You are on page 1of 5

Resumen Durante los ltimos aos los azoles anti fngicos se han presentado como una

herramienta potencialmente efectiva contra infecciones de Candida albicans, sin embargo la


resistencia a azoles puede ocurrir mediante mutaciones en la secuencia del gen ERG11, lo cual
presenta un problema de gran importancia a la hora de encontrar tratamiento efectivo contra las
infecciones de C. albicans, en este estudio se buscaron mutaciones en las secuencias del gen
ERG11 en muestras provistas, luego de la amplificacin y secuenciacin del gen ERG11 de la cepa
presente, se realiz un anlisis bioinformatico con intencin de comparar la muestra secuenciada
con informacin almacenada en bases de datos la finalidad de esta bsqueda consisti en encontrar
variaciones en las secuencias que indicaran la presencia de unas potencial resistencia a azoles de la
muestra.
Palabras clave: Candida albicans, gen ERG11, mutacin, Antifngicos, PCR
Introduccin En estas ltimas dos dcadas el
hongo Candida albicans ha adquirido una
gran importancia (Mariceli & Claudete,
2007), al ser responsable de una cantidad
importante de condiciones clnicas, pasando
por infecciones de la mucosa tales como
vaginitis y candidiasis orofaringea, hasta
llegar a algunas con un alto ndice de
mortalidad como candidemia (Morio, Loge,
Besse, Hannequin, & Le Pape, 2010;
Lockhart, y otros, 2012) debido a su carcter
de patgeno oportunista suele actuar en
situaciones de pacientes inmunodeprimidos
que suelen ser resultado de tratamiento contra
el cncer, trasplante de mdula sea y/o
SIDA (Vandeputte, Ferrari, & Coste, 2012)
sin embargo la gran fama adquirida por este
hongo en tiempos recientes no se relaciona
tanto en la patognesis sino en su resistencia
al tratamiento. Usualmente la forma ms
comn de tratar las infecciones de Candida es
mediante el uso de azoles antifungicos
(Mariceli & Claudete, 2007)
La ruta de sntesis del ergosterol, ha sido el
blanco ms ampliamente utilizado para el
desarrollo de antifngicos en agricultura y
medicina, dado los efectos en viabilidad y
crecimiento celular que su inhibicin produce
en los hongos, as como del carcter
especfico que tiene la accin de las
sustancias. (Van den Bossche, Willemsens,
Cools, Lauwers, & Le Jeune, 1978). Los
antifngicos son compuestos, naturales o
sintticos,
que
pueden
producir
modificaciones en estructuras bsicas de la
clula fngica inhibiendo su desarrollo y

alterando su viabilidad. Actualmente, existen


varias familias de antifngicos disponibles en
el mercado siendo una de los ms comunes
los azoles, que inhiben la enzima 14lanosterol-desmetilasa,
afectando
la
biosntesis de ergosterol, un importante
componente de la membrana plasmtica
fngica (Fuentes, et al., 2014).
Sin embargo, el uso indiscriminado de estas
sustancias ha favorecido la formacin de
cepas resistentes de casi todas las especies
que se conocen como patgenas de plantas de
importancia econmica y humanos (Vanden,
et al., 1997), por lo que entonces se ha
continuado con el estudio de los blancos de
accin y se ha determinado que el desarrollo
de resistencia al fluconazol es un proceso
complejo en el cual intervienen diversos
factores, tanto del husped como del
microorganismo.
Entre
los
factores
dependientes del microorganismo figuran
mecanismos moleculares y celulares. (Perea,
2000) A nivel molecular, diversos
mecansimos de resistencia ha sido descritos
en Candida. albicans como alteraciones
genticas puntuales en la regin 405-488 del
gen que codifica para la enzima blanco del
frmaco o ERG11, como por ejemplo G464S,
R467K y I471T, y/o sobre-expresin de este
gen. (Fuentes, et al., 2014).
En este estudio se presenta la secuencia del
gen ERG11 de Candida albicans
que
codifica para la enzima lanosterol-14-alfademetilasa, junto con la secuencia del gen

ERG11 y la prediccin de mutaciones que


originan sustituciones en aminocidos que
causen resistencia a azoles, ya que estas
alteraciones generan prdida de afinidad del
azol por su blanco de accin, la intencin con
esto es hacer un estudio comparativo a partir
de datos obtenidos experimentalmente contra
informacin obtenida de bases de datos, esto
con la finalidad de encontrar posibles
mutaciones
Materiales y Mtodos Se realiz la
extraccin de ADN de candida albicans, de
una siembra en agar YEPD (1% Extracto de
levadura, 2%Peptona, 2% Dextrosa (Glucosa)
y 1.5% Agar), previamente incubado a 37C
por durante 24 - 48 horas previas de la
extraccin. Se procede a realizar la lisis con
solucin salina, y posterior mente realizar la
extraccin segn el protocolo de levaduras
de Wizard genomic DNA promega.
Para la seleccin de primers se obtuvo la
secuencia en NCBI (National Center for
Biothecnology informatic) y se hizo un
diseo de primers para la secuencia ERG11
en prime3plus. Posteriormente se realiz un
PCR, donde amplificamos 407pb del gen
ERG11 de la regin donde estn los hotspots
en el marcador. Primero se realiza el Master
Mix, y se divide en 3 eppendorf y en uno se
realiza una muestra problema con agua ultra
pura, y en los 2 restantes se punen las
muestras de ADN previamente obtenidas,
despus se llevan las muestras al
termociclador y se programa el perfil trmico
(tabla A).

Clean-Up System [Promega, Madison


(Wisconsin), USA]. La electroforesis de los
productos de PCR se realiza en un gel de
agarosa al 1,5%, se deja correr y se analiza
con ayuda de un transluminador.
Al final se realiz la secuenciacin que se
hizo con un secuenciador ABI PRISM 310
Genetic Analyzer [Applied Biosyste ms,
Foster City (California), USA] y las
reacciones de secuenciacin se realizaron con
el Kit BigDye Terminator v3.1 Cycle
Sequencing (Applied Biosystems, Foster
City, CA, USA).
Resultados Se obtiene la secuencia consenso
y se visualizan los resultados mediante el
programa CLC main Workbench 7.5.1.

Ilustracin 1 Secuencia forward sepa


Cndida Albicans: se elimina los primeros
100 nucletidos debidos al sonido que tienen
esta tcnica por defecto. Los picos detallados
que se pueden ver en la imagen muestran
una secuenciacin de muy alta calidad.

Tabla A
Numero de
ciclos
1
35
1
1

Temperatura Tiempo(min)
94C
94C
58C
72C
72C
10C

5
1
1
1
1

Se hace la purificacin del producto de la


PCR usando el Kit Wizard SV Gel and PCR

Ilustracin 2 Secuencia Reverse sepa


Cndida Albicans: se elimina los primeros
100 nucletidos debido al sonido que tienen
esta tcnica por defecto. Los picos detallados
muestran una cromatografa correcta con
nivel de ruido moderado.

Secuencia consenso (Anexo2):


TTACGTTTTAGTTTCTCCAGGTTATGCT
CATACTAGTGAAAGATATTTTGATAAC
CCTGAAGATTTTGATCCAACTAGATGG
GACACTGCTGCTGCCAAAGCTAATTCT
GTTTCATTTAACTCTTCTGATGAAGTT
GATTATGGGTTTGGGAAAGTTTCTAAA
GGGGTTTCTTCACCTTATTTACCATTTG
GTGGTGGTAGACATAGATGTATTGGG
GAACAATTTGCTTATGTTCAATTGGGA
ACCATTTTAACTACTTTTGTTTATAACT
TAAGATGGACTATTGATGGTTATAAAG
TGCCTGACCCTGATTATAGTTCAAT

Ilustracin 3 blast2 secuencia nativa vs


secuencia consenso: en la imagen se ilustra
el resultado del alineamiento entre la
secuencias, se observa una mutacin en el
primer nucletido del tercer codn, el
polimorfismo anterior cambia una metionina
por una valina en la estructura de la
protena.
Como se puede ver en el (anexo 2) la
secuencia
forward
y
reverse
son
complementaria en ms de un 90% de sus
bases, porcentaje que no tiene en cuenta los
datos basura debido al error de la lectura de
las primeras bases. En consecuencia, la
secuencia consenso da una secuencia ms
certera para la comparacin gentica del
organismo nativo y la sepa a estudio, este
tema se discutir ms adelante.

Por otro lado, la ilustracin 2 muestra que la


secuencia reverse posee un ruido de fondo a
comparacin
de
secuencia
forward
(ilustracin 1), este ruido es causado por
diferentes razones, una de las ms comunes
es la purificacin incorrecta del ADN y otros
reactivos que pueden afectar los resultados
esperados. Para solucionar esto se repite el
proceso de purificacin. (Anonimo)
Otras causas pueden afectar la secuenciacin
despus de la purificacin, estas son: la baja
concentracin de ADN, concentracin del
cebador deficiente o cebador disfuncional,
provocando una ausencia de reaccin en la
PCR. En otras circunstancias, el cebador
puede tener dos o ms puntos de hibridacin
lo que reduce la veracidad de los resultados
causando ruido. Para solucionar estos
problemas se asegura un diseo de cebador
que cumpla los requisitos de la reaccin, y
suministrar la concentracin adecuado de
cada reactivo. (Anonimo)
Finalmente la comparacin entre la secuencia
nativa y la secuencia consenso indica que hay
variaciones genticas en el gen erg11, que
pueden contribuir a la resistencia a asoles en
esta sepa, por tanto, la resistencia de esta sepa
se debe a un cambio de la estructura
protenica de su membrana causado por el
cambio en un solo nucletido del gen erg11,
resultados similares se puede ver tambin en
la mutaciones A395T en el gen ERG11 de la
Cndida Tropicalis, mutacin resultante de
una sustitucin en el Y132F en el
ERG11p,dndole a la sepa resistencia al
Fluconazole. Por tanto la hiptesis planteada
es corecta.
Discusin La bioinformtica ligada a las
tcnicas moleculares significan un valioso
desarrollo para estudios en gentica,
bioqumica y molecular, los cuales han sido
de gran utilidad al momento de enfrentarse a
una nueva incgnita. En este estudio a partir
de la amplificacin de gen mediante PCR, la
secuenciacin del ADN del gen ERG11 de
Candida albicans y el posterior anlisis de la
secuencia
con
las
herramientas
bioinformticas se logr realizar un
alineamiento (BI2seq) el cual permite

identificar especficamente las regiones


donde se dan las posibles mutaciones de las
protenas involucradas en la va metablica y
sntesis del ergosterol en C. albicans.
La secuenciacin del gen ERG11 solamente
mostr una sustitucin en el primer
nucletido del tercer codn que es ATG a
ACG , este polimorfismo cambia entonces
una metionina por una valina en la estructura
de la protena, sin embargo no se debe
descartar la presencia de otras mutaciones en
la regin de los primeros aminocidos ya que
esta regin no se secuencio correctamente,
para lo cual, se requiere la secuenciacin del
gen ERG11 de nuevo para as ser analizada
de nuevo y determinar si esa regin puede
estar involucrada con mutaciones que generan
resistencia a los antifngicos.
La mutacin que se identific en la secuencia,
no debe ser considerada como un cambio
relevante a la hora de determinar la
resistencia a los azoles, pues las mutaciones
que han sido mayormente reportadas por
causar resistencia en el gen ERG11 de
Candida albicans son (F308S, P230L y
Y118A) , y una sustitucin particular de un
aminocido puede ser determinada como
patolgica si el clasificador usado lo
predice como deletreo o causante de
enfermedad (Debnath & Addya, 2014). Estas
mutaciones estn dispersas en hot spots en los
lmites de aminocidos 105 a 165, 266 a 287
y 405 a 488. (Marichal, et al., 1999). De
igual manera, si una mutacin se encuentra
lejos del sitio activo o del grupo Heme
probablemente no cause una resistencia a
azoles (Debnath & Addya, 2014).
Adems la resistencia a azoles en C. albicans
es un proceso multifactorial (Balkis, Leidich,
Mukherjee, & Ghannoum, 2002) que puede
ser mediado por distintos mecanismos
independientes al gen ERG11. (Debnath &
Addya, 2014). Es decir, la resistencia no solo
se debe a mutaciones en el gen ERG11,
tambin puede deberse por la sobre-expresin
de los genes de bombas de eflujo CDR1 y
CDR2. En este proceso una presin selectiva
como la presencia del antifngico, permite
que las clulas adquieran un fenotipo

resistente en el cual varios mecanismos


puedan contribuir (Fuentes, et al., 2014).
Entre otros mecanismos moleculares de
resistencia a los azoles figura tambin la
alteracin en otras enzimas de la ruta
biosinttica del ergoesterol (Perea, 2000).
El carcter multifactorial que presenta la
resistencia de C. albicans a los antifngicos,
hace necesario que se adopten nuevas
estrategias que permitan el control de estas
afecciones, dado que tiene una gran
importancia en cuanto a enfermedades en
humanos y en patologas en plantas;
estrategias en la que se desarrollen molculas
ms potentes, la investigacin de nuevos
antifngicos con nuevas dianas y mecanismos
de accin, as como combinaciones con
inhibidores de los transportadores activos de
membrana. (Perea, 2000).
Esto constituye adems, un aporte y una
herramienta til para diagnosticar si hay
resistencia a azoles en Candida albicans.

Bibliografa
Anonimo. (s.f.). PROBLEMAS MS
FRECUENTES Y POSIBLES
SOLUCIONES. Recuperado el 28 de
noviembre de 2014, de
http://www.eez.csic.es/files/Problemas_
Mas_Frecuentes_Y_Soluciones.pdf [1]
Balkis, M., Leidich, S., Mukherjee, P., &
Ghannoum, M. (2002). Mechanism of
fungal resistance. Drugs, 62: 1025-1040.
Debnath, S., & Addya, S. (2014). Structural basis
for heterogeneous phenotype of ERG11
dependent Azole resistance in C.albicans
clinical isolates. SpringerPlus, 3:660.
Fuentes, M., H, G., Alburquenque, C., Falconer,
M. A., Amaro, J., & Tapia, C. (2014).
Caracterizacin de los mecanismos de
resistencia a azoles en cepas clnicas
chilenas de Candida albicans. Revista
Chilena de Infectologa. Vol 31, 511-517.
Jones, T. F. (16 de abril de 2004). ncbi. Candida
albicans SC5314 chromosome 5 Ctg1910080, whole genome shotgun sequence.

Stanford, California. Recuperado el 28 de


noviembre de 2014, de ncbi:
http://www.ncbi.nlm.nih.gov/nuccore/N
W_139483.1?from=8338&to=9924&rep
ort
Lockhart, S., Lqbal, N., Cleveland, A., Farley, M.,
Harrison, L., & Bolden, C. (2012).
Species identification and antifungal
susceptibility testing of Candida
bloodstream isolates from populationbased surveillance studies in two U.S
cities from, 2008 to 2011. Journal of
Clinical Microbiology, 435-442.
Mariceli, R., & Claudete, P. (2007). Up-regulation
of ERG11 gene among fluoconazoleresistant Candida albicans generated in
vitro: is there any clinical implications?
Diagnostic Microbiology and Infectious
Disease, 71-75.
Marichal, P., Koymans, L., Willemsens, S.,
Bellens, D., Verhasselt, P., Luyten, W., .
. . Bossche, H. (1999). Contribution of
mutations in the cytochrome P450
14alpha-demethylase (ERG11p.
CYP51p) to azole resistance in Candida
albicans . Microbiology, 145: 2701-2713.
Morio, F., Loge, C., Besse, B., Hannequin, C., &
Le Pape, P. (2010). Screening for amino
acid substitutions in the Candida albicans
Erg11 protein of azole-susceptible and
azole-resistant clinical isolates: new
substitutions and a review of the
literature. Diagnostic Microbiology and
Infectious Disease, 373-384.

Perea, S. (2000). Resistencia de Candida albicans


a los azoles. Revista Espaola de
Quimioterapia. 13(3).
Tan J, Z. J. (15 de noviembre de 2014). The
A395T Mutation in ERG11 Gene
Confers Fluconazole Resistance in
Candida tropicalis Causing Candidemia.
Beijing: Department of Dermatology,
Peking University First Hospital,
Research Center for Medical Mycology,
Peking University, , People. Recuperado
el 28 de noviembre de 2014, de
http://www.ncbi.nlm.nih.gov/pubmed/25
398256
Van den Bossche, H., Willemsens, G., Cools, W.,
Lauwers, W. F., & Le Jeune, L. (1978).
Biochemical effects of miconazole on
fungi. II. Inhibition of ergosterol
biosynthesis in Candida albicans.
Chemico-biological interactions, 59-78.
Vanden, B. H., Dromer, F., Improvisi, I., LozanoChiu, M., Rex, J. H., & Sanglard, D.
(1997). Antifungal drug resistance in
pathogenic fungi. Medical Mycology,
119-128.
Vandeputte, P., Ferrari, S., & Coste, A. (2012).
Antifungal resistance and new strategies
to control fungal infections. International
Journal of Microbiology.
Yonghao, X., Lamei, C., & Chunyang, L. (2008).
Susceptibility of clinical isolates of
Candida species to fluconazole and
detections of Candida albicans ERG11
mutations. Journal of Antimicrobial
Chemotherapy 61, 798-804.