Tissue and Cell 40 (2008) 75–81

Characterization of laminin isoforms in human amnion
Seiji Takashima a,b , Masanori Yasuo c , Noriko Sanzen d , Kiyotoshi Sekiguchi d , Motonori Okabe e , Toshiko Yoshida e , Ayaka Toda e , Toshio Nikaido a,e,∗
a

Department of Organ Regeneration, Institutes of Organ Transplants, Reconstructive Medicine and Tissue Engineering, Shinshu University Graduate School of Medicine, 3-1-1 Asahi, Matsumoto 390-8621, Japan b Department of Biomolecular Engineering, Faculty of Bioscience and Biotechnology, Tokyo Institute of Technology, 4259 Nagatsuta, Midori-ku, Yokohama 226–8501, Japan c First Department of Internal Medicine, Shinshu University School of Medicine, Matsumoto, Japan d Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita 565-0871, Japan e Department of Regenerative Medicine, University of Toyama Graduate School of Medicine and Pharmaceutical Sciences, 2630 Sugitani, Toyama 930-0194, Japan

Abstract Epithelial cells of the human amnion have been reported to possess similar functions to many types of cells, such as hepatocytes, neurons, and pancreatic -cells. We reported previously that one of the hepatocyte-like functions of human amniotic epithelial cells was reinforced by the presence of basement membrane components. Laminin is one of the main components of the basement membrane; it critically contributes to cell differentiation. Laminin has several heterotrimer isoforms composed of an -, a -, and a -chain, and each type of chain has several types of subunit chains: 1–5, 1–3, and 1–3. In this study, we characterized the laminin subunit chains in human amnion. Laminin is produced and secreted from adjacent epithelial cells, and therefore, the gene expression of laminin subunit chains in human amniotic epithelial cells was investigated by RT-PCR. Their localization was examined by immunohistochemical staining of frozen sections. The findings suggested that the basement membrane of the human amnion contains a broad spectrum of laminin isoforms, laminin-2, -4, -5, -6, -7, -10, -11. These findings will provide clues not only for understanding the physiological roles of the amnion and hAECs, but also for applying this tissue as a source of donor cells for cell transplantation therapy. © 2007 Published by Elsevier Ltd.
Keywords: Basement membrane; Laminin; Amnion; Stem cell

1. Introduction Basement membrane molecules have been shown to affect the differentiation and survival of cells (Streuli, 1996). Laminins are the major noncollagenous basement membrane component. Laminin is a glycoprotein heterotrimer composed of an -, a -, and a -chain. Five different laminin -chains ( 1–5), three laminin -chains ( 1–3), and three laminin -chains ( 1–3) are known at present.
∗ Corresponding author at: Department of Regenerative Medicine, University of Toyama Graduate School of Medicine and Pharmaceutical Sciences, 2630 Sugitani, Toyama 930-0194, Japan. Tel.: +81 76 434 7210; fax: +81 76 434 5011. E-mail address: tnikaido@med.u-toyama.ac.jp (T. Nikaido).

Different combinations of these chains can form approximately 15 laminin isoforms, and these isoforms vary in a time- and cell-specific manner (Colognato and Yurchenco, 2000). Interacting with the underlying cells via cell surface receptors, such as integrins and dystroglycan complex, the laminins regulate gene expression and influence cell fate. Through such cell–extracellular matrix communication, laminins critically contribute to cell differentiation, cell shape and movement, the maintenance of tissue phenotypes, and the promotion of tissue survival (Akashi et al., 1999; Fukushima et al., 1998). Recently, detailed studies of the effects of genetic disruptions in humans, mice, nematodes, and flies have revealed developmental roles for the different laminin subunits in diverse cell types, including effects on differentiation from blastocyst forma-

0040-8166/$ – see front matter © 2007 Published by Elsevier Ltd. doi:10.1016/j.tice.2007.09.001

76

S. Takashima et al. / Tissue and Cell 40 (2008) 75–81

tion to the post-natal period (Colognato and Yurchenco, 2000). The amnion, which lines the amniotic cavity, consists of a single layer of epithelial cells on a thick basement membrane and a spongy collagen layer containing mesenchymal cells. The amnion has been applied clinically, e.g., in the treatment of burn lesions (Trelford and Trelford-Sauder, 1979), to cover surgical wounds to avoid collusion (Trelford and Trelford-Sauder, 1979), and in ocular surface reconstitution (Nakamura et al., 2003). Recent reports from our group suggested that human amnion-derived cells possess multipotency and that they can differentiate into insulin-producing cells (Wei et al., 2003) and hepatocytes (Takashima et al., 2004), and therefore that human amniotic epithelial cells (hAECs) could be applied for cell transplantation therapy. Other groups suggested the usefulness of the application of hAEC transplantation for Parkinson’s disease (Kakishita et al., 2000). Although the amnion has already been applied clinically, as described above, the nature of amniotic tissue, including hAECs, is largely unknown. There is a current need to define the characteristics of the amnion, not only of the cells but also of the extracellular matrices in this tissue. Recently, we showed that hAECs have the potential to produce albumin, and this ability is increased by laminin (Takashima et al., 2004). Characterization of the isoforms of laminin in the human amnion may contribute to understanding the regulation of the function or cell survival of hAECs in cell transplantation therapy. In this study, we therefore, characterized the laminin subunit chains in the basement membrane of the human amnion.

mother or fetus at the 40th week of gestation. The amnions were used with the approval of the Ethics Committee of the Shinshu University School of Medicine and with the consent of the patients. The amnion was mechanically peeled from the chorion of a placenta. It was washed with saline several times to remove blood and maintained at 4 ◦ C until use. Human AECs were isolated from the human amnion using the method described in our previous report (Takashima et al., 2004). Briefly, the amnion was washed in calcium-free, magnesium-free phosphate-buffered saline (PBS(–)), then cut into pieces in PBS(–) containing 0.03% hyaluronidase (Sigma–Aldrich Co., St. Louis, MO) and 0.025% deoxyribonuclease I (Sigma–Aldrich Co.). Then the pieces of amnion were digested with 0.2% trypsin (Sigma–Aldrich Co.) in Dulbecco’s Modified Eagle’s Medium (DMEM, Sigma–Aldrich Co.) for 30 min at 37 ◦ C, and hAECs were collected by centrifugation at 200 × g for 10 min. This digestion step was repeated several times until no more hAECs were obtained. The hAECs thus obtained were washed with DMEM containing 10% fetal bovine serum (Moregate, Bulimba, QLD, Australia) and antibiotic–antimycotic (Invitrogen, Grand Island, NY). To prepare frozen sections, human amnions were cut into small pieces and then mounted in OCT compound (Sakura Finetechnical Co., Tokyo, Japan) and maintained at −80 ◦ C. 2.2. Reverse transcription-polymerase chain reaction (RT-PCR) analysis Total RNA of hAECs was extracted using an ISOGEN kit (Nippon Gene, Tokyo, Japan) according to the manufacturer’s instructions. Complementary DNA (cDNA) was prepared from collected total RNA using an OmniscriptTM RT Kit (QIAGEN GmbH, Hilden, Germany) and oligo(dT)15 primer (Promega, Madison, WI) according to the manufacturers’ instructions. The obtained cDNA was subjected to PCR using a Taq PCR Core Kit (QIAGEN GmbH) with the sets of primers described in Table 1. The PCR con-

2. Materials and methods 2.1. Preparation of hAECs and frozen sections of human amnion Human amnions were obtained from patients who underwent cesarean section without any complications in either
Table 1 Primers for RT-PCR Primer name Laminin Laminin Laminin Laminin Laminin Laminin Laminin Laminin Laminin Laminin GAPDH 1 2 3 4 5 1 2 3 1 2a Forward primer sequence AAGTGTGAAGAATGTGAGGATGGG AAATGTACAGAGTGCAGTCGAGGTCA CACTGTGAACGCTGCCAGGAGGGCTA CACTGTGAAAAGTGTCTGGATGGT GACTGCCTGCTGTGCCAGC AACTGTGAGCAGTGCAAGCCGTTT CACTGTGAGCTCTGTCGGCCCTTC ACAAGCATGACCAAGCAGC CACTGTGAGAGGTGCCGAGAGAAC GCTCAGGTCAACTGACCTG GAAGGTGAAGGTCGGAGT

Reverse primer sequence CACTGAGGACCAAAGACATTTTCCT CAGTGGATGCCTTCCACATTCACCTT CAGCTACCTCCGAATTTCTGGGGATT CAGGTGCTTCCAATGAGGAAGGGG GGGGTAGCCATGAAAGCCCG CAACCAAATGGATCTTCACTGCTT CAAGGAGTGCTCCCAGGCACTGTG TGCAGGTGGCATAGTAGAGC CATCCTGCTTCAGTGAGAGAATGG TCTAAGTTGCCATGGCATCAT AAGATGGTGATGGGATTTC

Product size (base pairs) 317 170 212 227 195 248 299 427 194 589 225

Annealing temperature (◦ C) 55 59 61 55 61 53 61 61 57 60 62

GAPDH: glyceraldehydes-3-phosphate dehydrogenase. a Reference: Fukushima et al. (1998).

S. Takashima et al. / Tissue and Cell 40 (2008) 75–81

77

Fig. 1. RT-PCR for laminin subunit chains using RNA extracts from hAECs. Clear bands of the expected size were detected for 3, 5, 1, 2, 3, 1, and weak bands were observed for 2, 2. However, no bands were detected for 1 or 4. An intense band of 225 bp for GAPDH showed the good integrity of the RNA extracted.

ditions were denaturation at 94 ◦ C for 5 min followed by 30 cycles of 94 ◦ C for 1 min, annealing at 53 ◦ C or higher temperature shown in Table 1, depending on the primers, for 1 min, extension at 72 ◦ C for 1 min, and a final extension at 72 ◦ C for 10 min. PCR products were size fractionated by 2% agarose gel electrophoresis, stained with ethidium bromide, and visualized using an ultraviolet illuminator. The PCR products were size fractionated by 2% agarose gel electrophoresis and confirmed by DNA sequencing. 2.3. Immunohistochemistry Fresh frozen sections (7- m thickness) of human amnion were incubated in 3% H2 O2 in H2 O for 5 min to block endogenous peroxidase activity, followed by washing with calcium-free, magnesium-free phosphate-buffered saline (PBS(−)). Next, they were incubated with blocking solution (10% non-immune goat serum (Dako Cytomation, Kyoto, Japan) in PBS(−)) for 20 min to reduce non-specific binding. Then they were incubated with each anti-laminin subunit chain mouse monoclonal antibody (against 1,2,3,4,5, 1,2,3, or 1,2; each antibody was diluted 1:200 (Fukushima

et al., 1998; Hattori et al., 2003) in blocking solution or with normal serum (as a negative control) for 1 h at room temperature. The specificity of antibodies for laminin proteins was confirmed by the amino acid sequence of the protein derived from human placenta that bound to the antibody (Hattori et al., 2003). The sections were then incubated with horseradish peroxidase-conjugated goat anti-mouse IgG (1:200, Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) in blocking solution for 30 min at room temperature. After washing with PBS(−), they were stained with 3,3diaminobenzidine (Vector Laboratories, Inc. Burlingame, CA), and counterstained with Mayer’s hematoxylin (Wako Pure Chemical Industries, Ltd., Osaka, Japan), and then observed using an IX 70 microscope (Olympus, Tokyo, Japan).

3. Results Elements of the basement membrane, including laminin, are produced by and supplied from adjacent epithelial cells.

78

S. Takashima et al. / Tissue and Cell 40 (2008) 75–81

Fig. 2. Expression of laminin subunit -chain protein in human amnion. Frozen sections were treated with the following antibodies and the immunoperoxidase staining was performed using DAB as a substrate: anti-laminin 1– 5 antibody (A–E). Laminin 3 and 5 immunostaining showed strong intensity in the basement membrane and laminin 2 showed weak intensity, while laminin 1 and 4 were negative. Magnification: A–K ×200.

Therefore, at first we analyzed the expression of laminin subunit chains in hAECs by RT-PCR (Fig. 1). To confirm the integrity of the RNA, the same amount of cDNA was amplified by PCR using GAPDH (glyceraldehyde-3-phosphate dehydrogenase) primers, producing a 225-bp band. Expres-

sion of the laminin 1 and 4 subunit chains was not detected; however, expression of the other subunit chains was detected with various intensities. This result showed that hAECs themselves generate all the laminin subunit chains, except for 1 and 4.

S. Takashima et al. / Tissue and Cell 40 (2008) 75–81

79

Fig. 3. Expression of laminin subunit - and 1-chain proteins in human amnion. Frozen sections were treated with the following antibodies and immunoperoxidase staining was performed using DAB as a substrate: anti-laminin 1– 3 antibody (A–C), anti-laminin 1 and 2 antibody (D and E), or without antibody as a negative control (F). Laminin 1, 3, 1, and 2 immunostaining showed strong intensity in the basement membrane, while laminin 2 showed weak intensity. Magnification: A–K ×200.

Next, the localization of these isoform chains on the human amnion was studied by performing immunohistochemistry. Laminin 2, 3, 5 subunit chains were detected on the basement membrane of the human amnion (Fig. 2B,

C, E). Especially, rather strong staining of the laminin 3 and 5 subunit chains was detected. However, the laminin 1 and 4 subunit chains were not detected in human amniotic tissue (Fig. 2A and D). Although the expression of the

80

S. Takashima et al. / Tissue and Cell 40 (2008) 75–81

laminin 2 subunit chain was weaker than that of the other laminin subunit chains, all of the ( 1–3) and ( 1, 2) subunit chains were observed in the basement membrane of the human amnion (Fig. 3A–E). These results were compatible with those obtained by RT-PCR analysis in hAECs.

4. Discussion We characterized the expression of the laminin subunit chains in the human amnion. Considering that laminin is a heterotrimer composed of an -, a -, and a -chain, our findings indicate that among the isoforms previously reported, the following could exist in the human amnion: laminin2 ( 2 1 1), -4 ( 2 2 1), -5 ( 3 3 2), -6 ( 3 1 1), -7 ( 3 2 1), -10 ( 5 1 1), -11 ( 5 2 1). The laminin 1 subunit chain was not detected in the human amnion, either in the basement membrane or in the hAECs, which implies that laminin-1 ( 1 1 1) and 3( 1 2 1) are not constituents of the basement membrane in this tissue. A specific feature of laminin 1 is its prominent expression during early epithelial development (Ekblom et al., 2003; Sasaki et al., 1988; Smyth et al., 1999; Vuolteenaho et al., 1994). It is expressed at the 16-cell stage of the preimplantation mouse embryo, and it is subsequently expressed prominently, mainly by developing epithelial cells during organogenesis in mouse and human embryos (Colognato and Yurchenco, 2000; Ekblom et al., 1998; Shim et al., 1996). The expression of laminin 1 seems to be more restricted to only some epithelial basement membranes in the adult, such as those in the kidney, placenta, and male and female reproductive organs (Virtanen et al., 2000). It is very intriguing that a broad spectrum of laminin subunit chains was present in the basement membrane of the human amnion, while laminin 1 was absent, although the amnion is a fetus-derived tissue. In this study, we investigated the amnion at the full term of gestation. It is possible that the amnion of the first or second term might show a different distribution of laminin subunit chains. It was also reported that the carboxytermini of the -chains contain five laminin globular (LG) modules, with a distinct LG for each -chain. A particular role of the 1LG module 4 was demonstrated for the binding to its receptors in epithelial tubulogenesis (Durbeej et al., 2001; Kadoya et al., 1995). The absence of the laminin 1-chain may be related to the morphological construction of the cuboidal monolayer of the epithelium of the amnion. The laminin subunit 4-chain is typically found in mesenchyme or mesenchyme-derived cells (adult muscle, lung, nerve, fat cells, bone marrow, blood vessels) (Ekblom et al., 2003; Erickson and Couchman, 2000). One of the specific features of the amnion is that it lacks its own vessels in the tissue, and this feature may have some relationship with the absence of the laminin subunit 4-chain. The distribution of the 3 subunit chain, which we could not examine in this study because the antibody and promoters were unavailable, must also be investigated.

Previous reports from other groups and our group showed that hAECs possess the potency to act similarly to cells of multiple other organs, such as neurons, glial cells (Sakuragawa et al., 1996), pancreatic- cells (Wei et al., 2003), and hepatocytes (Takashima et al., 2004). In general, cellular functions are strongly regulated by the extracellular matrix. In fact, we showed that the hepatic function of hAECs, such as the production and secretion of albumin, was drastically increased by the presence of intact extracellular matrices of the amnion in organ culture analysis (Takashima et al., 2004). Although a coating of laminin-1 in the cell culture system also promoted albumin secretion by hAECs, the effect was weaker than that observed in organ culture. This suggested that the key isoform involved in this activity may be some isoforms other than type-1, which is compatible with our observation in this study. Although we have not yet examined the effect of laminin on the neuronal or pancreatic function of hAECs, the laminin isoforms detected in this study may regulate their function. The amnion has already been applied to ocular surface reconstitution because the basement membrane of the human amnion is a good carrier for the transplantation of corneal epithelial cells (Nakamura et al., 2003). One of the main components of the corneal basement membrane is laminin-5 (Fukuda et al., 1999). Moreover, laminin-5 promotes adhesion and migration of human corneal epithelial cells (Ebihara et al., 2000). Therefore, the present data suggesting the existence of laminin-5 in the basement membrane of human amnion indicate that this tissue is suitable for ocular surface reconstitution. Considering that the human amnion has the advantage that the tissue is rather easily obtained with minimum ethical issues associated with its usage compared with other tissues, it is a good candidate for use in the reconstitution of other epithelial surfaces, e.g., skin or oral mucosa. In this study, we demonstrated that a broad spectrum of laminin isoforms existed in the basement membrane of the human amnion. The existence of many types of laminin isoforms may be related to the multifunctions of hAECs. These findings will provide clues not only for understanding the physiological roles of the amnion and hAECs, but also for applying this tissue as a source of donor cells for cell transplantation therapy. References
Akashi, T., Miyagi, T., Ando, N., Suzuki, Y., Nemoto, T., Eishi, Y., Nakamura, K., Shirasawa, T., Osa, N., Tanaka, N., Burgeson, R.E., 1999. Synthesis of basement membrane by gastrointestinal cancer cell lines. J. Pathol. 187 (2), 223–228. Colognato, H., Yurchenco, P.D., 2000. Form and function: the laminin family of heterotrimers. Dev. Dyn. 218, 213–234. Durbeej, M., Talts, J.F., Henry, M.D., Yurchenco, P.D., Campbell, K.P., Ekblom, P., 2001. Dystroglycan binding to laminin alpha1LG4 module influences epithelial morphogenesis of salivary gland and lung in vitro. Differentiation 69 (2–3), 121–134.

S. Takashima et al. / Tissue and Cell 40 (2008) 75–81 Ebihara, N., Mizushima, H., Miyazaki, K., Watanabe, Y., Ikawa, S., Nakayasu, K., Kanai, A., 2000. The functions of exogenous and endogenous laminin-5 on corneal epithelial cells. Cornea 71, 69–79. Ekblom, M., Falk, M., Salmivirta, K., Durbeej, M., Ekblom, P., 1998. Laminin isoforms and epithelial development. Ann. N. Y. Acad. Sci. 857, 194–211. Ekblom, P., Lonai, P., Talts, J.F., 2003. Expression and biological role of laminin-1. Matrix Biol. 22 (1), 35–47. Erickson, A.C., Couchman, J.R., 2000. Still more complexity in mammalian basement membranes. J. Histochem. Cytochem. 48 (10), 1291–1306. Fukuda, K., Chikama, T., Nakamura, M., Nishida, T., 1999. Differential distribution of subchains of the basement membrane components type IV collagen and laminin among the amniotic membrane, cornea, and conjunctiva. Cornea 18, 73–79. Fukushima, Y., Ohnishi, T., Arita, N., Hayakawa, T., Sekiguchi, K., 1998. Integrinalpha 3 beta1-mediated interaction with laminin-5 stimulates adhesion, migration and invasion of malignant glioma cells. Int. J. Cancer 76, 63–72. Hattori, K., Mabuchi, R., Fujiwara, H., Sanzen, N., Sekiguchi, K., Kawai, K., Akaza, H., 2003. Laminin expression patterns in human ureteral tissue. J. Urol. 170, 2040–2043. Kadoya, Y., Kadoya, K., Durbeej, M., Holmvall, K., Sorokin, L., Ekblom, P., 1995. Antibodies against domain E3 of laminin-1 and integrin alpha 6 subunit perturb branching epithelial morphogenesis of submandibular gland, but by different modes. J. Cell Biol. 129 (2), 521–534. Kakishita, K., Elwan, M.A., Nakao, N., Itakura, T., Sakuragawa, N., 2000. Human amniotic epithelial cells produce dopamine and survive after implantation into the striatum of a rat model of Parkinson’s disease: a potential source of donor for transplantation therapy. Exp. Neurol. 165, 27–34. Nakamura, T., Koizumi, N., Tsuzuki, M., Inoki, K., Sano, Y., Sotozono, C., Kinoshita, S., 2003. Successful regrafting of cultivated corneal epithelium using amniotic membrane as a carrier in severe ocular surface disease. Cornea 22, 70–71.

81

Sakuragawa, N., Thangavel, R., Mizuguchi, M., Hirasawa, M., Kamo, I., 1996. Expression of markers for both neuronal and glial cells in human amniotic epithelial cells. Neurosci. Lett. 209, 9–12. Sasaki, M., Kleinman, H.K., Huber, H., Deutzmann, R., Yamada, Y., 1988. Laminin, a multidomain protein. The A chain has a unique globular domain and homology with the basement membrane proteoglycan and the laminin B chains. J. Biol. Chem. 63, 16536–16544. Shim, C., Kwon, H.B., Kim, K., 1996. Differential expression of laminin chain-specific mRNA transcripts during mouse pre-implantation embryo development. Mol. Reprod. Dev. 44, 44–55. Smyth, N., Vatansever, H.S., Murray, P., Meyer, M., Frie, C., Paulsson, M., Edgar, D., 1999. Absence of basement membranes after targeting the LAMC1 gene results in embryonic lethality due to failure of endoderm differentiation. J. Cell Biol. 144, 151–160. Streuli, C.H., 1996. Basement membrane as a differentiation and survival factor. In: Ekblom, P., Timpl, R. (Eds.), The Laminins. Harwood Academic Publishers, Amsterdam, The Netherlands, pp. 217–233. Takashima, S., Ise, H., Zhao, P., Akaike, T., Nikaido, T., 2004. Human amniotic epithelial cells possess hepatocyte-like characteristics and functions. Cell Struct. Funct. 29, 73–84. Trelford, J.D., Trelford-Sauder, M., 1979. The amnion in surgery, past and present. Am. J. Obstet. Gynecol. 134, 833–845. Virtanen, I., Gullberg, D., Rissanen, J., Kivilaakso, E., Kiviluoto, T., Laitinen, L.A., Lehto, V.P., Ekblom, P., 2000. Laminin alpha1-chain shows a restricted distribution in epithelial basement membranes of fetal and adult human tissues. Exp. Cell Res. 257 (2), 298–309. Vuolteenaho, R., Nissinen, M., Sainio, K., Byers, M., Eddy, R., Hirvonen, H., Shows, T.B., Sariola, H., Engvall, E., Tryggvason, K., 1994. Human laminin M chain (merosin): complete primary structure, chromosomal assignment, and expression of the M and A chain in human fetal tissues. J. Cell Biol. 124, 381–394. Wei, J.P., Zhang, T.S., Kawa, S., Aizawa, T., Ota, M., Akaike, T., Kato, K., Konishi, I., Nikaido, T., 2003. Human amnion-isolated cells normalize blood glucose in streptozotocin-induced diabetic mice. Cell Transplant. 12, 545–552.