SUBFORNICAL ORGAN ANGIOTENSIN TYPE 1 RECEPTOR EXPRESSION

AND DRINKING BEHAVIOR IN BILE DUCT LIGATED RATS
A
DISSERTATION
Presented to the F!"#t$ o%
The Un&'ers&t$ o% Te(s He#th S!&en!es Center t Sn Anton&o
Grd"te S!hoo# o% B&o)ed&!# S!&en!es
&n *rt&# %"#%&##)ent
o% the re+"&re)ents
%or the de,ree o%
DOCTOR OF PHILOSOPHY
B$
-ose*h D. /#!h B.S.
Sn Anton&o0 Te(s
-"#$ 120 1311
© Co*$r&,ht
B$
-ose*h D. /#!h
1311
A## R&,hts Reser'ed
SUBFORNICAL ORGAN ANGIOTENSIN TYPE 1 RECEPTOR EXPRESSION AND
DRINKING BEHAVIOR IN BILE DUCT LIGATED ANI4ALS
-ose*h D. /#!h
APPROVED5
-. Tho)s C"nn&n,h)0 Ph.D.0 S"*er'&s&n, Pro%essor
-ere)&h Her#&h$0 Ph.D.
-ohn -ohnson0 Ph.D.
X&n6Y"n L"0 Ph.D.
G#enn 4. Tone$0 Ph.D.
Dn&e# Lod,e0 Ph.D.
He#)"t Gott#e&70 Ph.D.0 E(tern# Ad'&s&n, Pro%essor
Dte
APPROVED5
888888888888888888888888888
D'&d /e&ss0 PhD
Den0 GSBS
DEDICATION
To Lo"&se
A 9o)n o% ,ret !o"r,e nd s"7#&)e d&,n&t$
ACKNO/LEDGE4ENTS
I 9o"#d #&:e to thn: )$ )entor0 Dr. -. Tho)s C"nn&n,h)0 %or h&s ,"&dn!e
nd s"**ort d"r&n, the *st %o"r $ers. I ) #so 'er$ thn:%"# %or the ,"&dn!e nd
en!o"r,e)ent o% )$ 'er$ !*7#e !o))&ttee )e)7ers.
I #so 9nt to thn: !"rrent nd *re'&o"s )e)7ers o% )$ #7 %or the&r
!ontr&7"t&ons5 F#'& Crreno0 D'&d Kn&,ht0 T. Prshnt Ned"n,d&0 -oe# L&tt#e0 nd L&s
-&. And %&n##$0 I 9o"#d #&:e to !:no9#ed,e the s"**ort o% the Nt&on# Inst&t"tes o%
He#th %or the&r %"nd&n, thro",h ,rnts NIH R31 HL3;1<2; = F>3 DK3?>??@.
5
DISSERTATION ABSTRACT
SUBFORNICAL ORGAN ANGIOTENSIN TYPE 1 RECEPTOR EXPRESSION
AND DRINKING BEHAVIOR IN BILE DUCT LIGATED RATS
P"7#&!t&on No. 888888888888888888888888
-ose*h D. /#!h0 Ph.D.
The Un&'ers&t$ o% Te(s He#th S!&en!e Center t Sn Anton&o
Grd"te S!hoo# o% B&o)ed&!# S!&en!es
S"*er'&s&n, Pro%essor5 -. Tho)s C"nn&n,h)0 Ph.D.
H$*ontre)& &s the )ost !o))on !#&n&!##$ s&,n&%&!nt e#e!tro#$te d&sorder.
D&#"t&on# h$*ontre)& &s !"sed 7$ 9ter retent&on t$*&!##$0 9h&!h res"#ts %ro)
&n**ro*r&te 'so*ress&n re#ese &n d&seses #&:e hert %&#"re or #&'er %&#"reA!&rrhos&s.
L&'er %&#"re &nd"!es s$ste)&! rter&# 'sod&#t&on nd ,ener#&Bed ede). Th&s rter&#
6
'sod&#t&on &s h$*othes&Bed to !"se e#e'ted *#s) ren&n !t&'&t$0 'so*ress&n re#ese
nd th&rst. A#tho",h the !entr# )e!hn&s)s tht )ed&te dr&n:&n, 7eh'&or nd
&n**ro*r&te 'so*ress&n re#ese re not !#er0 7oth h'e 7een sho9n to 7e %%e!ted 7$
n,&otens&n s&,n#&n, t %ore7r&n s&tes. T9o %ore7r&n !&r!")'entr&!"#r or,ns CCVOsD0
the s"7%orn&!# or,n CSFOD nd the or,n") 's!"#os") o% the #)&n ter)&n#&s
COVLTD re #o!ted #on, the nter&or 9## o% the th&rd !ere7r# 'entr&!#e %"n!t&on s
sensor$ s$ste) tht )on&tors !hn,es &n !&r!"#t&n, hor)ones s"!h s n,&otens&n0 nd
re &)*#&!ted &n !rd&o's!"#r nd 7od$ %#"&d ho)eosts&s. Re!ent st"d&es &n'est&,t&n,
the )e!hn&s)s o% dr&n:&n, 7eh'&or nd 'so*ress&n re#ese h'e sho9n tht these
%ore7r&n CVOs re &n'o#'ed &n os)ot&! nd non6os)ot&! ne"r# s&,n#&n, *th9$s.
Th"s !hn,es &n dr&n:&n, 7eh'&or nd !&r!"#t&n, 'so*ress&n sso!&ted 9&th #&'er
!&rrhos&s )$ &n'o#'e n,&otens&n II !t&n, t the SFO nd OVLT !ontr&7"t&n, to the
*tho*h$s&o#o,$ o% 9ter 7#n!e.
Chron&! 7&#e d"!t #&,t&on CBDLD &n the rt &s !o))on#$ "sed )ode# o% he*t&!
!&rrhos&s tht &s sso!&ted 9&th e#e'ted !&r!"#t&n, 'so*ress&n nd &n!resed *#s)
ren&n !t&'&t$. As &n the h")n !ond&t&on0 rts 9&th BDL h'e e#e'ted !&r!"#t&n,
'so*ress&n des*&te 7e&n, h$*er'o#e)&! nd h$*o6os)ot&!. The ,o# o% these st"d&es 9s
to deter)&ne )e!hn&s)s &n'o#'ed &n #tered dr&n:&n, 7eh'&or nd 'so*ress&n re#ese
tht #ed to d&sr"*ted h$dro)&ner# 7#n!e &n the BDL )ode#. 4$ h$*othes&s &s tht SFO
n,&otens&n s&,n#&n, d"r&n, BDL !t&'tes do9nstre) !entr# ne"r# *th9$s tht
&n!rese dr&n:&n, 7eh'&or nd !"se &n**ro*r&te 'so*ress&n re#ese. /e o7ser'ed
7
&n!resed n,&otens&n II t$*e 1 re!e*tor CAT1RD e(*ress&on &n the SFO o% BDL rts.
Bsed on th&s o7ser't&on 9e "sed *hr)!o#o,&!# 7#o!:de o% AT1R nd deno6
sso!&ted '&r# shRNA :no!:do9n o% AT1R e(*ress&on to de)onstrte tht SFO
n,&otens&n s&,n#&n, 9s ne!essr$ %or &n!resed dr&n:&n, 7eh'&or d"r&n, BDL
!&rrhos&s. Ho9e'er0 !t&'t&on o% ),no!e##"#r ne"rose!retor$ !e##s nd 'so*ress&n
re#ese 9s not d&)&n&shed 7$ &nter%er&n, 9&th SFO n,&otens&n s&,n#&n,. These
o7ser't&ons s",,est tht n,&otens&n s&,n#&n, thro",h the SFO &s ne"r# )e!hn&s)
)ed&t&n, dr&n:&n, 7eh'&or &n n n&)# )ode# o% !on,est&'e #&'er %&#"re0 nd &n!rese
o"r "nderstnd&n, o% the *tho*h$s&o#o,$ o% d&#"t&on# h$*ontre)&.

8
TABLE OF CONTENTS
Ded&!t&on...........................................................................................................................
A!:no9#ed,e)ents..............................................................................................................
D&ssertt&on A7str!t............................................................................................................
T7#e o% Contents.................................................................................................................
L&st o% t7#es.......................................................................................................................
L&st o% %&,"res.....................................................................................................................
Ch*ter 15 Gener# Introd"!t&on........................................................................................
Literature Review.........................................................................................................
Bile Duct Ligation Animal Model.........................................................................
Osmotic and Non-osmotic Regulation of Water Intake.........................................
Osmotic and Non-osmotic Regulation of Vasopressin Release............................
Summary................................................................................................................
Ch*ter 15 Intr!ere7ro'entr&!"#r CICVD Losrtn &n%"s&on nor)#&Bes An,&otens&n
t$*e 1 re!e*tor CAT1RD e(*ress&on &n the s"7%orn&!# or,n CSFOD nd dr&n:&n,
7eh'&or &n 7&#e d"!t #&,ted rts..................................................................................
Abstract........................................................................................................................
Introduction..................................................................................................................
Materials and Methods.................................................................................................
Animals..................................................................................................................
Bile Duct ligation model of hepatic cirrhosis........................................................
Chronic ICV cannula and osmotic minipump implantation..................................
Metabolic cages.....................................................................................................
Plasma measurements............................................................................................
Micropunch dissection of forebrain tissues...........................................................
9
Western Blot..........................................................................................................
RNA extraction and reverse transcription..............................................................
Quantitative real-time PCR....................................................................................
Quantification and analysis of PCR results...........................................................
Experimental protocol............................................................................................
Statistical Analysis.................................................................................................
Results..........................................................................................................................
Effects of BDL on fluid balance and AT1 receptors.............................................
Effects of chronic losartan infusions on fluid balance and AT1 receptor
expression in BDL rats.....................................................................................
Discussion....................................................................................................................
PERSPECTIVES...................................................................................................
Ch*ter >5 An,&otens&n II re!e*tor s"7t$*e 1 CAT1RD ,ene :no!:do9n &n ne"rons
o% the s"7%orn&!# or,n CSFOD *re'ents &n!resed dr&n:&n, 7eh'&or &n 7&#e d"!t
#&,ted rts....................................................................................................................
Abstract........................................................................................................................
Introduction..................................................................................................................
Materials and Methods.................................................................................................
Animals..................................................................................................................
Bile duct ligation model of hepatic cirrhosis.........................................................
Virally mediated AT1a receptor mRNA interference............................................
Metabolic cages.....................................................................................................
Plasma measurements............................................................................................
∆FosB immunohistochemistry...............................................................................
Confocal imaging and quantification of immunohistochemistry...........................
Laser capture microdissection................................................................................
Quantitative real-time PCR....................................................................................
10
Quantification and analysis of PCR results...........................................................
Experimental protocol............................................................................................
Statistical analysis..................................................................................................
Results..........................................................................................................................
Characterization of BDL experimental model and plasma measurements............
AT1aR shRNA viral transduction and gene knockdown.......................................
Fluid intake and renal sodium excretion................................................................
∆FosB in the SON of BDL rats..............................................................................
Discussion....................................................................................................................
Perspectives..........................................................................................................107
Ch*ter @5 S"))r$ nd S&,n&%&!n!e............................................................................109
Per*e!t&'es.......................................................................................................................113
11
LIST OF TABLES
Number Page
Table 1: Measurements of serum osmolality, hematocrit, protein, liver weight to body
weight ratio, and final body weight from sham (Sham) and bile duct
ligated (BDL) rats............................................................................................
Table 2: Measurements of serum osmolality, hematocrit, protein, liver weight to body
weight ratio and final body weight from sham (Sham) and bile duct ligated
(BDL) rats that were treated with either vehicle ICV (Veh), losartan ICV
(Los), or losartan subcutaneously (SCLos)......................................................
Table 3: RT-qPCR primer sequences................................................................................
Table 4: Measurements of serum osmolality, hematocrit, protein, and liver weight to
body weight ratio in sham (Sham) and bile duct ligated (BDL) rats
injected with a viral construct containing either a scrambled control
shRNA (SCM) or a shRNA targeted to AT1aR (sh-AT1a).............................
12
LIST OF FIGURES
Number Page
Figure 1: Diagram showing primary (black arrows) and alternate (light blue arrows)
neural and humoral pathways proposed to mediate increased water intake
and vasopressin release during BDL. The initiating factor is the peripheral
vasodilation that occurs as a result of portal hypertension (see Literature
Review). Peripheral vasodilation eventually decompensates and outstrips
renal autoregulatory ability by decreasing blood flow and resulting in the
release of plasma renin (black arrows). Acting on the SFO, angiotensin II
increases the excitatory drive for increased drinking behavior and
vasopressin release. Light blue arrows show a possible
alternative/redundant pathway involved in the stimulation of AVP release.
Red lettering indicates peripheral factors, and black lettering indicates
central factors. Abbreviations: AT1R, Angiotensin type 1 receptor; SFO,
subfornical organ; OVLT, organum vasculosum of the lamina terminalis;
MnPO, median preoptic nucleus; SON, supraoptic nucleus; NTS, nucleus
of the solitary tract; CVL, caudal ventrolateral medulla..................................
Figure 2: Average daily water intake and urine output (A) and average daily sodium
intake and urinary sodium excretion (B) from Sham and BDL rats. Values
are normalized to body weight (Kg) and represented as means ± SEM.
*Statistically significant, P<0.014 vs. Sham. Parentheses indicate the
number of animals............................................................................................
Figure 3: Western Blot analysis of AT1R abundance (A) and RT-qPCR analysis of
AT1aR mRNA (B) from brain punches containing the SFO of Sham and
BDL rats taken 28 days after BDL surgery. The data are presented as
13
mean ± SEM relative protein and mRNA abundance. * Statistically
significant, P<0.05. Parentheses indicate number of animals..........................
Figure 4: Western Blot analysis of AT1R abundance (top) and RT-qPCR analysis of
AT1aR mRNA (bottom) from brain punches containing the OVLT (A &
B) and MnPO (C & D) of Sham and BDL rats taken 28 days after BDL
surgery. The data are presented as mean ± SEM relative protein and
mRNA abundance. *Statistically significant, P<0.05. Parentheses indicate
number of animals............................................................................................
Figure 5: Average daily water intake and urine output normalized to body weight
(Kg) from Sham and BDL rats treated with either vehicle (Veh), losartan
(Los), or sub-cutaneous losartan (SCLos). Values are means ± SEM.
*Statistically significant, P<0.01 vs. all Sham groups. †Statistically
significant, P<0.02 vs. all BDL groups. Animal numbers are 8-10 for each
group................................................................................................................
Figure 6: Average daily sodium intake and renal sodium excretion from Sham and
BDL rats treated with either vehicle (Veh), losartan (Los), or sub-
cutaneous losartan (SCLos). Values are means ± SEM. Animal numbers
are 8-10 for each group. No significant differences between groups..............
Figure 7: Western Blot analysis of AT1R abundance from brain punches containing
the SFO of Sham and BDL rats from each treatment group taken 28 days
after BDL surgery. *Statistically significant, P<0.05 vs. all other ICV
groups, #Statistically significant vs. sham ICV groups P<0.05. Numbers
within the bars indicate the number of animals...............................................
Figure 8: Western Blot analysis of AT1R expression in brain punches of the A)
OVLT, and B) MnPO of Sham and BDL rats treated with either vehicle or
Losartan ICV taken 28 days after BDL surgery. Numbers within the bars
indicate the number of animals........................................................................
14
Figure 9: Representative digital images of the SFO expressing green fluorescent
protein from a rat injected with the viral transduction construct containing
either AAV-GFP-SCM shRNA (A) or AAV-GFP-AT1a shRNA (B) into
the SFO. Scale bar is 50 µm.............................................................................
Figure 10: RT-qPCR analysis of AT1aR mRNA from a laser microdissected SFO
nucleus from Sham and BDL rats injected with either a scrambled AAV-
shRNA (SCM) or an AAV-shRNA targeted to AT1a gene (sh-AT1a) into
the SFO. The data are presented as mean ± SEM relative mRNA levels as
calculated by the 2
-∆∆CT
method. *Statistically significant, p<0.05 vs. all
other groups. Animal numbers are n=5 for each group...................................
Figure 11: Average daily water intake and urine output from Sham and BDL rats
injected with either a scrambled control AAV-shRNA (SCM) or an AAV-
shRNA targeted to AT1a gene (sh-AT1a) into the SFO. Values are means
± SEM. *Statistically significant, Two-way repeated measures ANOVA
with post-hoc interaction test (SNK) P<0.05 vs. all other groups. Animal
numbers range from 12-18 for each group......................................................
Figure 12: Average daily sodium intake and renal sodium excretion from Sham and
BDL rats injected with either a scrambled AAV-shRNA (SCM) or an
AAV-shRNA targeted to AT1a gene (sh-AT1a) into the SFO. Values are
means ± SEM. *Statistically significant, p<0.05 vs. sham groups. Two-
way repeated measures ANOVA with post-hoc interaction test (SNK).
Animal numbers are 12-18 for each group......................................................
Figure 13: Average daily sodium balance from Sham and BDL rats injected with
either a scrambled AAV-shRNA (SCM) or an AAV-shRNA targeted to
AT1a gene (sh-AT1a) into the SFO. Values are means ± SEM.
*Statistically significant, p<0.01 vs. sham groups. †Statistically
significant, p<0.05 vs. sham SCM group. Statistical analysis was by two-
15
way repeated measures ANOVA with post-hoc interaction test (SNK).
Animal numbers are 12-18 for each group......................................................
Figure 14: Effects of bile duct ligation and AAV-GFP-AT1a shRNA injection into the
SFO on the numbers of cells stained for ∆FosB, vasopressin (AVP) and
colocalized ∆FosB and vasopressin in the supraoptic nucleus of rats in the
several treatment groups. *Significantly different from sham groups
p<0.001. †Significantly different from all other groups p<0.01. Animal
numbers range from 7-9 for each group..........................................................
Figure 15: Representative digital images of ∆FosB/FosB staining of the supraoptic
nucleus from a sham ligated control (A & B) and a bile duct ligated rat (C
& D) injected with either a viral construct containing scrambled control
shRNA (left column) or a viral construct containing the AT1aR shRNA
(right column). Scale bar is 50 µm for each image. Abbreviations: ot, optic
tract; SON, supraoptic nucleus........................................................................
Figure 16: Representative digital images of vasopressin immunofluorescence of the
supraoptic nucleus from a sham ligated control (A & B) and a bile duct
ligated rat (C & D) injected with either a viral construct containing
scrambled control shRNA (left column) or a viral construct containing the
AT1aR shRNA (right column). Scale bar is 50 µm for each image.
Abbreviations: ot, optic tract; SON, supraoptic nucleus..................................
Figure 17: Representative digital images of vasopressin immunofluorescence (red)
merged with pseudocolored ∆FosB/FosB staining (green) of the supraoptic
nucleus from a sham ligated control (A & B) and a bile duct ligated rat (C
& D) injected with either a viral construct containing scrambled control
shRNA (left column) or a viral construct containing the AT1aR shRNA
(right column). Scale bar is 50 µm for each image..........................................
16
Figure 18: Effects of bile duct ligation and AAV-GFP-AT1a-shRNA injection into
the SFO on the numbers of cells stained for ∆FosB, oxytocin (OXY) and
colocalized ∆FosB and oxytocin in the supraoptic nucleus of rats in the
several treatment groups. *Significantly different from sham groups
p<0.001. †Significantly different from all other groups p<0.01. Animal
numbers range from 7-9 for each group..........................................................
Figure 19: Representative digital images of oxytocin immunofluorescence of the
supraoptic nucleus from a sham ligated control (A & B) and a bile duct
ligated rat (C & D) injected with either a viral construct containing
scrambled control shRNA (left column) or a viral construct containing the
AT1aR shRNA (right column). Scale bar is 50 µm for each image.
Abbreviations: ot, optic tract; SON, supraoptic nucleus..................................
Figure 20: Representative digital images of Oxytocin immunofluorescence (blue)
merged with pseudocolored ∆FosB/FosB staining (green) of the supraoptic
nucleus from a sham ligated control (A & B) and a bile duct ligated rat (C
& D) injected with either a viral construct containing scrambled control
shRNA (left column) or a viral construct containing the AT1aR shRNA
(right column). Scale bar is 50 µm for each image..........................................
Figure 21: Schematic diagram showing the demonstrated neural pathway that
mediates increased water intake during BDL. Abbreviation: AT1R,
angiotensin type 1 receptor; MnPO, median preoptic nucleus; OVLT,
organum vasculosum of the lamina terminalis; P. Pit., posterior pituitary;
SFO, subfornical organ; SON, supraoptic nucleus........................................109
Figure 22: Schematic diagram showing the neural pathway proposed to mediate
increased vasopressin release during BDL. DBH-Saporin (Red lines) is an
immunotoxin that is used to remove all adrenergic innervation to the SON.
Green lines indicate central excitatory pathways that may be involved in
17
vasopressin release due to decompensated peripheral vasodilation (blue
lines) that results from liver cirrhosis (see Ch. 1). Abbreviation: CVL,
caudal ventrolateral medulla; DBH, dopamine- -hydroxylase; MnPO, β
median preoptic nucleus; NTS, nucleus of the solitary tract; OVLT,
organum vasculosum of the lamina terminalis; P. Pit., posterior pituitary;
SFO, subfornical organ; SON, supraoptic nucleus........................................118
18
CHAPTER 15 GENERAL INTRODUCTION
Re,"#t&on o% *#s) os)o##&t$ nor)##$ de*ends on t9o *r&n!&*#e )e!hn&s)s5
1D 9ter &nt:e
16>
0 nd 1D so#"te6%ree 9ter e(!ret&on )ed&ted 7$ r,&n&ne 'so*ress&n
CAVPD. AVP &s s$nthes&Bed &n h$*oth#)&! n"!#e&0 9h&!h then trns*orts the *e*t&de 7$
(on %or re#ese %ro) the *oster&or *&t"&tr$ &nto 7#ood !&r!"#t&on. The ne"ronto)&!#
s$ste) %or the s$nthes&s nd re#ese o% AVP &nto !&r!"#t&on &s !##ed the
ne"roh$*o*h$se# s$ste). C&r!"#t&n, AVP !ts on V1 re!e*tors o% the :&dne$
;
to !"se
+"*or&n !hnne# &nsert&on &nto the *&!# !o##e!t&n, d"!t )e)7rne ##o9&n, the
re7sor*t&on o% 9ter. In he#th$ h")ns0 *#s) os)o##&t$ &s re,"#ted 9&th&n the
nrro9 rn,e o% 1?361E< )Os)A:, H1O. Under nor)# !ond&t&ons the os)ot&! thresho#d
nd sens&t&'&t$ %or AVP re#ese re s&)&#r %or th&rst
E611
0 nd %!tors tht st&)"#te AVP
re#ese #so ,ener##$ st&)"#te th&rst. H$*ontre)& %ro) 9ter &nt:e #one &s
"n!o))on "nder nor)# !ond&t&ons &n he#th$ h")ns. Ho9e'er0 there &s e'&den!e tht
dr&n:&n, 7eh'&or )$ *#$ ro#e &n re,"#t&n, 9ho#e 7od$ 9ter 7#n!e d"r&n, !hron&!
d&sese.
H$*ontre)& &s the )ost %re+"ent#$ o!!"rr&n, !#&n&!# e#e!tro#$te d&sorder0 9&th
nn"# tret)ent !osts &n the US est&)ted to rn,e %ro) F1.; to F>.; 7&##&on
13
.
H$*ontre)& &s #so sso!&ted 9&th ne,t&'e o"t!o)es &n !hron&! d&sese sttes0 )ost
not7#$ !on,est&'e hert %&#"re nd #&'er !&rrhos&s. In 7oth !on,est&'e hert %&#"re nd
!&rrhos&s0 !hn,es &n the os)ore,"#t&on o% AVP re#ese %ro) the ne"roh$*o*h$se#
19
s$ste) !ontr&7"tes to 9ter retent&on nd d&#"t&on# h$*ontre)&66#ed&n, to &n!resed
)or7&d&t$ nd )ort#&t$
1361?
. A#tho",h tret)ent 9&th s*e!&%&! V1 re!e*tor nt,on&sts
CV1AD &n!reses so#"te6%ree 9ter e(!ret&on nd r&ses *#s) os)o##&t$ &n 7oth hert
%&#"re nd !&rrhos&s
1E6>1
0 e'&den!e %or 7ene%&!&# red"!t&on &n !#&n&!# *r)eters s"!h s
)ort#&t$ or hos*&t#&Bt&on &s "n!#er
>16>@
.
De!resed s$ste)&! 7#ood *ress"re hs )n$ e%%e!ts tht &)*!t 7od$ %#"&d
ho)eosts&s. These &n!#"de red"!&n, !t&'&t$ o% #o9 *ress"reA'o#")e re!e*tor %%erents0
&n!res&n, *#s) ren&n re#ese0 nd &n!res&n, s$)*thet&! ner'e d&s!hr,e nd
ne"ro,en&! 'so)otor tone. Th&s ne"roh")or# !t&'t&on *ro%&#e &s #so %et"re o%
n&)# )ode#s o% !&rrhos&s
>;6@1
. While this explanation is generally accepted in the
literature, the precise neural and molecular factors that affect the downward resetting
of the drinking behavior and AVP osmotic thresholds remain undetermined. I)*ro'ed
"nderstnd&n, o% d$s%"n!t&on# os)ore,"#t&on o% th&rst nd AVP re#ese &n !&rrhos&s
)&,ht &)*ro'e d&sese *##&t&on0 tret)ent re,&)ens tht )&n&)&Be d'erse dr", e%%e!ts0
nd &)*ro'e !#&n&!# o"t!o)es.
Chron&! 7&#e d"!t #&,t&on CBDLD &n the rt &s !o))on#$ "sed )ode# o% he*t&!
!&rrhos&s. As &n the h")n !ond&t&on0 these rts h'e e#e'ted !&r!"#t&n, 'so*ress&n
des*&te &n!resed *os&t&'e 9ter 7#n!e0 h$*er'o#e)& 9&th s!&tes %or)t&on0 nd
h$*ontre)&. 4$ dt re !ons&stent 9&th *re'&o"s st"d&es de)onstrt&n, tht the
&n!resed #e'e# o% *#s) AVP &s d"e to enhn!ed !t&'&t$ o% the ne"roh$*o*h$se#
20
s$ste). The purpose of this proect is to more fully elucidate neural mechanisms that
influence regulation of spontaneous water intake and vasopressin release in the !"#
rat model of cirrhosis.
LITERATURE REVIEW
BILE DUCT LIGATION ANIMAL MODEL
The *ort# !&r!"#tor$ s$ste) &s one o% t9o "n&+"e !&r!"#tor$ s$ste)s &n the
)))# 9here t9o !*&##r$ 7eds re !onne!ted &n ser&es. The *ort# 'eno"s s$ste)
re!e&'es s*#n!hn&! 7#ood %#o9 %ro) the s"7*hren&! se,)ent o% the d&,est&'e tr!: do9n
to the re!t")0 the *n!res nd the s*#een. D"r&n, #&'er !&rrhos&s0 *ort# h$*ertens&on
res"#ts %ro) 7oth &n!resed &ntrhe*t&! res&stn!e to 7#ood o"t%#o9 nd &n!resed
s*#n!hn&! &n%#o9
@E
. L&'er !&rrhos&s &n!reses &ntrhe*t&! res&stn!e thro",h
&n%#))tor$ !t&'t&on o% he*t&! ste##te !e##sG9h&!h enhn!es the&r !ontr!t&#&t$ nd
&n!reses s&n"so&d# res&stn!e. I)*&red 7#ood %#o9 thro",h the #&'er res"#ts &n h$*o(&0
9h&!h &nd"!es !o)*enstor$ res*onses &n the he*t&! rter$ to &n!rese 7#ood %#o9. Th&s
&n!resed 7#ood %#o9 &s %!&#&tted 7$ d&%%"s&on o% denos&ne to 'sod&#te *res&n"so&d#
rter&o#es 7$ &n!res&n, the *rod"!t&on o% n&tr&! o(&de CNOD. Prod"!t&on o% NO &s #&)&ted
&n the s&n"so&d# nd *osts&n"so&d# res #ed&n, to &n!resed &ntrhe*t&! res&stn!e nd
the se+"ester&n, o% 7#ood 9&th&n the #&'er
<;6<?
. U*re,"#t&on o% endothe#&n61 re!e*tors nd
#&,nds0 thro)7o(ne A10 nd &n!resed *rod"!t&on o% <6#&*o(e,ense6der&'ed
e&!osno&ds %"rther t&#ts the 7#n!e to9rds 'so!onstr&!t&'e s$ste)s 9&th&n the #&'er
<E6;1
.
21
A**ro(&)te#$ 1<H o% !rd&! o"t*"t CCOD &s re!e&'ed 7$ s*#n!n&! !&r!"#t&on t rest.
There%ore0 *ort# h$*ertens&on res"#ts %ro) 7oth &n!resed &ntrhe*t&! res&stn!e nd
he*t&! rter$ 'sod&#t&on. In %"#)&nte !&rrhos&s0 *ort# !&r!"#t&on re'erses nd there &s
&n!resed rter&o'eno"s nd 'eno'eno"s sh"nt&n, thro",h !o##ter# !&r!"#t&on
enhn!&n, s*#n!n&! 7#ood %#o9
;>
.
The de'e#o*)ent o% *ort# h$*ertens&on #eds to s*#n!n&! h$*ere)& 7$
)e!hn&!# stress on endothe#&# !e##s st&)"#t&n, denos&ne nd NO *rod"!t&on
;@6;;
.
Chron&!##$ e#e'ted *ort# *ress"re nd s*#n!n&! 'sod&#t&on #on, 9&th the %or)t&on
o% !o##ter# !&r!"#t&on &nd"!es stte o% h$*erd$n)&! !&r!"#t&on !hr!ter&Bed 7$
&n!resed s$ste)&! %#o9 nd *er&*her# 'sod&#t&on )ed&ted 7$ NO. H$*erd$n)&!
!&r!"#t&on %%e!ts other or,n s$ste)s &n the 7od$ nd &s !hr!ter&Bed 7$ &n!resed hert
rte0 !rd&! o"t*"t0 *#s) 'o#")e0 ren# sod&") retent&on0 nd *ro,ress&'e *er&*her#
'sod&#t&on. It hs 7een s",,ested tht s*#n!hn&! nd s$ste)&! 'sod&#t&on tht &n&t&tes
the h$*erd$n)&! !&r!"#tor$ stte or&,&ntes s se!ondr$ ne"r# *heno)enon d"e to
he*t&! I'o#")eA*ress"reJ %%erents. Ho9e'er0 there **ers to 7e )ore e'&den!e %or #o!#
*rod"!t&on o% 'sod&#tor$ %!tors s"!h s denos&ne nd NO thro",h sher stress
st&)"#t&on o% endothe#&# !e##s s res"#t o% &n!resed s*#n!hn&! nd s$ste)&! 7#ood
%#o9 s n e(*#nt&on %or the *er&*her# 'sod&#t&on0 sod&") retent&on nd
h$*erd$n)&! !&r!"#t&on seen &n !&rrhos&s
2162@
.
22
The 'eno"s s$ste) *#$s n &)*ortnt ro#e &n s"**ort&n, 7#ood *ress"re 7$
)&nt&n&n, reser'e o% 7#ood 'o#")e tht !n 7e )o7&#&Bed d"r&n, t&)es o% de!resed
*er%"s&on. S*#n!n&! nd !"tneo"s 'e&ns re the )ost !o)*#&nt nd re*resent the #r,est
7#ood 'o#")e reser'o&rs &n the h")n 7od$. D"r&n, !&rrhos&s there &s n &n!rese %#o9 o%
7#ood &nto the h&,h#$ !o)*#&nt s*#n!n&! 'eno"s s$ste) !o"*#ed 9&th n &n!resed
&ntrhe*t&! res&stn!e to o"t%#o9. The !o)7&ned e%%e!t o% &n!resed s*#n!n&! %#o9 nd
de!resed he*t&! !ond"!tn!e !!o)*n&ed 7$ !hron&! *er&*her# 'sod&#t&on &s !entr#
h$*o'o#e)& nd #&)&ted !rd&! *re#od reser'e.
Pro,ress&'e de!o)*enst&on o% *er&*her# 'sod&#t&on &n !&rrhos&s #eds to %#"&d
sh&%t&n, to e(tr's!"#r Ce.,.0 s!&tesD or 'eno"s !o)*rt)ents thro",h &n!resed 'eno"s
!*!&tn!e nd !entr# h$*o'o#e)&. E(tr!e##"#r 'o#")e &s deter)&ned 7$ ren#
sod&") hnd#&n,0 9h&!h re,"#tes the tot# 7od$ sod&") !ontent. S!hr&er *ro*osed the
"n&%$&n, h$*othes&s o% e(tr!e##"#r 'o#")e re,"#t&on &n he#th nd d&sese 9&th the
!on!e*t :no9n s e%%e!t&'e rter&# 7#ood 'o#")e CEABVD. The #tter re*resents %"##ness
o% the rter&# 's!"#r !o)*rt)ent nd &s )Kor deter)&nnt o% ren# re,"#t&on o%
sod&") nd 9ter e(!ret&on0 9h&!h )od"#tes e(tr!e##"#r %#"&d 'o#")e nd os)o##&t$.
A!!ord&n, to S!hr&erJs "n&%$&n, h$*othes&s0 *ro,ress&'e *er&*her# 'sod&#t&on
e'ent"##$ o"tstr&*s the !*!&t$ %or !rd&! !o)*enst&on nd res"#ts &n de!resed ren#
7#ood %#o90 &n!resed %&#trt&on %r!t&on0 nd de!o)*enst&on o% "tore,"#tor$
)e!hn&s)s &n !ond&t&on :no9n s he*toren# s$ndro)e. In!resed ren# sod&")
retent&on nd ren# d$s%"n!t&on !n 7e !orre!ted 7$ 'so*ressors tht !t )&n#$ to
23
&n!rese *er&*her# 's!"#r res&stn!e nd &n!rese ren# *er%"s&on *ress"re
?@
. Th&s
s"**orts the h$*othes&s tht the et&o#o,$ o% ren# sod&") retent&on &s *er&*her#
'sod&#t&on
?@
. Ne"r# %%erents %ro) "n#oded *ress"reA'o#")e re!e*tors st&)"#te
ne"roh")or# res*onses &n!#"d&n, !t&'t&on o% the s$)*thet&! ner'o"s s$ste)0
&n!resed *#s) ren&n !t&'&t$ nd non6os)ot&! AVP re#ese. Th&s *ro%&#e o%
ne"roh")or# !t&'t&on !n #ed to d&#"t&on# h$*ontre)&0 9h&!h !ontr&7"tes
s&,n&%&!nt#$ to de7&#&tt&n, )or7&d&t$ nd )ort#&t$ o% !&rrhos&s. Re,"#t&on o% *#s)
AVP &s 'er$ sens&t&'e to s)## !hn,es &n *#s) os)o##&t$0 7"t re+"&res ,reter
red"!t&ons o% 7#ood 'o#")e ndAor *ress"re to st&)"#te e+"&'#ent re#ese
E1
. As !&rrhos&s
*ro,resses0 *er&*her# 'sod&#t&on *rod"!es )ore *rono"n!ed ne"roh")or# !t&'t&on.
F"rther)ore0 s$ste)&! h$*otens&on hs s&)&#r re,"#tor$ e%%e!t on 9ter &nt:e.
Hen!e0 there &s e'&den!e tht s se'er&t$ o% d&sese *ro,resses0 the *r&)r$ #on,6ter)
tret)ent %or d&#"t&on# h$*ontre)& Ce.,.0 9ter restr&!t&onD 7e!o)es #ess to#er7#e nd
e%%e!t&'e
E16E@
. 4e!hn&s)s o% &)*&red %ree 9ter !#ern!e &n !&rrhos&s &n!#"de other
)&nor %!tors s"!h s de!resed ,#o)er"#r %&#trt&on nd &n!resed sod&") re7sor*t&on
&n the *ro(&)# t"7"#e
E<
. Ho9e'er0 7sed on st"d&es o% se#e!t&'e V1 nt,on&s) &n 7oth
h")ns
E;6E?
nd rts 9&th !&rrhos&s0 'so*ress&n !t&n, to *re'ent the %or)t&on o% d&#"te
"r&ne %o##o9&n, 9ter #od &s the *r&)r$ !ontr&7"t&n, %!tor %or d&#"t&on#
h$*ontre)&. Ne"r# )e!hn&s)s tht st&)"#te nd )&nt&n d&#"t&on# h$*ontre)&
d"r&n, !&rrhos&s re not !o)*#ete#$ "nderstood.
24
OSMOTIC AND NON-OSMOTIC REGULATION OF WATER INTAKE
In he#th$ n&)#s0 the !entr# ne"r# )e!hn&s)s tht re,"#te 7#ood 'o#")e nd
os)o##&t$ re &nter!onne!ted. The s*e!&%&!&t$ o% o'er#* 7et9een the %%erent nd
e%%erent ho)eostt&! res*onses &s re'e#ed 7$ *h$s&o#o,&!# !h##en,es. For e()*#e0
ne"r# *th9$s tht res*ond to #r,e de!reses &n 7#ood *ress"re or 'o#")e !n &n!rese
9ter &nt:e or 'so*ress&n re#ese0 9h&!h then de!reses *#s) os)o##&t$.
A!!ord&n,#$0 d&seses tht res"#t &n !hron&!##$ de!resed 7#ood *ress"re re sso!&ted
9&th non6os)ot&! !t&'t&on o% *th9$s tht re,"#te h")or# os)ot&! ho)eosts&sL
there7$ de!res&n, *#s) os)o##&t$.
The #)&n ter)&n#&s0 re,&on o% the 7r&n s&t"ted &n the )&d#&ne nter&or 9##
o% the th&rd 'entr&!#e0 !ont&ns t9o !&r!")'entr&!"#r or,ns5 the or,n") 's!"#os") o%
the #)&n ter)&n#&s COVLTD nd the s"7%orn&!# or,n CSFOD. Ne"rons 9&th&n these
"n&+"e %ore7r&n re,&ons re s"rro"nded 7$ %enestrted !*&##r&es tht #!: %"n!t&on#
7#ood 7r&n 7rr&er
131613>
0 9h&!h ##o9s these str"!t"res to 7e sens&t&'e to !&r!"#t&n,
%!tors s"!h s *#s) os)o##&t$ nd n,&otens&n
13@6132
. The OVLT nd SFO 7oth *roKe!t
to 'r&o"s h$*oth#)&! s&tes nd dense#$ to the )ed&n *reo*t&! n"!#e"s C4nPOD0 9h&!h
&s n &)*ortnt &nte,rt&'e !enter %or h$dro)&ner# nd !rd&o's!"#r re,"#t&on.
E'&den!e &n ,ots
13?
0 do,s0 rodents
111611>
0 nd shee*
11@611;
s",,ests tht the OVLT *#$s
*redo)&nnt ro#e &n the trnsd"!t&on o% os)ot&! s&,n#s thro",h ne!essr$ *th9$ tht
&n!#"des the 4nPO. Ho9e'er0 &n shee* se#e!t&'e #es&on o% the SFO0 OVLT0 or
!o)7&ned 7#t&on o% 7oth d&d not 7o#&sh the d&*so,en&! res*onse to n os)ot&!
25
st&)"#"s
11;
. Interest&n,#$0 !o)*#ete 7#t&on o% SFO0 OVLT nd 4nPO d&d 7o#&sh
h$*eros)ot&! st&)"#ted dr&n:&n,. /heres 7#t&on o% OVLT nd 4nPOG&n!#"d&n,
7#t&on o% the ent&re ntero'entr# 9## o% the th&rd 'entr&!#eGhs res"#ted &n te)*orr$
d&*s&0 7se#&ne ad libitum 9ter &nt:e nd !&r!d&n rh$th)s &n dr&n:&n, 7eh'&or 9ere
not *er)nent#$ #tered
11;
. St"d&es tht &n!#"ded &))"nost&n&n, o% c-fos0 *roto6
on!o,ene )r:er o% ne"ron# !t&'t&on0 #so !ontr&7"te to e'&den!e tht SFO nd OVLT
ne"rons re !t&'ted 7$ h$*erton&!&t$ nd tht the 4nPO &s !t&'ted se!ondr&#$ 7$
SFO nd OVLT !t&'t&on
1126113
.
An,&otens&n hs #on, 7een :no9n %or &ts d&*so,en&! *ro*ert&es0 nd the &nte,r&t$
o% 7oth SFO nd 4nPO ne"rons re essent&# %or *er&*her# n,&otens&n6&nd"!ed 9ter
&nt:e. Ne"ronto)&!# st"d&es "s&n, c-fos h'e sho9n tht SFO ne"ron !t&'t&on 7$
7oth &ntr'eno"s n,&otens&n II
11?61>1
nd &so*rotereno# C9h&!h st&)"#tes ren&n se!ret&on
d&re!t#$ nd &nd&re!t#$ 7$ #o9er&n, rter&# 7#ood *ress"reD0 nd tht !t&'t&on 7$ e!h &s
sso!&ted 9&th &n!resed 9ter &nt:e. There &s #so e'&den!e tht the ne"rons #o!ted &n
the o"ter 7order o% the SFO0 9h&!h re !t&'ted 7$ d&*so,en&! doses o% n,&otens&n or
&so*rotereno#0 *roKe!t to 4nPO ne"rons
1>@61>;
.
Intr!ere7ro'entr&!"#r CICVD d)&n&strt&on o% n,&otens&n II #so *otent#$
st&)"#tes dr&n:&n, &n rts0 nd the 4nPO **ers to 7e ne!essr$ %or the d&*so,en&!
e%%e!t o% !entr# n,&otens&n II
1>261>E
. Other st"d&es "t&#&B&n, trns,en&! )&!e h'e sho9n
tht the &n!resed *rod"!t&on o% SFO n,&otens&n II &n!resed 9ter &nt:e
1@3
0 nd tht
26
!hron&! 7r&n6restr&!ted o'ere(*ress&on o% AT1R res"#ts &n h&,her 7se#&ne 9ter &nt:e
nd n &n!resed 9ter &nt:e res*onse to e(o,eno"s ICV n,&otens&n II
1@1
. St"d&es o%
s*ontneo"s#$ h$*ertens&'e rts
1@161@@
0 rts de*r&'ed o% 9ter
1@<61@?
0 nd the rts 9&th
!on,est&'e hert %&#"re h'e #so sho9n &n!resed e(*ress&on o% AT1R &n the SFO
sso!&ted 9&th &n!resed 9ter &nt:e. T:en to,ether0 these dt s",,est n &)*ortnt
ro#e %or !entr# n,&otens&n II nd AT1R e(*ress&n, ne"rons &n the SFO *roKe!t&n, to the
4nPO &n the re,"#t&on o% 9ter &nt:e. Bsed on these st"d&es0 &n!resed !&r!"#t&n,
n,&otens&n II %o##o9ed 7$ AT1R "*re,"#t&on &n the SFO **ers to 7e the se+"ent&#
)e!hn&s) dr&'&n, dr&n:&n, 7eh'&or nd ne"roh")or# !t&'t&on. Although the role of
angiotensin among $%& neurons stimulating drinking behavior has been well
described, changes that occur in this system during cirrhosis are not well understood.
There%ore0 the %o!"s o% &)s 10 1 nd > 9&## e()&ne s*e!&%&!##$ ho9 SFO AT1Rs re
&n'o#'ed &n dr&n:&n, 7eh'&or d"r&n, BDL !&rrhos&s.
OSMOTIC AND NON-OSMOTIC REGULATION OF VASOPRESSIN RELEASE
C&r!"#t&n, #e'e#s o% AVP re *r&)r&#$ deter)&ned 7$ the !t&'&t$ o% AVP
),no!e##"#r ne"rose!retor$ !e##s C4NCsD o% the s"*ro*t&! CSOND nd *r'entr&!"#r
CPVND n"!#e& o% the h$*oth#)"s. 4NCs re &ntr&ns&!##$ os)osens&t&'e0 nd re!e&'e
ne"r# *roKe!t&ons %ro) os)osens&t&'e ne"rons o% the #)&n ter)&n#&s. Ne"rons &n the
#)&n ter)&n#&s )od"#te the !t&'&t$ o% 4NCs &n the SON nd PVN. C&r!"#t&n,
n,&otens&n II0 9h&!h !nnot !ross the 7#ood 7r&n 7rr&er0 hs 7een sho9n to &n!rese the
27
!t&'&t$ o% 'so*ress&n ne"rons &n the SON thro",h the #)&n ter)&n#&s. Ho9e'er0 &n
'&'o st"d&es s",,est tht %%erent *ress"reA'o#")e &n*"ts %ro) the )ed"## see) to *#$
n &)*ortnt st&)"#tor$ ro#e d"r&n, !"te h$*otens&on nd he)orrh,e to &n!rese
AVP
1<E61;;
. There%ore0 AVP re#ese d"r&n, !"te nd !hron&! 7o"ts o% h$*otens&on #&:e#$
res"#ts %ro) )"#t&*#e red"ndnt ho)eostt&! )e!hn&s)s0 nd )$ 7e )ore !o)*#e( thn
s&n,#e ho)eostt&! re%#e( #oo*. Th&s ):es sense !ons&der&n, the '&t# &)*ortn!e o%
!ont&n"o"s or,n *er%"s&on %or s"r'&'#.
In *re'&o"s e(*er&)ent *er%or)ed &n o"r #70 ,ro"* o% BDL rts 9ere ,&'en
1H s#&ne to dr&n: to &n!rese s#t de#&'er$ to the d&st# t"7"#e th"s de!res&n, *#s)
ren&n !t&'&t$ CPRAD thro",h the )!"# dens6K"(t,#o)er"#r **rt"s )e!hn&s)
1;2
.
H&,h s#t &nt:e 9s !!o)*n&ed 7$ s&,n&%&!nt de!rese &n !&r!"#t&n, AVP0 9h&!h
9s sso!&ted 9&th de!rese &n PRA !o)*red to BDL rts tht drn: on#$ 9ter
1;2
.
Er#&er st"d&es sho9ed tht ne"rons nd ,#& o% the #)&n ter)&n#&s to,ether !ont&n
%"n!t&on# ren&n6n,&otens&n s$ste) tht )$ *er)&t n,&otens&n II re#ese &n SON %ro)
these ne"r# *roKe!t&ons
1;?6121
0 nd &n '&tro e#e!tro*h$s&o#o,&!# st"d&es h'e #so sho9n
tht n,&otens&n !n !t *ost6s$n*t&!##$ to !t&'te non6s*e!&%&! !t&on&! !ond"!tn!e to
de*o#r&Be SON ne"rons nd *re6s$n*t&!##$ to %!&#&tte ,#"t)te re#ese
1236121
. Th&s
s",,ests tht !&r!"#t&n, n,&otens&n )&,ht !ontr&7"te to &n**ro*r&te re#ese o% AVP 7$
!t&n, on ne"rons o% %ore7r&n !&r!")'entr&!"#r or,ns0 ho9e'er th&s h$*othes&s hs not
7een tested. To !#r&%$ the ro#e o% n,&otens&n &n the st&)"#t&n, AVP re#ese nd 9ter
&nt:e I h'e %o!"sed on !t&ons o% !&r!"#t&n, n,&otens&n &n SFO.
28
4$ 9or:&n, h$*othes&s &s tht !&r!"#t&n, n,&otens&n !t&n, on ne"rons o% SFO
&nd"!es ne"r# d*tt&ons Ce.,.0 "*re,"#t&on o% AT1R e(*ress&onD tht *ro)ote
&n!resed dr&n:&n, 7eh'&or sso!&ted 9&th BDL CF&,"re 1D. The ro#e o% SFO AT1
re!e*tors &n )ed&t&n, AVP re#ese nd 9ter retent&on sso!&ted 9&th BDL 9s tested &n
rts 7$ &nKe!ted o% AT1R shRNA nd &n%"s&on o% #osrtn &nto the !ere7r# 'entr&!#es.
SUMMARY
G&n&n, ,reter "nderstnd&n, o% ho9 9ter &nt:e nd 'so*ress&n re#ese re
re,"#ted os)ot&!##$ nd non6os)ot&!##$ !o"#d he#* to &)*ro'e tret)ent *roto!o#s %or
*t&ents 9&th #&'er !&rrhos&s0 *otent&##$ *re'ent&n, or re'erse&n, d&#"t&on# h$*ontre)&.
F"rther e#"!&dt&on o% the )e!hn&s)s tht re,"#te 9ter &nt:e 9&## #so &n%or) 7etter
9$s to *re'ent d'erse dr", e%%e!ts s 9e## s *##&te e%%e!ts o% d&sese *ro,ress&on tht
#ed to &n**ro*r&te dr&n:&n, 7eh'&or.
29
Figure 1: Diagram showing primary (black arrows) and alternate (light blue arrows)
neural and humoral pathways proposed to mediate increased water intake and vasopressin
release during BDL. The initiating factor is the peripheral vasodilation that occurs as a
result of portal hypertension (see Literature Review). Peripheral vasodilation eventually
decompensates and outstrips renal autoregulatory ability by decreasing blood flow and
resulting in the release of plasma renin (black arrows). Acting on the SFO, angiotensin II
increases the excitatory drive for increased drinking behavior and vasopressin release.
Light blue arrows show a possible alternative/redundant pathway involved in the
stimulation of AVP release. Red lettering indicates peripheral factors, and black lettering
indicates central factors. Abbreviations: AT1R, Angiotensin type 1 receptor; SFO,
subfornical organ; OVLT, organum vasculosum of the lamina terminalis; MnPO, median
preoptic nucleus; SON, supraoptic nucleus; NTS, nucleus of the solitary tract; CVL,
caudal ventrolateral medulla.
30
CHAPTER 15 INTRACEREBROVENTRICULAR CICVD LOSARTAN INFUSION
NOR4ALIMES ANGIOTENSIN TYPE 1 RECEPTOR CAT1RD EXPRESSION IN
THE SUBFORNICAL ORGAN CSFOD AND DRINKING BEHAVIOR IN BILE
DUCT LIGATED RATS
A77re'&ted t&t#e5 In!resed dr&n:&n, 7eh'&or nd AT1R d"r&n, &n**ro*r&te 'so*ress&n
re#ese
Authors: -ose*h D /#!h
10 1
0 F#N'& Re,&n CrreOo
1
0 nd -. Tho)s C"nn&n,h)
1
1
De*rt)ent o% Inte,rt&'e Ph$s&o#o,$0 nd Crd&o's!"#r Reser!h Inst&t"te
Un&'ers&t$ o% North Te(s He#th S!&en!e Center t Fort /orth0
><33 C)* Bo9&e B#'d
Fort /orth0 TX 2;132
1
De*rt)ent o% Phr)!o#o,$ nd Ne"ros!&en!e
Un&'ers&t$ o% Te(s He#th S!&en!e Centre t Sn Anton&o
223> F#o$d C"r# Dr&'e
Sn Anton&o0 TX 2?11E
31
ABSTRACT
B&#e d"!t #&,t&on CBDLD !"ses !on,est&'e #&'er %&#"re nd &n&t&tes
he)od$n)&! !hn,es &n!#"d&n, *er&*her# 'sod&#t&on nd ,ener#&Bed ede).
Per&*her# 'sod&#t&on &s h$*othes&Bed to then !t&'te !o)*enstor$ )e!hn&s)s
&n!#"d&n, &n!resed %#"&d e#e!tro#$te d$sre,"#t&on nd ne"roh")or# !t&'t&on &n!#"d&n,
&n**ro*r&te r,&n&ne 'so*ress&n CAVPD re#ese nd &n!resed *#s) ren&n !t&'&t$.
A!t&'t&on o% hor)on# nd ne"r# *th9$s se!ondr$ to *er&*her# 'sod&#t&on &s #so
,ener##$ tho",ht to &n!rese dr&n:&n, 7eh'&orL ho9e'er0 the *re!&se !entr# )e!hn&s)s
tht ,o'ern 'so*ress&n re#ese nd dr&n:&n, 7eh'&or re not 9e## !hr!ter&Bed &n the
!onte(t o% #&'er %&#"re. The !&r!")'entr&!"#r or,ns0 the S"7%orn&!# Or,n CSFOD nd
the or,n") 's!"#os") o% the #)&n ter)&n#&s COVLTD0 %"n!t&on s sensor$ s$ste)
tht )on&tors !hn,es &n !&r!"#t&n, hor)ones s 9e## s *#s) os)o##&t$ nd h'e
7een &)*#&!ted &n !rd&o's!"#r !ontro#0 nd 7od$ %#"&d ho)eosts&s. /e tested the
h$*othes&s tht &n!resed !entr# n,&otens&n s&,n#&n, !ontr&7"tes to &n!resed dr&n:&n,
7eh'&or nd &n**ro*r&te AVP re#ese &n the BDL )ode# o% !&rrhos&s &n the rt. Rts
%&rst "nder9ent BDL or sh) #&,t&on s"r,er$. A%ter 2 d$s o% re!o'er$0 os)ot&!
)&n&*")*s %&##ed 9&th the n,&otens&n AT1 re!e*tor CAT1RD nt,on&st #osrtn C1.3
P,AP#D or 3.EH s#&ne 'eh&!#e !onne!ted 7$ t"7&n, to n &ntr!ere7ro'entr&!"#r CICVD
!nn"# 9ere &)*#nted %or !hron&! &n%"s&on. Se*rte sets o% !ontro# rts 9ere
!hron&!##$ &n%"sed s"7!"tneo"s#$ 9&th the s)e dose o% #osrtn or 'eh&!#e. Strt&n, 13
d$s %ter BDL or sh) #&,t&on s"r,er$0 rts 9ere ho"sed &n )et7o#&! !h)7ers %or
32
)es"re)ent o% %#"&d nd %ood &nt:e nd "r&ne o"t*"t. On the 1?
th
d$0 the rts 9ere
nesthet&Bed nd de!*&tted0 nd s)*#es o% 7#ood nd 7r&n *"n!hes 9ere !o##e!ted %or
+"nt&%&!t&on o% AT1R e(*ress&on 7$ 9estern 7#ot nd re#6t&)e +"nt&tt&'e PCR CRT6
+PCRD. A'er,e 7se#&ne 9ter &nt:e s&,n&%&!nt#$ &n!resed &n BDL rts !o)*red to
sh)0 nd th&s 9s tten"ted 7$ !hron&! ICV #osrtn &n%"s&on. U*re,"#t&on o% AT1R
*rote&n nd AT1R )RNA 9ere o7ser'ed &n the SFO o% BDL rts !o)*red to sh). In
the OVLT o% BDL n&)#s0 AT1R *rote&n 9s #so e#e'ted 7"t 9&tho"t n sso!&ted
&n!rese &n AT1R )RNA. Chron&! ICV #osrtn &n%"s&on *re'ented the &n!rese o% AT1R
*rote&n &n the SFO 9&tho"t !hn,&n, *#s) os)o##&t$. Ren# sod&") retent&on 9s
s&,n&%&!nt#$ &n!resed &n BDL n&)#s0 nd there 9s no d&%%eren!e &n %ood or sod&")
&nt:e. Dt *resented here &nd&!te *oss&7#e ro#e %or &n!resed #)&n ter)&n#&s AT1R
e(*ress&on &n s"**ort&n, &n!resed dr&n:&n, 7eh'&or d"r&n, !on,est&'e !&rrhos&s0 7"t #so
s",,est !entr# n,&otens&n s&,n#&n, &s not the *r&)r$ )e!hn&s) res*ons&7#e %or
!&rrhos&s6&nd"!ed d&#"t&on# h$*ontre)&.
33
INTRODUCTION
P#s) os)o##&t$ &s nor)##$ re,"#ted 7$ t9o *r&n!&*#e )e!hn&s)s5 1D 9ter
&nt:e0 nd 1D so#"te6%ree 9ter e(!ret&on )ed&ted 7$ r,&n&ne 'so*ress&n CAVPD. In
he#th$ h")ns0 *#s) os)o##&t$ &s )&nt&ned 9&th&n nrro9 rn,e o% 1?361E<
)Os)A:,. Under nor)# *h$s&o#o,&!# !ond&t&ons the os)ot&! thresho#d nd sens&t&'&t$
%or AVP re#ese nd th&rst re s&)&#r
11
0 nd h$*ontre)& %ro) e(!ess&'e 9ter &nt:e &s
"n!o))on. Ho9e'er0 st"d&es o% the dern,e)ent o% th&rst nd AVP re#ese &nd&!te tht
th&rst &n )7"#tor$ h")ns tht h'e !!ess to 9ter &s n &)*ortnt %!tor &n the
!hron&! re,"#t&on o% 9ho#e 7od$ 9ter 7#n!e.
H$*ontre)& &s sso!&ted 9&th ne,t&'e o"t!o)es &n )n$ !hron&! d&sese
sttes s"!h s !on,est&'e hert %&#"re nd !&rrhos&s. In 7oth !ses0 &n**ro*r&te#$ h&,h
AVP re#ese %ro) the *oster&or *&t"&tr$ &n re#t&on to the *re'&#&n, #o9 #e'e# o% *#s)
os)o##&t$ !ontr&7"tes to 9ter retent&on nd d&#"t&on# h$*ontre)&Gthere7$
&n!res&n, )or7&d&t$ nd )ort#&t$ . Tret)ent 9&th s*e!&%&! V1 re!e*tor nt,on&sts
CV1AD &n!reses so#"te6%ree 9ter e(!ret&on nd &)*ro'es *#s) os)o##&t$ &n hert
%&#"re nd !&rrhos&s
1E6>1
0 ho9e'er there h'e 7een re*orts o% &n!resed dr&n:&n, 7eh'&or
res"#t&n, %ro) d&sese nd *oss&7#$ s s&de6e%%e!t o% V1A tret)ent tht !ontr&7"tes to
&n!resed )ort#&t$ nd re6hos*&t#&Bt&on .
34
Trd&t&on##$0 &n!resed ne"roh")or# !t&'t&on sso!&ted 9&th !&rrhos&s hs
7een ttr&7"ted to de!resed e%%e!t&'e !&r!"#t&n, 'o#")e nd h$*erd$n)&! !&r!"#tor$
s$ndro)e !hr!ter&Bed 7$ &n!resed *ort# h$*ertens&on &n&t&t&n, s*#n!n&! h$*ere)&
nd !"#)&nt&n, &n *er&*her# 'sod&#t&on nd ne"roh")or# e(!&tt&on. H$*erd$n)&!
!&r!"#tor$ s$ndro)e &s re*orted to !t&'te the ren&n6n,&otens&n s$ste) d"r&n, he*t&!
!&rrhos&s 9h&!h &s !ons&stent 9&th the trd&t&on# '&e9 tht non6os)ot&! %!tors dr&'e
'so*ress&n re#ese sso!&ted 9&th th&s d&sese *oss&7#$ 7$ resett&n, the os)ot&!
thresho#d or ,&n. A #&:e#$ !nd&dte )e!hn&s) &s &n!resed !&r!"#t&n, n,&otens&n II
CAn, IID tht !o"#d !ontr&7"te to !hr!ter&st&! s$)*tho6e(!&tt&on0 &n!resed AVP
re#ese nd e#e'ted %#"&d &nt:e o% !&rrhos&s 7$ !t&n, on CNS !&r!")'entr&!"#r or,ns.
The #)&n ter)&n#&s !ont&ns t9o !&r!")'entr&!"#r or,ns5 the or,n")
's!"#os") o% the #)&n ter)&n#&s COVLTD nd the s"7%orn&!# or,n CSFOD. Ne"rons
9&th&n these "n&+"e %ore7r&n re,&ons #!: %"n!t&on# 7#ood 7r&n 7rr&er0 9h&!h ##o9s
ne"rons !o)*r&s&n, these str"!t"res to sense nd res*ond to !&r!"#t&n, %!tors s"!h s
*#s) os)o##&t$ nd An, II
12<
. Ne"rons o% OVLT nd SFO 7oth *roKe!t 9&de#$
thro",ho"t the %ore7r&n nd h$*oth#)"s0 9&th )Kor tr,et 7e&n, the )ed&n
*reo*t&! n"!#e"s C4nPOD0 9h&!h &s n &)*ortnt &nte,rt&'e !enter %or h$dro)&ner# nd
!rd&o's!"#r re,"#t&on. An,&otens&n II t$*e 1 re!e*tor CAT1RD e(*ress&on &s dense#$
#o!#&Bed to these n"!#e& 0 nd the #e'e# o% AT1R e(*ress&on &n these re,&ons &s ,ener##$
!ons&dered &)*ortnt %or deter)&n&n, res*ons&'eness o% the 7r&n n,&otens&n s$ste) &n
re,"#t&n, *er&*her# he)od$n)&!s. The *re!&se ne"r# nd )o#e!"#r %!tors tht reset
35
the th&rst nd AVP os)ot&! set6*o&nts do9n9rd d"r&n, hert or #&'er %&#"re re)&n
"ndeter)&ned.
Chron&! 7&#e d"!t #&,t&on CBDLD &n the rt &s !o))on#$ "sed )ode# o% he*t&!
!&rrhos&s . As &n the h")n !ond&t&on0 these rts h'e e#e'ted !&r!"#t&n, 'so*ress&n
des*&te s&,n&%&!nt#$ de!resed *#s) os)o##&t$0 &n!resed PRA0 nd h$*er'o#e)&!
s!&tes %or)t&on. Pre'&o"s#$0 o"r #7 re*orted tht there 9s s&,n&%&!nt *os&t&'e
re#t&onsh&* 7et9een PRA nd AVP re#ese0 nd tht de!res&n, PRA 7$ restr&!t&n, %#"&d
&nt:e to h$*erton&! s#&ne s&,n&%&!nt#$ de!resed !&r!"#t&n, AVP
1;2
.
The *"r*ose o% th&s st"d$ 9s to e'#"te the *ttern o% e(*ress&on o% AT1R
)RNA nd *rote&n &n the #)&n ter)&n#&s sso!&ted 9&th BDL &nd"!ed h$*oos)o##&t$.
/e %"rther tested the ro#e o% !entr# AT1R !t&'&t$ *hr)!o#o,&!##$ 9&th !hron&!
#osrtn &n%"s&ons to %"n!t&on##$ test the !ontr&7"t&on o% !entr# n,&otens&n s&,n#&n, &n
the de'e#o*)ent o% d&#"t&on# h$*ontre)& d"r&n, BDL !&rrhos&s.
MATERIALS AND METHODS
ANIMALS
E(*er&)ents 9ere !ond"!ted on d"#t )#e S*r,"e6D9#e$ rts C1<3Q><3,0
Chr#es R&'er L7ortor&es0 In!.0 /&#)&n,ton0 4A0 USAD tht 9ere &nd&'&d"##$ ho"sed
&n te)*ert"re6!ontro##ed C1>RCD en'&ron)ent "nder 11A11h #&,ht !$!#e 9&th #&,ht
onset t 3233h. E(!e*t d"r&n, s"r,&!# *ro!ed"res0 rts hd ad libitum !!ess to 9ter nd
36
%ood. The #tter !ont&ned 3.>1H NC#. A## e(*er&)ent# *ro!ed"res 9ere !ond"!ted &n
!!ordn!e 9&th the ,"&de#&nes o% the P"7#&! He#th Ser'&!e nd 9ere **ro'ed 7$ the
Un&'ers&t$ o% North Te(s He#th S!&en!e Centre Inst&t"t&on# An&)# Cre nd Use
Co))&ttee.
BILE DUCT LIGATION MODEL OF HEPATIC CIRRHOSIS
E!h n&)# 9s nesthet&Bed 9&th &so%#"rne C1H &n o($,enD. On!e %"##$
nesthet&Bed the 7do)en 9s sh'ed nd the re 9s !#ened 9&th &od&ne nt&se*t&!. A
)&d#&ne &n!&s&on 9s *er%or)ed on the 7do)en nd the !o))on 7&#e d"!t 9s &so#ted
7$ 7#"nt d&sse!t&on nd !"t 7et9een t9o #&,t"res. E!h rt 9s then ret"rned to !,e
nd )on&tored d&#$ "nt&# "sed %or the e(*er&)ent. V&s"# &ns*e!t&on o% s!&t&! %#"&d o% the
*er&tone# !'&t$ 9s *er%or)ed d&#$ %ter s"r,er$. An$ rt sho9&n, )or7&d&t$ Ce.,.0
%&#"re to thr&'e0 s&,n&%&!nt de!rese &n %ood or 9ter &nt:eD 9s e"thn&Bed 9&th
th&o7"t7r7&t# CIn!t&nS0 S&,)0 St. Lo"&s0 4OL 133 ),A:, &.*.D. Sh) #&,ted !ontro#s
9ere s"7Ke!ted to the s)e s"r,&!# *ro!ed"re 9&th the e(!e*t&on tht the 7&#e d"!t 9s
not #&,ted or !"t. Rts 9ere e"thn&Bed @ 9ee:s C1? d$sD %ter BDL or sh) s"r,er$ %or
!o##e!t&on o% 7r&n nd 7#ood s)*#es. L&'er %&7ros&s 9s o7ser'ed &n rts 9&th s"!!ess%"#
7&#e d"!t #&,t&on. L&'erA7od$ 9e&,ht rt&o nd d&s!o#ort&on o% 7#ood ser") 9s "sed to
'er&%$ the de'e#o*)ent o% he*t&! !&rrhos&s.
37
CHRONIC ICV CANNULA AND OSMOTIC MINIPUMP IMPLANTATION
Rts 9ere ##o9ed to re!o'er %or 2 d$s %ter BDL or sh) s"r,er$. There%ter
,ro"*s o% BDL nd sh) rts 9ere &nstr")ented 9&th os)ot&! )&n&6*")*s CA#Bet )ode#
133@0 3.1< T# hQ1L C"*ert&no0 CA0 USAD %or &ntr!ere7ro'entr&!"#r CICVD or
s"7!"tneo"s CSCD &n%"s&ons. The #tter 9s to !ontro# %or *er&*her# dr", e%%e!ts. P")*s
9ere %&##ed 9&th e&ther #osrtn C1 P,AP#D d&sso#'ed &n 3.EH s#&ne 'eh&!#e or 'eh&!#e
#one. The dose o% #osrtn 9s !hosen 7sed on *re'&o"s &n '&'o st"d&es tht sho9ed &t
to h'e no e%%e!t on rter&# *ress"re. P")*s 9ere &n!"7ted %or t #est @? h &n >2UC
9ter 7th nd 9e&,hed *r&or to &)*#ntt&on. S"r,er&es 9ere *er%or)ed "s&n, se*t&!
te!hn&+"e 9&th rts nesthet&Bed 9&th &so%#"rne. For ICV &n%"s&ons0 *")*s 9ere
!onne!ted 7$ *o#$eth$#ene t"7&n, to *&e!e o% 11 ,",e st&n#ess stee# t"7&n, CP#st&!s
One0 Rono:e0 VAD0 !"t <.3 )) 7e#o9 the *edest#. The %ree end o% the 11 ,",e t"7&n,
9s *#!ed &n the #e%t #ter# 'entr&!#e "s&n, stereot(&! te!hn&+"e. A s)## ho#e 9s
dr&##ed &n the s:"## t 1.3 )) *oster&or nd 1.< )) #ter# to 7re,) "s&n, the #e'e# s:"##
te!hn&+"e
1?1
. The !nn"# 9s *#!ed &nto the ho#e so tht &t e(tended < )) %ro) the
s"r%!e o% the s:"## nd then !e)ented &nto *#!e 9&th dent# !r$#&! nd Ke9e#erVs s!re9s.
P")*s 9ere then s"t"red &nto s)## *o!:et )de "nder the s:&n t the 7se o% the ne!:.
For SC &n%"s&ons0 *")*s 9ere *re*red nd *#!ed "nder the s:&n t the 7se o% the ne!:
K"st s the$ 9ere &)*#nted %or the ICV &n%"s&ons. A## rts 9ere e"thn&Bed 1? d$s %ter
BDL or sh) s"r,er$ C&.e.0 11 d$s %ter )&n&*")* &)*#ntt&onD nd *")*s 9ere
!#ened nd 9e&,hed ,&n 9e&,hed to 'er&%$ dr", or 'eh&!#e de#&'er$.
38
METABOLIC CAGES
To )es"re 9ter &nt:e0 %ood &nt:e0 nd "r&ne o"t*"t0 rts 9ere ho"sed &n
)et7o#&! !,es CL7 Prod"!ts In!.0 Se%ord0 DED strt&n, on the 1?
th
d$ %ter BDL or
sh) s"r,er$. The )et7o#&! !,e *roto!o# !ons&sted o% 13 d$s. D$s 16> 9ere
!!#&)t&on d$s &n 9h&!h no )es"re)ents 9ere t:en. On D$s @6130 %ood &nt:e0
9ter &nt:e nd "r&ne o"t*"t 9ere re!orded t E533 ). Food 9s )es"red 7$ %&##&n, the
%ood !ont&ners to s*e!&%&ed 9e&,ht &n ,r)s nd s"7tr!t&n, the re)&n&n, 9e&,ht 1@
ho"rs #ter. Sod&") &nt:e 9s !#!"#ted %ro) sod&") !ontent o% the %ood C3.>1H 7$
9e&,ht0 CtW L4@?<0 Te:#d D&ets0 4d&son /ID. /ter &nt:e 9s )es"red "s&n,
,rd"ted !$#&nders %&##ed d&#$ to 'o#")e o% 133 )#. Ur&ne o"t*"t 9s !o##e!ted &n <3
)# F#!on !entr&%",e t"7es nd 1 )# %ro) e!h d&#$ s)*#e 9s *&*etted &nto 1.< )#
)&!ro!entr&%",e t"7e nd !entr&%",ed C13 )&nL 130333(,D. 13 P# o% "r&ne s"*erntnt 9s
then re)o'ed %or )es"r&n, "r&ne sod&") !on!entrt&on "s&n, %#)e *hoto)eter
C-en9$ PFP20 V/R Internt&on#0 Rdnor PAD !!ord&n, to )n"%!t"rerJs &nstr"!t&ons.
A## )et7o#&! dt 9ere nor)#&Bed to e!h rtJs 7od$ 9e&,ht t s!r&%&!e.
PLASMA MEASUREMENTS
A s)*#e o% 9ho#e rter&# nd 'eno"s 7#ood %ro) e!h rt 9s !o##e!ted &nto
1.< )# )&!ro!entr&%",e t"7e. T9o he*r&n6!ont&n&n, !*&##r$ t"7es 9ere %&##ed to
)es"re he)to!r&t0 nd the re)&n&n, s)*#e 9s !entr&%",ed C< )&nL 130333X,D nd
133 P# s)*#e o% ser") 9s re)o'ed to )es"re os)o##&t$ "s&n, '*or *ress"re
39
os)o)eter C/es!or In!. Lo,n0 UTD. Ser") *rote&n 9s )es"red 7$ re%r!to)eter$
CNt&on# Proto)eter0 Nt&on# Instr")ents0 B#t&)ore0 4DD.
MICROPUNCH DISSECTION OF FOREBRAIN TISSUES
T&ss"e !ont&n&n, SFO0 OVLT0 nd 4nPO 9ere )&!ro*"n!hed %ro) the %ore7r&n
%or RT6+PCR nd /estern 7#ot n#$s&s. E!h rt 9s nesthet&Bed CIn!t&nL 133 ),A:,0
&.*.D nd de!*&tted. The &so#ted 7r&n 9s *#!ed &n !o))er!&##$ '&#7#e 7r&n
)tr&( CStoe#t&n,0 /ood D#e0 ILD. The )tr&( 9s "sed to !"t the 7r&n &nto 16))
!oron# s#7s 9&th rBor 7#des. Then0 the des&red re,&ons %ro) the **ro*r&te rostr#6
!"d# 16))6th&!: s#&!e 9ere )&!ro*"n!hed 9&th 16)# s$r&n,es e+"&**ed 9&th 7#"nt 1>6
,",e need#es. The *"n!h s)*#es 9ere e(*e##ed &nto )&!ro!entr&%",e t"7es nd sn*6
%roBen on dr$ &!e.
WESTERN BLOT
4od&%&ed 9estern 7#ot 9s *er%or)ed s *re'&o"s#$ re*orted. P"n!hes %ro) one
set o% rts 9ere son&!ted &n <3 P# o% )od&%&ed rd&o&))"no*re!&*&tt&on 7"%%er CRIPAD
s"**#e)ented 9&th *rotese C*rot&n&n0 #e"*e*t&n0 *e*stt&n0 S&,)0 151333 d&#"t&on
!!ord&n, to )n"%!t"rer &nstr"!t&onsD nd *hos*htse &nh&7&tors C*hos*htse &nh&7&tor
!o!:t&# 1 = 10 S&,) P1?<3 = P<21;D %o##o9ed 7$ >3 )&n &n!"7t&on on &!e. Cr"de
ho)o,entes 9ere then !entr&%",ed C1@0333 r*)0 >3 )&n t @UCD nd tot# *rote&n
!on!entrt&on 9s deter)&ned 7$ the Brd%ord )ethod. F&%t$ to s&(t$ )&!ro,r)s o% tot#
40
#$ste 9s #oded onto @613H !r$#)&de SDS ,e#0 e#e!tro*horesed &n Tr&s6,#$!&ne 7"%%er
"nder dent"r&n, !ond&t&ons nd trns%erred to n&tro!e##"#ose )e)7rne CB&o6Rd0
Her!"#es0 CAD &n Tr&s6,#$!&ne 7"%%er 9&th 13Q13H )ethno#. 4e)7rnes 9ere 7#o!:ed
%or 1 h t roo) te)*ert"re 9&th <H C9tA'o#D non6%t )&#: &n Tr&s67"%%ered s#&ne 3.3<H
C'o#A'o#D T9een 13 CTBS6T9eenL <3 )4 Tr&s 7se0 133 )4 NC#0 3.3<H T9een 13D.
4e)7rnes 9ere then &n!"7ted o'ern&,ht t @UC 9&th *r&)r$ nt&7od$ r&sed ,&nst
AT1 re!e*tors CF&tB,er#d Ind"str&es Internt&on#0 23R6AC331L 15<33 d&#"t&onD nd Y6
!t&n %or nor)#&Bt&on CS&,)0 A<@@1L 1510333 d&#"t&onD. B#ots 9ere r&nsed > t&)es 13
)&n e!h 9&th TBS 3.3<H T9een 13 nd then &n!"7ted t roo) te)*ert"re %or 1 h &n
horserd&sh *ero(&dse !onK",ted se!ondr$ nt&7od$ ,&nst the *r&)r$ nt&7od$ host
s*e!&es C15<0333L S&,)D. Prote&n 7nds 9ere dete!ted 7$ enhn!ed !he)&#")&nes!en!e
CECL re,entsL A)ersh)0 P&s!t9$0 N-D 7$ !+"&r&n, d&,&t# ,e# &),es %ro)
S$n,ene G67o( CFreder&!:0 4DD. Dens&to)etr$ o% &))"nore!t&'e 7nds o% &nterest 9s
n#$Bed "s&n, I),e - so%t9re.
RNA ETRACTION AND REVERSE TRANSCRIPTION
A## *ro!ed"res 9ere *er%or)ed "s&n, RNAse6%ree !ond&t&ons. Br&n *"n!h
s)*#es 9ere ho)o,en&Bed &n 133 P# o% Tr&Bo# CIn'&tro,en0 Cr#s7d0 CAD. Tot# RNA
9s &so#ted %ro) ho)o,entes "s&n, !h#oro%or) e(tr!t&on0 &so*ro*no# *re!&*&tt&on0
nd ethno# 9sh. Iso#ted RNA *e##ets 9ere e#"ted &n TE B"%%er nd ,eno)&! DNA
!ont)&nt&on 9s re)o'ed "s&n, n RNAse6%ree DNse I d&,est CDNA Free0 A)7&on0
41
A"st&n0 TXD. RNA !on!entrt&on nd *"r&t$ 9s deter)&ned "s&n, Nnodro*
CNnodro*0 /&#)&n,ton0 DED. S)*#es $&e#d&n, #ess thn <3 n,AP# ndAor 1;3A1?3 rt&o
#o9er thn 1.? 9ere not "sed %or )*#&%&!t&on. E(tr!ted RNA 9s nor)#&Bed %or
!on!entrt&on nd re'erse trns!r&7ed "s&n, n &S!r&*t !DNA s$nthes&s :&t CB&o6Rd0
Her!"#es0 CAD nd the *ro'&ded ther)# !$!#&n, *roto!o#.
!UANTITATIVE REAL-TIME PCR
T+)n ,ene e(*ress&on ss$s 9ere *"r!hsed %ro) A**#&ed B&os$ste)s
!ont&n&n, FA4 nd VIC *ro7e6#7e#ed *r&)ers CAT1RGAss$ ID5 Rn31@><@128)10
Gene ID5 1@1?3L GAPDHGAss$ ID5 HsEEEEEE3<8)1D. Us&n, E; 9e## PCR o*t&!#
*#te0 d"*#e(ed *r&)ers nd t #est 1P# o% s)*#e !DNA 9ere dded &n tr&*#&!te nd
ss$ed 9&th T+)n ,ene e(*ress&on )ster )&( CA**#&ed B&os$ste)s0 Cr#s7d0 CAD.
Re#6t&)e PCR 9s *er%or)ed 7$ B&o6Rd CFXE; re#6t&)e PCR dete!t&on s$ste).
The CFXE; &n&t&##$ 9r)s the s)*#e to <3UC %or 1 )&n"tes then het !t&'tes the
DNA6Po#$)erse %or 13 )&n"tes t E<UC. Then0 @3 !$!#es o% PCR re *er%or)ed s
%o##o9s5 C1D 1< se!onds t E<UC0 C1D 1 )&n"te t ;3UC. F#"ores!en!e dt re !*t"red 7$
the o*t&!# !)er )od"#e t the end o% e!h !$!#e "s&n, CFX 4n,er so%t9re
'1.;.<@1.131? CB&o6Rd0 133?D.
42
!UANTIFICATION AND ANALYSIS OF PCR RESULTS
Dt 9ere *#otted !ross !$!#es %or dete!ted %#"ores!en!e 7o'e the 7!:,ro"nd
s&,n#. The ( !oord&nte t the thresho#d o% )*#&%&!t&on 9s des&,nted the Ct nd "sed
s )es"re o% )RNA +"nt&tt&on. To '#&dte s)*#e '&7&#&t$0 the s#o*e o% tn,ent&#
#&ne t the &n%#e!t&on *o&nt %or e!h s)*#e 9s !o)*red nd s)*#es 9&th s#o*e '#"es
de'&t&n, )ore thn <H %ro) the )en 9ere d&s!rded. Stndrd d&#"t&on e%%&!&en!$
!"r'es 9ere ,enerted "s&n, *re'&o"s#$ deter)&ned *r&)ers. Stndrd !"r'es %or 7oth
,enes hd !orre#t&on !oe%%&!&ents ,reter thn 3.EE3. Inter!t&on tests 7et9een *r&)ers
d"r&n, )"#t&6*#e( 9ere ne,t&'e. The re#t&'e )RNA e(*ress&on o% GAPDH )RNA 9s
"sed %or nor)#&Bt&on. Dt 9ere n#$Bed 7$ the 1
6ZZCT
)ethod .
EPERIMENTAL PROTOCOL
There 9ere e&,ht se*rte ,ro"*s "sed %or )et7o#&s) !,e st"d&es5 dr",A'eh&!#e
n['e sh) #&,ted Cn \ ED0 dr",A'eh&!#e n['e BDL Cn \ 11D0 'eh&!#e ICV &n%"sed sh)
#&,ted Cn \ ED0 #osrtn ICV &n%"sed sh) #&,ted Cn \ ?D0 'eh&!#e ICV &n%"sed BDL Cn \
13D0 #osrtn ICV &n%"sed BDL Cn \ 13D0 SC #osrtn sh) #&,ted Cn \ 13D0 SC #osrtn
BDL Cn \ 13D. These n&)#s 9ere "sed %or *"n!h !o##e!t&on nd /estern 7#ot n#$s&s o%
SFO AT1R 7"ndn!e. So)e s)*#es 9ere not &n!#"ded &n the n#$s&s d"e to *oor
*rote&n or )RNA re!o'er$.
43
STATISTICAL ANALYSIS
A## res"#ts re *resented s )ens ] SE4. D&#$ 9ter0 "r&ne0 sod&")0 nd %ood
)es"re)ents 9ere n#$Bed "s&n, t9o69$ re*eted )es"res ANOVA. Post6ho!
n#$s&s o% s&,n&%&!nt )&n e%%e!ts 9s !rr&ed o"t "s&n, St"dent Ne9)nQKe"#s *ost6
ho! test CS&,)*#ot0 Sn -ose0 CAD. Other dt 9ere n#$Bed 7$ one69$ n#$s&s o%
'r&n!e. S&,n&%&!n!e 9s set t P ^ 3.3<.
RESULTS
EFFECTS OF BDL ON FLUID BALANCE AND AT" RECEPTORS
P#s) os)o##&t$0 he)to!r&t nd *#s) *rote&n '#"es %ro) n['e sh) #&,ted
nd BDL rts re sho9n &n T7#e 1. BDL rts e(h&7&ted s&,n&%&!nt#$ #o9er *#s)
os)o##&t$ nd he)to!r&t C*^3.3<D !o)*red to sh) #&,ted rts CT7#e 1D. De!resed
*#s) os)o##&t$ nd he)to!r&t re not d"e to !hn,es &n *rote&n s s",,ested 7$
%&#"re to %&nd d&%%eren!es &n *#s) *rote&n )es"re)ents. BDL rts tht !o)*#eted the
e(*er&)ent d&s*#$ed K"nd&!e 9&th e#e'ted ser") 7&#&r"7&n0 he*tos*#eno)e,#$0 nd
de'e#o*ed !&rrhot&! #&'er s e'#"ted 7$ ,ross '&s"# e()&nt&on. L&'er69e&,ht6to6
7od$69e&,ht rt&os t t&)e o% s!r&%&!e 9ere s&,n&%&!nt#$ h&,her &n ## BDL rts !o)*red
to sh) C*^3.331D. There%ore0 e(*er&)ent# BDL #ed to #&'er *tho#o,$ sso!&ted 9&th
e(tr!e##"#r 'o#")e e(*ns&on s est&)ted 7$ he)to!r&t. /e #so o7ser'ed trend %or
44
de!resed 9e&,ht ,&n &n BDL n&)#s CT7#e 10 *.32 sh) 's. BDLD. As res"#t0 ##
)et7o#&! dt 9ere nor)#&Bed to 7od$ 9e&,ht.
BDL rts drn: s&,n&%&!nt#$ )ore 9ter thn sh) #&,ted !ontro#s CF&,"re 1A0
*^3.3<D 7"t hd no s&,n&%&!nt d&%%eren!es &n "r&ne 'o#")e CF&,"re 1AD. BDL rts #so
sho9ed ,reter 9ter 7#n!e Csh)5 1E.2 ] 1.E )# :,
61
d$
61
's. BDL5 >E.? ] 1.? )# :,
61
d$
61
D nd sod&") 7#n!e Csh)5 1.? ] 3.1 )E+ :,
61
d$
61
's. BDL5 @.1 ] 3.> )E+ :,
61
d$
61
D !o)*red to sh) #&,ted rts. 4&n&*")* n['e BDL rts e(h&7&ted de!resed ren#
sod&") e(!ret&on !o)*red to sh) rts CF&,"re 1B0 *^3.331D.
AT1R *rote&n CF&,"re >AD nd )RNA CF&,"re >BD 7"ndn!es 9ere s&,n&%&!nt#$
&n!resed CP^3.3<D &n the SFO o% BDL rts !o)*red to sh). /heres OVLT AT1R
*rote&n 7"ndn!e sho9ed s#&,ht &n!resed e(*ress&on &n BDL rts CF&,"re @A *^3.3<D
there 9s no !orres*ond&n, &n!rese &n AT1R )RNA CF&,"re @BD. There 9s no
s&,n&%&!nt d&%%eren!e &n AT1R *rote&n or AT1R )RNA 7"ndn!e &n 4nPO 7et9een
tret)ent ,ro"*s CF&,"re @C nd @D res*e!t&'e#$D.
EFFECTS OF CHRONIC LOSARTAN INFUSIONS ON FLUID BALANCE AND AT" RECEPTOR
EPRESSION IN BDL RATS
S&)&#r to )&n&*")* n['e rts0 *#s) os)o##&t$ nd he)to!r&t 9ere #o9er &n
BDL rts tht re!e&'ed s#&ne or #osrtn &n%"s&on e&ther ICV or s"7!"tneo"s#$ CT7#e 1D.
Not7#$0 ICV #osrtn tret)ent d&d not %%e!t *#s) os)o##&t$ &n BDL rts CT7#e 1D.
45
These o7ser't&ons &nd&!te tht ICV #osrtn tret)ent t th&s !on!entrt&on )$ not
%%e!t 'so*ress&n re#ese or the res"#t&n, d&#"t&on# h$*ontre)&. F"rther)ore0 sh)
#&,ted rts &)*#nted 9&th s"7!"tneo"s #osrtn )&n&*")* ,&ned s&,n&%&!nt#$ ,reter
9e&,ht !o)*red to ## other tret)ent ,ro"*s CT7#e 10 *^3.3<D. As res"#t0 ##
)et7o#&! dt 9ere nor)#&Bed to 7od$ 9e&,ht.
Tret)ent 9&th ICV #osrtn *re'ented &n!resed dr&n:&n, 7eh'&or e(h&7&ted 7$
BDL rts CF&,"re <L *^3.3<D. BDL rts tht re!e&'ed s"7!"tneo"s )&n&*")*s !ont&n&n,
the s)e !on!entrt&on o% #osrtn s !ontro# %or *er&*her# !t&ons o% ICV &n%"sed
#osrtn sho9ed no &nh&7&t&on o% dr&n:&n, 7eh'&or or !hn,e o% ren# sod&") e(!ret&on.
These o7ser't&ons &nd&!te tht the CNS 9s the #&:e#$ s&te o% !t&on o% #osrtn. /e #so
d&d not o7t&n e'&den!e tht s"7!"tneo"s #osrtn )od&%&ed the d&sese *ro!ess.
Interest&n,#$0 BDL rts re!e&'&n, ICV &n%"s&on o% 3.EH s#&ne 'eh&!#e sho9ed ,reter
"r&ne o"t*"t !o)*red to sh) n&)#s CF&,"re <D *oss&7#$ d"e to &n!resed 9ter &nt:e
nd *rt&# 'so*ress&n es!*e.
/e d&d not o7ser'e d&%%eren!e &n ren# sod&") e(!ret&on &n BDL rts &n the ICV
or s"7!"tneo"s )&n&*")* tret)ent ,ro"*s CF&,"re ;D. There 9s #so no d&%%eren!e &n
%ood &nt:e 7et9een ## the tret)ent ,ro"*s Cdt not sho9nD.
Losrtn &n%"sed !hron&!##$ &nto the #ter# 'entr&!#es *re'ented the &n!resed o%
AT1R *rote&n e(*ress&on o7ser'ed &n dr", n['e nd 'eh&!#e &n%"sed rts CF&,"re 2D.
/estern 7#ot n#$s&s o% AT1R e(*ress&on &n the OVLT CF&,"re ?AD nd 4nPO CF&,"re
46
?BD o% BDL rts treted 9&th ICV #osrtn d&d no9 sho9 s&,n&%&!nt d&%%eren!e )on,
the tret)ent ,ro"*s.
47
Table 1: Measurements of serum osmolality, hematocrit, protein, liver weight to body
weight ratio, and final body weight from sham (Sham) and bile duct ligated (BDL) rats.
n
Osmolality
(mOsm/kg)
Hematocrit
(%)
Plasma
Protein
(g/dl)
Liver
Wt/Body
Wt
Final
Body
Weight (g)
Sham 11 !" # " $% # 1 &' # !'1
!'! #
!'!! 470 ± 9
B(L 1) "*) # 1+ $$ # 1+ &'$ # !'1
!'!&1 #
!'!!"+ 441 ± 11
Dt re )en ] SE4. _*^3.3< !o)*red to sh) #&,t&on.
48
Table 2: Measurements of serum osmolality, hematocrit, protein, liver weight to body
weight ratio and final body weight from sham (Sham) and bile duct ligated (BDL) rats
that were treated with either vehicle ICV (Veh), losartan ICV (Los), or losartan
subcutaneously (SCLos).
n
Osmolality
(mOsm/kg)
Hematocrit
(%)
Plasma
Protein
(g/dl)
Liver
Wt/Body
Wt
Final Body
Weight (g)
Sham
,eh 1! 303 ± 3 46 ± 1
7.4 ±
0.2
0.029 ±
0.004 437 ± 10†
Sham
Los * 300 ± 2 47 ± 1
7.4 ±
0.2
0.032 ±
0.004 425 ± 12†
Sham
S-Los 1! 304 ± 1 49 ± 1
7.7 ±
0.2
0.032 ±
0.004 482 ± 8
B(L
,eh 1! 293 ± 2* 41 ± 2*
7.6 ±
0.2
0.066 ±
0.004* 408 ± 14†
B(L
Los * 292 ± 3* 42 ± 1*
7.7 ±
0.2
0.068 ±
0.004* 411 ± 8†
B(L
S-Los 1! 297 ± 1† 46 ± 1†
7.5 ±
0.2
0.075 ±
0.004* 426 ± 6†
Dt re )en ] SE4. _*^3.3< !o)*red to ## sh) #&,t&onL `*^3.3< !o)*red to
Sh) SC Los.
49
50
Figure 2: Average daily water intake and urine output
(A) and average daily sodium intake and urinary
sodium excretion (B) from Sham and BDL rats. Values
are normalized to body weight (Kg) and represented as
means ± SEM. *Statistically significant, P<0.014 vs.
Sham. Parentheses indicate the number of animals.
51
Figure 3: Western Blot analysis of AT1R
abundance (A) and RT-qPCR analysis of
AT1aR mRNA (B) from brain punches
containing the SFO of Sham and BDL rats
taken 28 days after BDL surgery. The data
are presented as mean ± SEM relative
protein and mRNA abundance. *
Statistically significant, P<0.05.
Parentheses indicate number of animals.
52
Figure 4: Western Blot analysis of AT1R abundance (top) and RT-qPCR analysis of
AT1aR mRNA (bottom) from brain punches containing the OVLT (A & B) and MnPO
(C & D) of Sham and BDL rats taken 28 days after BDL surgery. The data are presented
as mean ± SEM relative protein and mRNA abundance. *Statistically significant, P<0.05.
Parentheses indicate number of animals.
53
.
v
e
r
a
g
e

(
a
i
l
y

,
o
l
/
m
e

(
m
l



0
g
1
1
)

!
"!
$!
2!
%!
1!!
1"!
H
"
O 3ntake
4rine
*
*
*

*

Figure 5: Average daily water intake and urine output normalized to body weight
(Kg) from Sham and BDL rats treated with either vehicle (Veh), losartan (Los),
or sub-cutaneous losartan (SCLos). Values are means ± SEM. *Statistically
significant, P<0.01 vs. all Sham groups. †Statistically significant, P<0.02 vs. all
BDL groups. Animal numbers are 8-10 for each group.
54
Figure 6: Average daily sodium intake and renal sodium excretion from Sham and
BDL rats treated with either vehicle (Veh), losartan (Los), or sub-cutaneous losartan
(SCLos). Values are means ± SEM. Animal numbers are 8-10 for each group. No
significant differences between groups.
55
Figure 7: Western Blot analysis of AT1R abundance from brain punches
containing the SFO of Sham and BDL rats from each treatment group taken 28
days after BDL surgery. *Statistically significant, P<0.05 vs. all other ICV
groups, #Statistically significant vs. sham ICV groups P<0.05. Numbers within
the bars indicate the number of animals.
56
Figure 8: Western Blot analysis of AT1R expression in brain
punches of the A) OVLT, and B) MnPO of Sham and BDL rats
treated with either vehicle or Losartan ICV taken 28 days after
BDL surgery. Numbers within the bars indicate the number of
animals.
DISCUSSION
The )&n %&nd&n,s o% th&s st"d$ re tht 1D 9ter &nt:e &n!resed &n BDL rts0 1D
BDL &s sso!&ted 9&th &n!resed SFO AT1R *rote&n nd AT1R )RNA0 nd >D &n%"s&on
o% the AT1R nt,on&st #osrtn &nto the 'entr&!#es 7#o!:ed the &n!resed 9ter &nt:e nd
&n!resed 7"ndn!e o% AT1R *rote&n &n the SFO. A !oro##r$ %&nd&n, &s tht ser")
os)o##&t$ 9s not %%e!ted 7$ ICV #osrtn &n%"s&onL 9h&!h s",,est tht !entr#
n,&otens&n s&,n#&n, )$ not *#$ ro#e &n BDL sso!&ted &n**ro*r&te 'so*ress&n
re#ese. T:en to,ether0 these res"#ts &nd&!te tht SFO AT1R e(*ress&on )$ *#$ ro#e
&n the re,"#t&on o% dr&n:&n, 7eh'&or 7"t not the !t&'t&on o% SON ne"rose!retor$ !e##s
&n the !onte(t o% BDL !&rrhos&s.
In *re'&o"s st"d$0 o"r #7 *ro'&ded ,ro"* o% BDL rts 9&th 1H s#&ne to dr&n:
to de!rese PRA 7$ &n!res&n, sod&") de#&'er$ to the d&st# t"7"#e o% the :&dne$
1;2
. Th&s
)n&*"#t&on 9s sso!&ted 9&th s&,n&%&!nt de!rese &n PRA nd !&r!"#t&n,
'so*ress&n !o)*red to BDL rts *ro'&ded on#$ 9&th 9ter
1;2
. These %&nd&n, *ro'&ded
!orre#t&on# e'&den!e tht the ren&n6n,&otens&n s$ste) )$ !ontr&7"te to &n!resed
*#s) 'so*ress&n !on!entrt&ons &n BDL rts. Er#&er &n '&'o st"d&es sho9ed tht
str"!t"res !o)*r&s&n, the #)&n ter)&n#&s !ont&n %"n!t&on# ren&n6n,&otens&n s$ste)
tht e(tends &nto the SON
1;?6121
0 nd &n '&tro e#e!tro*h$s&o#o,&!# st"d&es h'e #so sho9n
tht An, II !n !t *ost6s$n*t&!##$ to !t&'te non6s*e!&%&! !t&on&! !ond"!tn!e to
de*o#r&Be SON ne"rons nd *re6s$n*t&!##$ to %!&#&tte ,#"t)te re#ese . Losrtn
!n !ross the 7#ood67r&n 7rr&er t s"%%&!&ent#$ h&,h !on!entrt&ons to 7#o!: n,&otens&n
57
II 7&nd&n,
1?;
0 ho9e'er 9e d&d not test re!e*tor 7&nd&n, %ter #osrtn d)&n&strt&on.
There%ore 9e !nnot *ro'&de d&re!t &n%or)t&on 7o"t the nto)&!# s*e!&%&!&t$ o% the
o7ser'ed e%%e!ts. C&r!"#t&n, An, II )$ *#$ ro#e &n the !t&'t&n, !&r!")'entr&!"#r
or,n %%erents to the SONL ho9e'er0 the *resent dt &nd&!te tht !entr# n,&otens&n
s&,n#&n, &s not ne!essr$ %or d&#"t&on# h$*ontre)& d"r&n, BDL !&rrhos&s.
S"7!"tneo"s #osrtn 9s "sed to !ontro# %or #e:,e %ro) ICV #osrtn &nto the
*er&*her# !&r!"#t&on. T9o *re'&o"s st"d&es sho9ed tht #osrtn !n #ter the BDL
d&sese *ro!ess 7$ *re'ent&n, the *ro,ress&on o% #&'er %&7ros&s0 *ort# h$*ertens&on nd
h$*erd$n)&! !&r!"#t&on . Th&s st"d$ "sed !on!entrt&on o% Losrtn tht 9s )"!h
s)##er thn the )&n&)") dose tht &s re+"&red to red"!e !&rrhos&s or h$*erd$n)&!
!&r!"#t&on. There%ore0 red"!t&on &n dr&n:&n, 7eh'&or nd tten"t&on o% &n!resed AT1R
o7ser'ed &n BDL rts &s d"e to the !t&on o% #osrtn &n the CNS.
St"d&es o% dr&n:&n, 7eh'&or &n BDL rts h'e re!hed )&(ed !on!#"s&ons. O"r
%&nd&n, tht BDL rts !ons")e )ore 9ter &s !ons&stent 9&th *re'&o"s st"d$ o% rts tht
9ere not ho"sed &n )et7o#&! !,es
1;2
. Ho9e'er0 nother st"d$ sho9ed no d&%%eren!e
7et9een sh) #&,ted nd BDL rt dr&n:&n, 7eh'&ors
12>
. In th&s #tter st"d$0 the rts
9ere ho"sed &n )et7o#&! !,es %or ; d$s 9&tho"t *er&od o% !!#&)t&on d"r&n, 9h&!h
t&)e the rts 9ere ,&'en or# doses o% 9ter 7$ ,str&! ,',e s !ontro# %or #osrtn
dr", d)&n&strt&on. The "se o% ,str&! ,',e )$ h'e &n%#"en!ed 7se#&ne 9ter &nt:e
d"e to stress or the 'o#")e o% %#"&d de#&'ered d&re!t#$ to the ,stro&ntest&n# tr!t.
58
Other st"d&es h'e sho9n tht BDL rts h'e &n!resed sod&") **et&te0 7"t d&d
not %&nd e'&den!e o% &n!resed 9ter &nt:e . It hs #so 7een re*orted tht the &n!rese &n
sod&") &nt:e &s &nde*endent o% the ren&n6n,&otens&n s$ste) . The d&%%eren!es 7et9een
these o7ser't&ons )$ 7e d"e to the d&%%erent rt str&n "sed &n the *re'&o"s 9or: 0 9h&!h
hs 7een sho9n to h'e d&%%erent d&*so,en&! res*ons&'eness to os)ot&! or 7#ood *ress"re
!h##en,es
1?E
.
/h&#e n&)#s nor)##$ re,"#te *#s) os)o##&t$ d"r&n, !"te os)ot&!
!h##en,es thro",h d&%%erent&# 'so*ress&n re#ese to #ter ren# %ree 9ter !#ern!e0
dr&n:&n, 7eh'&or &s nother 9$ tht n&)#s !n re,"#te *#s) os)o##&t$. In the
*h$s&o#o,&!# !onte(t o% *ro,ress&'e#$ de!res&n, *#s) os)o##&t$ sso!&ted 9&th BDL
!&rrhos&s0 &n!resed 9ter &nt:e0 #on, 9&th &n**ro*r&te 'so*ress&n0 !o"#d !ontr&7"te
to h$*ontre)&. T9o !&r!")'entr&!"#r or,ns0 the SFO nd OVLT re &n'o#'ed &n the
!entr# !ontro# o% %#"&d &nt:e re#ted to !hn,es &n *#s) An, II nd )$ *rt&!&*te &n
e#e'ted 9ter &nt:e &n BDL rts. Ho9e'er0 the e%%e!t o% Losrtn on dr&n:&n, 7eh'&or
)$ not 7e s*e!&%&! to SFO AT1Rs 9h&!h 9ere "*re,"#ted &n BDL rts0 nd there%ore the
*re!&se re,&ons nd )o#e!"#r )e!hn&s)s res*ons&7#e %or &n!resed 9ter &nt:e &n BDL
re)&n to 7e deter)&ned.
Fro) o"r n#$s&s o% AT1R e(*ress&on &n the #)&n ter)&n#&s0 9e !on!#"ded tht
BDL &s sso!&ted 9&th n &n!resed 7"ndn!e o% AT1R )RNA nd AT1R *rote&n &n
the SFO o% BDL rts !o)*red to sh) !ontro#s. These dt re s&)&#r to other st"d&es
59
tht sho9ed &n!resed 7"ndn!e o% AT1R &n the SFO o% n&)# )ode#s tht hd e#e'ted
*er&*her# ren&n6n,&otens&n s$ste) !t&'t&on . Nor)##$ re!e*tors do9n6re,"#te 9hen
*resented 9&th n 7"ndn!e o% #&,nd. Ho9e'er0 &n res*onse to e#e'ted !&r!"#t&n, An,
II0 AT1Rs *rdo(&!##$ &n!rese &n 7"ndn!e. Th&s *heno)enon 9s %&rst o7ser'ed &n
st"d&es o% rts de*r&'ed o% 9ter
1@<61@?
nd s*ontneo"s h$*ertens&on rts
1@<61@?
0 7"t hs
s&n!e 7een !on%&r)ed &n the rt )ode# o% !on,est&'e hert %&#"re nd &n s#t6#oded
rodents . Th&s *os&t&'e "tore,"#t&on &s tho",ht to res"#t %ro) the !t&ons o% An, II nd
#dosterone on the SFO. Both An, II nd #dosterone h'e 7een sho9n to &n!rese the
e(*ress&on o% AT1Rs &n !rd&o's!"#r re,"#tor$ n"!#e& 7$ !t&n, thro",h )&to,en6
!t&'ted *rote&n C4APD :&nses . A#dosterone #so "*re,"#tes AT1Rs thro",h the
)&ner#o!ort&!o&d re!e*tor
1E@
*oss&7#$ 7$ !t&n, on the hor)one res*onse e#e)ent &n the
*ro)oter re,&on o% the AT1R ,ene . Other st"d&es "s&n, &ntr!ere7ro'entr&!"#r &n%"sed
An, II nd &n n rt )ode# o% hert %&#"re h'e de)onstrted tht AP610 7"t not 4AP
:&nse0 !t&'t&on 7$ o(&dnt stress &s essent&# %or AT1R "*re,"#t&on &n the rostr#
'entro#ter# )ed"## . In vitro st"d&es o% CATH. ne"rons h'e e(tended those res"#ts 7$
sho9&n, tht An, II e'o:ed "*re,"#t&on o% the AT1R re+"&res se+"ent&# !t&'t&on o%
the trns!r&*t&on %!tors NF6aB0 E#:610 nd !t&'tor *rote&n 1 CAP61D0 9h&!h then 7&nds
to the AP61 s&te &n the AT1R *ro)oter . There%ore0 SFO AT1R "*re,"#t&on &n the BDL
rt )ode# )&,ht 7e e%%e!ted thro",h )"#t&*#e )o#e!"#r *th9$s tht re)&n to 7e
deter)&ned.
60
ICV d)&n&strt&on o% An, II *otent#$ st&)"#tes dr&n:&n, &n rts0 nd the 4nPO
**ers to 7e 7oth ne!essr$ nd s"%%&!&ent %or d&*so,en&! e%%e!t
1>261>E
. Other st"d&es
"t&#&B&n, trns,en&! )&!e h'e sho9n tht the &n!resed *rod"!t&on o% SFO An, II
&n!resed 9ter &nt:e
1@3
0 nd tht !hron&! 7r&n6restr&!ted o'ere(*ress&on o% AT1R
res"#ts &n h&,her 7se#&ne 9ter &nt:e nd n &n!resed 9ter &nt:e res*onse to
e(o,eno"s ICV An, II
1@1
. St"d&es o% s*ontneo"s#$ h$*ertens&'e rts 0 rts de*r&'ed o%
9ter 0 nd rts 9&th !on,est&'e hert %&#"re h'e #so sho9n &n!resed e(*ress&on o%
AT1R &n the SFO0 9h&!h &s sso!&ted 9&th &n!resed 9ter &nt:e 9here )es"red.
T:en to,ether0 these dt s",,est n &)*ortnt ro#e %or !entr# An, II nd es*e!&##$
AT1R &n the re,"#t&on o% 9ter &nt:e 7$ SFO ne"rons *roKe!t&n, to the 4nPO.
A#tho",h the ro#e o% SFO n,&otens&n s&,n#&n, &n st&)"#t&n, dr&n:&n, 7eh'&or hs 7een
9e## des!r&7ed0 !hn,es tht o!!"r &n th&s s$ste) d"r&n, !&rrhos&s h'e not 7een
*re'&o"s#$ re*orted.
Western blot and RT-qPCR analysis of OVLT and MnPO AT1R protein and
mRNA abundance failed to show consistent differences between sham and BDL groups
indicating that increased expression of AT1R in the lamina terminalis of BDL rats is
limited to SFO. There might be an increase in Angiotensin type 1b (AT1b) receptor
subtype, which would be detected in our western blot results due to the lack of specificity
of the antibody; however, AT1aR mRNA in the SFO was also increased. Therefore, it is
likely that the increased AT1R protein abundance in the SFO reflects increased
61
expression of AT1aR. Both AT1a and AT1b receptor subtypes have unique regulatory
functions
1336131
; however both subtypes also share 95% homology in mRNA and amino
acid sequences, and have similar Ang II binding profiles
13>
. It is possible that the
increased drinking behavior we observed may have been due to increased activation of
AT1b receptors. Davisson et al
13@
showed that brain AT1b receptors are important
mediators of drinking behavior due to central administration of Ang II. However, it was
also shown that central AT1aR overexpression increased both baseline and Ang II-
induced drinking behavior
1@1
. Both of these transgenic studies were performed in mice,
and it is possible that the drinking behavior of rats may respond differently to AT1aR
knockdown or silencing. Therefore, future studies that selectively target AT1a and/or
AT1b receptor subtypes in the SFO during BDL, such as with viral-mediated shRNA
knockdown microinjected into the SFO
13<6132
would be very beneficial in further defining
its role in cardiovascular and hydromineral homeostasis.
PERSPECTIVES
/e tested the !ontr&7"t&on o% !entr# n,&otens&n re!e*tors to !hn,es &n 7od$
%#"&d re,"#t&on *rod"!ed 7$ BDL. Res"#ts de)onstrte tht &n!resed 9ter &nt:e
sso!&ted 9&th BDL 9s tten"ted 7$ !hron&! !entr# &n%"s&ons o% #osrtn. In!resed
AT1R e(*ress&on &n the SFO 9s #so 7#o!:ed 7$ ICV #osrtn. In !ontrst0 ICV #osrtn
d&d not *rod"!e n &n!rese &n "r&ne o"t*"t or r&se *#s) os)o##&t$ nd he)to!r&t s
9o"#d 7e e(*e!ted &% AVP re#ese 9ere s&,n&%&!nt#$ de!resed. Th&s s",,ests tht the
62
&nh&7&t&on o% !entr# n,&otens&n re!e*tors &s not s"%%&!&ent to re'erse or de#$ the
de'e#o*)ent o% d&#"t&on# h$*ontre)& *rod"!ed 7$ BDL. Nonethe#ess0 these %&nd&n,s
do he#* &dent&%$ *otent&# ro#e %or SFO AT1Rs &n e(!ess dr&n:&n, d"r&n, #&'er %&#"re.
Better "nderstnd&n, o% ho9 9ter &nt:e nd 'so*ress&n re#ese re re,"#ted 7oth
os)ot&!##$ nd non6os)ot&!##$ !o"#d &n%#"en!e tret)ent *roto!o#s %or d&#"t&on#
h$*ontre)&.
63
CHAPTER >5 ANGIOTENSIN II RECEPTOR SUBTYPE 1A CAT1ARD GENE
KNOCKDO/N IN NEURONS OF THE SUBFORNICAL ORGAN CSFOD
PREVENTS INCREASED DRINKING BEHAVIOR IN BILE DUCT LIGATED
RATS.
A77re'&ted t&t#e5
Authors: -ose*h D /#!h
10 1
0 nd -. Tho)s C"nn&n,h)
1
1
De*rt)ent o% Inte,rt&'e Ph$s&o#o,$0 nd Crd&o's!"#r Reser!h Inst&t"te
Un&'ers&t$ o% North Te(s He#th S!&en!e Centre t Fort /orth0
><33 C)* Bo9&e B#'d
Fort /orth0 TX 2;132
1
De*rt)ent o% Phr)!o#o,$ nd Ne"ros!&en!e
Un&'ers&t$ o% Te(s He#th S!&en!e Center t Sn Anton&o
223> F#o$d C"r# Dr&'e
Sn Anton&o0 TX 2?11E
K#$ %or&s: 'so*ress&n0 AT1R0 dr&n:&n, 7eh'&or0 7&#e d"!t #&,t&on

64
ABSTRACT
B&#e d"!t #&,t&on CBDLD !"ses !on,est&'e #&'er %&#"re tht &n&t&tes
he)od$n)&! !hn,es res"#t&n, &n d&#"t&on# h$*ontre)& *oss&7#$ d"e to &n!resed
9ter &nt:e nd 'so*ress&n re#ese. Th&s *roKe!t tested the h$*othes&s tht n,&otens&n
s&,n#&n, thro",h the s"7%orn&!# or,n CSFOD ",)ents dr&n:&n, 7eh'&or &n BDL rts.
A ,enet&!##$ )od&%&ed deno6sso!&ted '&r"s !ont&n&n, shRNA %or n,&otens&n II
re!e*tor s"7t$*e 1 CAT1RD ,ene 9s )&!ro&nKe!ted &nto the s"7%orn&!# or,n CSFOD o%
rts to :no!:do9n e(*ress&on. T9o 9ee:s #ter0 BDL or sh) s"r,er$ 9s *er%or)ed.
Rts 9ere ho"sed &n )et7o#&! !h)7ers %or )es"re)ent o% %#"&d nd %ood &nt:e nd
"r&ne o"t*"t. The rts 9ere e"thn&Bed 1? d$s %ter BDL s"r,er$ %or n#$s&s. A ,ro"* o%
rts 9s *er%"sed %or &))"noh&sto!he)&!# n#$s&s nd se!ond ,ro"* 9s "sed %or
#ser6!*t"re )&!rod&sse!t&on %or n#$s&s o% SFO AT1Rs ,ene e(*ress&on. BDL rts
sho9ed &n!resed 9ter &nt:e tht 9s tten"ted &n rts tht re!e&'ed SFO
)&!ro&nKe!t&on o% AT1R shRNA CR4 T9o69$ ANOVA %o##o9ed 7$ SNK *ost6ho!0
*^3.3<0 n \ 1161? *er ,ro"*D. A)on, BDL rts treted 9&th s!r)7#ed C!ontro#D nd
AT1R shRNA0 9e o7ser'ed n &n!resed n")7er o% 'so*ress&n *os&t&'e !e##s &n the
s"*ro*t&! n"!#e"s CSOND tht !o#o!#&Bed bFosB st&n&n,. These res"#ts &nd&!te tht
n,&otens&n s&,n#&n, thro",h the SFO !ontr&7"tes to &n!resed 9ter &nt:e0 7"t not
d&#"t&on# h$*ontre)&0 d"r&n, !on,est&'e #&'er %&#"re.
65
INTRODUCTION
H$*ontre)& &s the )ost %re+"ent#$ o!!"rr&n, !#&n&!# e#e!tro#$te d&sorder nd
the nn"# !ost o% tret&n, *t&ents 9&th h$*ontre)& &n the US &s est&)ted to 7e F1.; to
F>.; 7&##&on
13
. H$*ontre)& &s #so sso!&ted 9&th ne,t&'e o"t!o)es &n )n$ !hron&!
d&sese sttes s"!h s !on,est&'e hert %&#"re nd !&rrhos&s. In 7oth #&'er nd hert
%&#"re0 !hn,es &n dr&n:&n, 7eh'&or nd the os)ore,"#t&on o% r,&n&ne 'so*ress&n
CAVPD re#ese %ro) the ne"roh$*o*h$se# s$ste) !ontr&7"te to 9ter retent&on nd
d&#"t&on# h$*ontre)&Gthere7$ &n!res&n, )or7&d&t$ nd )ort#&t$ . Tret)ent 9&th
s*e!&%&! V1 re!e*tor nt,on&sts CV1AD does *rod"!e so#"te6%ree 9ter e(!ret&on nd
&)*ro'ed *#s) os)o##&t$ &n 7oth hert %&#"re nd !&rrhos&s
1E6>1
L ho9e'er0 there &s
e'&den!e tht &n!resed dr&n:&n, 7eh'&or %ro) d&sese nd *oss&7#$ s s&de6e%%e!t o%
V1A tret)ent #so %%e!ts )ort#&t$ ndAor re6hos*&t#&Bt&on .
C&r!"#t&n, #e'e#s o% AVP nd o($to!&n re *r&)r&#$ deter)&ned 7$ the !t&'&t$ o%
),no!e##"#r ne"rose!retor$ !e##s o% the s"*ro*t&! CSOND nd *r'entr&!"#r CPVND
n"!#e& o% the h$*oth#)"s tht *roKe!t to the *oster&or *&t"&tr$. The !t&'&t$ o% these
!e##s &s re,"#ted 7$ e(tr!e##"#r os)o##&t$0 nd 7$ ne"ron# *roKe!t&ons tht res*ond to
!hn,es &n *#s) os)o##&t$0 7#ood *ress"re0 7#ood 'o#")e0 nd !&r!"#t&n, hor)ones .
In!resed ne"roh")or# !t&'t&on sso!&ted 9&th !&rrhos&s hs 7een ttr&7"ted to
s$ste)&! h$*otens&on nd h$*erd$n)&! !&r!"#tor$ s$ndro)e . H$*erd$n)&!
!&r!"#tor$ s$ndro)e &s #so re*orted to !t&'te the ren&n6n,&otens&n s$ste) d"r&n,
he*t&! !&rrhos&s 9h&!h 9o"#d 7e !ons&stent 9&th the trd&t&on# '&e9 tht non6os)ot&!
66
%!tors &nd"!e the d&#"t&on# h$*ontre)& sso!&ted 9&th th&s d&sese stte 7$
st&)"#t&n, the re#ese o% 'so*ress&n des*&te *ro,ress&'e *#s) h$*ontre)& .
In!resed !&r!"#t&n, n,&otens&n II CAn, IID &s one %!tor tht !o"#d !ontr&7"te to
s$)*tho6e(!&tt&on0 &n!resed AVP re#ese nd e#e'ted %#"&d &nt:e 7$ !t&n, on CNS
!&r!")'entr&!"#r or,ns .
The #)&n ter)&n#&s !ont&ns t9o !&r!")'entr&!"#r or,ns5 the or,n")
's!"#os") o% the #)&n ter)&n#&s COVLTD nd the s"7%orn&!# or,n CSFOD. Ne"rons
9&th&n these "n&+"e %ore7r&n re,&ons #!: %"n!t&on# 7#ood 7r&n 7rr&er 0 9h&!h ##o9s
these str"!t"res to 7e sens&t&'e to !&r!"#t&n, %!tors s"!h s *#s) os)o##&t$ nd An, II
12<
. The OVLT nd SFO 7oth *roKe!t to the )ed&n *reo*t&! n"!#e"s C4nPOD0 9h&!h &s n
&)*ortnt &nte,rt&'e !enter %or h$dro)&ner# nd !rd&o's!"#r re,"#t&on. An,&otens&n
II t$*e 1 re!e*tor CAT1RD e(*ress&on &s dense#$ #o!#&Bed to these n"!#e& 0 nd the #e'e# o%
AT1R e(*ress&on &n these re,&ons )$ 7e n &)*ortnt e(!&ttor$ &n*"t tht #so
)od"#tes the res*ons&'eness o% the 7r&n n,&otens&n s$ste) &n re,"#t&n, 7od$ %#"&d
ho)eosts&s.
Chron&! 7&#e d"!t #&,t&on CBDLD &n the rt &s !o))on#$ "sed )ode# o% he*t&!
!&rrhos&s . As &n the h")n !ond&t&on0 these rts h'e e#e'ted !&r!"#t&n, 'so*ress&n nd
&n!resed dr&n:&n, 7eh'&or !!o)*n&ed 7$ s&,n&%&!nt#$ de!resed *#s) os)o##&t$0
&n!resed *#s) ren&n !t&'&t$0 nd h$*er'o#e)&! s!&tes %or)t&on
1;2
. Pre'&o"s#$0 9e
&n%"sed #osrtn !hron&!##$ &nto the #ter# 'entr&!#es o% the 7r&ns o% !ontro# nd BDL
rts to test e%%e!ts o% AT1R 7#o!:de on 9ter &nt:e nd %o"nd tht !entr# AT1R
67
7#o!:de res"#ted &n tten"t&on o% the &n!resed 9ter &nt:e sso!&ted BDL CCh*ter
1D. Th&s &nd&!tes n &)*ortnt ro#e %or AT1Rs &n re,"#t&n, %#"&d &nt:e &n BDL.
Ho9e'er0 the *re!&se ne"r# nd )o#e!"#r %!tors tht %%e!t the resett&n, o% the th&rst
nd AVP os)ot&! set6*o&nts d"r&n, hert or #&'er %&#"re re)&n "ndeter)&ned.
S$n*t&! !t&'t&on o% 'so*ress&n ne"rons &n the h$*oth#)"s &s sso!&ted 9&th
&n!resed e(*ress&on o% Fos nd Fos6re#ted *rote&ns. The e(*ress&on o% Fos hs 7een
"sed to )* re,&ons o% the CNS tht re !t&'ted %o##o9&n, !"te *h$s&o#o,&!# nd
s"*r*h$s&o#o,&!# st&)"#t&on . There%ore0 *rt o% th&s st"d$ 9&## e()&ne e(*ress&on o%
FosB &n SON to !hr!ter&Be !t&'t&on o% ),no!e##"#r ne"rose!retor$ !e##s d"r&n,
BDL nd 9&th &nKe!t&on o% ne"rotro*h&! deno6sso!&ted '&r# CAAVD 'e!tor !ont&n&n,
shRNA ,&nst AT1Rs.
The *"r*ose o% th&s st"d$ 9s to e'#"te the ro#e o% SFO AT1Rs &n re,"#t&n,
dr&n:&n, 7eh'&or nd SON AVP ne"r# !t&'t&on. In!resed e(*ress&on o% AT1R &n the
SFO o% !&rrhot&! rts !o"#d re*resent !e##"#r d*tt&on tht !ontr&7"tes to &n!resed
dr&n:&n, 7eh'&or nd SON !t&'t&on. /e h$*othes&Be tht :no!:do9n o% AT1R &n the
SFO 9&## tten"te dr&n:&n, 7eh'&or &n BDL rts nd de!rese SON !t&'t&on. Th&s
h$*othes&s 9s tested 7$ "s&n, n AAV6shRNA trnsd"!t&on 'e!tor ,&nst An,&otens&n
t$*e 1 re!e*tors CAT1RsD to &nh&7&t the o7ser'ed "*re,"#t&on o% AT1R e(*ress&on
d"r&n, BDL. /e #so )es"red *#s) e#e!tro#$te )es"re)ents nd bFosB st&n&n, to
e'#"te !hn,es &n ne"roh")or# !t&'t&on sso!&ted 9&th BDL nd AAV6shRNA
tret)ent.
68
MATERIALS AND METHODS
ANIMALS
E(*er&)ents 9ere !ond"!ted on d"#t )#e S*r,"e6D9#e$ rts C1<3Q><3,0
Chr#es R&'er L7ortor&es0 In!.0 /&#)&n,ton0 4A0 USAD. Rts 9ere &nd&'&d"##$ ho"sed
nd )&nt&ned &n te)*ert"re6!ontro##ed C1>RCD en'&ron)ent "nder 11A11h #&,ht
!$!#e 9&th #&,ht onset t 3233h. Rts hd ad libitum !!ess to %ood nd 9ter e(!e*t
d"r&n, the s"r,&!# *ro!ed"res. A## e(*er&)ent# *ro!ed"res 9ere !ond"!ted &n
!!ordn!e 9&th the ,"&de#&nes o% the P"7#&! He#th Ser'&!e nd 9ere **ro'ed 7$ the
Un&'ers&t$ o% North Te(s He#th S!&en!e Centre Inst&t"t&on# An&)# Cre nd Use
Co))&ttee.
BILE DUCT LIGATION MODEL OF HEPATIC CIRRHOSIS
E!h n&)# 9s nesthet&Bed 9&th &so%#"rne C1H &n o($,enD. A%ter %"##$
nesthet&Bed0 the 7do)en 9s sh'ed nd the re 9s !#ened 9&th &od&ne nt&se*t&!. A
)&d#&ne &n!&s&on 9s *er%or)ed on the 7do)en nd the !o))on 7&#e d"!t 9s &so#ted
7$ 7#"nt d&sse!t&on nd !"t 7et9een t9o #&,t"res. E!h n&)# 9s then ret"rned to
!,e nd )on&tored d&#$ "nt&# "sed %or the e(*er&)ent. V&s"# &ns*e!t&on o% s!&t&! %#"&d
&n the *er&tone# !'&t$ 9s *er%or)ed d&#$ %ter s"r,er$. An$ rt sho9&n, )or7&d&t$
Ce.,.0 %&#"re to thr&'e0 s&,n&%&!nt de!rese &n %ood or 9ter &nt:eD 9s e"thn&Bed 9&th
th&o7"t7r7&t# CIn!t&nS0 S&,)0 St. Lo"&s0 4OL 133 ),A:, &.*.D. Sh) #&,ted !ontro#s
9ere s"7Ke!ted to the s)e s"r,&!# *ro!ed"re 9&th the e(!e*t&on tht the 7&#e d"!t 9s
69
not #&,ted or !"t. A## rts %ro) e!h e(*er&)ent# s"7,ro"* 9ere e"thn&Bed @ 9ee:s C1?
d$sD %ter BDL or sh) s"r,er$ %or !o##e!t&on o% 7r&n nd 7#ood s)*#es. L&'er %&7ros&s
9s o7ser'ed &n s"!!ess%"# 7&#e d"!t #&,ted n&)#s. L&'erA7od$ 9e&,ht rt&o 9s "sed to
'er&%$ the de'e#o*)ent o% he*t&! !&rrhos&s. Three rts 9ere e"thn&Bed %ter s"r,er$ d"e
to &##ness. The n")7er o% re)&n&n, n&)#s &n e!h e(*er&)ent &s ,&'en &n T7#e 1.
VIRALLY MEDIATED AT"A RECEPTOR MRNA INTERFERENCE
Stereot(&! s"r,er$ 9s "sed to &nKe!t re!o)7&nnt deno6sso!&ted '&r"s CrAAVD
!ont&n&n, e&ther s!r)7#ed shRNA CshRNA6SC4D0 or shRNA ,&nst AT1 re!e*tor
CshRNA6AT1D. The &nKe!t&on 'o#")e 9s 3.> P# o% 1.1 ( 13
11
,eno)&! *rt&!#esA)#
CGeneDete!t0 Brdenton0 FLD. E!h rt 9s nesthet&Bed 9&th &so%#"rne nd *#!ed &n
stereot(&! **rt"s. To tr,et SFO0 >3 ,",e &nKe!tors or&ented 'ert&!##$ 9ere
d'n!ed to 61.13 )) Cnter&orA*oster&orD0 3.33 )) C)&d#&neD re#t&'e to the Bre,)0 nd
6@.13 )) Cdors#A'entr#D re#t&'e to the to* o% the )&ds,&t# s&n"s. E!h !onstr"!t 9s
&nKe!ted &n the SFO t 'o#")e o% 3.> P# o'er 13 )&n"te *er&od. F&'e )&n"tes
there%ter0 &nKe!tors 9ere then re)o'ed nd the s!#* &n!&s&on !#osed 9&th s"t"res.
METABOLIC CAGES
To )es"re 9ter &nt:e0 %ood &nt:e0 nd "r&ne o"t*"t0 n&)#s 9ere ho"sed &n
)et7o#&! !,es CL7 Prod"!ts In!.0 Se%ord0 DED strt&n, on the 1?
th
d$ %ter BDL or
sh) s"r,er$. The )et7o#&! !,e *roto!o# !ons&sted o% 13 d$s nd *ro!eeded s
*re'&o"s#$ des!r&7ed CCh*ter 1D.
70
PLASMA MEASUREMENTS
Tr"n: 7#ood 9s !o##e!ted &nto 1.< )# )&!ro!entr&%",e t"7e. T9o he*r&n6
!ont&n&n, !*&##r$ t"7es 9ere %&##ed 9&th 7#ood %ro) th&s s)*#e %or )es"r&n,
he)to!r&t. The rest o% the s)*#e 9s !entr&%",ed C< )&nL 130333X,D nd 133 P#
s)*#e o% ser") 9s re)o'ed %or )es"r&n, os)o##&t$ "s&n, '*or *ress"re
os)o)eter C/es!or In!. Lo,n0 UTD0 nd sod&") !on!entrt&on "s&n, %#)e
*hoto)eter C-en9$ PFP20 V/R Internt&on#0 Rdnor0 PAD. Ser") *rote&n 9s
)es"red 7$ re%r!to)eter$ Cnt&on# Proto)eter0 Nt&on# Instr")ents0 B#t&)ore0 4DD.
'FOSB IMMUNOHISTOCHEMISTRY
Se*rte ,ro"*s o% sh) #&,ted AAV6GFP6SC4 &nKe!ted Cn \ ED0 sh) #&,ted
AAV6GFP6sh6AT1 &nKe!ted Cn \ 13D0 BDL AAV6GFP6SC4 &nKe!ted Cn \ 2D0 nd BDL
AAV6GFP6sh6AT1 &nKe!ted Cn \ ?D rts 9ere "sed &n &))"noh&sto!he)&str$ st"d&es to
deter)&ne the e%%e!ts o% SFO AT1 re!e*tor :no!:do9n nd BDL on bFosB st&n&n, &n
the SON. Fo"r 9ee:s C1? d$sD %ter BDL or sh) #&,t&on s"r,er$0 rts 9ere
nesthet&Bed 9&th th&o7"t7r7&t# CIn!t&n0 133 ),A:, &.*.D nd *er%"sed trns!rd&##$
9&th <36133 )# o% PBS %o##o9ed 7$ >336@33 )# o% @H *r%or)#deh$de &n PBS %or
&))"noh&sto!he)&str$ s *re'&o"s#$ des!r&7ed
11<
. The des!end&n, ort nd 'en !'
9ere !#)*ed 7e#o9 the hert 9&th he)ostts nd e!h #&'er 9s re)o'ed nd 9e&,hed.
A#ternt&n, sets o% %ort$ T) !oron# se!t&ons !ont&n&n, the SON 9ere *ro!essed
%or FosB C,ot nt&6FosB C131D0 s!6@?6G Snt Cr"B B&ote!hno#o,$0 Snt Cr"B0 CAL
71
15<333D0 'so*ress&n C*o#$!#on# ,"&ne *&, nt&6CAr,?D6Vso*ress&n0 Pen&ns"#
L7ortor&es0 Sn Cr#os0 CAL 15<33D0 nd o($to!&n C)ono!#on# )o"se nt&6o($to!&n0
4AB<1E;0 4&##&*ore0 B&##er&!0 4AL 15<333D &))"noh&sto!he)&str$. The *r&)r$ FosB
nt&7od$ "sed &n th&s st"d$ does not d&s!r&)&nte 7et9een bFosB nd %"## #en,th FosB
nd 9&## 7e re%erred to s bFosB st&n&n, &n the te(t. A%ter &n!"7t&on &n the nt&6FosB
nt&7od$ %or 21 h t @UC0 se!t&ons 9ere r&nsed nd &n!"7ted 9&th 7&ot&n6!onK",ted horse
nt&6,ot I,G C15133L Ve!tor L7ortor&es0 Ber#&n,)e0 CAD0 n '&d&n6*ero(&dse
!onK",te CVe!tst&n ABC K&tL Ve!tor L7ortor&esD0 nd PBS !ont&n&n, 3.3@H >0>JQ
d&)&no7enB&d&ne h$dro!h#or&de nd 3.3@H n&!:e# ))on&") s"#%te s *re'&o"s#$
des!r&7ed
11<
. Ne(t0 the se!t&ons 9ere &n!"7ted 9&th 7oth the 'so*ress&n C,"&ne *&, nt&6
'so*ress&n0 B!he)D nd o($to!&n C)o"se nt&6o($to!&n0 4&##&*oreD nt&7od&es %or 21 h
t @UC %o##o9ed 7$ r&ns&n, nd &n!"7t&on 9&th se!ondr$ nt&7od&es !onK",ted to
e&ther C$1 or C$> Cdon:e$ nt&6,"&ne *&, C$> nd Don:e$ nt&6)o"se C$10 151<3L
-!:son I))"noReser!h0 /est Gro'e0 PAD.
CONFOCAL IMAGING AND !UANTIFICATION OF IMMUNOHISTOCHEMISTRY
Se!t&ons 9ere e()&ned "s&n, n O#$)*"s IX61 DSU !on%o!# )&!ros!o*e
e+"&**ed %or e*&%#"ores!en!e 9&th the **ro*r&te e(!&tt&onAe)&ss&on %&#ter sets %or
&),&n, bFosB0 AVP nd OXY *os&t&'e !e##s &n the SON. I),es 9ere !*t"red "s&n,
Ret&,6SRV !)er Cc6&),&n,0 S"rre$0 Br&t&sh Co#")7&0 CndD. Br&n res 9ere
&dent&%&ed "s&n, P(&nos nd /tson
1?1
. Se!t&ons !ont&n&n, the SON #o!ted 63.?3 )) to
72
61.?3 )) *oster&or to 7re,) 9ere n#$Bed %or bFosB0 AVP nd OXY !e## n")7ers nd
!o#o!#&Bt&on.
LASER CAPTURE MICRODISSECTION
A se*rte set o% n&)#s !o)*r&sed o% the s)e %o"r tret)ent ,ro"*s 9s "sed
%or the #ser !*t"re )&!rod&sse!t&on st"d&es0 Cn \ < %or ## %o"r ,ro"*sD. E!h rt 9s
nesthet&Bed 9&th In!t&n C133 ),A:, &.*.D nd +"&!:#$ de!*&tted1? d$s %ter BDL or
sh) #&,t&on s"r,er$. Br&ns 9ere re)o'ed nd &))ed&te#$ sn* %roBen &n dr$6&!e
!oo#ed &so*entne. Ser&# !oron# se!t&ons C13 T)D thro",h SFO 9ere !"t "s&n, !r$ostt
CC41E<3 Le!& 4&!ros$ste)s0 B"%%#o Gro'e0 ILD. These se!t&ons 9ere )o"nted onto
PEN )e)7rne !oted s#&des CLC43<116 Ar!t"r"s B&os!&en!e0 4o"nt&n V&e90 CAD
9&th 16> %ore7r&n se!t&ons on the )e)7rne *rt o% s#&de. These s#&des 9ere then stored
&n 6?3UC "nt&# %"rther *ro!ess&n,.
E!h s#&de 9s %&(ed &n &!e !o#d 133H )ethno# s *re'&o"s#$ des!r&7ed
11;
. A##
re,ents 9ere *re*red 9&th DEPC69ter nd !ont&ned RNAse &nh&7&tors. An Ar!t"r"s
Ver&ts 4&!rod&sse!t&on &nstr")ent0 e+"&**ed 9&th &n%rred !*t"re nd "#tr'&o#et !"tt&n,
#sers0 9s "sed to #ser !*t"re s&n,#e SFO o% e!h n&)#. RNA 9s e(tr!ted nd
*"r&%&ed %ro) e!h s)*#e "s&n, >3T# o% Arr$P"re Nno6S!#e L$s&s So#"t&on 9&th <.3
T, o% *rote&nse K nd Arr$P"re Nno6S!#e RNA P"r&%&!t&on K&t re,ents CE*&!entre
B&ote!hno#o,$0 4d&son0 /ID. The +"#&t$ o% e!h RNA s)*#e 9s e'#"ted "s&n,
Nnodro* S*e!tro*hoto)eter to )es"re RNA !ontent nd &dent&%$ !ont)&nt&on.
73
S)*#es $&e#d&n, #ess thn 13 n,AT# RNA ndAor 1;3A1?3 rt&o #o9er thn 1.? 9ere not
"sed %or )*#&%&!t&on. A 1Q1 T# #&+"ot o% !e##"#r RNA %ro) e!h s)*#e 9s )*#&%&ed
9&th Tr,etA)* 16Ro"nd A)&no##$#6RNA A)*#&%&!t&on K&t )ter&#s CE*&!entre
B&ote!hno#o,$D0 &n !!ordn!e 9&th the )n"%!t"rerJs &nstr"!t&ons s *re'&o"s#$
des!r&7ed.
!UANTITATIVE REAL-TIME PCR
Less thn <3 n, o% the s$nthes&Bed )&no##$#6RNA %ro) e!h s)*#e 9s
re'erse6trns!r&7ed to !DNA 9&th Sens&s!r&*t RT K&t re,ents C*rod. no.13<11>L c&,en
In!.0 V#en!&0 CA0 USAD s *re'&o"s#$ des!r&7ed
11;
. For9rd nd re'erse *r&)ers %or
tr,et ,enes CT7#e >D 9ere o7t&ned %ro) Inte,rted DNA Te!hno#o,&es CCor#'&##e0 IAD.
For *o#$)erse !h&n re!t&on0 s)*#es !ons&sted o% 1T# o% !DNA0 ?.>T# o% RNse d
DNse6%ree 9ter0 1T# o% e!h *r&)er0 nd 11.<T# o% &c SYBR Green S"*er)&( C*rod. no.
1236???3L B&o6RdD. PCR re!t&ons 9ere *er%or)ed &n B&o6Rd &cT4< &C$!#er
s$ste)0 9&th the %o##o9&n, !$!#&! *r)eters5 &n&t&# dent"rt&on t E< RC %or > )&n0
%o##o9ed 7$ <3 !$!#es o% 1.12 )&n e!h C13 s t E<RC0 %o##o9ed 7$ 1)t t << RC %or
AT1R nd GAPDHD. No6te)*#te nd 6RT !ontro#s 9ere *er%or)ed %or e!h n#$s&s.
The ho"se:ee*&n, ,ene0 GAPDH0 9s "sed %or nor)#&Bt&on o% )RNA e(*ress&on. 4e#t
!"r'es ,enerted 9ere n#$Bed to &dent&%$ nons*e!&%&! *rod"!ts nd *r&)er6d&)ers.
74
!UANTIFICATION AND ANALYSIS OF PCR RESULTS
Dt 9ere *#otted !ross !$!#es %or dete!ted %#"ores!en!e 7o'e the 7!:,ro"nd
s&,n#. The ( !oord&nte t the thresho#d o% )*#&%&!t&on 9s des&,nted the Ct nd "sed
s )es"re o% )RNA +"nt&tt&on. To '#&dte s)*#e '&7&#&t$0 the s#o*e o% #&ne
tn,ent&# to the &n%#e!t&on *o&nt %or e!h s)*#e 9s !o)*red nd s)*#es 9&th s#o*e
'#"es de'&t&n, )ore thn <H %ro) the )en 9ere d&s!rded. The re#t&'e e(*ress&on o%
GAPDH )RNA 9s "sed %or nor)#&Bt&on. Dt 9ere n#$Bed 7$ the 1
6ZZCT
)ethod.
EPERIMENTAL PROTOCOL
There 9ere %o"r se*rte rndo)#$ ##o!ted ,ro"*s "sed %or )et7o#&s) !,e
st"d&es5 AAV6GFP6SC4 sh) #&,ted Cn \ 11DL AAV6GFP6SC4 BDL Cn \ 11DL AAV6
GFP6sh6AT1 sh) #&,ted Cn \ 1?D0 nd AAV6GFP6sh6AT1 BDL Cn \ 1;D. Stereot(&!
s"r,er$ 9s *er%or)ed t9o 9ee:s *r&or to sh) #&,t&on or BDL s"r,er$ to ##o9 %or
re!o'er$. Rts 9ere )o'ed &nto )et7o#&! !,es %or )es"re)ent o% d&#$ %ood &nt:e0
9ter &nt:e0 nd "r&ne o"t*"t on the 1?
th
d$ %ter sh) #&,t&on or BDL s"r,er$ s
des!r&7ed 7o'e C4et7o#&! C,esD. At the end o% the e(*er&)ent0 e!h rt 9s
nesthet&Bed 9&th In!t&n C133 ),A:, &.*.D nd *er%"sed %or &))"noh&sto!he)&str$. A 16>
)# 7#ood s)*#e 9s t:en 7$ !rd&! *"n!t"re 7e%ore e!h *er%"s&on %or )es"r&n,
*#s) os)o##&t$0 sod&")0 he)to!r&t0 nd *#s) *rote&n s des!r&7ed 7o'e. E!h rtJs
#&'er 9s re)o'ed nd 9e&,hed s des!r&7ed 7o'e. The 7r&n %ro) e!h rt 9s
*ro!essed %or 'so*ress&n nd o($to!&n &))"noh&sto!he)&str$ "s&n, C$>6 nd C$16
!onK",ted se!ondr$ nt&7od$ res*e!t&'e#$ s des!r&7ed 7o'e. Se!t&ons !ont&n&n, the
75
SFO 9ere n#$Bed %or GFP "s&n, n e*&%#"ores!en!e )&!ros!o*$ to deter)&ne #o!t&on
o% the &nKe!t&on s&tes nd trnsd"!t&on o% SFO ne"rons. A se*rte set o% rts %ro) e!h o%
the %o"r ,ro"*s Cn###BOT_TEXT###lt;0 e!h ,ro"*D 9s *ro!essed %or #ser !*t"re )&!rod&sse!t&on s
des!r&7ed 7o'e.
STATISTICAL ANALYSIS
A## res"#ts re *resented s )ens ] SE4. D&#$ 9ter nd %ood &nt:e0 "r&ne0 nd
sod&") !on!entrt&on '#"es0 9ere n#$Bed "s&n, t9o69$ re*eted )es"res ANOVA.
Post6ho! n#$s&s o% s&,n&%&!nt )&n e%%e!ts 9s !rr&ed o"t "s&n, St"dent Ne9)nQ
Ke"#s *ost6ho! test CS&,)*#ot0 Sn -ose0 CAD. Other dt 9ere n#$Bed 7$ t9o69$
n#$s&s o% 'r&n!e. S&,n&%&!n!e 9s set t P ^ 3.3<.
76
RESULTS
CHARACTERI(ATION OF BDL EPERIMENTAL MODEL AND PLASMA MEASUREMENTS
P#s) s)*#es %ro) sh) !ontro#s nd BDL rts 9ere "sed to )es"re *#s)
os)o##&t$0 ser") sod&")0 nd he)to!r&t. A## BDL rts o% e!h tret)ent ,ro"*
e(h&7&ted s&,n&%&!nt#$ #o9er *#s) os)o##&t$ C*^3.31D !o)*red to sh) !ontro#
n&)#s o% the s)e ,ro"* CT7#e @D. Not7#$0 AAV6AT1R6shRNA )&!ro&nKe!t&on &nto
the SFO %&#ed to %%e!t *#s) os)o##&t$ &n BDL rts. Th&s o7ser't&on &nd&!tes tht
SFO AT1R s&,n#&n, )$ not 7e &n'o#'ed &n the *"tt&'e &n**ro*r&te re#ese o%
'so*ress&n or the !on!o)&tnt d&#"t&on# h$*ontre)& tht 9e o7ser'e &n BDL rts.
S&)&#r#$0 *#s) he)to!r&t 9s #so s&,n&%&!nt#$ de!resed &n BDL !o)*red to sh)
#&,ted rts C*^3.310 's. ## sh) ,ro"*sD. Chn,es &n *#s) os)o##&t$ nd he)to!r&t
re not d"e to !hn,es &n *rote&n s s",,ested 7$ the %&#"re to dete!t d&%%eren!es &n
*#s) *rote&n )es"re)ents. Co)*red to sh)0 BDL rts tht !o)*#eted the
e(*er&)ent d&s*#$ed K"nd&!e 9&th e#e'ted ser") 7&#&r"7&n0 he*tos*#eno)e,#$0 nd
de'e#o*ed !&rrhot&! #&'er s e'#"ted 7$ ,ross '&s"# e()&nt&on nd s&,n&%&!nt#$
&n!resed #&'er69e&,ht6to67od$69e&,ht rt&os C*^3.331D. The res"#ts de)onstrte e%%e!t&'e
&nd"!t&on o% #&'er %&#"re nd d&#"t&on# h$*ontre)& &n BDL rts tht 9ere not %%e!ted
7$ &nKe!t&on o% the AAV6AT1R shRNA trnsd"!t&on 'e!tor.
77
AT"AR SHRNA VIRAL TRANSDUCTION AND GENE KNOCKDOWN
S"!!ess%"# '&r# de#&'er$ o% the AAV6GFP6shRNA ,ene e(*ress&on !ssette 9s
'er&%&ed 7$ !on%o!# )&!ros!o*$ &n ## n&)#s CF&,"re ED. AAV6shRNA 'e!tors !ont&ned
,reen %#"ores!ent *rote&n CGFPD tht %"n!t&oned s )r:er to &nd&!te the s&te o%
de#&'er$ nd !e##s %%e!ted. S&( 9ee:s %ter d&re!t SFO )&!ro&nKe!t&on o% AAV6shRNA
!ontro# nd AT1R 'e!tors0 9e o7ser'ed ro7"st GFP e(*ress&on &n the SFO CF&,"re ED.
GFP *os&t&'e !e##s 9ere #so o7ser'ed &n the re s"rro"nd&n, the SFO0 not7#$ dors# to
the SFO nd o!!s&on##$ #on, the &nKe!tor tr!:s. A## rts &n!#"ded &n the st"d$
!ont&ned GFP #7e#&n, &n the SFO. Se'en n&)#s 9ere e(!#"ded %ro) the st"d$ d"e to
&nKe!t&on s&tes tht 9ere too dors# to *rod"!e GFP #7e#&n, &n the SFO. To e'#"te
e%%e!t&'eness o% AAV6AT1R6shRNA trnsd"!t&on to :no!:do9n AT1R e(*ress&on0 13
P) 7r&n s#&!e se!t&ons !ont&n&n, the SFO 9ere "sed %or #ser )&!rod&sse!t&on o% the
SFO nd n#$s&s o% AT1R )RNA 7"ndn!e 7$ RT6+PCR. AT1R )RNA 7"ndn!e
9s s&,n&%&!nt#$ &n!resed &n the SFO o% BDL rts treted 9&th the !ontro# shRNA
!onstr"!t !o)*red to sh) #&,ted n&)#s &nKe!ted 9&th e&ther the AAV6SC4 or AAV6
AT1R shRNA '&r# trnsd"!t&on 'e!tors CF&,"re 13L *^3.31D. SFOs %ro) BDL n&)#s
&nKe!ted 9&th the AT1R6shRNA !ont&ned s&,n&%&!nt#$ #ess AT1R )RNA 7"ndn!e
!o)*red to BDL n&)#s re!e&'&n, the !ontro# AAV6SC4 shRNA CF&,"re 13L *.31>0
BDL SC4 's. BDL sh6AT1D. Th"s0 )&!ro&nKe!t&on o% the AAV6AT1R shRNA
trnsd"!t&on 'e!tor e%%e!t&'e#$ *re'ented the &n!resed AT1R )RNA e(*ress&on
o7ser'ed &n BDL rts.
78
FLUID INTAKE AND RENAL SODIUM ECRETION
There 9s no s&,n&%&!nt !hn,e &n dr&n:&n, 7eh'&or or ren# sod&") e(!ret&on
7et9een sh) n&)#s treted 9&th e&ther the !ontro# SC4 shRNA or the AT1R shRNA.
/e o7ser'ed s&,n&%&!nt &n!rese &n 'er,e d&#$ 9ter !ons")*t&on o% BDL rts
&nKe!ted 9&th the !ontro# shRNA !o)*red to sh) #&,ted n&)#s treted 9&th 7oth
!ontro# nd AT1R shRNA trnsd"!t&on 'e!tors CF&,"re 11L *^3.3<0 T9o69$ re*eted
)es"res ANOVAD. Th&s &n!resed d&#$ dr&n:&n, 7eh'&or 9s tten"ted to sh) #e'e#s
7$ &nKe!t&on o% AT1R shRNA &nto SFO CF&,"re 11L BDL SC4 's. BDL sh6AT10
*^3.3<D. There%ore0 :no!:do9n o% SFO AT1R )RNA e(*ress&on &s sso!&ted 9&th
nor)#&Bt&on o% dr&n:&n, 7eh'&or &n BDL rts. Interest&n,#$0 BDL n&)#s &nKe!ted 9&th
AAV6SC4 shRNA sho9ed ,reter "r&ne 'o#")e o"t*"t !o)*red to sh) n&)#s
CF&,"re 11D *oss&7#$ d"e to *rt&# 'so*ress&n ndAor #dosterone es!*e #on, 9&th the
&n!resed 9ter &nt:e. Ho9e'er0 9ter 7#n!e 7et9een the t9o BDL n&)# ,ro"*s 9s
not d&%%erent CBDL SC45 12.; ] 1.> )# :,
61
d$
61
's. BDL sh6AT15 12.< ] 1.@ )# :,
61
d$
61
D.
/e o7ser'ed de!resed ren# sod&") e(!ret&on &n BDL n&)#s &nKe!ted 9&th the
AAV6shAT1R trnsd"!t&on !onstr"!t !o)*red to 7oth sh) #&,ted tret)ent ,ro"*s
CF&,"re 11L *^3.3<D. /e d&d not o7ser'e n$ d&%%eren!e &n ren# sod&") e(!ret&on
7et9een BDL n&)#s &nKe!ted 9&th the !ontro# AAV6SC4 trnsd"!t&on 'e!tor nd sh)
#&,ted n&)#s o% 7oth '&r# 'e!tor tret)ent ,ro"*s CF&,"re 11D. There 9s no
s&,n&%&!nt d&%%eren!e &n %ood &nt:e 7et9een ## the tret)ent ,ro"*s Cdt not sho9nD or
79
!onse+"ent#$ &n sod&") &nt:e CF&,"re 11D. Both BDL n&)# ,ro"*s #so sho9ed n
&n!resed sod&") 7#n!e CF&,"re 1>L BDL shAT15 *^3.3< !o)*red to 7oth sh)
,ro"*sL BDL SC45 *^3.3< !o)*red to sh) SC4D.
'FOSB IN THE SON OF BDL RATS
BDL &n!resed bFosB st&n&n, nd !o#o!#&Bt&on o% bFosB 9&th 'so*ress&n &n
the SON CF&,"re 1@D. The n")7ers o% bFosB *os&t&'e !e##s &n the SON 9s s&,n&%&!nt#$
&n!resed @ 9ee:s %ter BDL &n 7oth '&r# tret)ent ,ro"*s !o)*red to 7oth sh)
#&,ted !ontro#s CF&,"res 1@ = 1<D. F"rther)ore0 9e o7ser'ed &n!resed n")7ers o%
bFosB *os&t&'e !e##s &n the SON o% BDL shAT1 n&)#s !o)*red to BDL SC4
n&)#s CF&,"res 1@ = 1;D. /e #so o7ser'ed s&,n&%&!nt &nde*endent )&n e%%e!t o%
7oth BDL nd '&r"s tret)ents on the n")7ers o% 'so*ress&n *os&t&'e !e##s &n the SON
&nd&!t&n, tht BDL nd '&r"s tret)ent re &nde*endent#$ sso!&ted 9&th n &n!rese o%
th&s !e## t$*e Csh)5 @?.2 ] 1.2 's. BDL5 <;.1 ] 1.EL F\?.>;0 *^3.31L SC45 <2.3 ] 1.E 's.
shAT15 @2.E ] 1.?L F1.@<0 *^3.31D. A#tho",h 9e %&#ed to %&nd s&,n&%&!nt
&nter!t&on 7et9een BDL nd the 'e!tor tret)ent "s&n, t9o69$ ANOVA0 the n")7ers
o% 'so*ress&n *os&t&'e !e##s &n!resed 9&th BDL s"r,er$ nd de!resed 9&th shAT1
'&r# :no!:do9n CF&,"re 1@ = 1;D. In 7oth BDL '&r"s tret)ent ,ro"*s0 9e o7ser'ed
&n!resed n")7ers o% bFosB nd 'so*ress&n do"7#e6#7e#ed !e##s !o)*red to 7oth sh)
tret)ent ,ro"*s CF&,"res 1@ = 12D. In BDL rts treted 9&th the !ontro# AAV6SC4 or
the AAV6AT1 shRNA trnsd"!t&on 'e!tor0 ;1H nd <<H res*e!t&'e#$ o% the bFosB
80
*os&t&'e !e##s #so 9ere 'so*ress&n6*os&t&'e !o)*red to @2H nd >EH &n sh) #&,ted
!ontro#s &nKe!ted 9&th the AAV6SC4 or AAV6AT1 shRNA0 res*e!t&'e#$.
The res"#ts o7t&ned %ro) o($to!&n nd bFosB &))"noh&sto!he)&str$ re sho9n
&n F&,"res 1?613. /e o7ser'ed n &n!resed n")7er o% !e##s 9&th !o6#o!#&Bt&on o%
bFosB nd o($to!&n &n the SON. The n")7er o% o($to!&n *os&t&'e !e##s 9s s&)&#r &n ##
tret)ent ,ro"*s. In BDL rts treted 9&th !ontro# AAV6SC4 or the AAV6AT1 shRNA0
1EH nd >EH res*e!t&'e#$ o% the bFosB *os&t&'e !e##s #so 9ere o($to!&n *os&t&'e s
!o)*red to @3H nd @<H &n sh) #&,ted !ontro#s &nKe!ted 9&th the AAV6SC4 or AAV6
AT1 shRNA0 res*e!t&'e#$. In!resed *er!ent,e o% bFosB *os&t&'e !e##s tht !o#o!#&Bed
9&th o($to!&n &n sh) #&,ted rts !o)*red to BDL &s d"e to the s&,n&%&!nt#$ de!resed
n")7ers o% bFosB &n sh) #&,ted rts.
81
82
AT1 %or9rd5 <J6TTCTCAATCTCGCCTTGGCTGACT6>J
AT1 re'erse5 <J6AAGGAACACACTGGCGTAGAGGTT6>J
GAPDH %or9rd5 <J6CTCATGACCACAGTCCATGC6>J
GAPDH re'erse5 <J6TACATTGGGGGTAGGAACAC6>J
Table 3: RT-qPCR primer sequences Table 3: RT-qPCR primer sequences
Table 4: Measurements of serum osmolality, hematocrit, protein, and liver weight to
body weight ratio in sham (Sham) and bile duct ligated (BDL) rats injected with a viral
construct containing either a scrambled control shRNA (SCM) or a shRNA targeted to
AT1aR (sh-AT1a).
n
Osmolality
(mOsm/kg)
Ser/m
Sodi/m
(m56/L)
Hematocrit
(%)
Plasma
Protein
(g/dl)
Liver
Wt/Body
Wt
Body
Weight
at
(eath
Sham
S-7
1" 308 ± 1
166 ±
5
48 ± 1
7.6 ±
0.1
0.035 ±
0.002
484 ±
19
Sham
sh1
.81a
1% 304 ± 1
161 ±
4
48 ± 1
7.7 ±
0.1
0.031 ±
0.001
495 ±
9
B(L
S-7
1" 302 ± 1†
153 ±
4†
44 ± 1**
7.7 ±
0.1
0.070 ±
0.002*
470 ±
8
B(L
sh1
.81a
12 300 ± 1*
146 ±
3*
44 ± 1*
7.7 ±
0.1
0.075 ±
0.004*
458 ±
13
83
Dt re )en ] SE4. _*^3.31 !o)*red to sh) ,ro"*s. `*^3.3< !o)*red to Sh) SC4 ,ro"*
84
A
B
Figure 9: Representative digital images of the SFO
expressing green fluorescent protein from a rat injected
with the viral transduction construct containing either
AAV-GFP-SCM shRNA (A) or AAV-GFP-AT1a
shRNA (B) into the SFO. Scale bar is 50 µm.
"
1


-
t
!
"
$
2
*
Figure 10: RT-qPCR analysis of AT1aR mRNA from a laser microdissected SFO nucleus
from Sham and BDL rats injected with either a scrambled AAV-shRNA (SCM) or an
AAV-shRNA targeted to AT1a gene (sh-AT1a) into the SFO. The data are presented as
mean ± SEM relative mRNA levels as calculated by the 2
-∆∆CT
method. *Statistically
significant, p<0.05 vs. all other groups. Animal numbers are n=5 for each group.
85
.
v
e
r
a
g
e

(
a
i
l
y

,
o
l
/
m
e

(
m
l



0
g
1
1
)

!
"!
$!
2!
%!
1!!
1"!
"$ h H
"
O 3ntake
"$ h 4rine
*
*
Figure 11: Average daily water intake and urine output from Sham and BDL rats injected
with either a scrambled control AAV-shRNA (SCM) or an AAV-shRNA targeted to
AT1a gene (sh-AT1a) into the SFO. Values are means ± SEM. *Statistically significant,
Two-way repeated measures ANOVA with post-hoc interaction test (SNK) P<0.05 vs. all
other groups. Animal numbers range from 12-18 for each group.
86
.
v
e
r
a
g
e

(
a
i
l
y

S
o
d
i
/
m

(
m
5
6



0
g
1
1
)
!
"
$
2
%
1! "$ h 3ntake
"$ h 59cretion
*
Figure 12: Average daily sodium intake and renal sodium excretion from Sham and BDL
rats injected with either a scrambled AAV-shRNA (SCM) or an AAV-shRNA targeted to
AT1a gene (sh-AT1a) into the SFO. Values are means ± SEM. *Statistically significant,
p<0.05 vs. sham groups. Two-way repeated measures ANOVA with post-hoc interaction
test (SNK). Animal numbers are 12-18 for each group.
87
S
h
a
m

S
-
7
S
h
a
m

s
h
1
.
8
1
a
B
(
L

S
-
7
B
(
L

s
h
1
.
8
1
a
.
v
e
r
a
g
e

(
a
i
l
y

S
o
d
i
/
m
B
a
l
a
n
c
e

(
m
5
6



0
g
1
1
)
!
1
"

$
*

Figure 13: Average daily sodium balance from Sham and BDL rats injected with either a
scrambled AAV-shRNA (SCM) or an AAV-shRNA targeted to AT1a gene (sh-AT1a)
into the SFO. Values are means ± SEM. *Statistically significant, p<0.01 vs. sham
groups. †Statistically significant, p<0.05 vs. sham SCM group. Statistical analysis was by
two-way repeated measures ANOVA with post-hoc interaction test (SNK). Animal
numbers are 12-18 for each group.
88
.
v
e
r
a
g
e

:
/
m
;
e
r
s

o
<

-
e
l
l
s
/
S
e
c
t
i
o
n
!
"!
$!
2!
%!
FosB
AVP
FosB + AVP


*
*
*

Figure 14: Effects of bile duct ligation and AAV-GFP-AT1a shRNA injection into the
SFO on the numbers of cells stained for ∆FosB, vasopressin (AVP) and colocalized
∆FosB and vasopressin in the supraoptic nucleus of rats in the several treatment groups.
*Significantly different from sham groups p<0.001. †Significantly different from all
other groups p<0.01. Animal numbers range from 7-9 for each group.
89
90
Figure 15: Representative digital images of ∆FosB/FosB staining of the supraoptic
nucleus from a sham ligated control (A & B) and a bile duct ligated rat (C & D) injected
with either a viral construct containing scrambled control shRNA (left column) or a viral
construct containing the AT1aR shRNA (right column). Scale bar is 50 µm for each
image. Abbreviations: ot, optic tract; SON, supraoptic nucleus.
Figure 16: Representative digital images of vasopressin immunofluorescence of the
supraoptic nucleus from a sham ligated control (A & B) and a bile duct ligated rat (C &
D) injected with either a viral construct containing scrambled control shRNA (left
column) or a viral construct containing the AT1aR shRNA (right column). Scale bar is 50
µm for each image. Abbreviations: ot, optic tract; SON, supraoptic nucleus.
91
92
93
Figure 17: Representative digital images of vasopressin immunofluorescence (red)
merged with pseudocolored ∆FosB/FosB staining (green) of the supraoptic nucleus from
a sham ligated control (A & B) and a bile duct ligated rat (C & D) injected with either a
viral construct containing scrambled control shRNA (left column) or a viral construct
containing the AT1aR shRNA (right column). Scale bar is 50 µm for each image.
S
h
a
m
S
-
7
S
h
a
m
s
h
1
.
8
1
a
B
(
L
S
-
7
B
(
L
s
h
1
.
8
1
a
.
v
e
r
a
g
e

:
/
m
;
e
r
s

o
<

-
e
l
l
s
/
S
e
c
t
i
o
n
!
"!
$!
2!
%!
FosB
OXY
FosB + OXY


*

*
*
Figure 18: Effects of bile duct ligation and AAV-GFP-AT1a-shRNA injection into the
SFO on the numbers of cells stained for ∆FosB, oxytocin (OXY) and colocalized ∆FosB
and oxytocin in the supraoptic nucleus of rats in the several treatment groups.
*Significantly different from sham groups p<0.001. †Significantly different from all
other groups p<0.01. Animal numbers range from 7-9 for each group.
94
Figure 19: Representative digital images of oxytocin immunofluorescence of the
supraoptic nucleus from a sham ligated control (A & B) and a bile duct ligated rat (C &
D) injected with either a viral construct containing scrambled control shRNA (left
column) or a viral construct containing the AT1aR shRNA (right column). Scale bar is
50 µm for each image. Abbreviations: ot, optic tract; SON, supraoptic nucleus.
95
96
Figure 20: Representative digital images of Oxytocin immunofluorescence (blue) merged
with pseudocolored ∆FosB/FosB staining (green) of the supraoptic nucleus from a sham
ligated control (A & B) and a bile duct ligated rat (C & D) injected with either a viral
construct containing scrambled control shRNA (left column) or a viral construct
containing the AT1aR shRNA (right column). Scale bar is 50 µm for each image.
97
98
99
DISCUSSION
The )&n %&nd&n,s o% th&s st"d$ re tht 1D the :no!:do9n o% SFO AT1Rs 7$
&nKe!t&on o% AAV6GFP6AT1 shRNA *re'ented the &n!resed dr&n:&n, res*onse seen &n
BDL0 1D InKe!t&on o% AAV6GFP6AT1 shRNA res"#ted &n )ore *rono"n!ed &n!rese &n
bFosB !e## !o"nts &n BDL n&)#s0 s 9e## s &n!resed bFosBAAVP !o#o!#&Bt&on &n
7oth BDL ,ro"*s 7o'e 7oth sh) #&,ted ,ro"*s0 nd >D there 9s de!resed ren#
sod&") e(!ret&on nd #o9er ser") os)o##&t$ nd sod&") &n BDL rts &nKe!ted 9&th the
AAV6AT1 shRNA !o)*red to sh) tret)ent ,ro"*s des*&te de!resed 9ter &nt:e.
Pers&stent d&#"t&on# h$*ontre)& &n the *resen!e o% &n!resed sod&") 7#n!e o% BDL
rts treted 9&th AAV6AT1 shRNA )$ 7e d"e to "ndete!ted ,stro&ntest&n# sod&")
#oss. Interest&n,#$0 des*&te de!resed dr&n:&n, 7eh'&or0 9ter 7#n!e 9s no d&%%erent
7et9een the BDL rt ,ro"*s.
An,&otens&n II !n *ro)ote AVP se!ret&on 7$ 7oth )"#t&s$n*t&! )e!hn&s)
thro",h AT1Rs &n the SFO0 nd s d&re!t ne"r# e%%erent %ro) the SFO !t&n, '& AT1Rs
&n the SON. F"rther)ore0 &n res*onse to de!resed 7#ood *ress"re or *er%"s&on0
n,&otens&n s&,n#&n, !n 7e *otent&ted thro",h the !t&ons o% 7oth n,&otens&n II nd
#dosterone &n SFO. Both n,&otens&n II nd #dosterone h'e 7een sho9n to &n!rese the
e(*ress&on o% AT1Rs &n !rd&o's!"#r re,"#tor$ n"!#e& 7$ !t&n, thro",h )&to,en6
!t&'ted *rote&n :&nses. A#dosterone #so "*re,"#tes AT1Rs thro",h the
)&ner#o!ort&!o&d re!e*tor
1E@
*oss&7#$ 7$ !t&n, on the hor)one res*onse e#e)ent &n the
*ro)oter re,&on o% the AT1R ,ene. A *re'&o"s st"d$ tht "sed #osrtn &n%"s&on &nto the
100
#ter# 'entr&!#es to 7#o!: !entr# AT1Rs %&#ed to )&t&,te the de!resed *#s)
os)o##&t$ sso!&ted 9&th BDL CCh*ter 1D. In tht e(*er&)ent0 ho9e'er0 7&nd&n, st"d&es
9ere not *er%or)ed to !on%&r) tht #osrtn !rossed the CSF6!&r!")'entr&!"#r or,n
7rr&er to 7#o!: AT1Rs &n the SFO. There%ore0 ne"r# !t&'t&on o% SON AVP se!ret&on
thro",h )e!hn&s) tht &n!#"ded n,&otens&n s&,n#&n, t the #e'e# o% the SFO !o"#d
not 7e r"#ed o"t. In *re'&o"s e(*er&)ent0 o"r #7 *ro'&ded ,ro"* o% BDL rts 9&th 1H
s#&ne to dr&n: to de!rese PRA
1;2
7$ &n!res&n, sod&") de#&'er$ to the d&st# t"7"#e o%
the :&dne$. Th&s )n&*"#t&on 9s sso!&ted 9&th s&,n&%&!nt de!rese &n PRA nd
!&r!"#t&n, 'so*ress&n !o)*red to BDL rts *ro'&ded on#$ 9&th 9ter
1;2
. Th&s %&nd&n,
*ro'&ded !orre#t&on# e'&den!e tht the ren&n6n,&otens&n s$ste) )$ !ontr&7"te to
&n!resed *#s) 'so*ress&n !on!entrt&ons &n BDL rts. One &ntr&,"&n, %&nd&n, o% th&s
st"d$ &s the o7ser't&on tht &nKe!t&on o% the AAV6AT1 shRNA d&d not *re'ent the
red"!t&on o% *#s) os)o##&t$ sso!&ted 9&th BDL. Th&s s",,ests tht the *ro,ress&on
o% d&#"t&on# h$*ontre)& &s not de*endent on AT1R !t&'t&on &n the SFO.
In *re'&o"s st"d$ 9e o7ser'ed tht rts 9&th BDL de)onstrted &n!resed AT1R
*rote&n nd )RNA e(*ress&on &n the SFO0 nd #so hd s&,n&%&!nt#$ ,reter 9ter &nt:e
!o)*re to sh) #&,ted rts. Bsed on these o7ser't&ons0 9e e)*#o$ed ne"rotro*h&!
AAV6AT1R shRNA trnsd"!t&on 'e!tor &n order to deter)&ne &% &n!resed e(*ress&on o%
AT1R &n the SFO !ontr&7"tes to the !hn,es &n dr&n:&n, 7eh'&or sso!&ted 9&th BDL.
Pre'&o"s st"d&es "s&n, th&s 'e!tor h'e sho9n tht &ts e%%e!ts re *r&)r&#$ ne"rotro*h&!
nd &t re#&7#$ :no!:s do9n AT1R e(*ress&on 9&th&n 11 d$s nd *ers&sts %or )ore thn
101
<3 d$s
13<6132
. E'en tho",h &t 9s on#$ re!ent#$ de'e#o*ed0 the "se o% shRNA to &nd"!e
st7#e nd #o!#&Bed :no!:do9n AT1R e(*ress&on &n ne"rons o% the CNS hs e)er,ed s
*o9er%"# too# to de!&*her the )o#e!"#r )e!hn&s)s &n'o#'ed &n the ne"r# !ontro# o%
7#ood *ress"re nd 7od$ %#"&d ho)eosts&s. There%ore0 9e "sed the s)e **ro!h to test
the h$*othes&s tht AT1Rs &n the SFO )$ 7e &n'o#'ed &n the !entr# )od"#t&on o%
dr&n:&n, 7eh'&or. D'&sson et #
13@
sho9ed tht 7r&n AT17 re!e*tors re &)*ortnt
)ed&tors o% dr&n:&n, 7eh'&or d"e to !entr# d)&n&strt&on o% An, II. Ho9e'er0 &t 9s
#so sho9n tht !entr# AT1R o'ere(*ress&on &n!resed 7oth 7se#&ne nd An, II6
&nd"!ed dr&n:&n, 7eh'&or
1@1
. Both o% these trns,en&! st"d&es 9ere *er%or)ed &n )&!e0
nd &t &s *oss&7#e tht the dr&n:&n, 7eh'&or o% rts )$ res*ond d&%%erent#$ to AT17R
:no!:do9n or s&#en!&n,. There%ore0 st"d&es 9h&!h &n!#"de :no!:do9n o% AT17R !n 7e
he#*%"# to %"rther &dent&%$ the ro#e tht these re!e*tors *#$ &n dr&n:&n, 7eh'&or.
BDL rts &nKe!ted 9&th the !ontro# AAV6SC4 !onstr"!t drn: s&,n&%&!nt#$ )ore
9ter des*&te #o9er thn nor)# *#s) os)o##&t&es s *re'&o"s#$ re*orted
218
. Other
st"d&es h'e sho9n tht 9h&#e BDL rts h'e &n!resed sod&") **et&te0 the$ d&d not %&nd
e'&den!e o% &n!resed 9ter &nt:e0 nd tht the &n!rese &n sod&") &nt:e &s &nde*endent
o% the ren&n6n,&otens&n s$ste) . The d&%%eren!es 7et9een these o7ser't&ons )$ 7e d"e
to the d&%%erent str&n o% n&)# "sed &n the *re'&o"s 9or: 0 9h&!h hs 7een sho9n to h'e
d&%%erent d&*so,en&! res*ons&'eness to os)ot&! or 7#ood *ress"re !h##en,es
1?E
. Rts tht
9ere sh) #&,ted hd trend to9rds &n!resed 7od$ 9e&,ht t the end o% the
e(*er&)ent0 nd there%ore 9e nor)#&Bed ## )et7o#&! dt to 7od$ 9e&,ht. /e d&d not
102
%&nd n$ s&,n&%&!nt d&%%eren!es &n %ood &nt:e0 nd 9e d&d not )es"re n&)# !t&'&t$
#e'e#s.
/h&#e n&)#s nor)##$ re,"#te *#s) os)o##&t$ d"r&n, !"te os)ot&!
!h##en,es thro",h d&%%erent&# 'so*ress&n re#ese to #ter ren# %ree 9ter !#ern!e0
%#"&d &nt:e &s "#t&)te#$ needed %or !ont&n"ed re,"#t&on o% *#s) os)o##&t$. As
res"#t0 7od$ %#"&d nd e#e!tro#$te 7#n!e &s deter)&ned 7$ the &nter!t&on o% *h$s&o#o,&!#
nd 7eh'&or# e%%e!tor s$ste)s. In the *h$s&o#o,&!# !onte(t o% *ro,ress&'e#$ de!res&n,
*#s) os)o##&t$ sso!&ted 9&th BDL !&rrhos&s0 &n!resed 9ter &nt:e0 #on, 9&th
&n**ro*r&te 'so*ress&n re#ese0 !o"#d !ontr&7"te to d&#"t&on# h$*ontre)&. T9o
!&r!")'entr&!"#r or,ns0 the SFO nd OVLT re &n'o#'ed &n the !entr# !ontro# o% %#"&d
&nt:e re#ted to !hn,es &n *#s) An, II .
A *re'&o"s st"d$ %ro) o"r #7 re*orted the sso!&t&on 7et9een BDL0 &n!resed
dr&n:&n, 7eh'&or nd &n!resed e(*ress&on o% AT1R *rote&n nd )RNA &n the SFO
CCh*ter 1D. These dt re s&)&#r to other st"d&es tht sho9ed &n!resed 7"ndn!e o%
AT1R &n the SFO o% n&)# )ode#s tht hd e#e'ted *er&*her# ren&n6n,&otens&n s$ste)
!t&'t&on . Both the &n!resed e(*ress&on o% AT1R nd 9ter &nt:e 9ere nor)#&Bed 7$
!hron&! &n%"s&on o% #osrtn &nto the 'entr&!#es o% BDL rts. Be!"se #osrtn 9s &n%"sed
&nto the !ere7ro'entr&!"#r s$ste)0 ho9e'er0 d&re!t &n%or)t&on 7o"t the nto)&!#
s*e!&%&!&t$ o% the o7ser'ed e%%e!ts !o"#d not 7e ddressed.
103
Intr!ere7ro'entr&!"#r CICVD d)&n&strt&on o% An, II *otent#$ st&)"#tes
dr&n:&n, &n rts0 nd the 4nPO **ers to 7e 7oth ne!essr$ nd s"%%&!&ent %or the
d&*so,en&! e%%e!t o% !entr# An, II
1>261>E
. Other st"d&es "t&#&B&n, trns,en&! )&!e h'e
sho9n tht the &n!resed *rod"!t&on o% SFO An, II &n!resed 9ter &nt:e
1@3
0 nd tht
!hron&! 7r&n6restr&!ted o'ere(*ress&on o% AT1R res"#ts &n h&,her 7se#&ne 9ter &nt:e
nd n &n!resed 9ter &nt:e res*onse to e(o,eno"s ICV An, II
1@1
. St"d&es o%
s*ontneo"s#$ h$*ertens&'e rts 0 rts de*r&'ed o% 9ter 0 nd rts 9&th !on,est&'e hert
%&#"re h'e #so sho9n &n!resed e(*ress&on o% AT1R &n the SFO0 9h&!h 9ere
sso!&ted 9&th &n!resed 9ter &nt:e 9here )es"red. T:en to,ether0 these dt
s",,est SFO AT1Rs re &)*ortnt )ed&tors o% the &n!resed 9ter &nt:e des*&te
de!resed *#s) os)o##&t$ d"r&n, BDL &nd"!ed #&'er !&rrhos&s &n rts.
In!resed ren# sod&") retent&on &s 9e## des!r&7ed &n 7oth h")ns nd n&)#
)ode#s o% !&rrhos&s
11E6111
. Ho9e'er0 ren# sod&") retent&on &s not s"%%&!&ent to *re'ent the
*ro,ress&on o% d&#"t&on# h$*ontre)&. The )e!hn&s) 7$ 9h&!h sod&") &s ret&ned &n
!&rrhos&s &s #&:e#$ d"e to 7oth !t&ons o% n,&otens&n t the *ro(&)# t"7"#e nd
#dosterone on the d&st# t"7"#e
1136111
. In!resed ren# sod&") retent&on !ontr&7"tes to
s!&tes %or)t&on nd s&,n#s 9orsen&n, *ro,nos&s %or *t&ents 9&th !&rrhos&s
11>
. /e
!on%&r)ed th&s sso!&t&on 7et9een !&rrhos&s nd de!resed ren# sod&") e(!ret&on. BDL
n&)#s e(h&7&ted s&,n&%&!nt#$ &n!resed sod&") 7#n!e !o)*red to sh) #&,ted
n&)#s o% the s)e '&r"s tret)ent ,ro"*. InKe!t&on o% the AAV6GFP6AT1R shRNA hd
no net %%e!t on ren# sod&") e(!ret&on %or e&ther sh) or BDL n&)#s. BDL n&)#s
104
treted 9&th the AAV6GFP6AT1R shRNA drn: s&,n&%&!nt#$ #ess 9ter 9&tho"t
!on!o)&tnt &n!rese &n *#s) os)o##&t$ or ser") sod&") des*&te s&,n&%&!nt &n!rese
&n ren# sod&") retent&on. Th&s &s res"#t o% the %&#"re o% the :&dne$s to e(!rete d&#"te
"r&ne s de)onstrted 7$ the o7ser't&on tht there 9s no d&%%eren!e &n the 9ter
7#n!e 7et9een the BDL '&r# tret)ent ,ro"*s. T:en to,ether0 th&s !on%&r)s *re'&o"s
o7ser't&ons tht0 des*&te the o7ser'ed &n!rese &n ren# sod&") retent&on0 &ns&d&o"s
so#"te6%ree 9ter retent&onG*res")7#$ d"e to the !t&ons o% &n!resed !&r!"#t&n, AVP
G&s the )&n deter)&nnt o% d&#"t&on# h$*ontre)& &n the !onte(t o% BDL !&rrhos&s.
InKe!t&on o% AAV6GFP6AT1R shRNA %&#ed to %%e!t d&#"t&on# h$*ontre)& des*&te
#ter&n, the BDL n&)#Js 9ter &nt:e.
Rts 9&th BDL de)onstrted &n!resed bFosB st&n&n, &n AVP ne"rons o% the
SON. BDL #so &n!resed bFosB st&n&n, &n o($to!&n SON ne"rons. /e d&d o7ser'e
&n!resed AVP !e## !o"nts &n BDL n&)#s treted 9&th the !ontro# SC4 '&# !onstr"!tL
ho9e'er 9e d&d not o7ser'e n &n!rese &n the n")7ers o% AVP *os&t&'e !e##s &n BDL rts
treted 9&th the AAV6AT1R shRNA or o($to!&n *os&t&'e !e##s &n n$ tret)ent ,ro"*.
Th&s &s !ons&stent 9&th re!ent st"d$ o% 7oth BDL
112
nd he*t&! &s!he)&6re*er%"s&on
11@
)ode#s tht re*orted trns#t&on# !t&'t&on o% AVP &n SON ne"rons. A#tho",h
)Kor&t$ o% the bFosB *os&t&'e SON ne"rons &n BDL rts **er to 7e 'so*ress&ner,&!0
!t&'t&on o% o($to!&n ne"rons 9s #so e'&dent. AVP nd O($to!&n re re#esed %ro)
d&%%erent *o*"#t&ons o% ),no!e##"#r ne"rose!retor$ !e##s C4NCsD0 9h&!h de)onstrte
d&%%erent e#e!tro*h$s&o#o,&!# !hr!ter&st&!s. AVP ne"rons re &ntr&ns&!##$
105
os)osens&t&'e0 nd #so res*ond to )n&%o#d *h$s&o#o,&!# !"es s"!h s !hn,es &n 7#ood
*ress"re nd 7#ood 'o#")e. O($to!&n ne"rons res*ond to %%erent &n*"ts r&s&n, %ro)
s"!:#&n, nd d"r&n, *rt"r&t&on
1>1
0 ho9e'er &ts ro#e &n the re,"#t&on o% 9ter nd
e#e!tro#$te 7#n!e re)&ns "n!#er.
S$n*t&! or os)ot&! !t&'t&on o% AVP ne"rons &n the h$*oth#)"s &s sso!&ted
9&th &n!resed e(*ress&on o% bFosB0 n AP61 trns!r&*t&on %!tor tht hs 7een sho9n to
*#$ !r&t&!# ro#e &n the d*tt&on o% ne"r# net9or:s tht re,"#te s$)*thet&! o"t%#o9
d"r&n, deh$drt&on
1>@
. There%ore0 &n!resed e(*ress&on o% bFosB &n 'so*ress&n6*os&t&'e
SON ne"rons o% !&rrhot&! rts !o"#d 7e )ore thn )r:er o% !t&'t&on0 7"t !o"#d
)ed&te !e##"#r d*tt&ons 9h&!h !ontr&7"te to &n!resed 'so*ress&n re#ese. O"r
res"#ts de)onstrte bFosB !e## !o"nt *ro%&#es re &n!resed &n BDL rts treted 9&th
AAV6AT1R shRNA. Se'er# st"d&es h'e de)onstrted d&%%eren!es 7et9een the t9o
*r&n!&*#e !e## t$*es &n the SON5 o($to!&n nd AVP ),no!e##"#r !e##s. One de%&n&n,
!hr!ter&st&! o% these !e##s &s the se#e!t&'e e(*ress&on o% e&ther o($to!&n or AVP
1><
. A
th&rd *henot$*e o% ne"ron hs 7een des!r&7ed tht e(*resses 7oth o($to!&n nd AVP0
9h&!h res*onds d&%%erent#$ to *h$s&o#o,&!# !h##en,es s"!h !hn,es &n *#s)
os)o##&t$. A#so0 there re )"#t&*#e *o*"#t&ons &n SON tht h'e d&%%erent
e#e!tro*h$s&o#o,&!# !hr!ter&st&!s. In!resed bFosB !e## !o"nts &n BDL rts treted 9&th
AAV6AT1R shRNA )$ res"#t %ro) th&s th&rd ),no!e##"#r *henot$*e tht re!e&'e
&n*"t %ro) SFO ne"rons %%e!ted 7$ the ,ene :no!:do9n. F"rther)ore0 the ss$ )$
not 7e sens&t&'e to the #o9er #e'e#s o% AVP or o($to!&n *e*t&des tht h'e 7een sho9n to
106
7e e(*ressed 7$ th&s th&rd *henot$*e o% !e## res"#t&n, &n no d&%%eren!e 7et9een the
n")7ers o% bFosB !e##s tht !o#o!#&Bed 9&th 7oth AVP nd o($to!&n. F"rther st"d&es re
needed to &dent&%$ the !hn,es &n ne"ro!he)&!# !t&'t&on o% d&%%erent *henot$*&!#
*o*"#t&ons o% ),no!e##"#r !e##s &n BDL nd the ne"r# e%%erents &n'o#'ed.
The ro#e o% c-fos nd Fos re#ted *rote&ns &n the re,"#t&on o% AVP nd o($to!&n
,ene e(*ress&on re)&ns !ontro'ers&#
1><
. Re!ent st"d&es h'e s",,ested tht the rt AVP
,ene *ro)oter !ont&ns %"n!t&on# AP1 re,"#tor$ s&te
1@3
nd tht c-fos ,ene e(*ress&on
nd AVP hnRNA e(*ress&on &n 7oth SON nd PVN re s&,n&%&!nt#$ !orre#ted 9&th
!hn,es &n *#s) os)o##&t$
1>>
. Ho9e'er0 d&re!t SON &nKe!t&ons o% *"tt&'e
ne"rotrns)&tter ,on&sts *rod"!ed d&%%erent&# e%%e!ts on c-fos )RNA nd 'so*ress&n
hnRNA e(*ress&on
1>1
. The %&#"re to o7ser'e !on!"rrent &n!reses &n c-fos nd
'so*ress&n hnRNA e(*ress&on #ed the "thors to s",,est the &nd"!t&on o% these ,enes
%o##o9&n, !"te os)ot&! st&)"#t&on #&:e#$ &n'o#'es d&%%erent )e!hn&s)s. It &s *oss&7#e
tht other do9nstre) tr,ets o% bFosB s"!h s trns&ent re!e*tor *otent&# 'n&##o&d
CTRPVD !hnne#s or !hn,es &n s$n*t&! %"n!t&on re &n'o#'ed &n the s"st&ned !t&'t&on
ndAor hor)one re#ese tht res"#ts &n d&#"t&on# h$*ontre)&.
C&r!"#t&n, o($to!&n !n !ontr&7"te to h$*ontre)& d"e to &ts str"!t"r# s&)&#r&t$ to
'so*ress&n nd &ts 7&#&t$ to st&)"#te ren# 'so*ress&n re!e*tors. In *re'&o"s st"d$0
e(*er&)ent# !&rrhos&s &n the rt 9s not sso!&ted 9&th &n!resed o($to!&n ,ene
e(*ress&on &n the h$*oth#)"s0 #tho",h the st"d$ "sed d&%%erent )ode# o% !&rrhos&s
>?
.
/e d&d not o7ser'e s&,n&%&!nt &n!rese &n the n")7ers o% o($to!&n *os&t&'e ne"rones
107
%o##o9&n, BDL &n the !"rrent st"d$ or &n *re'&o"s *"7#&!t&ons . Pre'&o"s#$ 9e sho9ed
tht &nh&7&t&on o% bFosB 9&th do)&nnt ne,t&'e deno6sso!&ted '&r# !onstr"!t
res"#ted &n d&"res&s nd tten"t&on o% d&#"t&on# h$*ontre)&
112
. S&n!e 9e d&d not
d&re!t#$ )es"re *#s) 'so*ress&n or o($to!&n0 dd&t&on# e(*er&)ents 9&## 7e re+"&red
to deter)&ne the !ontr&7"t&on o% 'so*ress&n nd o($to!&n to nt&6d&"res&s d"r&n, BDL.
PERSPECTIVES
/e tested the !ontr&7"t&on o% SFO AT1 re!e*tors to the !hn,es &n 7od$ %#"&d
re,"#t&on *rod"!ed 7$ BDL. The res"#ts de)onstrte tht &n!resed 9ter &nt:e
sso!&ted 9&th BDL 9s tten"ted 7$ :no!:do9n o% AT1 re!e*tors &n the SFO. In
!ontrst0 :no!:do9n o% AT1Rs d&d not &n!rese "r&ne o"t*"t or r&se *#s) os)o##&t$
nd he)to!r&t s 9o"#d 7e e(*e!ted &% AVP re#ese 9ere s&,n&%&!nt#$ de!resed. Th&s
s",,ests tht *re'ent&n, the "*re,"#t&on o% SFO AT1 re!e*tors &s not s"%%&!&ent to
re'erse or de#$ the de'e#o*)ent o% d&#"t&on# h$*ontre)& *rod"!ed 7$ BDL. bFosB
st"d&es o% the *"tt&'e ne"r# !t&'&t$ &n the SON %"rther !on%&r) the o7ser't&on tht
SFO AT1Rs do not s&,n&%&!nt#$ !ontr&7"te to d&#"t&on# h$*ontre)& d"r&n, th&s
d&sese stte. Nonethe#ess0 these %&nd&n,s do he#* &dent&%$ *otent&# ro#e %or SFO AT1Rs
&n e(!ess dr&n:&n, d"r&n, #&'er %&#"re. Better "nderstnd&n, o% the !entr# )e!hn&s)s
tht re,"#te 9ter &nt:e nd 'so*ress&n re#ese thro",h os)ot&! nd non6os)ot&!
)od#&t&es )$ ss&st &n the de'e#o*)ent o% tret)ent *roto!o#s %or d&#"t&on#
h$*ontre)&. F"t"re e(*er&)ents 9&## !ons&der the *oss&7#e ro#e o% h&nd7r&n ne"r#
%%erents to 'so*ress&n se!ret&n, !e##s &n the de'e#o*)ent o% th&s d&sorder.
108
109
CHAPTER @5 SU44ARY AND SIGNIFICANCE
The o'er## ,o# o% the st"d&es *resented &n th&s d&ssertt&on 9s to e#"!&dte the
)e!hn&s) "nder#$&n, &n!resed 9ter &nt:e nd d&#"t&on# h$*ontre)& &n the 7&#e
d"!t #&,t&on rt )ode# o% #&'er !&rrhos&s. To *"rs"e th&s 9e st"d&ed the e%%e!ts o% !entr#
AT1R 7#o!:de or AT1R )RNA :no!:do9n &n the SFO on 9ter &nt:e nd d&#"t&on#
h$*ontre)&. O"r %&nd&n,s &nd&!te tht AT1R e(*ress&on nd !t&'t&on 9s &n'o#'ed &n
the &n!resed 9ter &nt:e d"r&n, BDL CF&,"re 11D0 7"t d&d not *#$ s&,n&%&!nt ro#e &n
the *ro,ress&on o% d&#"t&on# h$*ontre)&. Th&s !on!#"s&on &s 7sed on se'er#
o7ser't&ons. F&rst0 9e o7ser'ed &n!resed AT1R e(*ress&on &n the SFO0 %ore7r&n
re,&on tht &s &n'o#'ed &n the !rd&o's!"#r nd h")or# re,"#t&on0 &n rts 9&th BDL
&nd"!ed !&rrhos&s CCh*ter 1D. Th&s o7ser't&on #ed "s to test the h$*othes&s tht 1D AT1R
"*re,"#t&on &n the SFO &s &n'o#'ed &n the &n!resed 9ter &nt:e nd d&#"t&on#
h$*ontre)& tht &s sso!&ted 9&th BDL !&rrhos&s. To test th&s h$*othes&s 9e "sed 7oth
*hr)!o#o,&!# nd )o#e!"#r te!hn&+"es to 7#o!: !entr# n,&otens&n s&,n#&n, nd
tten"te the "*re,"#ted SFO AT1R e(*ress&on sso!&ted 9&th BDL to e'#"te &ts ro#e
&n &n!resed 9ter &nt:e nd d&#"t&on# h$*ontre)&. Chron&! !entr# &n%"s&ons o%
#osrtn *re'ented the &n!rese &n dr&n:&n, 7eh'&or CCh*ter 1D. F"rther)ore0 !hron&!
!entr# &n%"s&ons o% #osrtn tten"ted the &n!resed e(*ress&on o% SFO AT1Rs. In
!ontrst0 ICV #osrtn d&d not *rod"!e n &n!rese &n "r&ne o"t*"t or r&se *#s)
110
os)o##&t$ nd he)to!r&t s 9o"#d 7e e(*e!ted &% other )e!hn&s)s tht *rod"!e
d&#"t&on# h$*ontre)& s"!h s AVP re#ese 9ere s&,n&%&!nt#$ de!resed. Th&s s",,ests
tht the &nh&7&t&on o% !entr# n,&otens&n re!e*tors &s not s"%%&!&ent to re'erse or de#$ the
de'e#o*)ent o% d&#"t&on# h$*ontre)& *rod"!ed 7$ BDL. In order to s*e!&%&!##$
e'#"te the ro#e tht SFO AT1Rs *#$ &n the &n!resed 9ter &nt:e sso!&ted 9&th
BDL !&rrhos&s0 9e )&!ro&nKe!ted ne"rotro*h&! AAV6AT1R shRNA 'e!tor &nto the SFO
o% BDL rts. O"r res"#ts sho9 tht AT1R )RNA :no!:do9n &n the SFO nor)#&Bed
dr&n:&n, 7eh'&or &n BDL rts to sh) #&,ted #e'e#s. In !ontrst0 ne&ther *hr)!o#o,&!#
7#o!:de nor :no!:do9n o% AT1R )RNA 9s s"%%&!&ent to *rod"!e n &n!rese &n "r&ne
o"t*"t or r&se *#s) os)o##&t$ nd he)to!r&t s 9o"#d 7e e(*e!ted &% AVP re#ese
9ere s&,n&%&!nt#$ de!resed. Add&t&on##$0 9e o7ser'ed n "ne(*e!ted &n!rese &n FosB
nd AVP !o#o!#&Bt&on &n the SON o% BDL rts treted 9&th AAV6AT1R shRNA. FosB
st&n&n, &n 'so*ress&n nd o($to!&n ne"rons &n the SON 9s not de!resed 7$
tten"t&n, the "*re,"#t&on o% SFO AT1 re!e*tors e&ther *hr)!o#o,&!##$ or thro",h
shRNA :no!:do9n. To,ether these res"#ts &nd&!te s&,n&%&!nt ro#e %or AT1 re!e*tors
&n the SFO &n the e#e'ted 9ter &nt:e sso!&ted 9&th BDL 7"t not &n the )e!hn&s)s
res*ons&7#e %or %#"&d retent&on &n the d&sorder. Th&s &s n &nterest&n, %&nd&n, !ons&der&n,
the !entr# ro#e tht dr&n:&n, 7eh'&or *#$s &n the !hron&! )&ntenn!e o% *#s)
os)o##&t$. One *oss&7#e e(*#nt&on %or th&s )$ 7e tht the )&ntenn!e o% *#s)
os)o##&t$ 9&th&n nrro9 rn,e &n he#th$ h")nsAn&)#s &)*#&es 'er$ h&,h ,&n
s$ste) s"!h tht &t !o"nters n$ e%%e!ts o% re#t&'e !hn,es &n 9ter &nt:e 7o'e
)&n&)# h$drt&on 'o#")e.
111
D&#"t&on# h$*ontre)& &s the !o))onest e#e!tro#$te d&sorder nd &s the !#&n&!#
)n&%estt&on o% 9&de 'r&et$ o% d&seses nd the s&de e%%e!t o% )n$ ther*e"t&!
&nter'ent&ons. Tret)ent o%ten &n'o#'es %#"&d restr&!t&on0 7"t th&s &s d&%%&!"#t to s"st&n &n
the #on, ter). S&n!e d&#"t&on# h$*ontre)& !n res"#t %ro) n e(!ess o% %#"&d &nt:e &n
*t&ents 9ho !nnot d&#"te the&r "r&ne s"%%&!&ent#$ to !o)*enste0 &)*ro'ed "nderstnd&n,
o% the )e!hn&s) o% &n!resed %#"&d &nt:e !o"#d 7ene%&t th&s #r,e *t&ent *o*"#t&on tht
s"%%ers %ro) h$*ontre)&. In dd&t&on to tret&n, d&#"t&on# h$*ontre)&0 &)*ro'ed
:no9#ed,e o% the !entr# ne"r# *th9$s nd )o#e!"#r )e!hn&s)s &n'o#'ed &n the
s"7Ke!t&'e senst&on o% th&rst 9&## &d &n )&n&)&B&n, s"%%er&n, o% *t&ents 9ho )"st
end"re the "ns#:ed "r,e to dr&n: tht res"#ts %ro) d&sese or s res"#t o% ther*e"t&!
&nter'ent&on.
112
Figure 21: Schematic diagram showing the demonstrated neural pathway that mediates
increased water intake during BDL. Abbreviation: AT1R, angiotensin type 1 receptor;
MnPO, median preoptic nucleus; OVLT, organum vasculosum of the lamina terminalis;
P. Pit., posterior pituitary; SFO, subfornical organ; SON, supraoptic nucleus.
113
PERPECTIVES
Bsed on the o7ser't&on tht AT1 re!e*tors &n SFO re &n'o#'ed &n the &n!resed
dr&n:&n, 7eh'&or tht res"#ts %ro) BDL &nd"!ed #&'er !&rrhos&s0 &t 9&## no9 7e &)*ortnt
to deter)&ne the *re!&se )o#e!"#r )e!hn&s)s tht re,"#tes these re!e*tors. Th&s )$
*ro'&de %"rther &ns&,ht &nto other d&sese sttes tht &n'o#'e de!o)*enst&on o%
he)od$n)&! or 9ter nd e#e!tro#$te ho)eosts&s s&n!e the SFO &s &n'o#'ed &n the
re,"#t&on o% )n$ !rd&o's!"#r nd ren# %"n!t&ons. The %eed6%or9rd re#t&onsh&*
7et9een An, II nd AT1R e(*ress&on hs 7een 9e## des!r&7ed &n the #&tert"re. Th&s
*heno)enon 9s %&rst o7ser'ed &n st"d&es o% rts de*r&'ed o% 9ter
1@<61@?
nd s*ontneo"s
h$*ertens&on rts
1@<61@?
0 nd hs s&n!e 7een !on%&r)ed &n n&)# )ode#s o% !on,est&'e
hert %&#"re nd &n s#t6#oded rodents . Both An, II nd #dosterone &n!rese e(*ress&on
o% AT1Rs &n !rd&o's!"#r re,"#tor$ n"!#e& 7$ !t&n, thro",h )&to,en6!t&'ted *rote&n
C4APD :&nses. A#dosterone #so "*re,"#tes AT1Rs thro",h the )&ner#o!ort&!o&d
re!e*tor
1E@
*oss&7#$ 7$ !t&n, on the hor)one res*onse e#e)ent &n the *ro)oter re,&on o%
the AT1R ,ene. Other st"d&es "s&n, &ntr!ere7ro'entr&!"#r &n%"sed An, II nd &n n
n&)# )ode# o% hert %&#"re h'e de)onstrted tht !t&'tor *rote&n 1 CAP61D0 7"t not
4AP :&nse0 !t&'t&on 7$ o(&dnt stress &s essent&# %or AT1R "*re,"#t&on &n the rostr#
'entro#ter# )ed"## . In vitro st"d&es o% CATH. ne"rons h'e e(tended those res"#ts 7$
sho9&n, tht An, II e'o:ed "*re,"#t&on o% the AT1R re+"&res se+"ent&# !t&'t&on o%
114
the trns!r&*t&on %!tors NF6aB0 E#:610 nd AP610 9h&!h then 7&nds to the AP61 s&te &n the
AT1R *ro)oter . There%ore0 SFO AT1R "*re,"#t&on &n the BDL n&)# )ode# )$ 7e
%%e!ted thro",h )"#t&*#e )o#e!"#r *th9$s tht re)&n to 7e deter)&ned.
These res"#ts *ro'&de !#"es to "nderstnd the ne"r# )e!hn&s)s o% &n!resed
dr&n:&n, 7eh'&or &n !&rrhos&sL ho9e'er0 'er$ #&tt#e &s :no9n 7o"t the ne"r# !orre#tes o%
the s"7Ke!t&'e e)ot&on o% th&rst or the&r ne"r# !onne!t&ons 9&th the #)&n ter)&n#&s
d"r&n, d&sese. Re!ent st"d&es "s&n, %"n!t&on# ),net&! resonn!e &),&n, nd *os&tron
e)&ss&on to)o,r*h$ d"r&n, h$*erton&! s#&ne &n%"s&on nd e(er!&se6&nd"!ed
deh$drt&on h'e de)onstrted &)*ortnt sso!&t&ons 7et9een !ort&!# re,&ons o% the
7r&n nd the senst&on o% th&rst d"r&n, 9ter &n,est&on nd t 'r&o"s t&)es d"r&n,
os)ot&! !h##en,es nd reh$drt&on
1@<61@2
. One st"d$ de)onstrted the d$n)&!
%"n!t&on# !onne!t&'&t$ 7et9een the 'entr# #)&n ter)&n#&s nd the &ns"# or the
!&n,"#te !orte( d"r&n, deh$drt&on0 th&rst senst&on0 nd reh$drt&on
1@2
. These st"d&es
*ro'&de &)*ortnt &ns&,ht &n the *ro!ess o% th&rst senst&on0 ho9e'er0 #&tt#e &s :no9n 7o"t
ho9 th&s s$ste) )&,ht !hn,e d"r&n, !hron&! d&sese tht &n'o#'es d&#"t&on#
h$*ontre)&. An&)# )ode#s o% *tho*h$s&o#o,&!# sttes re "se%"# s&n!e the te!hn&+"es
"sed to test ne"r# %"n!t&on&n, d"r&n, th&rst re o%ten &n**#&!7#e to h")n st"d&es. In
one st"d$0 s#&ne6&nd"!ed Fos e(*ress&on 9s "t&#&Bed #on, 9&th retro,rde ne"r#
tr!er to &dent&%$ %"n!t&on# *th9$s %ro) the #)&n ter)&n#&s to the dors# )&d#&ne o%
the th#)"s to !ort&!# re,&ons tht 9ere !t&'ted 7$ the h$*erton&! st&)"#"s
1@?
. S&)&#r
115
st"d&es !o"#d 7e *er%or)ed &n BDL or !hron&! hert %&#"re rts to see &% the *ttern o%
re,&on# 7r&n !t&'t&on &s s&)&#r to he#th$ rts.
The 4nPO &s nother &)*ortnt &nte,rt&'e n"!#e"s %or the trnsd"!t&on o%
h$*o'o#e)&! or os)ot&! s&,n#s to )od"#te dr&n:&n, 7eh'&or CF&,"re 11D0 7"t the
s&,n&%&!n!e o% th&s n"!#e"s %or 7od$ 9ter ho)eosts&s d"r&n, d&seses tht &nd"!e
d&#"t&on# h$*ontre)&0 nd the ne"ronto)&!# !onne!t&'&t$ 7et9een the 4nPO nd
!ort&!# res &n'o#'ed &n th&rst &s not 9e## "nderstood. D&re!t &nKe!t&ons o% n,&otens&n &n
e&ther the 4nPO
1>E
or PVN
1@E
h'e 7een sho9n to st&)"#te dr&n:&n, 7eh'&or &n the rt.
S&n!e the SFO *roKe!ts to 7oth the 4nPO nd PVN0 one or 7oth o% these res !o"#d 7e
&n'o#'ed the &n!resed 9ter &nt:e &n BDL rts. The ne"roto(&n &7oten&! !&d &s "se%"#
9hen tr,et&n, !e## 7od&es o% n"!#e"s o% &nterest 9h&#e #e'&n, dK!ent %&7er tr!ts
&nt!t
111
. There%ore0 st"d$ tht "sed !o)7&nt&on o% Fos &))"noh&sto!he)&str$0
&7oten&! !&d0 nd ne"ronto)&!# tr!t tr!ers 9o"#d !#r&%$ the ro#e o% the 4nPO nd
the PVN &n dr&n:&n, 7eh'&or d"r&n, !&rrhos&s. To deter)&ne %"n!t&on# !onne!t&ons
7et9een the SFO0 OVLT0 4nPO nd PVN nd re,&ons o% the !orte( tht re &)*#&!ted &n
th&rst !ons!&o"sness nd dr&n:&n, 7eh'&or0 e(*er&)entt&on 9o"#d &n!#"de 1D "se o% the
ntero,rde H11E str&n o% the her*es s&)*#e( '&r"s 1 CHSV610 1.3 ( 13
?
*%"A)#L 1<3
n#A&nKe!t&onD en!od&n, ,reen %#"ores!ent *rote&n ,ene &nKe!ted &nto the SFO or the
OVLT #on, 9&th &7oten&! !&d &nKe!t&ons &nto the 4nPO or PVN0 nd 1D &nKe!t&on o%
A#e(e F#"or6!onK",ted !ho#er to(&n B CCTB0 1H &n 3.1 4 *hos*hte 7"%%er0 *H ;.3D
&onto*horet&!##$ de*os&ted Cf1 )A0 < s *"#ses0 <3H d"t$ !$!#e0 13 )&nD &nto the dors#
116
)&d#&ne o% the th#)"s0 the &ns"#0 nd the !&n,"#te !orte( #on, 9&th &7oten&! !&d
&nKe!t&ons &nto e&ther the 4nPO or the PVN. In order to e'#"te e%%e!ts o% 4nPO or PVN
destr"!t&on on dr&n:&n, 7eh'&or nd he)od$n)&!s0 )et7o#&! !,e )es"re)ents nd
rd&o te#e)etr$ )on&tor&n, o% 7#ood *ress"re 9o"#d 7e *er%or)ed. E'#"t&on o% the
ne"r# tr!t tr!&n, 9o"#d &n!or*orte FosB &))"noh&sto!he)&str$ to &dent&%$ FosB
e(*ress&n, ne"rons &n the !orte( tht !onne!t to the #)&n ter)&n#&s or FosB e(*ress&n,
ne"rons &n the #)&n ter)&n#&s tht h'e trnsne"ron# !onne!t&ons to !ort&!# re,&ons
o% &nterest e&ther de*endent#$ or &nde*endent#$ o% the 4nPO or PVN. Conse+"ent#$0 these
e(*er&)ents 9o"#d de%&ne 9h&!h *o*"#t&ons o% !e##s re !hron&!##$ !t&'ted0 nd #so
trns!r&*t&on##$ )od&%&ed s res"#t o% BDL6&nd"!ed FosB e(*ress&on. E'#"t&on o% the
t$*es o% trns!r&*t&on# )od&%&!t&on o% ne"r# %"n!t&on !o"#d &n!#"de #ser6!*t"re
)&!rod&sse!t&on o% s*e!&%&! FosB or non6FosB e(*ress&n, ne"ronsGs*e!&%&!##$ &n the
SFO0 OVLT0 4nPO nd PVN tht !o#o!#&Be 9&th tr!&n, )r:ers. These
ne"ronto)&!# e(*er&)ents 9o"#d &##")&nte the !o)*#e( ne"r# nd )o#e!"#r
)e!hn&s)s tht re,"#te the ho)eostt&! e)ot&on o% th&rst.
D&#"t&on# h$*ontre)& &s #so %!tor &n !on,est&'e hert %&#"re0 nd s&)&#r to
!&rrhos&s0 &t &s d"e to the &n7&#&t$ to d&#"te "r&ne 9h&#e )&nt&n&n, n e#e'ted 9ter
&nt:e. It &s "n:no9n 9hether the !hn,es &n s$n*t&! nd ne"r# %"n!t&on re,"#t&n,
9ter &nt:e nd 'so*ress&n re#ese d"r&n, !on,est&'e hert %&#"re &s s&)&#r to #&'er
!&rrhos&s0 7"t th&s &s nother re 9here the )e!hn&s)s ,o'ern&n, d&#"t&on#
h$*ontre)& re)&n *oor#$ "nderstood.
117
The *re!&se ne"r# nd )o#e!"#r )e!hn&s)s tht res"#t &n e#e'ted se!ret&on o%
'so*ress&n tht o!!"rs &n the BDL )ode# re)&n to 7e deter)&ned. L&:e#$ res o%
d&s!o'er$ #so &n!#"de )o#e!"#r )e!hn&s)s tht )od"#te os)ot&! re,"#t&on o%
'so*ress&n ne"rons &n BDL rts0 s 9e## s the ro#e tht ne"r# %%erents %ro) the
h&nd7r&n. Vso*ress&n re#ese d"e to "n#od&n, o% rter&# 7rore!e*tors nd #o9
*ress"reA'o#")e !rd&o*"#)onr$ re!e*tors &s )ed&ted 7$ nordrener,&! *roKe!t&ons
%ro) the )ed"##. These nordrener,&! %%erents or&,&nte *r&)r&#$ %ro) ne"rons
!o)*r&s&n, the A1 !e## ,ro"* #o!ted &n the !"d# 'entro#ter# )ed"## nd the A1 !e##
,ro"* &n the n"!#e"s o% the so#&tr$ tr!t CNTSD. It sho"#d 7e noted0 ho9e'er0 tht
!ontro'ers$ e(&sts &n re,rd to *rt&!&*t&on o% A1 ne"rons &n 'so*ress&n re#ese d"r&n,
!"te h$*o'o#e)&. Des*&te *ro,ress !hr!ter&B&n, %%erent ne"r# *th9$s &n'o#'ed &n
'so*ress&n se!ret&on0 #&tt#e &s :no9n 7o"t ho9 these s$ste)s res*ond d"r&n, !hron&!
d&sese s"!h s !&rrhos&s or !on,est&'e hert %&#"re. It &s *oss&7#e tht these
!te!ho#)&ne *th9$s0 9h&!h 9o"#d 7e !t&'ted 7$ s$ste)&! h$*otens&on0 !ontr&7"te
to 'so*ress&n re#ese &n BDL rts e&ther #one or &n !onK"n!t&on 9&th e(!&ttor$ SFO
e%%erent ne"r# *roKe!t&ons. The ro#e o% nordrener,&! &nner't&on o% the SON &n
'so*ress&n re#ese &n BDL rts !n 7e tested 7$ "s&n, the &))"noto(&n do*)&ne6Y6
h$dro($#se CDBHD s*or&n to #es&on th&s ne"ro!he)&!# &n*"t d"r&n, BDL CF&,"re 11D.
A#so o% *rt&!"#r &nterest re *oss&7#e &nter!t&ons 7et9een &n%#))tor$
!$to:&nes nd the ren&n6n,&otens&n s$ste). The !t&on o% n,&otens&n II t the SFO &s
)ore #o,&!##$ sso!&ted 9&th dr&n:&n, 7eh'&or nd the &nd"!t&on o% d&#"t&on#
h$*ontre)& 7sed on S!hr&erJs h$*othes&s nd *re'&o"s re*ortsL ho9e'er0 &n%#))tor$
118
!$to:&nes )$ #so *#$ ro#e. One o% the )n$ *h$s&o#o,&!# !hn,es sso!&ted 9&th
#&'er !&rrhos&s &s &n!resesd #e'e#s o% !$to:&nes s"!h s IL6; tht re re#esed %ro) the
%&#&n, #&'er
257-260
. The *ro6&n%#))tor$ !$to:&ne &nter#e":&n ; CIL6;D hs 7een sho9n to
&n!rese the #e'e#s o% !&r!"#t&n, 'so*ress&n
1;161;>
nd &n!rese Fos e(*ress&on &n the
SON nd PVN
1;@61;;
. 4ost &nterest&n, &s the re*ort tht IL6; hs 7een sho9n to &n!rese
the e(*ress&on o% n,&otens&n re!e*tors
267-271
. A ,ro9&n, 7od$ o% e'&den!e s",,est tht
IL6; *#$s n &)*ortnt ro#e &n *osto*ert&'e h$*ontre)&0 e(er!&se6&nd"!e
h$*ontre)&0 nd &n h$*ontre)& sso!&ted 9&th ,e&n,
272
. There%ore0 IL6; )$
!ontr&7"te to d&#"t&on# h$*ontre)& sso!&ted 9&th #&'er !&rrhos&s *oss&7#$ 7$
*otent&t&n, the !t&on o% n,&otens&n II t the #)&n ter)&n#&s to &n!rese the e(!&ttor$
dr&'e o% the ne"roh$*o*h$se# s$ste). F"t"re e(*er&)ents 9o"#d &n!#"de s$ste)&!
*hr)!o#o,&!# nt,on&sts o% or ,ene :no!:do9n o% IL6;.
O"r res"#ts &nd&!ted tht trns#t&on# !t&'t&on o% 'so*ress&n SON ne"rons0 s
)es"red 7$ FosBAbFosB &))"noh&sto!he)&str$0 9s not &nh&7&ted 7$ :no!:do9n o%
SFO AT1 re!e*tors. /e o7ser'ed &n!resed FosBAbFosB st&n&n, &n 'so*ress&n ne"rons
&n BDL rts &nKe!ted &n the SFO 9&th AAV AT1 shRNA. E#e!tro*h$s&o#o,&!# st"d&es &n
the nesthet&Bed rt h'e sho9n tht e#e!tr&!# st&)"#t&on o% the SFO e'o:ed )&(t"re
o% &nh&7&tor$ nd e(!&ttor$ SON ne"ron# res*onses
12>
. It )&,ht 7e tht the &n!rese &n
bFosB st&n&n, &n the SON %o##o9&n, AT1 re!e*tor :no!:do9n 9s res"#t o% the
re)o'# o% 7oth the e(!&ttor$ nd &nh&7&tor$ &n%#"en!es o% the SFO 9&tho"t %%e!t&n,
other &n*"ts s"!h s those %ro) )ed"##r$ !te!ho#)&ne !e## ,ro"*s. The ne"ro!he)&!#
119
&n*"ts to the SON %ro) the #)&n ter)&n#&s re #&:e#$ )ore !o)*#e( nd red"ndnt thn
re !"rrent#$ "nderstood.
/e re!ent#$ re*orted tht do)&nnt ne,t&'e &nh&7&t&on o% bFosB *re'ents or
s#o9s the *ro,ress&on o% d&#"t&on# h$*ontre)& &n BDL rts
112
. To,ether these
o7ser't&ons s"**ort the h$*othes&s tht AT1R &n the SFO &s not ne!essr$ %or d&#"t&on#
h$*ontre)& 7$ !t&'t&on o% 'so*ress&n ne"rons nd tht trns#t&on# !t&'t&on o%
bFosB !ontr&7"tes to *oss&7#e !e##"#r d*t&ons &n SON ne"rons tht *ro)ote the
de'e#o*)ent o% h$*ontre)&. The e(!t ro#e o% SON bFosB re)&ns to 7e deter)&ned.
There re )n$ *oss&7#e tr,et ,enes tht )$ 7e re,"#ted 7$ bFosB trns!r&*t&on#
!t&'t&on nd %%e!t ne"ron# %"n!t&on. For e()*#e &n the n"!#e"s !!")7ens0 G#"R10
NR10 Cd:<0 NF6aB0 nd d$nor*h&n h'e 7een &dent&%&ed s *"tt&'e ,ene tr,ets o%
bFosB tht re re#ted to !hn,es &n ne"r# %"n!t&on sso!&ted 9&th !o!&ne or )or*h&ne
d)&n&strt&on or the !t&ons o% *s$!h&tr&! nt&de*ressnts &n th&s re,&on . In the SON0
bFosB !o"#d 7e )od"#t&n, s&)&#r tr,ets tht &n%#"en!e s$n*t&! res*ons&'eness o%
),no!e##"#r se!retor$ !e##s %o##o9&n, BDL. D$nor*h&n &s n &)*ortnt "to!r&ne %!tor
tht re,"#tes *hs&! !t&'&t$ &n 'so*ress&n ),no!e##"#r ne"rose!retor$ !e##s.
O'ere(*ress&on o% bFosB de!reses d$nor*h&n e(*ress&on &n the n"!#e"s !!")7ens
12;
0
nd &% bFosB s&)&#r#$ re,"#tes d$nor*h&n &n the SON0 &n!resed bFosB e(*ress&on
!o"#d h'e *ro%o"nd e%%e!t on the !t&'&t$ o% 'so*ress&n ),no!e##"#r ne"roendo!r&ne
!e##s nd 'so*ress&n re#ese. It &s #so *oss&7#e tht the do9nstre) tr,ets o% bFosB re
&n'o#'ed &n other !e##"#r *ro!esses ne!essr$ %or s"st&ned !t&'t&on ndAor hor)one
re#ese. It hs *re'&o"s#$ 7een re*orted tht BDL &s sso!&ted 9&th s&,n&%&!nt !hn,es &n
120
TRPV1 nd TRPV@ e(*ress&on &n SON ne"rons. Ho9e'er0 %e9 st"d&es h'e
!hr!ter&Bed the trns!r&*t&on# re,"#t&on o% these !hnne#s
122612E
0 nd there%ore &t &s not
:no9n &% the&r e(*ress&on &s re,"#ted 7$ AP61 trns!r&*t&on %!tors.
In !on!#"s&on0 the res"#ts *resented &n th&s d&ssertt&on *ro'&de ne9 &ns&,ht &nto the
*otent&# ro#e %or SFO AT1Rs &n e(!ess dr&n:&n, d"r&n, #&'er %&#"re. These %&nd&n,s dd
to o"r "nderstnd&n, o% 9ter nd e#e!tro#$te ho)eosts&s &n n &)*ortnt !hron&!
d&sese0 nd 9&## *oss&7#$ #ed to 7etter tret)ent re,&)ens or *re'entt&'e strte,&es %or
%"t"re he#th !re *r!t&t&oners.
121
Figure 22: Schematic diagram showing the neural pathway proposed to mediate increased
vasopressin release during BDL. DBH-Saporin (Red lines) is an immunotoxin that is
used to remove all adrenergic innervation to the SON. Green lines indicate central
excitatory pathways that may be involved in vasopressin release due to decompensated
peripheral vasodilation (blue lines) that results from liver cirrhosis (see Ch. 1).
Abbreviation: CVL, caudal ventrolateral medulla; DBH, dopamine- -hydroxylase; β
MnPO, median preoptic nucleus; NTS, nucleus of the solitary tract; OVLT, organum
vasculosum of the lamina terminalis; P. Pit., posterior pituitary; SFO, subfornical organ;
SON, supraoptic nucleus.

122
123
LITERATURE CITED
1. 4!K&n#e$ 4-0 Denton DA0 O#d%&e#d B-0 De O#&'e&r LB0 4th& 4L. /ter
&nt:e nd the ne"r# !orre#tes o% the !ons!&o"sness o% th&rst. Seminars in
Nephrology. 133;L1;51@E61<2
1. -ohnson AK. The sensor$ *s$!ho7&o#o,$ o% th&rst nd s#t **et&te. Medicine and
Science in Sports and Exercise. 1332L>E51>??61@33
>. Thornton SN. Th&rst nd h$drt&on5 Ph$s&o#o,$ nd !onse+"en!es o% d$s%"n!t&on.
Physiology and Behavior. 1313L13351<611
@. O#&'er G0 S!hg%er EA. On the *h$s&o#o,&!# !t&on o% e(tr!ts o% the *&t"&tr$
7od$ nd !ert&n other ,#nd"#r or,ns. J Physiol. 1?E<L1?5122612E
<. D" V&,ne"d V0 G&sh DT0 Ktso$nn&s PG. A s$nthet&! *re*rt&on *ossess&n,
7&o#o,&!#. Pro*ert&es sso!&ted 9&th r,&n&ne6'so*ress&n hEi. Journal of the
merican !hemical Society. 1E<@L2;5@2<16@2<1
;. B&rn7")er 40 Se&7o#d A0 G&#7ert S0 Ish&do 40 Br7er&s C0 Antr)&n A0 Br7et
P0 Rosenth# /. 4o#e!"#r !#on&n, o% the re!e*tor %or h")n nt&d&"ret&!
hor)one. Nature. 1EE1L><25>>>6>><
2. 4"rt K0 4&ts"o: K0 H&r# T0 /#B T0 A,re P0 He$)nn -B0 En,e# A0 F"K&$osh&
Y. Str"!t"r# deter)&nnts o% 9ter *er)et&on thro",h +"*or&n61. Nature.
1333L@325<EE6;3<
?. N&e#sen S0 Frj:&kr -0 4r*#es D0 K9on TH0 A,re P0 Kne**er 4A. A+"*or&ns &n
the :&dne$5 Fro) )o#e!"#es to )ed&!&ne. Physiological "evie#s. 1331L?1513<6
1@@
E. Ro7ertson GL. A7nor)#&t&es o% th&rst re,"#t&on. $idney International.
1E?@L1<5@;36@;E
13. 4!Kenn K0 Tho)*son C. Os)ore,"#t&on &n !#&n&!# d&sorders o% th&rst
**re!&t&on. !linical Endocrinology. 1EE?L@E51>E61<1
11. Ro##s B-0 /ood R-0 Ro##s ET0 L&nd H0 L&nd /0 Led&n,h) -G. Th&rst %o##o9&n,
9ter de*r&'t&on &n h")ns. %he merican &ournal of physiology.
1E?3L1>E5R@2;6@?1
11. Tho)*son C-0 B#nd -0 B"rd -0 B$#&s PH. The os)ot&! thresho#ds %or th&rst nd
'so*ress&n re#ese re s&)&#r &n he#th$ )n. !linical Science. 1E?;L215;<16;<;
1>. Cro9#e$ RK0 Sher#o!: 40 A,h A0 S)&th D0 Tho)*son C-. C#&n&!# &ns&,hts &nto
d&*s&! d&7etes &ns&*&d"s5 A #r,e !se ser&es. !linical Endocrinology.
1332L;;5@2<6@?1
1@. 4'r:&s AN0 Tr&tos NA. D&7etes &ns&*&d"s 9&th de%&!&ent th&rst5 Re*ort o%
*t&ent nd re'&e9 o% the #&tert"re. merican Journal of $idney 'iseases.
133?L<15?<16?<E
1<. Ro7ertson GL. D&*so,en&! d&7etes &ns&*&d"s5 A ne9#$ re!o,n&Bed s$ndro)e
!"sed 7$ se#e!t&'e de%e!t &n the os)ore,"#t&on o% th&rst. %ransactions of the
ssociation of merican Physicians. 1E?2L13351@161@E
124
1;. Sher#o!: 40 A,h A0 Cro9#e$ R0 S)&th D0 Tho)*son C-. Ad&*s&! d&7etes
&ns&*&d"s %o##o9&n, *&t"&tr$ s"r,er$ %or )!ro*ro#!t&no). Pituitary.
133;LE5<E6;@
12. S)&th D0 4oore K0 Tor)e$ /0 B$#&s PH0 Tho)*son C-. Do9n9rd resett&n, o%
the os)ot&! thresho#d %or th&rst &n *t&ents 9&th s&dh. merican Journal of
Physiology - Endocrinology and Metabolism. 133@L1?25E131E6E131>
1?. H))ond DN0 4o## G/0 Ro7ertson GL0 Che#)&!:6S!horr E. H$*od&*s&!
h$*erntre)& 9&th nor)# os)ore,"#t&on o% 'so*ress&n. Ne# England Journal
of Medicine. 1E?;L>1<5@>>6@>;
1E. Ll*eB6C**m 40 Go#)$o L0 LorenBo G0 G##e,o N0 Brr&o R. H$*oth#)&!
d&*&! h$*erntre)& s$ndro)e 9&th nor)# os)ore,"#t&on o% 'so*ress&n.
European Journal of Pediatrics. 133@L1;>5<?36<?>
13. Bos!oe A0 Pr)ore C0 Ver7#&s -G. Cost o% &##ness o% h$*ontre)& &n the "n&ted
sttes. !ost Eff "esour lloc. 133;L@513
11. ChtterKee K. Ne"rohor)on# !t&'t&on &n !on,est&'e hert %&#"re nd the ro#e o%
'so*ress&n. %he merican Journal of !ardiology
133<LE<5?
11. Go#ds)&th SR. C"rrent tret)ents nd no'e# *hr)!o#o,&! tret)ents %or
h$*ontre)& &n !on,est&'e hert %&#"re. m J !ardiol. 133<LE<51@61>
1>. Oren R4. H$*ontre)& &n !on,est&'e hert %&#"re. m J !ardiol. 133<LE<51B6
2B
1@. S!hr&er R/. /ter nd sod&") retent&on &n ede)to"s d&sorders5 Ro#e o%
'so*ress&n nd #dosterone. m J Med. 133;L11E5S@26<>
1<. Ver7#&s -G. D&sorders o% 7od$ 9ter ho)eosts&s. Best Pract "es !lin
Endocrinol Metab. 133>L125@216<3>
1;. Crdens A0 Arro$o V. 4e!hn&s)s o% 9ter nd sod&") retent&on &n !&rrhos&s
nd the *tho,enes&s o% s!&tes. Best Practice ( "esearch !linical Endocrinology
( Metabolism. 133>L125;326;11
12. 4rt&n PY0 S!hr&er R/. Sod&") nd 9ter retent&on &n hert %&#"re5 Ptho,enes&s
nd tret)ent. $idney Int) Suppl) 1EE2L<E5S<26;1
1?. ChtterKee K. Ne"rohor)on# !t&'t&on &n !on,est&'e hert %&#"re nd the ro#e o%
'so*ress&n. merican Journal of !ardiology. 133<LE<5?61>
1E. Gheor,h&de 40 Gott#&e7 SS0 Ude#son -E0 Konst) 4A0 CBer9&e! F0 O"$n, -0
Or#nd& C. Vso*ress&n 'C1D re!e*tor 7#o!:de 9&th to#'*tn 'ers"s %#"&d
restr&!t&on &n the tret)ent o% h$*ontre)&. m J !ardiol. 133;LE2513;@613;2
>3. Gheor,h&de 40 N&B& I0 O"$n, -0 CBer9&e! F0 K)7$sh& -0 M)*&no 40
Or#nd& C. Vso*ress&n '16re!e*tor 7#o!:de 9&th to#'*tn &n *t&ents 9&th
!hron&! hert %&#"re5 Res"#ts %ro) do"7#e67#&nd0 rndo)&Bed tr&#. !irculation.
133>L13251;E361;E;
>1. S!hr&er R/0 Gross P0 Gheor,h&de 40 Ber# T0 Ver7#&s -G0 CBer9&e! FS0 Or#nd&
C. To#'*tn0 se#e!t&'e or# 'so*ress&n '16re!e*tor nt,on&st0 %or
h$*ontre)&. N Engl J Med. 133;L><<513EE61111
125
>1. Ro7ertson GL. V*tns %or the tret)ent o% h$*ontre)&. Nature "evie#s
Endocrinology. 1311L251<161;1
>>. RoBen6M'& B0 Yh' D0 Gheor,h&de 40 KorBets A0 Le&7o'&!& L0 G%ter U.
Vso*ress&n re!e*tor nt,on&sts %or the tret)ent o% h$*ontre)&5 S$ste)t&!
re'&e9 nd )et6n#$s&s. merican Journal of $idney 'iseases. 1313L<;5>1<6
>>2
>@. Ross& -0 B$r) 40 Ude#son -E0 L#o$d6-ones D0 Ad)s KF0 O!onnor C40
Sto",h /G0 O"$n, -0 Sh&n DD0 Or#nd& C0 Gheor,h&de 4. I)*ro'e)ent &n
h$*ontre)& d"r&n, hos*&t#&Bt&on %or 9orsen&n, hert %&#"re &s sso!&ted 9&th
&)*ro'ed o"t!o)es5 Ins&,hts %ro) the !"te nd !hron&! ther*e"t&! &)*!t o%
'so*ress&n nt,on&st &n !hron&! hert %&#"re C!t&' &n !h%D tr&#. cute !ard
!are. 1332LE5?16?;
><. Crdens A0 G&nes P. Ptho,enes&s nd tret)ent o% %#"&d nd e#e!tro#$te
&)7#n!e &n !&rrhos&s. Seminars in Nephrology. 1331L115>3?6>1;
>;. Better OS0 A&sen7re$ GA0 Ber# T0 Anderson R-0 Hnde#)n /A0 L&ns SL0
G",,enhe&) S-0 S!hr&er R/. Ro#e o% nt&d&"ret&! hor)one &n &)*&red "r&nr$
d&#"t&on sso!&ted 9&th !hron&! 7&#e6d"!t #&,t&on. !lin Sci *+ond,. 1E?3L<?5@E>6
<33
>2. -onssen TE0 He&de A40 -nK" NR0 Chr&stensen S. Co##e!t&n, d"!t %"n!t&on &n
#&'er !&rrhot&! rts 9&th er#$ sod&") retent&on. cta Physiologica Scandinavica.
1331L12<51>261@@
>?. K&) -K0 S"))er SN0 Ho9rd RL0 S!hr&er R/. Vso*ress&n ,ene e(*ress&on &n
rts 9&th e(*er&)ent# !&rrhos&s. -epatology. 1EE>L1251@>61@2
>E. NtrKn SK0 Bs&'&redd$ -0 R)!hndrn A0 Tho)s S0 R))oorth$ P0
P"#&)ood AB0 -!o7 40 B#s"7r)n&n KA. Ren# d),e &n e(*er&)ent##$6
&nd"!ed !&rrhos&s &n rts5 Ro#e o% o($,en %ree rd&!#s. -epatology. 133;L@>511@?6
11<;
@3. Ort&B 4C0 Forte*&n& LA0 4rt&neB6S#,do C0 E#eno N0 At"!h N40 Lo*eB6
No'o -40 Gr!&6Estn -. Ren# e%%e!ts !hron&! n&tr&! o(&de s$nthes&s &nh&7&t&on
&n !&rrhot&! rts 9&th s!&tes. Nefrologia. 1331L115<<;6<;@
@1. Vo&,t 4D0 -ones SY0 D&Bon GF. Ro#e o% n,&otens&n &n ren# s$)*thet&!
!t&'t&on &n !&rrhot&! rts. merican Journal of Physiology. 1EEEL1225F1@<61<3
@1. Koe*:e -P0 -ones S0 D&Bon GF. Ren# ner'es )ed&te 7#"nted ntr&"res&s to tr&#
ntr&"ret&! *e*t&de &n !&rrhot&! rts. merican Journal of Physiology.
1E?2L1<15R131E6131>
@>. Brond L0 Hdr"* N0 S##&n, N0 Tor* 40 Gre7e 40 Chr&stensen S0 N&e#sen S0
-onssen TE. Un!o"*#&n, o% 'so*ress&n s&,n#&n, &n !o##e!t&n, d"!ts %ro) rts
9&th !7#6&nd"!ed #&'er !&rrhos&s. m J Physiol "enal Physiol. 133@L1?25F?3;6?1<
@@. L& Y0 Son, D0 Mhn, Y0 Lee SS. E%%e!t o% neont# !*s&!&n tret)ent on
he)od$n)&!s nd ren# %"n!t&on &n !&rrhot&! rts. .ut. 133>L<151E>61EE
@<. Bre&t)n DR0 Lee SS. B#"nted res*ons&'eness o% the ne"ron# !t&'t&on )r:er
%os &n 7r&nste) !rd&o's!"#r n"!#e& o% !&rrhot&! rts. -epatology.
1EE2L1;51>?361>?<
126
@;. -onssen TE0 He&de A40 -nK" NR0 Chr&stensen S. Co##e!t&n, d"!t %"n!t&on &n
#&'er !&rrhot&! rts 9&th er#$ sod&") retent&on. cta Physiol Scand.
1331L12<51>261@@
@2. S9&n 4G0 Pt!he' V0 Ver,## -0 Chro"sos G0 -ones EA. S"**ress&on o%
h$*oth#)&!6*&t"&tr$6dren# (&s res*ons&'eness to stress &n rt )ode# o%
!"te !ho#ests&s. Journal of !linical Investigation. 1EE>LE151E3>61E3?
@?. Bos!h64r!e 40 Poo -L0 -&)eneB /0 Bords N0 Le&'s A0 4or#es6R"&B 40
4"noB R40 PereB 40 Arro$o V0 R&'er F0 Rodes -. Co)*r&son o% t9o +"ret&!
dr",s Cn&r'o#&ne nd o*!6>11;3D &n !&rrhot&! rts 9&th s!&tes nd 9ter retent&on.
J Pharmacol Exp %her. 1EEEL1?E51E@6131
@E. Bos!h -0 Gr!n6P,Nn -C. Co)*#&!t&ons o% !&rrhos&s. I. Port# h$*ertens&on.
Journal of -epatology. 1333L>151@161<;
<3. Gs"## X0 Bt##er R0 G&nos P0 Sn!ho6Br" P0 N&!o#Ns -40 Gpr7&, 4N0 Ferrer E0
Bdn E0 G"# A0 Arro$o V0 Rodms -. H")n )$o%&7ro7#st&! he*t&! ste##te !e##s
e(*ress ! 1f6!t&'ted : f !hnne#s tht )od"#te the e%%e!ts o% endothe#&n61 nd
n&tr&! o(&de. Journal of -epatology. 1331L><52>E62@?
<1. Ro!:e$ DC0 /e&s&,er RA. Endothe#&n &nd"!ed !ontr!t&#&t$ o% ste##te !e##s %ro)
nor)# nd !&rrhot&! rt #&'er5 I)*#&!t&ons %or re,"#t&on o% *ort# *ress"re nd
res&stn!e. -epatology. 1EE;L1@51>>61@3
<1. G"*t TK0 Tor"ner 40 Ch"n, 4K0 GrosB)nn R-. Endothe#&# d$s%"n!t&on nd
de!resed *rod"!t&on o% n&tr&! o(&de &n the &ntrhe*t&! )&!ro!&r!"#t&on o%
!&rrhot&! rts. -epatology. 1EE?L1?5E1;6E>1
<>. R&!hter S0 4q!:e I0 4en,er 4D0 Vo##)r B. I)*!t o% &ntr&ns&! 7#ood %#o9
re,"#t&on &n !&rrhos&s5 4&ntenn!e o% he*t&! rter&# 7"%%er res*onse. merican
Journal of Physiology - .astrointestinal and +iver Physiology. 1333L12E5G@<@6
G@;1
<@. T:s:& S0 Hno H. Three6d&)ens&on# o7ser't&ons o% the h")n he*t&! rter$
Crter&# s$ste) &n the #&'erD. Journal of -epatology. 1331L>@5@<<6@;;
<<. M&**r&!h A. He)od$n)&!s &n the &so#ted !&rrhot&! #&'er. Journal of !linical
.astroenterology. 1332L@15S1<@6S1<?
<;. Lo"re&ro6S&#' 4R0 Cde#&n G/0 GrosB)nn R-. De%&!&t &n n&tr&! o(&de
*rod"!t&on &n !&rrhot&! rt #&'ers &s #o!ted &n the s&n"so&d# nd *osts&n"so&d#
res. merican Journal of Physiology - .astrointestinal and +iver Physiology.
133>L1?@5G<;26G<2@
<2. D"denhoe%er AA0 Lo"re&ro6S&#' 4R0 Cde#&n G/0 G"*t T0 GrosB)nn R-.
B&o!t&'t&on o% n&tro,#$!er&n nd 'so)otor res*onse to n&tr&! o(&de re &)*&red
&n !&rrhot&! rt #&'ers. -epatology. 1331L>;5>?16>?<
<?. Perr& RE0 Ln,er DA0 ChtterKee S0 G&77ons S-0 Gd,&# -0 Co S0 Frr",& G0
Shh VH. De%e!ts &n !,)*6*:, *th9$ !ontr&7"te to &)*&red no6de*endent
res*onses &n he*t&! ste##te !e##s "*on !t&'t&on. merican Journal of
Physiology - .astrointestinal and +iver Physiology. 133;L1E35G<><6G<@1
<E. B"er 40 Mhn, -X0 B"er I0 C#e)ens 4G. Et61 &nd"!ed #tert&ons o% he*t&!
)&!ro!&r!"#t&on5 S&n"so&d# nd e(trs&n"so&d# s&tes o% !t&on. merican
127
Journal of Physiology - .astrointestinal and +iver Physiology. 1EE@L1;25G1@>6
G1@E
;3. C#e)ens 4G0 Mhn, -X. Re,"#t&on o% s&n"so&d# *er%"s&on5 In '&'o )ethodo#o,$
nd !ontro# 7$ endothe#&ns. Seminars in +iver 'isease. 1EEEL1E5>?>6>E;
;1. Gr"*er 40 Gr!nP,Nn -0 T&tos E0 C#r& -0 4ss,"er A0 Bos!h -0 Rodms -. <6
#&*o($,ense &nh&7&t&on red"!es &ntrhe*t&! 's!"#r res&stn!e o% !&rrhot&! rt
#&'ers5 A *oss&7#e ro#e o% !$ste&n$#6#e":otr&enes. .astroenterology. 1331L1115>?26
>E>
;1. Gr"*er 40 4r!h S0 En,e# P0 Rodms -0 Bos!h -0 Gr!n6P,Nn -C. S&n"so&d#
endothe#&# !o(616der&'ed *rostno&ds )od"#te the he*t&! 's!"#r tone o%
!&rrhot&! rt #&'ers. merican Journal of Physiology - .astrointestinal and +iver
Physiology. 133<L1??5G2;>6G223
;>. /!hs7er, RH0 Bhr)&*o"r P0 So%o!#eo"s CT0 Brone A. He*to%",# %#o9 &n
the *ort# 'eno"s s$ste)5 Ptho*h$s&o#o,$0 &),&n, %&nd&n,s0 nd d&,nost&!
*&t%##s1. "adiographics. 1331L11511>61@3
;@. /&est R0 GrosB)nn R-. The *rdo( o% n&tr&! o(&de &n !&rrhos&s nd *ort#
h$*ertens&on5 Too )"!h0 not eno",h. -epatology. 1331L><5@2?6@E1
;<. I9:&r& Y0 GrosB)nn R-. Vs!"#r endothe#&# d$s%"n!t&on &n !&rrhos&s. Journal
of -epatology. 1332L@;5E126E>@
;;. I9:&r& Y0 GrosB)nn R-. The h$*erd$n)&! !&r!"#t&on o% !hron&! #&'er d&seses5
Fro) the *t&ent to the )o#e!"#e. -epatology. 133;L@>5S1116S1>1
;2. B#end&s L0 /on, F. The h$*erd$n)&! !&r!"#t&on &n !&rrhos&s5 An o'er'&e9.
Pharmacology and %herapeutics. 1331L?E511161>1
;?. K&) 4Y0 B&: SK0 Lee SS. He)od$n)&! #tert&ons &n !&rrhos&s nd *ort#
h$*ertens&on. $orean J -epatol. 1313L1;5>@26><1
;E. L&" H0 S!h"e#ert N0 4!Do",## --0 Lee SS. Centr# ne"r# !t&'t&on o%
h$*erd$n)&! !&r!"#t&on &n *ort# h$*ertens&'e rts de*ends on ',# %%erent
ner'es. .ut. 133?L<25E;;6E2>
23. O#&'er -A0 Vern EC. A%%erent )e!hn&s)s o% sod&") retent&on &n !&rrhos&s nd
he*toren# s$ndro)e. $idney International. 1313L225;;E6;?3
21. L#e)n /0 Vn Lnde,he) L0 /&#)er A0 Fe'er$ -0 Ne'ens F. Port#
h$*ertens&on5 Fro) *tho*h$s&o#o,$ to !#&n&!# *r!t&!e. +iver International.
133<L1<5132E613E3
21. 4j##er S0 Ho7o#th L0 /&n:#er C0 Bendtsen F0 Chr&stensen E. Deter)&nnts o% the
h$*erd$n)&! !&r!"#t&on nd !entr# h$*o'o#e)& &n !&rrhos&s. .ut. 1311
2>. N&eder7er,er 40 4rt&n PY0 G&nes P0 4orr&s K0 Ts& P0 X" DL0 4!4"rtr$ I0
S!hr&er R/. Nor)#&Bt&on o% n&tr&! o(&de *rod"!t&on !orre!ts rter&#
'sod&#t&on nd h$*erd$n)&! !&r!"#t&on &n !&rrhot&! rts. .astroenterology.
1EE<L13E51;1@61;>3
2@. S!hr&er R/. Pr&)r$ s$ste)&! rter&# 'sod&#t&on &n !&rrhot&! *t&ents. $idney
International. 1313L2?5;1E
2<. Arro$o V0 FernndeB -. Ptho*h$s&o#o,&!# 7s&s o% #7")&n "se &n !&rrhos&s.
nnals of -epatology. 1311L135S;6S1@
128
2;. 4j##er S0 Henr&:sen -H. C&rrhot&! !rd&o)$o*th$. Journal of -epatology.
1313L<>512E61E3
22. S!hr&er R/. Bod$ %#"&d 'o#")e re,"#t&on &n he#th nd d&sese5 A "n&%$&n,
h$*othes&s. nnals of Internal Medicine. 1EE3L11>51<<61<E
2?. S!hr&er R/0 G"re'&!h AK0 Cdn**horn!h& 4A. Ptho,enes&s nd
)n,e)ent o% sod&") nd 9ter retent&on &n !rd&! %&#"re nd !&rrhos&s.
Seminars in Nephrology. 1331L1151<26121
2E. S!hr&er R/. The se 9&th&n "s5 D&sorders o% 7od$ 9ter ho)eosts&s. !urrent
/pinion in Investigational 'rugs. 1332L?5>3@6>11
?3. S!hr&er R/. De!resed e%%e!t&'e 7#ood 'o#")e &n ede)to"s d&sorders5 /ht does
th&s )enr Journal of the merican Society of Nephrology. 1332L1?5131?613>1
?1. 4rt&n PY0 G&nos P0 S!hr&er R/. 4e!hn&s)s o% d&sese5 N&tr&! o(&de s
)ed&tor o% he)od$n)&! 7nor)#&t&es nd sod&") nd 9ter retent&on &n
!&rrhos&s. Ne# England Journal of Medicine. 1EE?L>>E5<>>6<@1
?1. L V&## G0 Br#ett G0 Pnt#eo P0 De# Bene R0 V&BB"tt& F0 Ve!!h&r&no S0 4s&n&
E0 Per%etto F0 Tr+"&n& R0 Gent&#&n& P0 L%%& G. He)od$n)&!0 ren#0 nd endo!r&ne
e%%e!ts o% !"te &nh&7&t&on o% n&tr&! o(&de s$nthse &n !o)*ensted !&rrhos&s.
-epatology. 1331L>@51E612
?>. Bos!h -0 BerB&,ott& A0 Gr!&6P,n -C0 A7r#des -G. The )n,e)ent o% *ort#
h$*ertens&on5 Rt&on# 7s&s0 '&#7#e tret)ents nd %"t"re o*t&ons. Journal of
-epatology. 133?L@?5S;?6SE1
?@. F,"ndes C0 G&nos P. He*toren# s$ndro)e5 A se'ere0 7"t tret7#e0 !"se o%
:&dne$ %&#"re &n !&rrhos&s. merican Journal of $idney 'iseases. 1311L<E5?2@6
??<
?<. Es#er 40 D"d#e$ F0 -enn&n,s G0 De7&ns:& H0 L)7ert G0 -ones P0 Crott$ B0
Co#)n -0 /&##ett I. In!resed s$)*thet&! ner'o"s !t&'&t$ nd the e%%e!ts o% &ts
&nh&7&t&on 9&th !#on&d&ne &n #!oho#&! !&rrhos&s. nnals of Internal Medicine.
1EE1L11;5@@;6@<<
?;. Lenerts A0 Codden T0 4e"n&er -C0 Henr$ -P0 L&,n$ G. E%%e!ts o% !#on&d&ne on
d&"ret&! res*onse &n s!&t&! *t&ents 9&th !&rrhos&s nd !t&'t&on o% s$)*thet&!
ner'o"s s$ste). -epatology. 133;L@@5?@@6?@E
?2. Arro$o V0 G&nos P0 -&)mneB /0 Rodms -. Ren# d$s%"n!t&on &n !&rrhos&s. /xford
%extboo0 of !linical -epatology. 1EEE52>>62;1
??. Arro$o V0 -&)mneB /. Co)*#&!t&ons o% !&rrhos&s. I&. Ren# nd !&r!"#tor$
d$s%"n!t&on. L&,hts nd shdo9s &n n &)*ortnt !#&n&!# *ro7#e). Journal of
-epatology. 1333L>151<26123
?E. CNrdens A0 Arro$o V. 4e!hn&s)s o% 9ter nd sod&") retent&on &n !&rrhos&s
nd the *tho,enes&s o% s!&tes. Best Practice and "esearch1 !linical
Endocrinology and Metabolism. 133>L125;326;11
E3. 4rt&n PY0 S!hr&er R/. Ptho,enes&s o% 9ter nd sod&") retent&on &n !&rrhos&s.
$idney Int Suppl. 1EE2L<E5S@>6@E
E1. Ver7#&s -G. D&sorders o% 7od$ 9ter ho)eosts&s. Best Practice and "esearch1
!linical Endocrinology and Metabolism. 133>L125@216<3>
129
E1. Sher#o!: 40 Tho)*son C-. The s$ndro)e o% &n**ro*r&te nt&d&"ret&! hor)one5
C"rrent nd %"t"re )n,e)ent o*t&ons. European Journal of Endocrinology.
1313L1;1
E>. S)&th D0 4oore K0 Tor)e$ /0 B$#&s PH0 Tho)*son C-. Do9n9rd resett&n, o%
the os)ot&! thresho#d %or th&rst &n *t&ents 9&th s&dh. merican Journal of
Physiology - Endocrinology and Metabolism. 133@L1?2
E@. G&nos P0 G"e'r 4. H$*ontre)& &n !&rrhos&s5 Ptho,enes&s0 !#&n&!#
s&,n&%&!n!e0 nd )n,e)ent. -epatology. 133?L@?5133161313
E<. D&eB -0 S&)on 4A0 Anton F0 Indrt F-0 Pr&eto -. T"7"#r sod&") hnd#&n, &n
!&rrhot&! *t&ents 9&th s!&tes s n#$sed 7$ the ren# #&th&") !#ern!e )ethod.
Eur J !lin Invest. 1EE3L1351;;6121
E;. G&nos P0 /on, F0 /tson H0 Ter, R0 Br"h R0 Mrs:& -P0 D"d#e$ F. C#&n&!# tr&#5
Short6ter) e%%e!ts o% !o)7&nt&on o% st'*tn0 se#e!t&'e 'so*ress&n '1
re!e*tor nt,on&st0 nd d&"ret&!s on s!&tes &n *t&ents 9&th !&rrhos&s 9&tho"t
h$*ontre)& 6 rndo)&Bed0 do"7#e67#&nd0 *#!e7o6!ontro##ed st"d$.
limentary Pharmacology and %herapeutics. 1313L>15?>@6?@<
E2. CNrdens A0 G&nos P. 4n,e)ent o% *t&ents 9&th !&rrhos&s 9&t&n, #&'er
trns*#ntt&on. .ut. 1311L;35@116@11
E?. G&nes P0 /on, F0 /tson H0 4&#"t&no'&! S0 de# Ar7o# LR0 O#ten" D. E%%e!ts o%
st'*tn0 se#e!t&'e 'so*ress&n 'C1D re!e*tor nt,on&st0 on s!&tes nd ser")
sod&") &n !&rrhos&s 9&th h$*ontre)&5 A rndo)&Bed tr&#. -epatology.
133?L@?513@611>
EE. FernndeB6Vro G0 Ros -0 CeK"do64rt&n P0 Cno C0 Arro$o V0 R&'er F0 Rodes -0
-&)eneB /. E%%e!t o% the '1A'16'* re!e*tor nt,on&st0 !on&'*tn0 on ren#
9ter )et7o#&s) nd s$ste)&! he)od$n)&!s &n rts 9&th !&rrhos&s nd s!&tes. J
-epatol. 133>L>?52<<62;1
133. Ros -0 FernNndeB6Vro G0 4soB6L"+"e -0 Arro$o V0 Rodms -0 G"nnet -/0
De)rest KT0 -&)mneB /. S"st&ned +"ret&! e%%e!t o% the '16'* re!e*tor
nt,on&st0 r9K6><1;@20 &n !&rrhot&! rts 9&th s!&tes nd 9ter retent&on. British
Journal of Pharmacology. 133<L1@;5;<@6;;1
131. 4!K&n#e$ 4-0 4th& 4L0 4!A##en R40 4!C#er RC0 4&se#&s RR0 Penn&n,ton
GL0 V&'s L0 /de -D0 O#d%&e#d B-. Vso*ress&n se!ret&on5 Os)ot&! nd hor)on#
re,"#t&on 7$ the #)&n ter)&n#&s. Journal of Neuroendocrinology.
133@L1;5>@36>@2
131. 4!K&n#e$ 4-0 4!A##en R40 D'ern P0 G&#es 4E0 Pens!ho9 -0 S"nn N0
Us!h:o' A0 O#d%&e#d B-. The sensor$ !&r!")'entr&!"#r or,ns o% the
)))#&n 7r&n. dvances in natomy2 Embryology and !ell Biology.
133>L1215III6XII0 161110 7!: !o'er
13>. Brod$ 4-0 -ohnson AK. Ro#e o% the ntero'entr# th&rd 'entr&!#e re,&on &n %#"&d
nd e#e!tro#$te 7#n!e0 rter&# *ress"re re,"#t&on0 nd h$*ertens&on.
. 3rontiers in neuroendocrinology. 1E?3L;51@E61E1
13@. Anderson -/0 S)&th P40 Fer,"son AV. S"7%orn&!# or,n ne"rons *roKe!t&n, to
*r'entr&!"#r n"!#e"s5 /ho#e6!e## *ro*ert&es. Brain "esearch. 1331LE1152?6?<
130
13<. Anderson -/0 /sh7"rn DL0 Fer,"son AV. Intr&ns&! os)osens&t&'&t$ o%
s"7%orn&!# or,n ne"rons. Neuroscience. 1333L1335<>E6<@2
13;. 4!K&n#e$ 4-0 A##en A40 B"rns P0 Co#'&## L40 O#d%&e#d B-. Inter!t&on o%
!&r!"#t&n, hor)ones 9&th the 7r&n5 The ro#es o% the s"7%orn&!# or,n nd the
or,n") 's!"#os") o% the #)&n ter)&n#&s. !linical and Experimental
Pharmacology and Physiology. 1EE?L1<5S;16S;2
132. N&ssen R0 Bo"r+"e C/0 Ren"d LP. 4e)7rne *ro*ert&es o% or,n")
's!"#os") #)&n ter)&n#&s ne"rons re!orded &n '&tro. m J Physiol.
1EE>L1;@5R?116?1<
13?. Andersson B0 Le:se## LG0 L&shK:o F. Pert"r7t&ons &n %#"&d 7#n!e &nd"!ed 7$
)ed&##$ *#!ed %ore7r&n #es&ons. Brain "esearch. 1E2<LEE51;1612<
13E. Thrsher TN0 Ke&# LC0 R)s$ D-. Les&ons o% the or,n") 's!"#os") o% the
#)&n ter)&n#&s Co'#tD tten"te os)ot&!##$6&nd"!ed dr&n:&n, nd 'so*ress&n
se!ret&on &n the do,. Endocrinology. 1E?1L11351?>261?>E
113. Thrsher TN0 Ke&# LC. Re,"#t&on o% dr&n:&n, nd 'so*ress&n se!ret&on5 Ro#e o%
or,n") 's!"#os") #)&ne ter)&n#&s. merican Journal of Physiology -
"egulatory Integrative and !omparative Physiology. 1E?2L1<>
111. C"nn&n,h) -T0 Be#tB T0 -ohnson RF0 -ohnson AK. The e%%e!ts o% &7otente
#es&ons o% the )ed&n *reo*t&! n"!#e"s on e(*er&)ent##$6&nd"!ed nd !&r!d&n
dr&n:&n, 7eh'&or &n rts. Brain "esearch. 1EE1L<?35>1<6>>3
111. -ohnson AK0 B",,$ -. Per&'entr&!"#r *reo*t&!6h$*oth#)"s &s '&t# %or th&rst nd
nor)# 9ter e!ono)$. merican Journal of Physiology - "egulatory Integrative
and !omparative Physiology. 1E2?L>5R1116R11E
11>. 4!K&n#e$ 4-0 /#:er LL0 A#e(&o" T0 A##en A40 C)*7e## D-0 D& N&!o#nton&o
R0 O#d%&e#d B-0 Denton DA. Os)ore,"#tor$ %#"&d &nt:e 7"t not h$*o'o#e)&!
th&rst &s &nt!t &n )&!e #!:&n, n,&otens&n. merican Journal of Physiology -
"egulatory Integrative and !omparative Physiology. 133?L1E@
11@. 4!A##en R40 Penn&n,ton GL0 4!K&n#e$ 4-. Os)ores*ons&'e "n&ts &n shee*
)ed&n *reo*t&! n"!#e"s. m J Physiol. 1EE3L1<E5R<E>6;33
11<. 4!K&n#e$ 4-0 Denton DA0 Le:se## LG. Os)ore,"#tor$ th&rst &n shee* &s
d&sr"*ted 7$ 7#t&on o% the nter&or 9## o% the o*t&! re!ess. Brain "esearch.
1E?1L1>;5113611<
11;. 4!K&n#e$ 4-0 4th& 4L0 Penn&n,ton G0 R"nd,ren 40 V&'s L. E%%e!t o%
&nd&'&d"# or !o)7&ned 7#t&on o% the n"!#er ,ro"*s o% the #)&n ter)&n#&s on
9ter dr&n:&n, &n shee*. merican Journal of Physiology - "egulatory Integrative
and !omparative Physiology. 1EEEL12;
112. Ho -40 M&erth DK0 S'os AV0 Fe)&no D-0 Bssett -E0 4!K&n#e$ 4-0 F&tts DA.
D&%%erent&# e%%e!ts o% &ntr'eno"s h$*eros)ot&! so#"tes on dr&n:&n, #ten!$ nd
!6%os e(*ress&on &n the !&r!")'entr&!"#r or,ns nd h$*oth#)"s o% the rt.
merican Journal of Physiology - "egulatory Integrative and !omparative
Physiology. 1332L1E1
131
11?. Ho!hsten7!h SL0 C&r&e##o -. E%%e!t o% #es&ons o% %ore7r&n !&r!")'entr&!"#r
or,ns on !6%os e(*ress&on &n the !entr# ner'o"s s$ste) to *#s) h$*erntre)&.
Brain "es. 1EE;L21>51261?
11E. O#d%&e#d B-0 Bdoer E0 Hrds DK0 4!K&n#e$ 4-. Fos *rod"!t&on &n retro,rde#$
#7e##ed ne"rons o% the #)&n ter)&n#&s %o##o9&n, &ntr'eno"s &n%"s&on o% e&ther
h$*erton&! s#&ne or n,&otens&n &&. Neuroscience. 1EE@L;351<<61;1
113. O#d%&e#d B-0 B&!:ne## R-0 4!A##en R40 /e&s&n,er RS0 4!K&n#e$ 4-. Intr'eno"s
h$*erton&! s#&ne &nd"!es %os &))"nore!t&'&t$ &n ne"rons thro",ho"t the #)&n
ter)&n#&s. Brain "esearch. 1EE1L<;151<161<;
111. En, R0 4&se#&s RR. Po#$d&*s& nd 7o#&t&on o% n,&otens&n6&nd"!ed dr&n:&n, %ter
trnse!t&ons o% s"7%orn&!# or,n e%%erent *roKe!t&ons &n the rt. Brain "es.
1E?1L11<5133613;
111. F&tBs&)ons -T0 S&)ons B-. The e%%e!t on dr&n:&n, &n the rt o% &ntr'eno"s
&n%"s&on o% n,&otens&n0 ,&'en #one or &n !o)7&nt&on 9&th other st&)"#& o% th&rst.
Journal of Physiology. 1E;EL13>5@<6<2
11>. Kr"se EG0 4e#horn S-0 D'&s -F0 S!ott KA0 4 LY0 De K#oet AD0 Beno&t SC0
/oods SC0 S:& RR. An,&otens&n t$*e 1 re!e*tors &n the s"7%orn&!# or,n
)ed&te the dr&n:&n, nd h$*oth#)&!6*&t"&tr$6dren# res*onse to s$ste)&!
&so*rotereno#. Endocrinology. 133?L1@E5;@1;6;@1@
11@. L&nd R/0 -ohnson AK. S"7%orn&!# or,n6)ed&n *reo*t&! !onne!t&ons nd
dr&n:&n, nd *ressor res*onses to n,&otens&n &&. Journal of Neuroscience.
1E?1L1513@>613<1
11<. 4n,&*ne 4L0 S&)*son -B. S"7%orn&!# or,n5 Fore7r&n s&te o% *ressor nd
d&*so,en&! !t&on o% n,&otens&n &&. merican Journal of Physiology - "egulatory
Integrative and !omparative Physiology. 1E?3L?
11;. S&)*son -B0 Ro"tten7er, A. S"7%orn&!# or,n5 S&te o% dr&n:&n, e#&!&tt&on 7$
n,&otens&n &&. Science. 1E2>L1?1511216112<
112. S&)*son -B0 Ro"tten7er, A0 B",,$ -0 F&sher AE0 Ho%%)n /E0 -ohnson AK0
Ph&##&*s 4I. S"7%orn&!# or,n5 A d&*so,en&! s&te o% !t&on o% n,&otens&n &&.
Science. 1E2?L1315>2E6>?3
11?. 4!K&n#e$ 4-0 Bdoer E0 O#d%&e#d B-. Intr'eno"s n,&otens&n && &nd"!es %os6
&))"nore!t&'&t$ &n !&r!")'entr&!"#r or,ns o% the #)&n ter)&n#&s. Brain
"esearch. 1EE1L<E@51E<6>33
11E. 4!K&n#e$ 4-0 Bdoer E0 V&'s L0 O#d%&e#d B-. Co)*r&son o% !6%os e(*ress&on &n
the #)&n ter)&n#&s o% !ons!&o"s rts %ter &ntr'eno"s or &ntr!ere7ro'entr&!"#r
n,&otens&n. Brain "esearch Bulletin. 1EE<L>251>161>2
1>3. 4!K&n#e$ 4-0 Co#'&## L40 G&#es 4E0 O#d%&e#d B-. D&str&7"t&on o% %os6
&))"nore!t&'&t$ &n rt 7r&n %o##o9&n, d&*so,en&! dose o% !*to*r&# nd e%%e!ts
o% n,&otens&n re!e*tor 7#o!:de. Brain "esearch. 1EE2L2@25@>6<1
1>1. Ro9#nd NE0 L& BH0 RoBe##e AK0 Fre,#$ 4-0 Gr!& 40 S)&th GC. Lo!#&Bt&on
o% !hn,es &n &))ed&te er#$ ,enes &n 7r&n &n re#t&on to h$dro)&ner# 7#n!e5
Intr'eno"s n,&otens&n &&. Brain "esearch Bulletin. 1EE@L>>5@126@>;
132
1>1. G&#es 4E0 Fern#e$ RT0 N:)"r Y0 4oe##er I0 A#dred GP0 Ferrro T0 Pens!ho9
-D0 4!K&n#e$ 4-0 O#d%&e#d B-. Chr!ter&Bt&on o% s*e!&%&! nt&7od$ to the rt
n,&otens&n && t1 re!e*tor. Journal of -istochemistry and !ytochemistry.
1EEEL@25<326<1<
1>>. O#d%&e#d B-0 4!K&n#e$ 4-. D&str&7"t&on o% %os &n *t 7r&n res"#t&n, %ro)
endo,eno"s#$ ,enerted n,&otens&n &&. $idney International. 1EE@L@;51<;261<;E
1>@. 4&se#&s RR. The e%%erent *roKe!t&ons o% the s"7%orn&!# or,n o% the rt5 A
!&r!")'entr&!"#r or,n 9&th&n ne"r# net9or: s"7ser'&n, 9ter 7#n!e. Brain
"esearch. 1E?1L1>35161>
1><. S*er CB0 Le'&sohn D. A%%erent !onne!t&ons o% the )ed&n *reo*t&! n"!#e"s &n the
rt5 Anto)&!# e'&den!e %or !rd&o's!"#r &nte,rt&'e )e!hn&s) &n the
ntero'entr# th&rd 'entr&!"#r C'>'D re,&on. Brain "esearch. 1E?>L1??5116>1
1>;. S9nson L/0 L&nd R/. Ne"r# *roKe!t&ons s"7ser'&n, the &n&t&t&on o% s*e!&%&!
)ot&'ted 7eh'&or &n the rt5 Ne9 *roKe!t&ons %ro) the s"7%orn&!# or,n. Brain
"esearch. 1E?;L>2E5>EE6@3>
1>2. B",,$ -0 -ohnson AK. An,&otens&n6&nd"!ed th&rst5 E%%e!ts o% th&rd 'entr&!#e
o7str"!t&on nd *er&'entr&!"#r 7#t&on. Brain "esearch. 1E2?L1@E5112611?
1>?. L&nd R/0 Th"nhorst RL0 -ohnson AK. The s"7%orn&!# or,n nd the &nte,rt&on
o% )"#t&*#e %!tors &n th&rst. Physiology and Behavior. 1E?@L>15;E62@
1>E. OVNe&## TP0 Brod$ 4-. Ro#e %or the )ed&n *reo*t&! n"!#e"s &n !entr##$ e'o:ed
*ressor res*onses. merican Journal of Physiology - "egulatory Integrative and
!omparative Physiology. 1E?2L1<1
1@3. S:& K0 A,ssnd&n K0 4or&)oto S0 S&nn$h P0 Csse## 4D0 D'&sson RL0
S&,)"nd CD. Lo!# *rod"!t&on o% n,&otens&n && &n the s"7%orn&!# or,n !"ses
e#e'ted dr&n:&n,. Journal of !linical Investigation. 1332L112513??613E<
1@1. LBrt&,"es E0 S&nn$h P0 A",o$rd G0 Ghr&7 C0 -ohnson AK0 D'&sson RL.
Enhn!ed 9ter nd s#t &nt:e &n trns,en&! )&!e 9&th 7r&n6restr&!ted
o'ere(*ress&on o% n,&otens&n Ct^s"7t1^As"7tD re!e*tors. merican Journal of
Physiology - "egulatory Integrative and !omparative Physiology. 133?L1E<
1@1. G"t:&nd -S0 K"r&hr 40 Cstren E0 S'edr -4. In!resed !on!entrt&on o%
n,&otens&n && 7&nd&n, s&tes &n se#e!ted 7r&n res o% s*ontneo"s#$ h$*ertens&'e
rts. Journal of -ypertension. 1E??L;52E6?@
1@>. PmreB6De#,do 4D40 Cr)on6C#ero E0 4rrero6Gord&##o N0 PmreB6GonBN#eB
H0 CstOe$r6Perdo)o A. E%%e!t o% h$*ertens&on on the n,&otens&n && %&7res
rr&'&n, t the *oster&or #o7e o% the h$*o*h$s&s o% the rt. An
&))"noh&sto!he)&!# st"d$. -istology and -istopathology. 1333L1<52>622
1@@. /r&,ht -/0 Ro7erts KA0 Hrd&n, -/. Dr&n:&n, to &ntr!ere7ro'entr&!"#r#$
&n%"sed n,&otens&n &&0 &&& nd &' &n the shr. Peptides. 1E??LE5E2E6E?@
1@<. Brth S/0 Gerst7er,er R. D&%%erent&# re,"#t&on o% n,&otens&no,en nd t1
re!e*tor )rn 9&th&n the rt s"7%orn&!# or,n d"r&n, deh$drt&on. Brain "es Mol
Brain "es. 1EEEL;@51<161;@
133
1@;. H9n, BH0 /" -Y0 Se'ers /B. E%%e!ts o% !hron&! deh$drt&on on n,&otens&n &&
re!e*tor 7&nd&n, &n the s"7%orn&!# or,n0 *r'entr&!"#r h$*oth#)&! n"!#e"s
nd dren# )ed"## o% #on,6e'ns rts. Neuroscience +etters. 1E?;L;<5><6@3
1@2. NBr#& A-0 G"t:&nd -S0 S'edr -4. Re,"#t&on o% n,&otens&n && 7&nd&n, s&tes
&n the s"7%orn&!# or,n nd other rt 7r&n n"!#e& %ter 9ter de*r&'t&on.
!ellular and Molecular Neurobiology. 1E?2L25@@26@<<
1@?. Sn'&tto GL0 -uvhren O0 Huw"ser /0 S'edr -4. /ter de*r&'t&on
"*re,"#tes n, && t1 7&nd&n, nd )rn &n rt s"7%orn&!# or,n nd nter&or
*&t"&tr$. merican Journal of Physiology - Endocrinology and Metabolism.
1EE2L12>
1@E. /e& SG0 Y" Y0 Mhn, MH0 Fe#der RB. An,&otens&n && "*re,"#tes h$*oth#)&!
t^s"7t1^As"7t re!e*tor e(*ress&on &n rts '& the )&to,en6!t&'ted *rote&n
:&nse *th9$. merican Journal of Physiology - -eart and !irculatory
Physiology. 133EL1E;
1<3. /e& SG0 Y" Y0 Mhn, MH0 /e&ss R40 Fe#der RB. 4&to,en6!t&'ted *rote&n
:&nses )ed&te "*re,"#t&on o% h$*oth#)&! n,&otens&n && t$*e 1 re!e*tors &n
hert %&#"re rts. -ypertension. 133?L<15;2E6;?;
1<1. Bo"r+"e C/0 Vo&s&n DL0 Ch:%e Y. Stret!h6&n!t&'ted !t&on !hnne#s5 Ce##"#r
tr,ets %or )od"#t&on o% os)osens&t&'&t$ &n s"*ro*t&! ne"rons. Progress in
Brain "esearch. 1331L1>E5?<6E@
1<1. Bo"r+"e C/0 O#&et SH. Os)ore!e*tors &n the !entr# ner'o"s s$ste). nnual
"evie# of Physiology. 1EE2L<E5;316;1E
1<>. H))"r 40 N"neB D-0 Len, G0 E)son PC0 K&$) H. C6%os )$ !ode %or
!o))on trns!r&*t&on %!tor 9&th&n the h$*oth#)&! ne"r# !&r!"&ts &n'o#'ed &n
os)ore,"#t&on. Brain "es. 1EE1L<215@16<1
1<@. 4!K&n#e$ 4-0 B&!:ne## R-0 Hrds D0 4!A##en R40 V&'s L0 /e&s&n,er RS0
O#d%&e#d B-. E%%erent ne"r# *th9$s o% the #)&n ter)&n#&s s"7ser'&n,
os)ore,"#t&on. Prog Brain "es. 1EE1LE15>E<6@31
1<<. X" M0 Her7ert -. E%%e!ts o% "n&#ter# or 7&#ter# #es&ons 9&th&n the ntero'entr#
th&rd 'entr&!"#r re,&on on !6%os e(*ress&on &nd"!ed 7$ deh$drt&on or n,&otens&n
&& &n the s"*ro*t&! nd *r'entr&!"#r n"!#e& o% the h$*oth#)"s. Brain "es.
1EE;L21>5>;6@>
1<;. Ren"d LP. Cns *th9$s )ed&t&n, !rd&o's!"#r re,"#t&on o% 'so*ress&n.
!linical and Experimental Pharmacology and Physiology. 1EE;L1>51<261;3
1<2. Fer,"son AV. S$ste)&! n,&otens&n !ts t s"7%orn&!# or,n to %!&#&tte !t&'&t$
o% ne"roh$*o*h$s&# ne"rons. merican Journal of Physiology1 +egacy !ontent.
1E?;L1<15R211
1<?. Kne*e# /0 N"tto D0 4e$er DK. E%%e!t o% trnse!t&on o% s"7%orn&!# or,n e%%erent
*roKe!t&ons on 'so*ress&n re#ese &nd"!ed 7$ n,&otens&n or &so*ren#&ne &n the
rt. Brain "esearch. 1E?1L1@?51?361?@
1<E. D$ TA0 C&r&e##o -. A%%erent ren# ner'e st&)"#t&on e(!&tes s"*ro*t&! 'so*ress&n
ne"rons. %he merican &ournal of physiology. 1E?<L1@E5R>;?6>21
134
1;3. D$ TA0 C&r&e##o -. E%%e!ts o% ren# re!e*tor !t&'t&on on ne"rose!retor$
'so*ress&n !e##s. merican Journal of Physiology - "egulatory Integrative and
!omparative Physiology. 1E?2L1<>
1;1. S!hre&ho%er A40 Ho%%)n GE0 S'ed AF. The :&dne$s st&)"#te 'so*ress&n
re#ese d"r&n, he)orrh,e &n rts 9&th !hron&! nts #es&ons. merican Journal of
Physiology - "egulatory Integrative and !omparative Physiology.
1EE2L1215R1<@36R1<<1
1;1. S&)on -K0 Kst&n, N/0 C&r&e##o -. A%%erent ren# ner'e e%%e!ts on *#s)
'so*ress&n nd o($to!&n &n !ons!&o"s rts. merican Journal of Physiology -
"egulatory Integrative and !omparative Physiology. 1E?EL1<;
1;>. c"&# A/0 /oods RL0 Korner PI. Crd&! nd rter&# 7rore!e*tor &n%#"en!es &n
re#ese o% 'so*ress&n nd ren&n d"r&n, he)orrh,e. merican Journal of
Physiology - -eart and !irculatory Physiology. 1E?2L1<1
1;@. Shen E0 D"n SL0 Ren C0 Bennett6C#r:e C0 D"n N-. H$*otens&on *re%erent&##$
&nd"!es !6%os &))"nore!t&'&t$ &n s"*ro*t&! 'so*ress&n ne"rons. Brain "es.
1EE1L<E>51>;61>E
1;<. Shen YT0 Co9#e$ A/0 -r.0 Vtner SF. Re#t&'e ro#es o% !rd&! nd rter&#
7rore!e*tors &n 'so*ress&n re,"#t&on d"r&n, he)orrh,e &n !ons!&o"s do,s.
!irc "es. 1EE1L;?51@1161@>;
1;;. Sh&r&sh& Y0 F"K&)"r S0 Hnd 40 K&)"r T0 Ot K0 N:d T. Vso*ress&n nd
tr&# ntr&"ret&! *e*t&de re#ese &n !rd&o*"#)onr$ dener'ted do,s. m J
Physiol. 1EE3L1<?5R23@6213
1;2. CrreOo FR0 -& LL0 C"nn&n,h) -T. A#tered !entr# tr*'@ e(*ress&on nd #&*&d r%t
sso!&t&on re#ted to &n**ro*r&te 'so*ress&n se!ret&on &n !&rrhot&! rts.
merican Journal of Physiology - "egulatory Integrative and !omparative
Physiology. 133EL1E;
1;?. Cto 4-0 Tone$ G4. An,&otens&n && e(!&tes *r'entr&!"#r n"!#e"s ne"rons tht
&nner'te the rostr# 'entro#ter# )ed"##5 An &n '&tro *t!h6!#)* st"d$ &n 7r&n
s#&!es. Journal of Neurophysiology. 133<LE>5@3>6@1>
1;E. Chen cH0 Tone$ G4. At16re!e*tor 7#o!:de &n the h$*oth#)&! *'n red"!es
!entr# h$*eros)o##&t$6&nd"!ed ren# s$)*thoe(!&tt&on. m J Physiol "egul
Integr !omp Physiol. 1331L1?15R1?@@61?<>
123. OB 40 Yn, K6H0 OVDono'n 4-0 Ren"d LP. Pres$n*t&! n,&otens&n && t1
re!e*tors enhn!e &nh&7&tor$ nd e(!&ttor$ s$n*t&! ne"rotrns)&ss&on to
)otone"rons nd other 'entr# horn ne"rons &n neont# rt s*&n# !ord. Journal
of Neurophysiology. 133<LE@51@3<61@11
121. Y. OB:& AS-NT4YU. Potent&t&on 7$ n,&otens&n && o% s*ontneo"s e(!&ttor$
*osts$n*t&! !"rrents &n rt s"*ro*t&! ),no!e##"#r ne"rones. Journal of
Neuroendocrinology. 133@L1;5?216?2E
121. Ch:%e Y0 Bo"r+"e C/. Pe*t&der,&! e(!&tt&on o% s"*ro*t&! n"!#e"s ne"rons5
In'o#'e)ent o% stret!h6&n!t&'ted !t&on !hnne#s. Experimental Neurology.
1331L1215113611?
135
12>. Cro+"et V0 4o# F0 Ve# N0 /n, -0 O7ert& F0 Ro"( -0 V"&##e)&n E0 G##o&s Y0
Do"$ O0 Ch**rd D0 C#es P. He)od$n)&! nd nt&%&7rot&! e%%e!ts o% #osrtn
&n rts 9&th #&'er %&7ros&s ndAor *ort# h$*ertens&on. J -epatol. 1331L>2522>62?3
12@. Yn, YY0 L&n HC0 H"n, YT0 Lee TY0 Ho" 4C0 Lee FY0 L&" RS0 Chn, FY0 Lee
SD. E%%e!t o% 169ee: #osrtn d)&n&strt&on on 7&#e d"!t6#&,ted !&rrhot&! rts
9&th *ort# h$*ertens&on. Journal of -epatology. 1331L>;5;336;3;
12<. Os7orn -/0 F&n: GD0 S'ed AF0 Tone$ G40 R&Bd 4K. C&r!"#t&n, n,&otens&n
&& nd d&etr$ s#t5 Con'er,&n, s&,n#s %or ne"ro,en&! h$*ertens&on. !urrent
-ypertension "eports. 1332LE511?61><
12;. 4!K&n#e$ 4-0 -ohnson AK. The *h$s&o#o,&!# re,"#t&on o% th&rst nd %#"&d
&nt:e. Ne#s in Physiological Sciences. 133@L1E516;
122. A##en A40 4oe##er I0 -en:&ns TA0 Mh"o -0 A#dred GP0 Ch& SY0 4ende#sohn FAO.
An,&otens&n re!e*tors &n the ner'o"s s$ste). Brain "esearch Bulletin.
1EE?L@251261?
12?. Gro7 40 Trott&er -F0 4o",&not D. Hetero,eneo"s !o6#o!#&Bt&on o% t1 re!e*tor
nd %os *rote&n &n %ore7r&n ne"ron# *o*"#t&ons res*ond&n, to !"te
h$dro)&ner# de%&!&t. Brain "esearch. 133@LEE;5?16??
12E. Porter -P0 Ph&##&*s A0 R&!h -0 /r&,ht D. E%%e!t o% !hron&! stress on the !rd&!
7rore%#e( &n the *ost69en#&n, rt. +ife Sci. 133@L2<51<E<61;32
1?3. M&))er)n 4C0 LBrt&,"es E0 Shr) RV0 D'&sson RL. H$*ertens&on !"sed
7$ n,&otens&n && &n%"s&on &n'o#'es &n!resed s"*ero(&de *rod"!t&on &n the !entr#
ner'o"s s$ste). !irculation "esearch. 133@LE<5113611;
1?1. P(&nos G0 /tson C. %he rat brain in stereotaxic coordinates. Sn D&e,o5
A!de)&! PressL 1EE2.
1?1. CrreOo FR0 /#!h -0 C"nn&n,h) -T. Bdn%6tr:7 *th9$ )ed&tes n)d
re!e*tor nr17 s"7"n&t *hos*hor$#t&on &n the s"*ro*t&! n"!#e& %o##o9&n,
*ro,ress&'e deh$drt&on. Journal of neuroendocrinology. 1311
1?>. Ned"n,d& TP0 Crreno FR0 /#!h -D0 Bth&n CS0 C"nn&n,h) -T. Re,&on
s*e!&%&! !hn,es &n tr*' !hnne# e(*ress&on &n the 'so*ress&n ),no!e##"#r
s$ste) &n he*t&! !&rrhos&s &nd"!ed h$*ontre)&. J Neuroendocrinol. 1311
1?@. L&': K-0 S!h)&tt,en TD. An#$s&s o% re#t&'e ,ene e(*ress&on dt "s&n, re#6
t&)e +"nt&tt&'e *!r nd the 16hde#tihde#ti!t )ethod. Methods. 1331L1<5@316
@3?
1?<. S!h)&tt,en TD0 L&': K-. An#$B&n, re#6t&)e *!r dt 7$ the !o)*rt&'e !CtD
)ethod. Nature protocols. 133?L>511316113?
1?;. H"n, BS0 Ah)d 40 Tn -0 Leenen FHH. Chron&! !entr# 'ers"s s$ste)&!
7#o!:de o% t^s"7t1^As"7t re!e*tors nd !rd&! d$s%"n!t&on &n rts *ost6
)$o!rd&# &n%r!t&on. merican Journal of Physiology - -eart and !irculatory
Physiology. 133EL1E2
1?2. F&tts DA0 Lne -R0 Str7"!: E40 L& CP. Dr&n:&n, nd 7#ood *ress"re d"r&n,
sod&") de*#et&on or n, && &n%"s&on &n !hron&! !ho#estt&! rts. merican Journal
of Physiology - "egulatory Integrative and !omparative Physiology. 1EEEL12;
136
1??. Lne -R0 Lo"&e S0 Lee P0 F&tts DA. Ind"!ed *re%eren!e or !ond&t&oned 'ers&on %or
sod&") !h#or&de &n rts 9&th !hron&! 7&#e d"!t #&,t&on. Physiology and Behavior.
1EE?L;>5<>26<@>
1?E. Fre,#$ 4-0 P"#d&n, /0 Ro9#nd NE. Co)*r&son o% the d&*so,en&!
res*ons&'eness o% #on,6e'ns nd s*r,"e6d9#e$ rts. Physiol Behav.
1EE3L@2511?2611E1
1E3. /n, -40 Veers&n,h) S-0 Tn -0 Leenen FH. E%%e!ts o% h&,h s#t &nt:e on
7r&n t1 re!e*tor dens&t&es &n dh# rts. m J Physiol -eart !irc Physiol.
133>L1?<5H1E@E61E<<
1E1. Chen Y0 D Ro!h 4-A0 4orr&s 4. Os)ot&! re,"#t&on o% n,&otens&n t1
re!e*tor s"7t$*es &n )o"se 7r&n. Brain "esearch. 133>LE;<5><6@@
1E1. Mhn, MH0 Y" Y0 Kn, Y40 /e& SG0 Fe#der RB. A#dosterone !ts !entr##$ to
&n!rese 7r&n ren&n6n,&otens&n s$ste) !t&'&t$ nd o(&dt&'e stress &n nor)#
rts. m J Physiol -eart !irc Physiol. 133?L1E@5H13;26132@
1E>. Mhn, MH0 Y" Y0 /e& SG0 Fe#der RB. A#dosterone6&nd"!ed 7r&n )*: s&,n#&n,
nd s$)*thet&! e(!&tt&on re n,&otens&n && t$*e61 re!e*tor de*endent.
merican Journal of Physiology - -eart and !irculatory Physiology.
1311L>315H2@16H2<1
1E@. Y" Y0 /e& SG0 Mhn, MH0 Go)eB6Sn!heB E0 /e&ss R40 Fe#der RB. Does
#dosterone "*re,"#te the 7r&n ren&n6n,&otens&n s$ste) &n rts 9&th hert
%&#"rer -ypertension. 133?L<1521262>>
1E<. F"nder -/. 4&n&re'&e95 A#dosterone nd )&ner#o!ort&!o&d re!e*tors5 Pst0
*resent0 nd %"t"re. Endocrinology. 1313L1<15<3E?6<131
1E;. H"n, BS0 Leenen FHH. 4&ner#o!ort&!o&d !t&ons &n the 7r&n nd h$*ertens&on.
!urrent -ypertension "eports. 1311L1>511@6113
1E2. L&" D0 Go L0 Ro$ SK0 Corn&sh KG0 M"!:er IH. Ne"ron# n,&otens&n && t$*e 1
re!e*tor "*re,"#t&on &n hert %&#"re5 A!t&'t&on o% !t&'tor *rote&n 1 nd K"n n6
ter)&n# :&nse. !irc "es. 133;LEE5133@61311
1E?. L&" D0 Go L0 Ro$ SK0 Corn&sh KG0 M"!:er IH. Ro#e o% o(&dnt stress on t1
re!e*tor e(*ress&on &n ne"rons o% r77&ts 9&th hert %&#"re nd &n !"#t"red
ne"rons. !irc "es. 133?L13>51?;61E>
1EE. 4&tr AK0 Go L0 M"!:er IH. An,&otens&n &&6&nd"!ed "*re,"#t&on o%
t^s"7t1^As"7t re!e*tor e(*ress&on5 Se+"ent&# !t&'t&on o% n%6a7 nd e#:61 &n
ne"rons. merican Journal of Physiology - !ell Physiology. 1313L1EE
133. B"rson -40 A,"&#er G0 Gross K/0 S&,)"nd CD. D&%%erent&# e(*ress&on o%
n,&otens&n re!e*tor 1 nd 17 &n )o"se. M)J)P-4SI/+) 1EE@L1;25E1;36E1;2
131. I9& N0 In,)& T0 Oh)&!h& N0 N:)"r Y0 Se:& Y0 K&nosh&t 4. D&%%erent&#
re,"#t&on o% rt t1 nd t17 re!e*tor )rn. Biochemical and Biophysical
"esearch !ommunications. 1EE1L1??51E?6>3>
131. L#orens6Cortes C0 Green7er, B0 H"n, H0 Cor'o# P. T&ss"#r e(*ress&on nd
re,"#t&on o% t$*e 1 n,&otens&n && re!e*tor s"7t$*es 7$ +"nt&tt&'e re'erse
trns!r&*tse6*o#$)erse !h&n re!t&on n#$s&s. -ypertension. 1EE@L1@5<>?6<@?
137
13>. Ch&" AT0 D"ns!o)7 -0 Kos&ero9s:& -0 B"rton CRA0 Snto)enn LD0 CorK$ 4H0
Ben%&e#d P. The #&,nd 7&nd&n, s&,nt"res o% the rt tC1D0 tC17D nd the h")n
t1 re!e*tors re essent&##$ &dent&!#. Biochemical and Biophysical "esearch
!ommunications. 1EE>L1E25@@36@@E
13@. D'&sson RL. D&'er,ent %"n!t&ons o% n,&otens&n && re!e*tor &so%or)s &n the 7r&n.
%he Journal of clinical investigation. 1333L13;513>613;
13<. Chen Y0 Chen H0 Ho%%)nn A0 Coo# DR0 D&B DI0 Ch**e## 4C0 Chen A0 4orr&s
4. Adeno'&r"s6)ed&ted s)##6&nter%eren!e rn %or &n '&'o s&#en!&n, o%
n,&otens&n t1 re!e*tors &n )o"se 7r&n. -ypertension. 133;L@251>361>2
13;. X"e B0 Be#tB TG0 Y" Y0 G"o F0 Go)eB6Sn!heB CE0 H$ 40 -ohnson AK. Centr#
&nter!t&ons o% #dosterone nd n,&otens&n && &n #dosterone6 nd n,&otens&n &&6
&nd"!ed h$*ertens&on. merican Journal of Physiology - -eart and !irculatory
Physiology. 1311L>33
132. Ho))e# -D0 Sers R40 Geor,es!" D0 S&))ons DL0 D&Leone R-. Lo!# ,ene
:no!:do9n &n the 7r&n "s&n, '&r#6)ed&ted rn &nter%eren!e. Nat Med.
133>LE51<>E61<@@
13?. Ar)stron, /E. 4or*ho#o,&!# nd e#e!tro*h$s&o#o,&!# !#ss&%&!t&on o%
h$*oth#)&! s"*ro*t&! ne"rons. Progress in Neurobiology. 1EE<L@251E16>>E
13E. C"nn&n,h) -T0 Penn$ 4L0 4"r*h$ D. Crd&o's!"#r re,"#t&on o% s"*ro*t&!
ne"rons &n the rt5 S$n*t&! &n*"ts nd !e##"#r s&,n#s. Progress in Biophysics
and Molecular Biology. 133@L?@51?>61E;
113. Fer,"son AV0 Lt!h%ord K-. Lo!# !&r!"&tr$ re,"#tes the e(!&t7&#&t$ o% rt
ne"roh$*o*h$s&# ne"rones. Exp Physiol. 1333L?< S*e! No51<>S61;1S
111. Gr&ndst%% RR0 C"nn&n,h) -T. Crd&o's!"#r re,"#t&on o% 'so*ress&n ne"rons
&n the s"*ro*t&! n"!#e"s. Experimental Neurology. 1331L121511E611;
111. C"rrn T0 4or,n -I. Fos5 An &))ed&te6er#$ trns!r&*t&on %!tor &n ne"rons.
Journal of Neurobiology. 1EE<L1;5@3>6@11
11>. D)*ne$ RA0 Hor&"!h& -. F"n!t&on# or,n&st&on o% !entr# !rd&o's!"#r
*th9$s5 St"d&es "s&n, !6%os ,ene e(*ress&on. Progress in Neurobiology.
133>L215><E6>?@
11@. Herde,en T0 M&))er)nn 4. I))ed&te er#$ ,enes C&e,sD en!od&n, %or
&nd"!&7#e trns!r&*t&on %!tors C&t%sD nd ne"ro*e*t&des &n the ner'o"s s$ste)5
F"n!t&on# net9or: %or #on,6ter) *#st&!&t$ nd *&n. Progress in Brain "esearch.
1EE<L13@51EE6>11
11<. -& LL0 F#e)&n, T0 Penn$ 4L0 Tone$ G40 C"nn&n,h) -T. E%%e!ts o% 9ter
de*r&'t&on nd reh$drt&on on !6%os nd %os7 st&n&n, &n the rt s"*ro*t&!
n"!#e"s nd #)&n ter)&n#&s re,&on. m J Physiol "egul Integr !omp Physiol.
133<L1??5R>116>11
11;. CrreOo FR0 /#!h -D0 D"tt 40 Ned"n,d& TP0 C"nn&n,h) -T. Br&n6der&'ed
ne"rotro*h&! %!tor6t$ros&ne :&nse 7 *th9$ )ed&tes n)d re!e*tor nr17
s"7"n&t *hos*hor$#t&on &n the s"*ro*t&! n"!#e& %o##o9&n, *ro,ress&'e
deh$drt&on. Journal of Neuroendocrinology. 1311L1>5?E@6E3<
138
112. C"nn&n,h) -T0 Ned"n,d& TP0 /#!h -D0 Nest#er E-0 Gott#&e7 HB. xde#ty%os7
&n the s"*ro*t&! n"!#e"s !ontr&7"tes to h$*ontre)& &n rts 9&th !&rrhos&s. m J
Physiol "egul Integr !omp Physiol. 1311
11?. Crreno FR0 -& LL0 C"nn&n,h) -T. A#tered !entr# tr*'@ e(*ress&on nd #&*&d r%t
sso!&t&on re#ted to &n**ro*r&te 'so*ress&n se!ret&on &n !&rrhot&! rts. m J
Physiol "egul Integr !omp Physiol. 133EL1E;5R@<@6@;;
11E. Bernrd& 40 Snt& L. Ren# sod&") retent&on &n *re6s!&t&! !&rrhos&s5 The )ore 9e
:no9 7o"t the *"BB#e0 the )ore &t 7e!o)es &ntr&!te. Journal of -epatology.
1313L<>52E362E1
113. G&r,rh N0 L&" P0 Co##&er -0 B#end&s L0 /on, F. He)od$n)&!0 ren# sod&")
hnd#&n,0 nd ne"rohor)on# e%%e!ts o% !"te d)&n&strt&on o% #o9 dose #osrtn0
n n,&otens&n && re!e*tor nt,on&st0 &n *res!&t&! !&rrhos&s. .ut. 1333L@;511@6113
111. /on, F0 L&" P0 B#end&s L. The )e!hn&s) o% &)*ro'ed sod&") ho)eosts&s o%
#o96dose #osrtn &n *res!&t&! !&rrhos&s. -epatology. 1331L><51@@E61@<?
111. Snsoe G0 Ferrr& A0 Br#d& E0 Cste##n CN0 De Snt&s 4C0 4nent& F. Ren#
d&st# t"7"#r hnd#&n, o% sod&") &n !entr# %#"&d 'o#")e ho)oeosts&s &n
*res!&t&! !&rrhos&s. .ut. 1EEEL@<52<362<<
11>. G&nes P0 Crdens A0 Arro$o V0 Rodes -. 4n,e)ent o% !&rrhos&s nd s!&tes. N
Engl J Med. 133@L><351;@;61;<@
11@. B"ndB&:o' -0 P&rn&: M0 L!:o'&!o' L0 4r'e! B0 K&ss A. A!t&'t&on o% d&%%erent
ne"ron# *henot$*es &n the rt 7r&n &nd"!ed 7$ #&'er &s!he)&6re*er%"s&on &nK"r$5
D"# %osAne"ro*e*t&de &))"noh&sto!he)&str$. !ell Mol Neurobiol. 1311L>151E>6
>31
11<. Ar)stron, /E. The ne"ro*h$s&o#o,$ o% ne"rose!retor$ !e##s. Journal of
Physiology. 1332L<?<5;@<6;@2
11;. Htton GI. O($to!&n nd 'so*ress&n ne"rones5 V&'e # d&%%eren!ez Journal of
Physiology. 1EE2L<3351?@
112. Ren"d LP0 Bo"r+"e C/. Ne"ro*h$s&o#o,$ nd ne"ro*hr)!o#o,$ o%
h$*oth#)&! ),no!e##"#r ne"rons se!ret&n, 'so*ress&n nd o($to!&n.
Progress in Neurobiology. 1EE1L>;51>161;E
11?. X& D0 K"sno K0 G&ner H. c"nt&tt&'e n#$s&s o% o($to!&n nd 'so*ress&n
)essen,er r&7on"!#e&! !&ds &n s&n,#e ),no!e##"#r ne"rons &so#ted %ro)
s"*ro*t&! n"!#e"s o% rt h$*oth#)"s. Endocrinology. 1EEEL1@35@;226@;?1
11E. Bo"r+"e C/. Centr# )e!hn&s)s o% os)osenst&on nd s$ste)&!
os)ore,"#t&on. Nature revie#s) Neuroscience. 133?LE5<1E6<>1
1>3. Pr,er6Kho"tors:$ 40 Bo"r+"e C/. Os)osenst&on &n 'so*ress&n ne"rons5
Chn,&n, !t&n dens&t$ to o*t&)&Be %"n!t&on. %rends in Neurosciences.
1313L>>52;6?>
1>1. Len, G0 Bro9n CH0 R"sse## -A. Ph$s&o#o,&!# *th9$s re,"#t&n, the !t&'&t$ o%
),no!e##"#r ne"rose!retor$ !e##s. Progress in Neurobiology. 1EEEL<25;1<6;<<
1>1. K9s:& 40 PonB&o TA0 Y"e C0 F&e#ds RL0 G&ner H. Ne"rotrns)&tter
re,"#t&on o% !6%os nd 'so*ress&n ,ene e(*ress&on &n the rt s"*ro*t&! n"!#e"s.
Experimental Neurology. 133EL11E51116111
139
1>>. K9s:& 40 Y),"!h& K0 S&to -0 OB:& Y0 4er T0 Hsh&)oto H0 F"K&hr H0
O:&)oto N0 Ohn&sh& H0 N:)"r T0 Uet Y. E(*ress&on o% &))ed&te er#$
,enes nd 'so*ress&n heteron"!#er rn &n the *r'entr&!"#r nd s"*ro*t&!
n"!#e& o% rts %ter !"te os)ot&! st&)"#"s. Journal of Neuroendocrinology.
133<L12511261>2
1>@. Co#o)7r& DS0 Co#o)7r& E0 Fre&r&6O#&'e&r AH0 Ant"nes V0 Yo ST0 H&nd)r!h
C0 Fer,"son AV0 Fr$ 40 4"r*h$ D0 Pton -F. S9&t!h&n, !ontro# o% s$)*thet&!
!t&'&t$ %ro) %ore7r&n to h&nd7r&n &n !hron&! deh$drt&on. J Physiol. 1311
1><. B"r7!h -P0 L"!:)n S40 4"r*h$ D0 G&ner H. Gene re,"#t&on &n the
),no!e##"#r h$*oth#)o6ne"roh$*o*h$s&# s$ste). Physiol "ev.
1331L?1511E2611;2
1>;. G&ner H. Ce##6t$*e s*e!&%&! e(*ress&on o% o($to!&n nd 'so*ress&n ,enes5 An
e(*er&)ent# od$sse$. Journal of Neuroendocrinology. 1311L1@5<1?6<>?
1>2. G#s,o9 E0 K"sno K0 Ch&n H0 4eBe$ {0 Yo"n, I&& /S0 G&ner H. S&n,#e !e##
re'erse trns!r&*t&on6*o#$)erse !h&n re!t&on n#$s&s o% rt s"*ro*t&!
),no!e##"#r ne"rons5 Ne"ro*e*t&de *henot$*es nd h&,h 'o#t,e6,ted !#!&")
!hnne# s"7t$*es. Endocrinology. 1EEEL1@35<>E16<@31
1>?. Bro9n CH0 R"n 40 S!ott V0 To7&n VA0 L"d9&, 4. 4"#t&6%!tor&# so)to6
dendr&t&! re,"#t&on o% *hs&! s*&:e d&s!hr,e &n 'so*ress&n ne"rons.
133?L123511E611?
1>E. S7t&er N0 Bro9n CH0 L"d9&, 40 Len, G. Phs&! s*&:e *ttern&n, &n rt
s"*ro*t&! ne"rones &n '&'o nd &n '&tro. Journal of Physiology. 133@L<<?51;16
1?3
1@3. Yosh&d 40 I9s:& Y0 As& 40 T:$s" S0 T,"!h& T0 Ito& K0 Hsh&)oto K0 O&so
Y. Ident&%&!t&on o% %"n!t&on# *1 e#e)ent &n the rt 'so*ress&n ,ene *ro)oter.
Endocrinology. 133;L1@251?<361?;>
1@1. 4!C#"n, CA0 U#er$ PG0 Perrott& LI0 M!hr&o" V0 Berton O0 Nest#er E-.
hde#ti%os75 A )o#e!"#r s9&t!h %or #on,6ter) d*tt&on &n the 7r&n. Molecular
Brain "esearch. 133@L1>151@;
1@1. V&#o" V0 Ro7&son A-0 LP#nt cC0 Co'&n,ton HE0 D&etB D40 Ohn&sh& YN0
4o"Bon E0 R"sh A-0 /tts EL0 /##!e DL0 In&,"eB SD0 Ohn&sh& YH0 Ste&ner
4A0 /rren BL0 Kr&shnn V0 Bo#nos CA0 Ne'e RL0 Ghose S0 Berton O0
T))&n, CA0 Nest#er E-. hde#ti%os7 &n 7r&n re9rd !&r!"&ts )ed&tes res&#&en!e
to stress nd nt&de*ressnt res*onses. Nat Neurosci. 1313L1>52@<62<1
1@>. L& C0 /n, /0 S"))er SN0 /est%## TD0 Broo:s DP0 F#: S0 S!hr&er R/.
4o#e!"#r )e!hn&s)s o% nt&d&"ret&! e%%e!t o% o($to!&n. J m Soc Nephrol.
133?L1E511<61>1
1@@. Cho" CL0 D&G&o'nn& SR0 4eK& R0 N&e#sen S0 Kne**er 4A. O($to!&n s n
nt&d&"ret&! hor)one. I. Con!entrt&on de*enden!e o% !t&on. m J Physiol.
1EE<L1;E5F23622
1@<. Denton D0 Shde R0 M)r&** F0 E,n G0 B#&r6/est -0 4!K&n#e$ 40 Ln!ster
-0 Fo( P. Ne"ro&),&n, o% ,enes&s nd st&t&on o% th&rst nd n &ntero!e*tor6
140
dr&'en theor$ o% or&,&ns o% *r&)r$ !ons!&o"sness. Proceedings of the National
cademy of Sciences of the 5nited States of merica. 1EEELE;5<>3@6<>3E
1@;. E,n G0 S&#: T0 M)rr&* F0 /&##&)s -0 Feder&!o P0 C"nn&n,ton R0 Cr7ott L0
B#&r6/est -0 Shde R0 4!K&n#e$ 40 Frre## 40 Ln!ster -0 -!:sons G0 Fo( P0
Denton D. Ne"r# !orre#tes o% the e)er,en!e o% !ons!&o"sness o% th&rst.
Proceedings of the National cademy of Sciences of the 5nited States of merica.
133>L13351<1@161<1@;
1@2. Frre## 4-0 Bo9# TK0 G'r&#es!" 40 Ph&##&*s PA0 4!K&n#e$ 4-0 4!A##en R40
Denton DA0 E,n GF. Cort&!# !t&'t&on nd #)&n ter)&n#&s %"n!t&on#
!onne!t&'&t$ d"r&n, th&rst nd dr&n:&n, &n h")ns. merican Journal of
Physiology - "egulatory Integrative and !omparative Physiology.
1311L>315R;1>6R;>1
1@?. Ho##&s -H0 4!K&n#e$ 4-0 DVSo"B 40 K)*e -0 O#d%&e#d B-. The trKe!tor$ o%
sensor$ *th9$s %ro) the #)&n ter)&n#&s to the &ns"#r nd !&n,"#te !orte(5 A
ne"ronto)&!# %r)e9or: %or the ,enert&on o% th&rst. m J Physiol "egul
Integr !omp Physiol. 133?L1E@5R1>E361@31
1@E. -ensen LL0 Hrd&n, -/0 /r&,ht -/. Ro#e o% *r'entr&!"#r n"!#e"s &n !ontro# o%
7#ood *ress"re nd dr&n:&n, &n rts. m J Physiol. 1EE1L1;15F13;?6132<
1<3. Ger%en CR0 S9!hen:o PE. An ntero,rde ne"ronto)&!# tr!&n, )ethod tht
sho9s the det&#ed )or*ho#o,$ o% ne"rons0 the&r (ons nd ter)&n#s5
I))"noh&sto!he)&!# #o!#&Bt&on o% n (on##$ trns*orted *#nt #e!t&n0
*hseo#"s '"#,r&s #e"!o,,#"t&n&n C*h6#D. Brain "esearch. 1E?@L1E3511E61>?
1<1. Son, CK0 S!h9rtB G-0 Brtness T-. Antero,rde trnsne"ron# '&r# tr!t tr!&n,
re'e#s !entr# sensor$ !&r!"&ts %ro) 9h&te d&*ose t&ss"e. merican Journal of
Physiology - "egulatory Integrative and !omparative Physiology.
133EL1E;5R<316R<11
1<1. ChtterKee K. H$*ontre)& &n hert %&#"re. Journal of Intensive !are Medicine.
133EL1@5>@26><1
1<>. B#ess&n, //0 /&##o",h7$ -O. Inh&7&t&n, the r77&t !"d# 'entro#ter# )ed"##
*re'ents 7rore!e*tor6&n&t&ted se!ret&on o% 'so*ress&n. J Physiol. 1E?<L>;251<>6
1;<
1<@. 4!A##en R40 B#ess&n, //. Ne"rons C*res")7#$ 16!e##sD *roKe!t&n, %ro) the
!"d# 'entro#ter# )ed"## to the re,&on o% the s"*ro*t&! n"!#e"s res*ond to
7rore!e*tor &n*"ts &n the r77&t. Neuroscience +etters. 1E?2L2>51@261<1
1<<. S9!hen:o PE0 S9nson L/. The or,n&Bt&on nd 7&o!he)&!# s*e!&%&!&t$ o%
%%erent *roKe!t&ons to the *r'entr&!"#r nd s"*ro*t&! n"!#e&. Progress in
Brain "esearch. 1E?>L;351E61E
1<;. S!hre&ho%er A40 Str&!:er E40 S'ed AF. Chron&! n"!#e"s tr!t"s so#&tr&"s #es&ons
do not *re'ent h$*o'o#e)&6 &nd"!ed 'so*ress&n se!ret&on &n rts. merican
Journal of Physiology - "egulatory Integrative and !omparative Physiology.
1EE@L1;25RE;<6RE2>
1<2. Le!hner A-0 Ve#s+"eB A0 Kn"dsen KR0 -ohnns CA0 Tr!$ TF0 -r.0 4t"s!h:
G4. Cho#estt&! #&'er &nK"r$ &n!reses !&r!"#t&n, tn%6#*h nd &#6; nd )ort#&t$
141
%ter es!her&!h& !o#& endoto(e)&. m J "espir !rit !are Med. 1EE?L1<251<<36
1<<?
1<?. G&ron6GonB#eB -A0 4rt&neB6S&err C0 Rodr&,"eB6R)os C0 4!&s 4A0
Rendon P0 D&B F0 FernndeB6G"t&erreB C0 4rt&n6Herrer L. I)*#&!t&on o%
&n%#))t&on6re#ted !$to:&nes &n the nt"r# h&stor$ o% #&'er !&rrhos&s. +iver Int.
133@L1@5@>26@@<
1<E. FernndeB64rt&neB E0 PereB6A#'reB V0 Ts"ts")& V0 Sh&7$) 40 4"r&e# P.
Chron&! 7&#e d"!t o7str"!t&on &nd"!es !hn,es &n *#s) nd he*t&! #e'e#s o%
!$to:&nes nd n&tr&! o(&de &n the rt. Exp %oxicol Pathol. 133;L<?5@E6<?
1;3. M&'n H0 M&'n$ P0 P#&!: V0 NoB&!: -. The d&%%eren!es &n se#e!ted 7&o!he)&!#
)r:ers nd h&sto#o,&!# %&nd&n,s %ter 7&#e d"!t #&,t&on &n )#e nd %e)#e rts.
dv !lin Path. 1331L<51@261<>
1;1. 4stor:os G0 /e7er -S0 4,&:o" 4A0 G"nn H0 Chro"sos GP. H$*oth#)&!6
*&t"&tr$6dren# (&s !t&'t&on nd st&)"#t&on o% s$ste)&! 'so*ress&n se!ret&on
7$ re!o)7&nnt &nter#e":&n6; &n h")ns5 Potent&# &)*#&!t&ons %or the s$ndro)e
o% &n**ro*r&te 'so*ress&n se!ret&on. J !lin Endocrinol Metab. 1EE@L2E5E>@6
E>E
1;1. R7er -0 OVShe RD0 B#oo) FE0 C)*7e## IL. 4od"#t&on o% h$*oth#)&!6
*&t"&tr$6dren# %"n!t&on 7$ trns,en&! e(*ress&on o% &nter#e":&n6; &n the !ns o%
)&!e. J Neurosci. 1EE2L125E@2>6E@?3
1;>. Ys&n SA0 Cost A0 Fors#&n, 4L0 Gross)n A. Inter#e":&n61 7et nd &nter#e":&n6
; st&)"#te ne"roh$*o*h$s&# hor)one re#ese &n '&tro. J Neuroendocrinol.
1EE@L;512E61?@
1;@. N&&)& 40 /d Y0 Sto 40 T:hr -0 K9n&sh& K. E%%e!t o% !ont&n"o"s
&ntr'eno"s &nKe!t&on o% &nter#e":&n6; nd *retret)ent 9&th !$!#oo($,ense
&nh&7&tor on 7r&n !6%os e(*ress&on &n the rt. Neuroendocrinology. 1EE2L;;5@26<>
1;<. P#&n K0 4ore" 4L0 Or!e# H0 D"'o&d6G"&##o" A0 R7&e A0 Ke##e$ K/0 4oos F.
A,e6&)*&red %#"&d ho)eosts&s de*ends on the 7#n!e o% &#6;A&,%6& &n the rt
s"*ro*t&! n"!#e&. Neurobiol ging. 133?
1;;. V##&eres L0 L!ro&( S0 R&'est S. In%#"en!e o% &nter#e":&n6; on ne"r# !t&'&t$ nd
trns!r&*t&on o% the ,ene en!od&n, !ort&!otro*h&n6re#es&n, %!tor &n the rt 7r&n5
An e%%e!t de*end&n, "*on the ro"te o% d)&n&strt&on. Eur J Neurosci.
1EE2LE51@;161@21
1;2. /ss)nn S0 N&!:en&, G. Ptho*h$s&o#o,&!# re,"#t&on o% the t16re!e*tor nd
&)*#&!t&ons %or 's!"#r d&sese. J -ypertens Suppl. 133;L1@5S1<611
1;?. S)"e#sson A40 A#e(nderson C0 4o#ne -0 Hr#dsson B0 Hnse## P0 Ho#)n, A.
Prent# e(*os"re to &nter#e":&n6; res"#ts &n h$*ertens&on nd #tert&ons &n the
ren&n6n,&otens&n s$ste) o% the rt. J Physiol. 133;L<2<5?<<6?;2
1;E. /ss)nn S0 St")*% 40 Streh#o9 K0 S!h)&d A0 S!h&e%%er B0 Boh) 40 N&!:en&,
G. Inter#e":&n6; &nd"!es o(&dt&'e stress nd endothe#&# d$s%"n!t&on 7$
o'ere(*ress&on o% the n,&otens&n && t$*e 1 re!e*tor. !irc "es. 133@LE@5<>@6<@1
142
123. 4&$osh& 40 N,t K0 I)oto T0 Goto O0 Ish&d A0 /tn7e T. An, && &s &n'o#'ed
&n the #*s6&nd"!ed *rod"!t&on o% *ro&n%#))tor$ !$to:&nes &n deh$drted rts.
m J Physiol "egul Integr !omp Physiol. 133>L1?@5R13E1613E2
121. Peeters AC0 Nete 4G0 K"##7er, B-0 Th&en T0 'n der 4eer -/. The e%%e!t o%
ren&n6n,&otens&n s$ste) &nh&7&tors on *ro6 nd nt&6&n%#))tor$ !$to:&ne
*rod"!t&on. Immunology. 1EE?LE@5>2;6>2E
121. S9rt R40 Hoorn E-0 BetKes 4G0 M&etse R. H$*ontre)& nd &n%#))t&on5 The
e)er,&n, ro#e o% &nter#e":&n6; &n os)ore,"#t&on. Nephron Physiol. 1311L11?5@<6
<1
12>. S,ro S0 Fer,"son AV0 Ren"d LP. S"7%orn&!# or,n6s"*ro*t&! n"!#e"s
!onne!t&ons5 An e#e!tro*h$s&o#o,&! st"d$ &n the rt. Brain "esearch. 1E?@L>3>526
1>
12@. Bro9n CH0 Bo"r+"e C/. 4e!hn&s)s o% rh$th)o,enes&s5 Ins&,hts %ro)
h$*oth#)&! 'so*ress&n ne"rons. %rends in Neurosciences. 133;L1E513?611<
12<. S!ott V0 Bro9n CH. Stte6de*endent *#st&!&t$ &n 'so*ress&n ne"rones5
Deh$drt&on6&nd"!ed !hn,es &n !t&'&t$ *ttern&n,. J Neuroendocrinol.
1313L115>@>6><@
12;. M!hr&o" V0 Bo#nos CA0 Se##e$ DE0 Theo7#d D0 Css&d$ 4P0 Ke#B 4B0 Sh96
L"t!h)n T0 Berton O0 S&)6Se##e$ L-0 D&#eone R-0 K")r A0 Nest#er E-. An
essent&# ro#e %or de#t%os7 &n the n"!#e"s !!")7ens &n )or*h&ne !t&on. Nature
Neuroscience. 133;LE513<6111
122. Chn, AS0 Chn, S40 Gr!& RL0 S!h&##&n, /P. Con!o)&tnt nd hor)on##$
re,"#ted e(*ress&on o% tr* ,enes &n 7o'&ne ort&! endothe#&# !e##s. 3EBS +ett.
1EE2L@1<5>><6>@3
12?. -"n, C0 Fndos C0 LorenBo I40 P#t C0 Fernndes -0 Gene GG0 VB+"eB E0
V#'erde 4A. The *ro,esterone re!e*tor re,"#tes the e(*ress&on o% tr*'@
!hnne#. Pflugers rch. 133EL@<E513<611>
12E. Hoendero* -G0 N&#&"s B0 B&nde#s R-. E*&the#&# !#!&") !hnne#s5 Fro)
&dent&%&!t&on to %"n!t&on nd re,"#t&on. Pflugers rch. 133>L@@;5>3@6>3?
143