Revista Mexicana de Fitopatología

Sociedad Mexicana de Fitopatología, A.C.
guillermofuentes_davila@hotmail.com

ISSN (Versión impresa): 0185-3309
MÉXICO

2005
Hugo Galindo Flores / Juan Carlos Martínez Álvarez / Eusebio Nava Pérez /
Raymundo Saúl García Estrada / Ignacio Eduardo Maldonado Mendoza
A SAPROTROPHIC FUNGAL ISOLATE FROM NORTHERN SINALOA, MEXICO,
WITH HOMOLOGY TO MEMBERS OF THE CHAETOMIACEAE BEHAVES AS AN
ANTAGONIST OF PHYTOPATHOGENIC FUNGI IN VITRO
Revista Mexicana de Fitopatología, julio - diciembre, año/vol. 23, número 002
Sociedad Mexicana de Fitopatología, A.C.
Ciudad Obregón, México
pp. 130-139

Red de Revistas Científicas de América Latina y el Caribe, España y Portugal
Universidad Autónoma del Estado de México
http://redalyc.uaemex.mx

and Maldonado-Mendoza. 28S rDNA hypervariable region. Fusarium oxysporum f. the understanding of its interactions with plants and other rhizospheric organisms might be important for future ecological and agricultural studies. R. 3Current Address: Boyce Thompson Institute for Plant Research. Additional keywords: Aporothielavia leptoderma. km 5. Unidad Sinaloa (CIIDIR-IPN-Unidad Sinaloa). Guasave Valley in the state of Sinaloa. éste proliferó alrededor de los fitopatógenos e inhibió su crecimiento. When mycelium from the isolate was placed in contact with Rhizoctonia solani and Fusarium oxysporum f. which allowed its identification as related to members of the Chaetomiaceae family (Aporothielavia leptoderma and members of the genus Chaetomium). Postal 280. Abstract. surrounded them and inhibited their growth.. E. lo cual permitió identificarlo como un organismo relacionado a los miembros de la familia Chaetomiaceae (Aporothielavia leptoderma y miembros del género Chaetomium). km 1. J. with Homology to Members of the Chaetomiaceae Behaves as an Antagonist of Phytopathogenic Fungi in vitro Hugo Galindo-Flores1. Ya que CIIDIR-1 se encontró en todas las muestras de suelo evaluadas. Only the asexual phase of CIIDIR-1 can be cultured in vitro in different culture media. sp. sp. 1 Centro Interdisciplinario de Investigación para el Desarrollo Integral Regional. Las Glorias. it proliferated. This fungal isolate named CIIDIR-1. Palabras clave adicionales: Aporothielavia leptoderma. Apdo. Raymundo Saúl García-Estrada2. Culiacán. Al poner en contacto el micelio de CIIDIR-1 con Rhizoctonia solani o Fusarium oxysporum f. Se utilizó DNA extraído de micelio para amplificar y secuenciar una región hipervariable del rDNA 28S.. An ascomycete was isolated from spore preparations of arbuscular mycorrhizal fungi from soil samples collected in northern Sinaloa. Bioassays showed that the isolate acts as an antagonist against phytopathogenic fungi. Mexico. México CP 80129. Instituto Politécnico Nacional. H. Guasave.0 Carr.E. DNA extracted from mycelium was used to amplify and sequence a 28S rDNA hypervariable region. Se aisló un ascomiceto en el norte del estado de Sinaloa. México CP 81101. así como para el entendimiento sobre sus interacciones con plantas y otros organismos rizosféricos.5 Carr. and Ignacio Eduardo Maldonado-Mendoza1. Apdo. Sinaloa. is ubiquitous in soils of this agricultural region. sp. lycopersici. I. Correspondence: iem3@cornell. lycopersici. is one of the most prominent agricultural regions of the country. 2005 A Saprotrophic Fungal Isolate From Northern Sinaloa. lycopersici.C. 2004 Accepted: March 31. México. Nava-Pérez. lycopersici. Culiacán-El Dorado. Ithaca. Nevertheless. such as tomato (Lycopersicon esculentum Mill. puede ser importante para estudios futuros referentes al manejo agrícola y ecológico. CIIDIR-1 puede ser cultivado in vitro solamente en su etapa asexual en diversos medios de cultivo. A saprotrophic fungal isolate from northern Sinaloa. and soil quality contribute to obtain high crop yields in this area. Rhizoctonia solani.. Mexico. Eusebio Nava-Pérez 1. En bioensayos se mostró que el aislamiento actúa como antagonista contra otros hongos fitopatógenos. Martínez-Álvarez. NY. Juan Carlos Martínez-Álvarez1. antagonism. antagonismo. several fungal phytopathogenic diseases have been described affecting the root system of commercial crops. García-Estrada. región hipervariable 28S rDNA. esto sugiere un papel importante en la rizósfera. USA 14853.S. Fusarium oxysporum f. es ubicuo en suelos de esta importante región agrícola. Tower Rd. Sinaloa. Postal 32-A. Número 2. también.3. Mexico. Rhizoctonia solani. CIIDIR-1 mostró un comportamiento saprofítico en presencia de raíces vegetales desarrolladas in vitro.) and pepper (Capsicum . The presence of CIIDIR-1 in all soil samples evaluated suggests an important role in the rhizosphere. with homology to members of the chaetomiaceae behaves as an antagonist of phytopathogenic fungi in vitro. also. 2CIAD-Culiacán. Diverse factors such as water availability. Sucursal Palacio de Gobierno. sp. 2005) Galindo-Flores. Resumen. Mexico. crop management. (Received: November 19. and technology. Este aislamiento fúngico designado como CIIDIR-1.130 / Volumen 23.edu. 2005. Revista Mexicana de Fitopatología 23:130-139. CIIDIR-1 showed a saprophytic behavior in the presence of plant roots grown in vitro. a partir de preparaciones de esporas de hongos micorrízicos arbusculares..

2003. 2000). Surface sterilization of microsclerotia and AMF spores. The abundance of microsclerotia compared to black AMF spores in BM subsamples was determined by visual inspection under the stereoscope... This fungal isolate was denominated CIIDIR-1. This can then be used to predict the necessary conditions for biocontrol of phytopathogenic fungi (Whipps. and containing 10 g L-1 of sucrose and 4 g L-1 of gellan gum. and elongation at 72ºC for 30 sec. Our group has initiated the characterization and identification of the fungal entities present in the rhizosphere of soils of northern Sinaloa. No.) Snyder and Hansen and Rhizoctonia solani Kühn have been found consistently associated (Carrillo-Fasio et al. A hypervariable region from the 28S rDNA region was amplified by PCR using the primer set LSU 0061/LSU0599 (Kjøller and Rosendahl. González-Chavira et al. Unidad Sinaloa. as a result of this work. sp. The amplification product was then cloned into the pGEM-T easy vector (Promega. we have isolated a chetomiaceous fungus. One of the subsamples was denominated BM for black morphotype. we report the molecular identification. The microorganisms present in the rhizosphere of these soils are basically unknown. 2001). Samples containing a mix of AMF spores and microsclerotia were separated manually under a stereoscope using a fine paint brush. and sequenced from both strands using an ABI Prism 310 sequencer. Calculated microsclerotia levels were expressed as microsclerotia per kilogram of soil analyzed. Soils possess the biological capacity to restrict disease progression. USA). using plant DNAzol reagent (Invitrogen Cat. Information on the physicochemical and biological components of the soils of northern Sinaloa is still lacking. This phenomenon. In vitro growth of the fungal isolate CIIDIR-1. One of these is root rot disease. In this paper. 2004). Cat. Biocontrol of phytopathogenic fungi has been carried out using saprotrophic fungi. USA). with potential use as a biological control agent against root pathogens. Microsclerotia were then treated overnight with an antibiotic solution (50 mg gentamycin and 100 mg streptomycin in 10 ml water). or from soil samples. The purified mix of AMF spores/microsclerotia were transferred to multicell dishes using minimal M medium (Bécard and Fortin.. 1996). 1993. and spores (and microsclerotia) were subdivided according to color morphotypes. A piece of agar medium (0. They were germinated into an enriched CO2 (2%) atmospheric chamber in darkness at 20-23ºC. this fungus formed microsclerotia in the multi-cell dishes. and currently it is deposited in the ceparium of CIAD-Culiacán and CIIDIR-IPN. 2003. 157348. The fungal isolate grew profusely under these conditions and after one week. PCR conditions were an initial step of 95ºC for 3 min. Madison. Final elongation was 72ºC for 5 min. and its antagonistic effect against Fusarium oxysporum and Rhizoctonia solani. 2002). Confirmation of the identity of the microsclerotia was done by PCR amplification and sequencing as described below. bacteria (Whipps. Growth of the fungal isolate CIIDIR-1 on sterile tomato plantlets and hairy root cultures. a method commonly used to isolate arbuscular mycorrhizal fungi (AMF) from soil samples. WI. Besides chemical control. causing important economic losses due to their devastating effect on crop production. Plugs of M medium (0.. DNA was extracted from mycelium and microsclerotia obtained in vitro.5. annealing at 55ºC for 30 sec. f. they were transferred to Petri dishes containing M medium pH 5.:Fr. lycopersici (Sacc. Molecular identification of the fungal isolate. Weller et al. The key is the knowledge of the ecological interactions taking place in soil and root environment. Microsclerotia were co-isolated with AMF spores due to their similarities on size and shape. Then.). a mix of spores of AMF and microsclerotia was obtained. California. is conferred by the overall activity of the microbial community resident to the soil (Cook and Baker. launching of website in preparation). 1983). denaturing at 95ºC for 30 sec. Mycoparasitic fungi such as Trichoderma (Green et al. 2001).8 cm in radius) containing mycelium and microsclerotia were used as inoculum to propagate the fungus in Petri dishes containing M medium.. termed general suppression. 1988) as substrate. Microsclerotia of the fungal isolate were obtained by wet sieving and decanting. Sequences were compared using the BLAST-N program (NCBI) with the GenBank database. no biocontrol agents have been described that impact several of the fungal components of this consortium. involving the passage of the soil through specific-size meshes followed by differential centrifugation in sucrose discontinuous gradients (Brundrett et al. or yeasts (El-Tarabily. Quantitation and morphological identification of microsclerotia in soil samples. Microsclerotia were treated with chloramine-T (2% w/v) and Tween-20 (0. Sample numbers and names included in Table 1 are those of a current database containing information on these soil samples (MartínezAlvarez. The biotic and abiotic factors that contribute to specific soil suppressiveness have been elucidated for a number of plant pathogen systems (Amir and Alabouvette. BM subsamples were kept for two months at 4ºC in 1 mL of sterile water in microcentrifuge tubes. and a total of 30 cycles. Mexico. and washed three times with abundant sterile distilled water. Tomato seeds were surface sterilized and grown in Whatman 1 wet paper placed inside Petri plates under sterile conditions for ten days. which was conformed by a mix of black AM spores and microsclerotia. 2002). MATERIALS AND METHODS Purification of microsclerotia from soil samples.01% w/v) following several washes with sterile distilled water.Revista Mexicana de FITOPATOLOGIA/ 131 annuum L. caused by a consortium of soil microorganisms from which Fusarium oxysporum Schlechtend. 2000) display antagonistic mechanisms against phytopathogenic fungi. No. 10978-021 Carlsbad. At this point. 1999) and Gliocladium (Ortiz and Orduz.8 cm in diameter) containing mycelium and microsclerotia of isolate CIIDIR-1 (3 weeks . saprophytic behavior in the presence of plant roots.

This first type of experiment involved two subexperiments: A) one 8 mm agar disc containing the phytopathogen inoculum was placed in the center of the plate. Mycelium extract preparation. Based on dose-response experiments of TIMSEN on R. Final concentration of mycelium was 1% w/v. Antagonism bioassays.5 cm from the edges. and 0. The commercial fungicide TIMSEN (United Promotions Inc. and at one and four weeks post-inoculation for the hairy root experiment. Mexico. Both experiments were done using PDA plates and incubated at 23ºC. This is an antibody that specifically stains sialic acid residues from the fungal walls. B) Another set of plates were done inoculating the phytopathogen on opposite sides of the plates from 0. 2005 Table 1. Staining of CIIDIR-1 isolate. a concentration of 3 g L-1 of the powder was used in subsequent experiments. USA) in 100 ml PBS pH 7. Callejones de Tamazula (surface) 756991 2816742 420 28 14. Endemic strains of Rhizoctonia solani and Fusarium oxysporum f. No. Número 2. UTM UTM Sample number and namew Coordinates Coordinates Microesc. fungal extract. lycopersici (Carrillo-Fasio et al. OR. To gain insight on the mechanisms of growth inhibition of the pathogens and to analyze the response of CIIDIR-1 to physical contact with . z Percentage of microsclerotia from the total mix of AMF spores and microsclerotia from the black morphotype. W11261.4.2 µM Millipore filtration unit. sp.2 g of KCl.44 g of Na2HPO4. solani and F. y Microsclerotia per kilogram of soil. Molecular Probes. fungicide. while two 8 mm paper discs containing either 100 µL of water. 1). Each of these experiments was performed twice with each phytopathogen using three replicate plates obtaining similar results in each experiment. The extract was filter-sterilized by passing the homogenate through a 0. Number of microsclerotia of CIIDIR-1 fungal isolate on soils from Guasave. and in the second set of plates by measuring the length of the mycelial growth from the middle of the disc towards the center of the plate. Portugués de Gálvez (1 m) 761384 2848348 848 53 41. 1. sativus (Hoffm. Two types of experiments were set up: 1) Co-inoculation of plates with phytopathogenic and antagonistic fungi. Eugene.) Arcang.] and tomato growing on M solid medium in Petri plates. Estación Naranjo (surface) 753515 2856375 1020 60 32../ Morph. Staining of the fungus was performed using 10 µL of 0. 2) Inoculation of phytopathogens on a CIIDIR-1 mycelium net. El Amole (surface) 757582 2810885 2852 31 17. 2003) were provided by the ceparium of CIAD-Culiacán. or 8 mm agar discs containing CIIDIR-1. and one disc containing the different treatments (water. washed 4 times for 5 min at room temperature with abundant distilled water.5 cm to the edges. Atlanta. frozen. Cruz Blanca (surface) 763689 2841517 468 49 16. These are two aggressive strains of phytopathogenic fungi and were used in antagonism experiments. fungicide (3 g L-1). Growth of the phytopathogens in the first set of plates was calculated by measuring the diameter of their mycelium. Fungal strains. (West)x (North) kg soily (%)z 10. as described above. were inoculated with plugs containing mycelium and microsclerotia of isolate CIIDIR-1 (two-weeks old). Las Lichis (1 m) 760119 2839808 714 34 40. Two-week old hairy root cultures of carrot [Daucus carota subsp. Tissues were incubated overnight at 4ºC and the staining was visualized using fluorescence microscopy. fungal extract (1% w/v). Cat. Young root tissues were cleared using 20% KOH. El Varal (surface) 759045 2838085 1196 52 23. Sinaloa.24 g of KH2PO4) at pH 7.4. and CIIDIR-1) in the center of the plate (Fig.1 µg µL-1 wheat germ agglutinin conjugate (WGA-488. 0. CIIDIR-1 was grown for one week on a 500 ml Erlenmeyer flask containing 100 mL of M liquid medium at 28°C on an orbitary shaker (250 rpm). old) were placed surrounding the root system. x The positioning of the sampling points is given on UTM coordinates. Mycelium was collected. El Coyote (1 m) 733922 2853389 353 47 21. USA. oxysporum (data not shown). GA. and pulverized on a mortar in fresh M medium. Tissues were rinsed once again at room temperature for 5 min using 1X PBS buffer (8 g of NaCl. active ingredient n-alkyl dimethyl benzyl ammonium chloride 3% w/w) was utilized as a control in antagonistic experiments. Santa Fe (surface) 737331 2836391 595 35 w Surface (0-30 cm) and 1 m (90 to 120 cm) indicates the depth at which the samples were taken from the soil. Pozo Mezquitón (1 m) 742814 2828511 125 25 46. They were set up on opposite sides of the plates at 0. Fungal growth was monitored at one week post-inoculation for the tomato experiment.132 / Volumen 23.

.

1962). in addition to different pH and cold and heat treatments [data not shown]). 2A) and acquired a dark coloration when they reached . leptoderma. are from the same fungus as the one isolated in vitro. CIIDIR-1 microsclerotia survived the surface sterilization protocol used to sterilize AMF spores and grew on minimal M medium. Mismatches between CIIDIR-1 and the A. The top sequence corresponds to CIIDIR-1 fungal isolate and the bottom sequence from A. 2D) or MS. The fungus grew profusely in rich nutrient media such as PDA (Fig. leptoderma sequence are shown in upper cases and bold on the CIIDIR-1 sequence. This confirmed that the microsclerotia obtained from soil samples and germinated microsclerotia in water. MS (Murashige and Skoog. PDA. CIIDIR-1 forms microsclerotia when cultured in vitro. and less in minimal M medium (Fig. 3. Primers used at the 5’ and 3’ ends of the fragment are shown in bold. Microsclerotia remained clear while developing (Fig. Sequence comparison of the fungal isolate CIIDIR-1 and Aporothielavia leptoderma.134 / Volumen 23. 2005 1 5 61 65 agcatatcaataagcggaggaaaagaaaccaacagggattgccctagtaacggcgagtga |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| agcatatcaataagcggaggaaaagaaaccaacagggattgccctagtaacggcgagtga 60 64 agcggcaacagctcaaatttgaaatctggcctcggcccgagttgtaatttgTagaggaag 120 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| agcggcaacagctcaaatttgaaatctggcctcggcccgagttgtaatttgcagaggaag 124 121 ctttaggcgcggcaccTTctgagtcTccctggaacggggcgccatagagggtgagagccc 180 |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| 125 ctttaggcgcggcaccaactgagtc-ccctggaacggggcgccatagagggtgagagccc 183 181 cgtatagtCggaTgcctagcctgtgtaaagctccttcgacgagtcgagtagtttgggaat 240 |||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| 184 cgtatagttggacgcctagcctgtgtaaagctccttcgacgagtcgagtagtttgggaat 243 241 gctgctcaaaatgggaggtaaatttcttctaaagctaaataccggccagagaccgatagc 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 244 gctgctcaaaatgggaggtaaatttcttctaaagctaaataccggccagagaccgatagc 303 301 gcacaagtagagtgatcgaaagatgaaaagcGctttgGaaagagggttaaatagcacgtg 360 ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| 304 gcacaagtagagtgatcgaaagatgaaaagcactttgaaaagagggttaaatagcacgtg 363 361 aaattgttgaaagggaagcgcttgtgaccagacttgcgccgggcTgatcatccggtgttc 420 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| 364 aaattgttgaaagggaagcgcttgtgaccagacttgcgccgggcggatcatccggtgttc 423 421 tcaccggtgcactcTgcccggctcaggccagcatcggttctcgcggggggaCaaaggCcc 480 |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| || 424 tcaccggtgcactccgcccggctcaggccagcatcggttctcgcggggggataaaggtcc 483 481 TgggaacgtagctcctccgggagtgttatagcccAgggcgCaatgccctcgcggggaccg 540 ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| 484 cgggaacgtagctcctccgggagtgttatagcccggggcgtaatgccctcgcggggaccg 543 541 aggttcgcgc-tctgcaaggatgctggcgtaatggtcatcagcgacccgtcttgaaacac 599 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| 544 aggttcgcgcatctgcaaggatgctggcgtaatggtcatcagcgacccgtcttgaaacac 603 600 ggacca 605 |||||| 604 ggacca 609 Fig. and V8 were tested. Sequence alignment was performed using the Blast 2 sequences program from NCBI (Tatusova and Madden. 2C). No differences in length or sequence were observed between the PCR products obtained from fungal material isolated from soil or in vitro. throughout this study (different common nutrient media such as M. Número 2. 1999).

.

In fact. oxysporum f. sp. These data support our hypothesis that CIIDIR-1 has an antagonistic effect on the phytopathogenic fungi growth. lycopersici after 8 days cocultivation (Figs. sp. oxysporum f. lycopersici.5 Mycelium length (cm) Mycelium length (cm) 4 3 2. The addition of CIIDIR-1 aqueous extract had no inhibitory effect on any of the experiments made. A) Type 1A experiment with F. lycopersici and R. Mycelium of the fungal isolate CIIDIR-1 responds to physical contact with phytopathogenic fungi. 6A-D) and the restriction of growth of these phytopathogens. lycopersici and R.5 2 1. oxysporum. solani. The percentage of growth inhibition compared to the water control was of 50-60% and 40-50% for F. These results obtained at day 4 and day 8 of growth for R. .5 1 0. Número 2. The response of CIIDIR-1 mycelium net to the presence of the phytopathogenic fungi was the production of halos of profuse mycelium growth surrounding both R. R. oxysporum f. Effect of CIIDIR-1 isolate on mycelium growth of Fusarium oxysporum f. lycopersici and Rhizoctonia solani. sp.5 Mycelium length (cm) Mycelium length (cm) 4 days post inoculation 3 2. or even two weeks after their addition (data not shown). respectively.136 / Volumen 23.5 2 1. 5C). and closed triangles to aqueous extracts of CIIDIR-1 mycelium. solani. DISCUSSION CIIDIR-1 fungal isolate might belong to the genus Aporothielavia or Chaetomium. 6E and F). in one of the experiments (Type 1A. may belong to the species Aporothielavia leptoderma. sp. 5A and B). oxysporum. Quantitative results showed a growth inhibition effect at day 4 for F. The percentage of inhibition compared to the negative control was 59. solanii and F. solani and F. intraradices were used as negative controls and no effect on CIIDIR-1 mycelium net overgrowth was observed 4 days post inoculation (Figs. Similar results were observed for the slower growing F. oxysporum f. B) Type 1B experiment with F.78 and 50% for experiments A and B. at the end of the experiments. solani). oxysporum f. sp.5 B 6 5 4 3 2 1 0 0 0 2 4 6 0 8 2 days post inoculation 4 6 8 3 4 9 C 3. solani. are statistically different (ANOVA) with a degree of significance of 0.5 8 7 6 5 4 3 2 1 0 0 0 1 2 3 4 days post inoculation 0 1 2 days post inoculation Fig. Plugs of M medium or mycelium from the plant symbiotic fungus G. 2005 7 A 3. respectively. C) Type 1A experiment with R. closed squares to intact CIIDIR-1 fungal isolate. sp.5 1 0. experiment. Open circles refer to water control samples. a slight enhancement on growth at two and three days post inoculation was observed compared to the intact fungus (Fig. respectively. solani. D) Type 1B experiment with R. lycopersici (Fig. open diamonds to fungicide (TIMSEN). Sinaloa in Mexico.05 to the negative and positive control treatments (data not shown). Molecular analysis of a 28S rDNA hypervariable region suggests that the fungus isolated in this work from soils of Guasave. 5.

.

) Arx and D.. has been described as a saprotrophic growing fungus. 2005 propagation and dispersal mechanism for this fungal species.138 / Volumen 23. A.F. 1992. It is possible that CIIDIR-1 might use a similar antagonistic mechanism. including Fusarium culmorum (W. globosum. 1982). CIIDIR-1 might be an important component of the rhizosphere and its microbial interactions. (Knudsen et al. 1988. 1962). sp. Soil Biology and Biochemistry 25:157164. Y. C. N. Brundrett. Working with mycorrhizas in forestry and agriculture.. CIIDIR-1 behaves as an antagonist of root rot fungi. R. one of the fungi with close homology to the 28S rDNA region of CIIDIR-1.. 5).. solani in in vitro bioassays. Sivan and Chet. 1996. I. M. since the fungus could be established on the root system in the greenhouse. Nevertheless. Montoya-Rodríguez. Melina LopezMeyer and Megan Ackerman for the critical review of this manuscript. Canberra. CIIDIR-1 fungal isolate showed an antagonistic effect on F.. and Alabouvette. M. globosum is able to grow not only in the epidermis. G. Dell. This would explain its widespread distribution throughout the valley. 539 p. Número 2. Early events of vesiculararbuscular mycorrhiza formation on Ri T-DNA transformed roots. and Fortin. Mexico. Walker by a sterile red fungus in the rhizosphere of wheat (Triticum aestivum L. Paul. Minnesota. Márquez-Zequera. E. 1994). Sinaloa. Chaetomium globosum shows antagonism to other fungi involved in root diseases. Microbial antagonism to the imperfect stage of the apple scab pathogen. Mandeel and Baker. involves the production of antibiotic substances (Di Pietro et al. The immediate response of CIIDIR-1 mycelium to the presence of the phytopathogens was exacerbated growth surrounding and limiting growth of the pathogenic fungi (Fig. 6). in pots. 1993. Berbee. which suggests its possible ubiquitous presence throughout the Guasave valley.. and 2003) and UNESCO (MEX200606). Revista Mexicana de Fitopatología 21:123-127.. 1992). The main difference between root tissues growing under these two conditions is the formation of an exodermis with Casparian bands and complete suberin lamellae under aeroponics conditions. since aqueous extracts of the mycelium did not seem to inhibit growth of the phytopathogens (Fig. The authors thank Dr. Venturia inaequalis. does not invade the root tissue and interacts only with the epidermis and never invades the exodermis. R. C. J. St. Hubbard et al. and in the field are currently underway to discover if the effect observed in vitro has any relevance in vivo. C. lycopersici and R. Microsclerotia of CIIDIR-1 were semi-purified from the total AMF spore preparations as forming part of the black spore morphotype. which constitutes the most abundant AMF morphotype in this region. 4B and C). USA. Races of Fusarium oxysporum f. in tomato (Lycopersicon esculentum Mill. 4D) when they are young and alive... This would create a mycelial net that would help prevent the infection of roots with phytopathogens. New Phytologist 108:211-218. Bougher. Australia. 1989) and competition for thiamine factors into the control of Gaeummanomyces graminis (Sacc. profuse mycelium growth and formation of microsclerotia was observed on the decaying roots (Figs. F. Further experiments in vitro. It is still not known if there is a similar mechanism for root protection against invasion by CIIDIR-1. This suggests an inhibitory role of the exodermis for the establishment of a plant-pathogen association (Reissinger et al. 1995) and Pythium ultimum Trow (Di Pietro et al. Phytopathology 73:228234.G. 1991.. CIIDIR-1 has the potential to be used as a biocontrol agent to prevent root rot disease. Cook. 1983. 2003. and it may contribute to the soil suppressiveness of disease in these soils. H.. When the plant tissue aged. but also in the exodermis and cortical cells.A. showed that CIIDIR-1 grows abundantly over the roots without any sign of root penetration (Fig.) (Shankar et al. J. 1983.. Observations made in vitro with hairy roots (Fig. 2003). Carrillo-Fasio. a mechanism involved in biological control . In MS agar (Murashige and Skoog. Involvement of soil abiotic factors in the mechanisms of soil suppressiveness to Fusarium wilts. sp. lycopersici Snyder and Hansen. Bécard. 374 p. Sm. J. C.. and Nick. Australian Centre for International Agricultural Research.. This is especially relevant for horticultural crops that involve germination in the greenhouse and further transfer of plantlets to soil. the antagonistic mechanism used by this fungus remains to be elucidated. Cruz-Ortega. Couteaudier. G. Tim. Andrews.. 2003).) in the valley of Culiacan..) Sacc.. This does not seem to be the mechanism that CIIDIR-1 isolate uses. 1992. LITERATURE CITED Amir. Olivier var. The Nature and Practice of Biological Control of Plant Pathogens. CECyT-Sinaloa (2002. tritici J. Competition for carbon. Acknowledgements.. and Nordheim. and will need to be addressed in the future. American Phytopathology Society. J. CIIDIR-1 most probably behaves saprotrophically in vivo.. when grown on aeroponics. García-Estrada. The mechanism that this Chaetomium species uses. and SañudoBarajas. globosum. Detailed studies of AMF composition from these soils has shown that only two out of 75 different soil samples from this region do not contain spores of this morphotype (Martínez-Alvarez. T. and Baker. Competition for carbon in soil and rhizosphere. and the support received by IPN (CGPI20020546). and iron has been shown to be a mechanism associated with biocontrol or suppression of Fusarium wilt in several systems by non-pathogenic Fusarium and Trichoderma species (Couteaudier. K. CIIDIR-1 behaves in vitro as a saprophyte in the presence of roots. nitrogen. oxysporum f.. 4A) and non-transformed roots of carrot and tomato (data not shown). B. 1992.

. P. F..M. 1973. Winter. D. Reissinger.. and Cain. Proceedings of the 16th International Pepper Conference: Tampico. I. Guarro. Gardener. Von Arx. Detection of arbuscular mycorrhizal fungi (Glomales) in roots by nested PCR and SSCP (Single Stranded Conformation Polymorphism). Plant and Soil 226:189-196. Jensen. Hubbard.. Canadian Journal of Microbiology 40:478-483. Larsen. W. Guasave. Canadian Journal of Microbiology 28:431-437. Gut-Rella. Biological Control of Plant Diseases. Role of antibiotics produced by Chaetomium globosum in biocontrol of Phytium ultimum. Nova Hedwigia 84:1162. González-Chavira. 25-28. J. J. J.. Olsson. D. The Ascomycete genus Chaetomium. sp. M. R. CIIDIR-IPN Unidad Sinaloa. D. 1992. J. production of inhibitory compounds and hyphal interactions in suppression of the take-all fungus by a sterile red-fungus... Débois. Steckelbroeck. Weller..). Mycopathologia 150:53-60. Patógenos involucrados en la marchitez del chile.. 2001.F.. 1991. S. and Thomashow. Biocontrol of seedling diseases of barley and wheat caused by Fusarium culmorum and Bipolaris sorokiniana: Effects of selected fungal antagonists on growth and yield components.. 2001. Tamaulipas. M. Infection of barley roots by Chaetomium globosum: evidence for a protective role of the exodermis. and Dhingra. A re evaluation of the Eurotiales. Phytopathology 81:462-469. and Orduz. 1987. 1994. Mandeel. . M. Instituto Politécnico Nacional. Untereiner. Journal of Experimental Botany 52:487511. Annual Review of Phytopathology 40:309-348. 1986. D. T. J. 99-104. L.M. Harman. K. Mexico. 78 p. Sivan. J. Kjøller. D. O. R. A. 1999. S. Mycological Research 107:1094-1102. K. Applied and Environmental Microbiology 65:1428-1434. 1999. Papavizas... S. 2003.A. Shankar.C. A.. On Thielavia and some similar genera of the Ascomycetes. Phytopathology 82:131-135. T.. Pereira. R. and Naveau. Gillespie-Sasse. C.M. and Chet. V. a causal agent of damping off. Molecular phylogeny of the cleistothecial fungi placed in Cephalothecaceae and Pseudeurotiaceae.. Malloch. y GuzmánMaldonado. Identificación Molecular de Hongos Micorrízicos Arbusculares (HMAs) y Hongos Asociados en Suelos del Norte de Sinaloa. Torres-Pacheco. Mycologia 91:836-848. meridionalis in soybean stems by Chaetomium globosum. In vitro evaluation of Trichoderma and Glyocladium antagonism against the symbiotic fungus of the leaf-cutting ant Atta cephalotes. Suppression of the biocontrol agent Trichoderma harzianum by mycelium of the arbuscular mycorrhizal fungus Glomus intraradices in root-free soil. J. J. A. J. and Jensen. I. Plenum Press.. El-Tarabily. F.. M. Di Pietro. S. Ortiz. USA. 2002.C. S. L. The Genus Thielavia.A. 1999. 2003... Phytopathology 79:198-203. pp. Whipps.. 1989. Von Arx. H..J. Martínez-Alvarez. G. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Green. and R. J. 1982. Q. and Skoog. Interaction of a biological control agent. Pachlatko.. Rowland. Mycologia 65:1055-1077. Hartung. 1997.M. New York. Blast 2 sequences-a new tool for comparing protein and nucleotide sequences.. and Rosendahl. and Sikora. Canadian Journal of Botany 79:321-333. D. Possible roles of competition for thiamine. Plant Pathology 44:467-477. Plant Pathology 46:216-223. and Eckenrode. with seed coat microflora. FEMS Microbiology Letters 174:247-250. The possible role of competition between Trichoderma harzianum and Fusarium oxysporum on rhizosphere colonization. J. Raaijmakers. Mexico. Suppression of Rhizoctonia solani diseases of sugar beet by antagonistic and plant growthpromoting yeasts.. 462 p. A. Cook (eds. and Madden. pp. Tatusova. C.. Physiologia Plantarum 15:473-497.L. T. Tjanos. R. Molecular systematics of the ascomycete genus Farrowia (Chaetomiaceae). Murashige. and Jakobsen.B. and Blackwell. 2004. Sinaloa. and Figueras. Mechanisms involved in biological control of Fusarium wilt on cucumber with strains of non-pathogenic Fusarium oxysporum.C. 2000..A. 1962. Knudsen. In: E.. Tesis de Maestría en Ciencias en Recursos Naturales y Medio Ambiente. W. Studies in Mycologia 8:1-31. B. Microbial populations responsible for specific soil suppressiveness to plant pathogens. J.. Suppression of Diaporthe phaseolorum f.. Persoonia 13:273-300. A. Von Arx. I... and Sivasithamparam. 1995. Microbial interactions and biocontrol in the rhizosphere.S.A.. H. Journal of Applied Microbiology 96:6975. 1975. I. 2000. and Baker.. and Schwinn. Suh. Kurtböke.. Chaetomium globosum.Revista Mexicana de FITOPATOLOGIA/ 139 of Fusarium wilts.. Hockenhull. F. 2002.