts of
T-DNA needed to enable transfer into plants-
Removal of other T-DNA genes creates a disarmed Ti plasmid
Gene Transfer using Agrobacterium Gene Transfer using Agrobacterium
Agro types Agro types
Hellens et al (2000; Trends in Plant Science 5:446-451)
Agropine Agropine--type type (strain EHA105::pEHA105): (strain EHA105::pEHA105):
Carry genes for agropine synthesis and catabolism.
Tumors do not differentiate and die out.
Octopine Octopine--type type (strain LBA4404::pAL4404): (strain LBA4404::pAL4404):
Carry genes(3 required) to synthesize octopine in the
plant and catabolism in the bacteria plant and catabolism in the bacteria.
Tumors do not differentiate, but remain as callus tissue.
Nopaline Nopaline--type type (strain GV3101::pMP90 (pTiC58)): (strain GV3101::pMP90 (pTiC58)): Nopaline Nopaline type type (strain GV3101::pMP90 (pTiC58)): (strain GV3101::pMP90 (pTiC58)):
Carry gene for synthesizing nopaline in the plant and
for utilization (catabolism) in the bacteria.
Tumors can differentiate into shooty masses (teratomas).
10
Gene Transfer using Agrobacterium Gene Transfer using Agrobacterium
Agro types Agro types
LBA4404: rifampicin (chromosomal) and streptomycin (on
the Ti plasmid)
EHA105rifampicin (chromosomal) and streptomycin (on
the Ti plasmid)
GV3101: streptomycin 500 mg/l
11
Hellens et al (2000; Trends in Plant Science 5:446-451)
Gene Transfer using Gene Transfer using Agrobacterium Agrobacterium
CSS451
h l d d GG
Chromosomal and vir genes of
bacterial cells are both
Chromosomal and Vir and Vir Genes Genes
Virulence genes
bacterial cells are both
involved in T-DNA transfer
g
vir A
vir B
vir C
Chemoreceptor, activator of vir G
Transmembrane complex
Host range specificity vir C
vir D
vir E
Host-range specificity
Site-specific endonuclease
T-DNA processing and protection
vir F
vir G
Host range specificity
Positive regulator of vir B, C, D, E, F
12
Chromosomal
genes
Attachment to plant cell, vir gene regulation
Disarmed Ti Disarmed Ti--plasmid plasmid
T-DNA
LB RB auxin cytokin
opine
Oncogenic genes
vir genes ori opine catabolism
13
Disarmed Ti Disarmed Ti--plasmid plasmid
LB RB
i i i t b li vir genes ori opine catabolism
Disarmed Ti -plasmid
14
A Binary Vector Map A Binary Vector Map
15
A Binary Vector Map A Binary Vector Map
Plant selectable marker
Km
R
Bacterial selectable marker
16
From Dr. S. Gelvin, Purgue University From Dr. S. Gelvin, Purgue University
Introduction of Binary Vector into Agro Introduction of Binary Vector into Agro
Electroporation Electroporation
Freeze/Thaw Freeze/Thaw
Triparental Mating Triparental Mating Triparental Mating Triparental Mating
Agrobacterium
17
Competent Agrobacterial Cells
Introduction of Binary Vector into Agro Introduction of Binary Vector into Agro
Electroporation Electroporation
Freeze/Thaw Freeze/Thaw Freeze/Thaw Freeze/Thaw
Liquid nitrogen (196C) 3 min Liquid nitrogen (196C) 3 min---- ----37C 30 min 37C 30 min
18
Binary Vector System Binary Vector System
Agro only Agro/E Coli
Binary Vector Binary Vector Ti Helper Plasmid Ti Helper Plasmid
Agro only Agro/E. Coli
19
Binary Vector System Binary Vector System
Plant selectable marker
Km
R
Bacterial selectable marker
20
Introduction of Binary Vector into Agro Introduction of Binary Vector into Agro
Agro culture Agro colonies
Agro stock
(-80C with Glycerol)
21
Mechanism Mechanism of Gene Transfer using of Gene Transfer using Agrobacterium Agrobacterium
CSS451
External Signals
such as
Acetosyringone

22
Stanton B. Gelvin. Nature 433: 583-584 (2005)
Passage of T-DNA from Agrobacterium cells into plant
genomic DNA
Mechanism Mechanism of of Gene Transfer using Gene Transfer using Agrobacterium Agrobacterium
------ ------ The Plant Cell Step The Plant Cell Step
CSS451
Chromosomal and vir genes of bacterial cells are both
involved in T-DNA transfer
The plant cell step of T-DNA transfer is poorly
understood
Entry into plant cell?
Nuclear uptake?

Integration into chromosome?

23
CSS451
24
Expression of the Transgene Expression of the Transgene
CSS451
External Signal
Cell Receptor
Regulatory Elements Promoter Gene Terminator
p
Where When How much
Go
STO
P
Transcription
Where When How much
Translation
mRNA
Constitutive promoters:
CaMV35S Actin Ubi
a stop codon (or
termination
Translation
Protein
CaMV35S, Actin, Ubi
Inducible prompters: rbcS
Tissue specific promoters: Cab
termination
codon): UAG (in
RNA) / TAG (in DNA)
("amber"), UAA /
TAA ("ochre"), and
UGA / TGA ("opal" or
25
Protein
Tissue specific promoters: Cab
UGA / TGA ( opal or
"umber"
Summary: T Summary: T- -DNA transfer DNA transfer Summary: T Summary: T- -DNA transfer DNA transfer
CSS451
1. Agrobacteria attach to plant cell surfaces at wound sites. g p
2. The plant releases wound signal compounds, such as acetosyringone.
3. Vir C and/or Vir F recognize the host plant cells.
4. The signal binds to vir A on the Agrobacterium membrane.
5 Vir A with signal bound activates vir G 5. Vir A with signal bound activates vir G.
6. Activated vir G turns on other vir genes, including vir D and E.
7. Vir D cuts at a specific site in the Ti plasmid (tumor-inducing), the left
border.
8. Single stranded T-DNA is bound by vir E product as the DNA unwinds
from the vir D cut site. Binding and unwinding stop at the right border.
9. Vir B + T-DNA complex is transferred to the plant cell, where it
integrates in nuclear DNA integrates in nuclear DNA.
T-DNA codes for proteins that produce hormones and opines. Hormones
encourage growth of the transformed plant tissue Opines feed bacteria ----a
26
Zhu et al. Journal of Bacteriology (2000)
encourage growth of the transformed plant tissue. Opines feed bacteria a
carbon and nitrogen source.
Agrobacterium Preparation Agrobacterium Preparation
Agro-transformation Streak the plate
Temperature: 30C Temperature: 30C
Medium: LB
Antibiotic: Km vector.
Time: 2-3 days.
Temperature: 30C
Medium: LB, YEB, or YEP
Antibiotic: Km or based on the
i h
27
SMG in the vector.
Time: 24-48 hr.
Concentration: O.D.
600
=0.5-1.0
CSS451
Agrobacterium Protocols---Transformation Agrobacterium Protocols---Transformation
T b
Ri
Tobacco Rice
Re-growth
4
Tobacco
Rice
Tobacco Rice
Inoculation
1
Molecular verification of gene
5
2
Molecular verification of gene
presence & expression
Co-cultivation
5
PCR
2
Southern
Blot
Selection and regeneration
3
Flowering and setting seeds 6
28
The Floral Dip Method
CSS451
A good stage for floral dipping
Co-cultivation
A good stage for floral dipping
Infection
Seed setting Harvest seeds Selection Seed setting Harvest seeds Selection
A b t i di t d t f ti f
29
Zhang et al. Nature Protocols 1(2) (2006)
Agrobacterium-mediated transformation of
Arabidopsis thaliana using the floral dip method
Experiment 2: Tobacco Transformation
Objectives:
Toget familiar withA tumefaciens mediated transformation To get familiar with A. tumefaciens-mediated transformation,
such as explants, T-DNA, infection, co-cultivation, selection,
binary vector, right border and left border, selectable marker
gene (SMG), markers for screening, regeneration, antibiotics,
andetc and etc.
To understand the differences between the wild-type T-DNA
and the disarmed T-DNA.
30
Experiment 2: Tobacco Transformation
CSS451
Agro strains: LBA4404:pBI121 & ACH5
1. LBA4404 has the Ach5 chromosomal background 1. LBA4404 has the Ach5 chromosomal background
2. ACH5 (pTiAch5---a wild-type octopine plasmid)
3. LBA4404 (pAL4404---a disarmed octopine plasmid)
NOS-pro NPT II (Kan
R
) NOS-ter 35S-pro GUS
NOS-ter
pBI121
31
LBA 4404 with the Ach5 chromosomal background exhibits clumping
CSS451
Experiment 2
Plant materials: Tobacco cv. Samsun
Seeds Seed germination Seedling Plant
Mature seeds harvested from wild type tobacco
plant cv. Samsun
Sterile seedling was maintained in
MagentaboxGA7containing50ml plant cv. Samsun
1. Surface sterilization (50% clorox +0.02%
Tween 20, 15 min; 4 washes in sterile water).
Magenta box GA7 containing 50 ml
MS medium.
Subcuture cy cutting the internodes.
Culture conditions: 25C, 16 h-
32
2. Seed germination on MS medium.
,
photoperiod, 35-50 E m
-2
s
-1
.
Explant preparation 1 Explant size: 05-08cm X 05-08cm
Experiment 2
Explant preparation 1. Explant size: 0.5-0.8 cm X 0.5-0.8 cm.
2. To prepare the explants using sterile techniques.
3. Do not let the explants too dry.
1
Inoculation
1. Agro concentration: O.D.
600
=0.5-0.8.
2. Infection time: 10-15 min.
2
3. Infection medium: Regeneration medium (RM)
4. Acetosyringone (Ac): 100 M
Co cultivation
1 Co cultivationmedium: RM
2
Co-cultivation
2-3 d A. tumefaciens
5 d S. meliloti
5 d M. loti
5-11Rhizobium sp. NGR234
1. Co-cultivation medium: RM
2. Co-cultivation time: 2-4 d
3. Environmental conditions: in the dark
4 Ac: 100M
3
5 11Rhizobium sp. NGR234
4. Ac: 100 M
Selection and
regeneration
1. Selection medium: RM +100 mg/l Km +500
mg/l Tn
33
2. Subculture: every 3 wk
CSS451
Explant preparation 1. Segments from hypocotyl, cotyledons, epicotyl, leaf,
internodes and petiole (Dicot)
2 E b i ll (M t) 2. Embryogenic calluses (Monocot)
3. Well developed regeneration system via either
organogenesis or somatic embryogenesis
Inoculation 1 Agroconcentration: OD 05 08 Inoculation 1. Agro concentration: O.D.
600
=0.5-0.8.
2. Infection time: 10-15 min.
3. Infection medium: Regeneration medium (RM)
4 A t i (A ) 100 M 4. Acetosyringone (Ac): 100 M
Co-cultivation
2-3 d A. tumefaciens
5 d S. meliloti
1. Co-cultivation medium: RM
2. Co-cultivation time: 2-4 d
3 i l di i i h d k
5 d M. loti
5-11Rhizobium sp. NGR234
3. Environmental conditions: in the dark
4. Ac: 100 M
Selection and
ti
1. Selection medium: RM +100 mg/l Km +500 mg/l Tn
34
regeneration
2. Subculture: every 3 wk
CSS/HRT 451 CSS/HRT 451 CSS/HRT 451 CSS/HRT 451
CSS451
Biolistic-mediated transformation
Guo Guo- -qing qing Song Song Guo Guo- -qing qing Song Song
G D li S t m Gene Delivery System
Agrobacterium
Viral vectors
Biolistic
Microinjection
PEG - Polyethylene Glycol PEG Polyethylene Glycol
Electroporation
Biolistic Transformation Biolistic Transformation
------- Advantage and Disadvantage
Advantage:
This method can be use to transform all plant species.
No binary vector is required.
T f ti t l i l ti l i l Transformation protocol is relatively simple.
Disadvantage: g
Difficulty in obtaining single copy transgenic events.
High cost of the equipment and microcarriers High cost of the equipment and microcarriers.
Intracellular target is random (cytoplasm, nucleus, vacuole,
plastid, etc.).
Transfer DNA is not protected.
Gene Delivery System
------Biolistic-mediated transformation
Known as:
Particle Bombardment Particle Bombardment
Biolistics
Microprojectile bombardment
Particle acceleration
Particle inflow gun
Gene gun
Using a gene gun directly shoots a piece of DNA into the
recipient plant tissue.
T t ld b d t d i th f i t t Tungsten or gold beads are coated in the gene of interest
and fired through a stopping screen, accelerated by Helium,
into the plant tissue. The particles pass through the plant
cells leaving the DNA inside cells, leaving the DNA inside.
Biolistic Biolistic--Mediated Gene Transfer Mediated Gene Transfer
------- Mechanism
Biolistic Biolistic--Mediated Gene Transfer Mediated Gene Transfer
------- Equipment
The Helios Gene Gun
PDS 1000/He
The Helios Gene Gun
http://www.oardc.ohio-state.edu/plantranslab/PIG.htm
www.bio-rad.com/genetransfer/
PDS-1000/He
Particle Inflow Guns (PIG)
Biolistic Biolistic--Mediated Gene Transfer Mediated Gene Transfer
------- Equipment- PDS-1000/He
PDS-1000/He
DNA-coated microcarriers are
loaded on microcarrier.
Micro-carriers are shot towards Micro-carriers are shot towards
target tissues during helium gas
decompression.
A stopping screen placed allowing
www.bio-rad.com/genetransfer/
A stopping screen placed allowing
the coated microprojectiles to
pass through and reach the target
cells.
Biolistic Biolistic--Mediated Gene Transfer Mediated Gene Transfer
------- PDS-1000/He References
Arnold D et al., Proc Natl Acad Sci USA 91, 99709974 (1994)
Castillo AM et al Biotechnology 12 13661371 (1994) Castillo AM et al., Biotechnology 12, 1366 1371 (1994)
Duchesne LC et al., Can J For Res 23, 312316 (1993)
Fitzpatrick-McElligott S, Biotechnology 10, 10361040 (1992) p g , gy , ( )
Hartman CL et al., Biotechnology 12, 919923 (1994)
Heiser WC, Anal Biochem 217, 185196 (1994)
Lo DC et al., Neuron 13, 12631268 (1994)
Sanford JC et al., Technique 3, 316 (1991)
Sh k KB t l 480 485 (1991) Shark KB et al., 480485 (1991)
Smith FD et al., J Gen Microbiol 138, 239248 (1992)
Svab Z and Maliga P Proc Natl Acad Sci USA 90 913917 (1993) Svab Z and Maliga P, Proc Natl Acad Sci USA 90, 913 917 (1993)
Toffaletti DL et al., J Bacteriol 175, 14051411 (1993)
www.bio-rad.com/genetransfer/
Biolistic Biolistic--Mediated Gene Transfer Mediated Gene Transfer
------- Equipment- Particle Inflow Gun
Finer JJ, P Vain, MW Jones, MD McMullen (1992) Development of the
particle inflow gun for DNA delivery to plant cells. Plant Cell Reports
11:232-238.
V i P N K J M ill C R h C N JJ Fi (1993) Vain P, N Keen, J Murillo, C Rathus, C Nemes, JJ Finer (1993)
Development of the Particle Inflow Gun. Plant Cell Tiss Org Cult
33:237-246.
Biolistic Biolistic--Mediated Gene Transfer Mediated Gene Transfer
------- Equipment- Helios Gene Gun
www.bio-rad.com/genetransfer/
The helium pulse sweeps the DNA- or RNA-coated gold The helium pulse sweeps the DNA or RNA coated gold
microcarriers from the inside wall of the sample cartridge.
The microcarriers accelerate for maximum penetration as they The microcarriers accelerate for maximum penetration as they
move through the barrel, while the helium pulse diffuses outward.
The spacer maintains the optimal target distance for in vivo The spacer maintains the optimal target distance for in vivo
applications and vents the helium gas away from the target to
minimize cell surface impact.
Biolistic Biolistic--Mediated Gene Transfer Mediated Gene Transfer
------- Helios Gene Gun System References
Fynan EF et al., DNA vaccines: Protective immunizations by
parenteral, mucosal, and gene-gun inoculations, Proc Natl Acad Sci
USA 90, 1147811482 (1993) 9 , ( 99 )
Qiu P et al., Gene gun delivery of mRNA in situ results in efficient
transgene expression and genetic immunization, Gene Ther 3, 262
268 (1996)
Sun WH et al., In vivo cytokine gene transfer by gene gun reduces
t th i i P N tl A d S i USA 92 2889 2893 (1995) tumor growth in mice, Proc Natl Acad Sci USA 92, 28892893 (1995)
Sundaram P et al., Particle-mediated delivery of recombinant
expression vectors to rabbit skin induces high titered polyclonal expression vectors to rabbit skin induces high-titered polyclonal
antisera (and circumvents purification of a protein immunogen),
Nucleic Acids Res 24, 13751377 (1996)
www.bio-rad.com/genetransfer/
Tang DC et al., Genetic immunization is a simple method for eliciting
an immune response, Nature 356, 152154 (1992)
Biolistic Transformation Biolistic Transformation Biolistic Transformation Biolistic Transformation
------- Parameters
A number of parameters has been
d f d d d b d d identified and need to be considered
carefully in experiments involving
particle bombardment particle bombardment
Parameter categories: Parameter categories:
- Physical parameters
Biological parameters - Biological parameters
- Environmental parameters
Biolistic Transformation Biolistic Transformation Biolistic Transformation Biolistic Transformation
Ph i l t
------- Parameters
- Physical parameters
Nature, chemical and physical properties of the metal particles used as
a macrocarrier for the foreign DNA
Particles should be high enough mass in order to possess adequate
momentum to penetrate into appropriate tissue.
Suitable metal particles include gold, tungsten, palladium, rhodium,
platinum and iridium.
Metals should be chemically inert to prevent adverse reaction with
Additional desirable properties for the metal include size and shape,
ll l ti d di i ti di t 0 36 6
Metals should be chemically inert to prevent adverse reaction with
DNA and cell components.
as well as agglomeration and dispersion propertiesdiameter 0.36-6
m.
Nature, preparation and binding of DNA onto the particles
Target tissue
- Biological parameters
- Environmental parameters
Target tissue
Biolistic Transformation Biolistic Transformation Biolistic Transformation Biolistic Transformation
Ph i l t
------- Parameters
- Physical parameters
Nature, chemical and physical properties of the metal particles used as
a macrocarrier for the foreign DNA
Th t f DNA ( i l d bl t d d i l li i d
Nature, preparation and binding of DNA onto the particles
The nature of DNA (single vs double stranded, circular vs linerized
DNA). Optimal: double stranded circular DNA molecules (e.g. plasmid)
In the process of coating the metal particls with DNA certain additives
h d d d C Cl b f l such as spermididne and CaCl
2
appear to be useful.
Target tissue
- Biological parameters
- Environmental parameters
Biolistic Transformation Biolistic Transformation Biolistic Transformation Biolistic Transformation
Ph i l t
------- Parameters
- Physical parameters
Nature, chemical and physical properties of the metal particles used as
a macrocarrier for the foreign DNA
Nature, preparation and binding of DNA onto the particles
Target tissue
It is important to target the appropriate cells that are competent for
both transformation and regeneration.
Depth of penetration is one of the most important variables in order to Depth of penetration is one of the most important variables in order to
achieve particle delivery to particular cells.
- Biological parameters
- Environmental parameters
Biolistic Transformation Biolistic Transformation Biolistic Transformation Biolistic Transformation
Ph i l t
------- Parameters
- Physical parameters
- Biological parameters
Temperature, photoperiod and humidity
These parameters have a direct effect on the physiology of tissues.
Such factors will influence receptiveness of target tissue to foreign
DNA delivery and also affect its susceptibility to damage and injury DNA delivery and also affect its susceptibility to damage and injury
that may adversely affect the outcome of transformation process.
Some explants may require a healing period after bombardment under
special regiments of light temperature and humidity special regiments of light, temperature, and humidity.
- Environmental parameters
Biolistic Transformation Biolistic Transformation Biolistic Transformation Biolistic Transformation
Ph i l t
------- Parameters
- Physical parameters
- Biological parameters
E i l - Environmental parameters
Nature of explants as well as pre- and post-bombardment culture
conditions.
Explants derived from plants that are under stress will provide inferior
materials for bombardment experiments.
Metal particles need to be directed to the nucleus.
Transformation frequencies may also be influenced by cell cycle stage.
O f h l b h b f Osmotic pretreatment of target tissues has also been shown to be of
importance.
Physical trauma and tungsten toxicity were found to reduce efficiency
f tr nsf rm ti n in experiments perf rmed ith t b cc cell of transformation in experiments performed with tobacco cell
suspension culture.
Biolistic Transformation Biolistic Transformation Biolistic Transformation Biolistic Transformation
------- Summary
For biolistic transformation, tungsten or gold
particles are coated with DNA and accelerated p
towards target plant tissues. Most devices use
compressed helium as the force to accelerate the
particles. particles.
The particles punch holes in the plant cell and
ususally petetrate only 1-2 cell layerswall . Particle y p y y
bombardment is a physical method for DNA
introduction.
h d l d h The DNA-coated particles can end up either near
or in the nucleus,where the DNA comes off the
particles and integrated into plant chromosomal
DNA.