You are on page 1of 12

MOLECULAR, CELLULAR, AND DEVELOPMENTAL BIOLOGY

Toxicological and gene expression analysis of the impact of aflatoxin B1
on hepatic function of male broiler chicks
L. P. Yarru,* R. S. Settivari,* E. Antoniou,* D. R. Ledoux,*1 and G. E. Rottinghaus†
*Department of Animal Sciences, and †Veterinary Medical Diagnostic Laboratory,
University of Missouri, Columbia 65211
ABSTRACT The objective of this study was to determine the effects of dietary aflatoxin B1 (AFB1) on hepatic gene expression in male broiler chicks. Seventy-five
1-d-old male broiler chicks were assigned to 3 dietary
treatments (5 replicates of 5 chicks each) from hatch to
d 21. The diets contained 0, 1 and 2 mg of AFB1/kg of
feed. Aflatoxin B1 reduced (P < 0.05) feed intake, BW
gain, serum total proteins, and serum Ca and P, but
increased (P < 0.01) liver weights in a dose-dependent
manner. Microarray analysis was used to identify shifts
in genetic expression associated with the affected physiological processes in chicks fed 0 and 2 mg of AFB1/
kg of feed to identify potential targets for pharmacological/toxicological intervention. A loop design was
used for microarray experiments with 3 technical and
4 biological replicates per treatment group. Ribonucleic
acid was extracted from liver tissue, and its quality
was determined using gel electrophoresis and spectrophotometry. High-quality RNA was purified from DNA

contamination, reverse transcribed, and hybridized to
an oligonucleotide microarray chip. Microarray data
were analyzed using a 2-step ANOVA model and validated by quantitative real-time PCR of selected genes.
Genes with false discovery rates less than 13% and fold
change greater than 1.4 were considered differentially
expressed. Compared with controls (0 mg of AFB1/kg),
various genes associated with energy production and
fatty acid metabolism (carnitine palmitoyl transferase),
growth and development (insulin-like growth factor 1),
antioxidant protection (glutathione S transferase), detoxification (epoxide hydrolase), coagulation (coagulation factors IX and X), and immune protection (interleukins) were downregulated, whereas genes associated
with cell proliferation (ornithine decarboxylase) were
upregulated in birds fed 2 mg of AFB1/kg. This study
demonstrates that AFB1 exposure at a concentration
of 2 mg/kg results in physiological responses associated
with altered gene expression in chick livers.

Key words: aflatoxin B1, gene expression, broiler, liver, microarray
2009 Poultry Science 88:360–371
doi:10.3382/ps.2008-00258

INTRODUCTION

biologically active form and causes poor performance,
liver lesions, and immunosuppression in poultry (Kubena et al., 1990; Ledoux et al., 1999). Aflatoxin B1 also
increases free radical production, leading to oxidative
damage and lipid peroxidation, which might ultimately
lead to cell damage and death (Surai, 2002). Eraslan et
al. (2005) studied the effects of AF on oxidative stress
and observed a reduction in antioxidant activity in
the erythrocytes of chicks fed AF compared with controls. Although problems associated with AF have been
known for decades and a great deal of research has been
conducted on the effects of AF at the animal level, very
little research has been done at the gene level. Microarrays are being used for global gene expression profiling
to identify candidate genes and to map growth, metabolic, and regulatory pathways that control important
production traits. To date, no study has been reported
regarding the measurement of gene expression in chicks
fed AFB1 using microarrays. The current project will
allow us to determine genes that are specifically ex-

Mycotoxins are naturally occurring toxic secondary
metabolites of fungi that may be present in food ingredients (Kuiper-Goodman, 1995). Several mycotoxins
have been associated with various animal and poultry
diseases. Mycotoxins encompass a wide spectrum of different chemical structures and affect many target organs such as liver and kidney and systems such as the
nervous and immune systems (Kuiper-Goodman, 1995).
A major contaminant of common feed ingredients used
in poultry rations is the aflatoxins (AF; Smith et al.,
1995). Aflatoxins are a class of mycotoxins produced by
the fungi Aspergillus parasiticus and Aspergillus flavus
(Smith et al., 1995). Aflatoxin B1 (AFB1) is the most
©2009 Poultry Science Association Inc.
Received June 25, 2008.
Accepted September 29, 2008.
1
Corresponding author: LedouxD@missouri.edu

360

2% SDS and twice with water (3 min each wash). metabolism. CA). Serum Biochemistry Collected blood was centrifuged to obtain serum. IDT DNA). Serum analyses included determinations of serum total protein (TP). and a piece of liver tissue was collected. These measurements are components of a larger biochemical profile determined at the Veterinary Medical Diagnostic Laboratory using an auto-analyzer (Kodak Ektachem Analyzer. coagulation. weighed. RNA Extraction Ribonucleic acid was extracted from the liver samples of birds fed 0 and 2 mg of AFB1/kg using an RNeasy Midi Kit (Qiagen Inc. St.0 mg of AFB1/kg of diet. Louis. IDT DNA.2% I-block (Applied Biosystems. Bedford. purified using DNase-1 (Ambion Inc. Tucson). The animal care and use protocol was reviewed and approved by the University of Missouri-Columbia Animal Care and Use Committee.. The purified RNA samples were preserved at −80°C until used. CA) at 42°C to decrease background and increase specificity. 25× amino-allyl dUTP/dNTP (Sigma Chemicals. 1996). The slides were dried by centrifugation and stored in the dark until used. Sample Collection On d 21. Stratagene. Average feed intake and BW gain were determined. Concentrated and purified total RNA (15 µg) from each chick liver was reverse-transcribed to cDNA using oligo dT (5 µg/µL. 2006). and the quantity was measured using an ND-1000 spectrophotometer (Nanodrop Technologies. Fifteen chicks (5 replicates of 3 chicks each) from each treatment were killed with carbon dioxide. Chicks were maintained on a 24-h continuous light schedule and allowed ad libitum access to feed and water.HEPATIC GENE EXPRESSION IN BROILER CHICKS FED AFLATOXIN B1 pressed in response to AF and thus enable us to identify various pathways that control growth. random hexamers (5 µg/µL. snap-frozen in liquid nitrogen.. immune. The means for treatments showing significant differences in the ANOVA were compared using Fisher’s protected least significant difference procedure at a significance based on the 0. wingbanded. TX) and phenol:chloroform:isoamyl alcohol (25:24:1). representing entire chicken genome) were purchased from the Genomic Research Laboratory (University of Arizona.05 level of probability. development. Austin. and antioxidant status of broiler chicken.. The slides were washed once with 0. Figure 1). The slides were cross-linked using an ultraviolet cross-linker (600 mJ). CA). and concentrated using Microcon YM30 filters (Millipore Corp. NY).120 oligonucleotides (70 bp. MO). Aflatoxin B1 was supplied by Aspergillus parasiticus (NRRL 2999) culture material containing 760 mg/ kg of AFB1. The resulting cDNA was purified using Microcon-30 filters (Millipore) and conjugated separately with Cy3 . and P using standard procedures. Following rehydration for 30 s at 55°C. with 4 biological replicates (4 animals/treatment group) and 3 technical replicates (each RNA sample repeated on 3 different arrays. IA). Microarray Hybridization A loop design was used for microarray experiments. Eastman Kodak Co. and blood was collected via cardiac puncture for serum chemistry analysis. Diets The basal diet was a commercial type corn-soybean meal diet formulated to meet the nutritional requirement of growing chicks as recommended by the National Research Council (1994). 2005). Coralville. and birds were inspected daily for any health problems. MA) as described previously (Settivari et al. Valencia. 361 Statistical Analysis of Physiological Responses Data were analyzed using the General Linear Model procedures of SAS (SAS Institute. Before hybridization. Wilmington. B) a basal diet with 1. The chicks were randomly assigned to 3 treatments with 5 replicates of 5 birds each. Microarray Slide Preparation Microarray slides containing 21. the microarray slides were rehydrated to increase the spot size and to spread the DNA more uniformly within each spot. Rudd. Mortality was recorded. Liver weight of each bird was recorded. Foster City. Ca. The quality and integrity of the purified RNA was checked through agarose gel electrophoresis. MATERIALS AND METHODS Experimental Design and Birds Seventy-five 1-d-old (Cobb × Cobb) male broiler chicks were purchased from a commercial hatchery (Hoover’s Hatchery Inc. Rochester. IA).. which was immediately frozen until submitted for serum biochemistry analysis. DE. all birds were weighed and feed intake was measured for each pen. and C) a basal diet with 2.. Microarray slides were incubated in 0. Dietary treatments included A) a basal diet containing 0 mg of AFB1/kg of diet (control). and assigned to pens in stainless-steel chick batteries for 21 d. the slides were snap-dried on a 100°C hot plate surface for 5 s. Flanagan.0 mg of AFB1/kg of diet. and stored at −80°C for microarray and real time-PCR analyses. La Jolla. detoxification. and reverse transcriptase (StrataScript RT..

Four biological and 3 technical replicates were used for the microarray experiment.nih.. Dried cDNA pellets were resuspended with the hybridization mixture. The serial entry number for the microarray data is GSE8603. Ygnlijk = µ + Ai + Dk +(AD)ik + sgnlijk. 2002).0 software (Eisen et al. labeling and hybridizations were carried out with the same RNA labeled with Cy3 and Cy5 on the arrays. the theoretical mean ratio of Cy3 to Cy5 is equal to 1. The resulting files and images were linked together and stored in the local BioArray Software Environment database (Saal et al. NJ) by incubating in the dark for 1 h. A3. the slides were rinsed in wash solution I (20× SSC. unconjugated dye using a Qia-quick PCR purification kit (Qiagen) following the manufacturer’s instructions. GSM213392. respectively.nlm. or Cy5 mono reaction dyes (Amersham Biosciences. V is the animal. A4 are chicks fed 2 mg of aflatoxin/kg of feed. Figure 1. GSM213358. GSM213402. €gnlijk = (GV)gi + (GD)gk + rgnlijk. 2001) was applied to the microarray data using MAANOVA and its Java graphic user interface JMAANOVA (Wu. and were used for further analysis.or downregulated.. w is the observed median intensity for each color channel by gene. and analyzed as described previously. Union City.12 software (Axon Instruments Inc. Because the same RNA sample is hybridized to the arrays. A is the array.gov/projects/geo/). Genes with expression above or below this threshold were considered as up. GSM213399. which consisted of 1× 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (pH 7. D is the dye. and € and r are the residuals from the linear models. GSM213360. A 2-stage ANOVA model (Wolfinger et al. The second stage was the gene-specific model in which the effects of treatment-gene interaction and array-gene interaction were modeled as random effects. The first stage was the normalization model to remove the effect of array and dye at the across gene level. 2003) to model the data and run statistical analyses. A1. For these models ygnlijk = log2(wgnlijk). Microarray raw data files were deposited with the National Center for Biotechnology Information Gene Expression Omnibus (http://www.0). Hybridizations in the microarray experiment were given the following serial numbers: GSM213349. The 2 cDNA samples. C1. and the platform number is GPL5618. C4 are control chicks fed no aflatoxin B1. Microarray Slide Scanning and Analysis Microarray slides were scanned using a GenePix 4000B Microarray Scanner (Axon Instruments. Stratagene). and a threshold was set as mean ± 2 SD (±1. and GSM213405. Missing values for each gene were imputed using the k-nearest neighbor method (k = 20) and significant analysis of microarrays software. poly A (10 µg/µL. GSM213395. Slides were hybridized. Wu et al. 20× saline sodium citrate (SSC. Deviation from this theoretical mean can only be attributed to technical noise. Stratagene).4). 1995) software. were mixed together and dried. The normalized intensities were then inputted into the software package microarray ANOVA (MAANOVA. labeled with Cy3 and Cy5 dyes. In these hybridizations. Loop design used for micro array experiments. CA) at 5-µm resolution. The slides were incubated in a water bath (60°C) for 12 to 16 h. A permutation Fs test (a modified F test designed specifically for mi- . 1998).ncbi. Piscataway. µ is the model grand mean. Conjugated cDNA was separated from free.. G is the gene. scanned. C2. Statistical Analysis of Microarray Data Microarray data were first filtered to remove all the blank spots. C3. and 10% SDS) for 15 min and then in wash solution II (20× SSC) for 15 min. GSM213359.1. the same chick liver was used for different RNA isolations..362 YARRU ET AL.0. and 10% SDS. Means and SD for Cy5 and Cy3 ratios were calculated for 5 hybridizations.). The microarray spot intensities were first log2 transformed and genes with greater than 20% missing values (genes with spot intensities absent/below threshold level due to hybridization problems) were filtered using CLUSTER 3. and the image was analyzed using GenePix Pro 4. The background corrected median intensities were normalized using pin-based LOWESS normalization within BioArray Software Environment. After incubation. Self-Self Hybridization Five self-self hybridizations were performed to measure the variation in gene expression due to technical errors. A2.

Serum Biochemical Parameters The effects of dietary treatments on serum chemistry are summarized in Figure 3. From each chick liver. The differentially expressed genes between the treat- . 2003) and Entrez-Gene (http://www. IA) and random hexamers (5 µg/ µL.4) as differentially expressed between controls and chicks fed 2 mg of AFB1/kg. Each gene was measured in triplicate. Forward and reverse primer final concentrations were 100 nM in the SYBR green assay. Feeding chicks 1 mg of AFB1/kg and 2 mg of AFB1/kg resulted in significantly (P < 0. ABI Prism 7700 SDS). Of these. Bootstrap testing supported the hierarchical clustering results with 100% confidence. Coralville. 2003) was run to test the significance of sample effect for each probe (500 permutations). Settivari et al. In the 2-∆∆CT analysis. Genes with an adjusted permutation Fs test (false discovery rate) value less than 13% were regarded as significantly differentially expressed across samples. The hierarchical tree was confirmed using bootstrap (Kerr and Churchill. Thermal cycling was carried out with an ABI Prism 7500 sequence detection system (Applied Biosystems) under factory default conditions (50°C. chicks fed 1 mg of AFB1/kg and 2 mg of AFB1/kg had significantly (P < 0.. Cui and Churchill. RESULTS Performance of Broiler Chicks Data on average feed intake.05) less feed intake and weight gain in a dose-dependent manner. with all the birds from each treatment group clustering together.. Foster City. A 2-tailed t-test with unequal group variance was used for the Ct values of each gene to analyze differences between control and AFB1-fed birds..4 (value obtained from mean ± 2 SD of 5 self-self hybridizations. 60°C 1 min). β actin. cycle number at which the expression exceeds threshold level) from control birds was used as a calibrator sample.ncbi. insulin-like growth factor 1. The clustering program divided the chicks into 2 groups. Genomic Responses to Aflatoxicosis Microarray analysis identified 177 genes (false discovery rate ≤13% and fold change ≥1. A second type of microarray analysis was performed to measure the gene expression across each individual animal (gene × animal model). BW gains. and 40 cycles at 95°C. This differentially expressed gene list was then filtered to remove genes with a fold change of less than 1. Quantitative Real-Time PCR Two-step quantitative real-time-PCR was used to confirm expression patterns of randomly selected 4 differentially expressed genes [ornithine decarboxylase.05) reduced serum TP. Glyceraldehyde phosphate dehydrogenase (GAPDH). CA). Compared with controls. Primer sequences (5′ 3′) used in real-time PCR Name Symbol Forward primer Reverse primer Coagulation factor 9 Insulin-like growth factor 1 Ornithine decarboxylase Glyceraldehyde-3 phosphate dehydrogenase Glutathione S transferase-α F9 IGF-1 OD GAPDH GSTα CTTTTCTTGGTGCCGAAAGT TGCACTTTTAAGAAGCAATGGA CCTTGACGAGGGCTTTACTG CCTCTCTGGCAAAGTCCAAG GCCTGACTTCAGTCCTTGGT TCCCGGGAATTAACTCTTCC GCAAACACAGGCCAAGGTAG CCGCATGTGCTTCTTTACAA CAACATCAAATGGGCAGATG CCACCGAATTGACTCCATCT croarray data. 2002). serum Ca.nih. 15 s. 10 µg of total RNA was reverse transcribed using Stratascript RT (Stratagene) with oligo dT (5 µg/µL. and 18s RNA were tested to identify a suitable endogenous control gene and GAPDH was selected because its gene expression did not differ between the control and AFB1 groups. 1998) analysis.25 ng of cDNA was added to a 25-µL PCR reaction to get a final concentration of 0.HEPATIC GENE EXPRESSION IN BROILER CHICKS FED AFLATOXIN B1 363 Table 1. 97 genes were upregulated and 80 genes were downregulated in chicks fed AF compared with controls. and the formation of single PCR products was confirmed using melt- ing curves. Then. Hierarchical clustering was used to group the chicks based on their profile of gene expression.25 ng/µL of cDNA in a SYBR green assay (Applied Biosystems. Primers were designed using Primer3 program with an annealing temperature of 60°C and amplification size of less than 250 bp (Table 1). and serum P levels compared with controls. the threshold cycle (Ct. Saeed et al. and relative liver weights are presented in Figure 2. The relative quantification of gene expression changes were recorded after normalizing for GAPDH gene expression was computed by using the 2-∆∆Ct method (user manual 2. Relative liver weight was increased (P < 0. IDT DNA. Negative controls.05) in chicks fed the diet containing 1 mg of AFB1/kg and 2 mg of AFB1/ kg compared with control chicks in a dose-dependent manner. which consisted of all the components of the PCR mix except cDNA. The DAVID (Dennis et al. coagulation factor I×. glutathione S-transferase (GST) α]. Values obtained from both ANOVA analyses were inputted into TIGR multi-experiment viewer software (TM4-Mev.. 6. were used for all primers. 2003) to run hierarchical clustering (Eisen et al. which suggests low biological variation within each treatment group. 2006). IDT DNA).gov/entrez) databases from the National Center for Biotechnology Information were used to find gene annotations of the differentially expressed genes. 2 min. 95°C 10 min.

such as antimicrobial peptides and proteins (Büchau and Gallo.. reduced levels of TP. ment groups represented various important pathways such as detoxification. and relative liver weights of broiler chicks. and antioxidant activities were altered in chicks fed 2 mg of AFB1/kg of diet.05). 2004) on the effects of AF Figure 3. Decreased serum Ca and P levels could probably be one of the reasons for the leg and bone abnormalities associated with rubbery leg syndrome in birds fed AF (Washburn et al. BW gain. immune response. including detoxification. These genomic effects and their relationship . oxidative phosphorylation. Effect of aflatoxin B1 (AFB1) on serum P.. F9. Effect of aflatoxin B1 (AFB1) on feed intake. and total protein. fatty acid metabolism. Real-Time PCR Results Quantitative real-time PCR was used to confirm the validity of the microarray results. cell proliferation.. A decrease in TP levels would lead to decreased efficiency of the immune system because the key mechanisms of some immune responses are the production of factors that kill pathogens. Similarly. fatty acid metabolism. energy production. coagulation. coagulation. oxidative phosphorylation. Ca. 1976). Microarray results demonstrated that the expression of genes coding for specific physiological pathways. metabolism. and P in birds fed AFB1 are in agreement with earlier reports (Huff et al. a–cBars with no common letter are significantly different (P < 0. insulin-like growth factor 1. Figure 2. metabolism. in young broiler chicks. cell proliferation. immune response. Verma et al. 1988). Genomic Responses to AFB1 Intake of the AFB1 diet was hypothesized to result in changes in liver gene expression representing characteristic pathophysiology associated with aflatoxicosis. growth and development. The altered genomic responses observed in the present study could be due to the direct effects of stress associated with AF. and antioxidant activities (Tables 2 to 8).05). energy production.. growth and development. Ortatatli and Oğuz. a–cBars with no common letter are significantly different (P < 0. Ca. 2007). GSTα) had a similar expression pattern as observed in microarray results.364 YARRU ET AL. All 4 of the randomly selected differentially expressed genes (ornithine decarboxylase. thereby validating the microarray results (Figure 4). 1988. DISCUSSION Physiological Responses to Aflatoxicosis Decreased feed intake and BW gain along with increased liver weights in birds fed AFB1 are consistent with earlier reports (Huff et al. 2001.

43 12.13 12.57 12.64 Growth factor stimulation Down. 0.93 12. .1 CYB5R CK607798 CPT Carnitine palmitoyl transferase NM_008898 Por ENSGALT00000020816. 0.1 CYP2C45 CYP2P3 ACVR1 UBE2I ENSGALT00000024891.1 KCNA10 ENSGALT00000027702.76 Down. Carnitine palmitoyl transferase 1A transports long-chain fatty acids into mitochondria for energy release.66 Electron transport Electron transport Anion transport. especially when hepatic glycogen is depleted during starvation (Shin et al. pyrophosphatase activity ATP-binding cassette transporter Down. Downregulation of these genes in chicks fed 2 mg of AFB1/kg of diet could result in impaired oxidative phosphorylation as well as electron leak. Somatomedin) ENSGALT00000024891. GST = glutathione S-transferase.64 Electron transport Down.20 12.77 Up.66 12.59 Down. ion transport ATP binding. 1.50 Growth-promoting activity Down. Genes such as adrenodoxin mitochondrial precursor (adrenal ferredoxin).1 FDX1 ChEST492f11 ChEST371g7 ChEST1027e3 ENSGALT00000011328.93 12. aflatoxin/ control (log values) FDR.1 ABCA1 ENSGALT00000013008. % Gene name Gene ontology Shaker subfamily potassium channel Adrenodoxin mitochondrial precursor (adrenal ferredoxin) Cytochrome p-450 2c45 Cytochrome P450 2P3 Collagen alpha1 BMP/retinoic acid-inducible neural-specific protein Voltage-gated ion channel activity Electron transport Up.365 HEPATIC GENE EXPRESSION IN BROILER CHICKS FED AFLATOXIN B1 Table 2. cytochrome P450 2P3. ATP = adenosine triphosphate. OD = ornithine decarboxylase. 1. 1. 0.55 ATP-binding cassette transporter Up. Oxidative Phosphorylation and Energy Production.69 Up.59 Up.1 ABCA1 ENSGALT00000008501. and nicotinamide adenine dinucleotide phosphate (NADH)-cytochrome b5 reductase play a major role in electron transport.00 ATPbinding cassette sub-family A NADHcytochrome b5 reductase ATPbinding cassette sub-family A Growth factor receptor-bound protein 2 1 FDR = false discovery rate. cytochrome P450 2C5. The resulting end product enters the Krebs’s cycle in the mitochondrial matrix. IGF-1 = insulin-like growth factor 1..1 IGF1 P450 (cytochrome) oxidoreductase Insulin-like growth factor I precursor (IGF-I. NADH. 0. Long-chain fatty acids cross the outer and inner membranes of mitochondria with the help of carnitine palmitoyl transferase and undergo β-oxidation. Differentially expressed genes associated with oxidative phosphorylation and energy synthesis in B1-fed chicks compared with control birds at the end of 21-d treatment period1 Transcript ID Gene symbol ENSGALT00000000598. Genes associated with oxidative phosphorylation and adenosine triphosphate (ATP) synthesis were downregulated in liver of chicks fed 2 mg of AFB1/kg of diet (Table 2). The by-products of the Krebs’s cycle.0. to the observed physiological responses are expected to provide additional insight into the pathophysiology of aflatoxicosis. resulting in ATP synthesis. The major purpose of electron transport is ATP synthesis. NADH = nicotinamide adenine dinucleotide phosphate.57 12. 2006).63 12.46 13.49 12. Validation of micro array results with real-time PCR. Treatment and control birds consisted of 3 biological replicates. F9 = coagulation factor IX.56 Up.63 12. 0. BMP = bone morphogenic protein. 0.1 GRB2 Ratio. 0. Because the carnitine palmitoyl transferase gene was Figure 4. RT-PCR = real-time-PCR.93 12. 0. resulting in formation of superoxide radicals. and flavin adenine dinucleotide enter the electron transport chain.53 Transport long-chain fatty acids into mitochondria Electron transport Down. 1. and therefore we speculate that oxidative phosphorylation and ATP synthesis pathways are more affected in chicks fed 2 mg of AFB1/kg leading to decreased energy production.

lactate dehydrogenase H subunit.74 12. Metabolism and Growth. Up.09 Up.61 0.79 12. 2. The genes involved in fatty acid metabolism (lipoprotein lipase precursor. lipid biosynthesis Lipid metabolism Glucose metabolism Down.04 12. downregulation of carnitine palmitoyl transferase gene in birds fed 2 mg of AFB1/ kg could contribute to fatty liver condition because of impaired long chain fatty acid transport into mitochondria. nucleotide and nucleic acid metabolism Carbohydrate catabolism Protein metabolism Nucleobase.55 0.1 Up.72 ChEST337c15 ENSGALT00000013370.87 13.1 GYS1 NAT1 12.4 12.55 12.40 13.69 0. cofactor biosynthesis Amine metabolism Up.44 Down.57 ENSGALT00000022490.74 12.72 12.1 LDH-B PSEN1 Pemt Up.48 12. Cellular protein metabolism Nucleobase. 0. malic enzyme 1 nicotinamide adenine diculeotide phosphate (+)-dependent cytosolic] and protein metabolism (muller glia protein tyrosine phosphatase 2. 0. LIM domain kinase 2.51 12.1 NM_001012591.53 12. This could be the reason for the fatty livers and increased liver weights observed in the present study. pyruvate dehydrogenase complex E1 component.92 Up. 0. 0.87 ChEST748i8 ChEST532d8 NM_001006164.91 Down.01 1 Nonspecific lipid-transfer protein y box binding protein 1 LIM domain kinase 2 MULLER glia protein tyrosine phosphatase 2 Lactate dehydrogenase H subunit Presenilin 1 Phosphatidylethanolamine N-methyltransferase isoform 1 Lipoprotein lipase precursor Pyruvate dehydrogenase complex.55 12. member 2 Up. . 0. hepatocyte growth factor-like/macrophage stimulating protein.04 ENSGALT00000006295.08 12.85 12.47 0. 1. 2. As a result.87 ChEST1010o8 ChEST214h19 Bbox1 Slc45a2 Glycogen synthase1 N-acetyltransferase 1 (arylamine n-acetyltransferase) Glutamine synthetase (glutamate– ammonia ligase) GTP cyclohydrolase I feedback regulator Muller glia protein tyrosine phosphatase 2 γ-butyrobetaine. 1.56 ChEST859c9 ENSGALG0000002722.59 ENSGALT00000024882.49 ENSGALT00000005829.57 13. Up. nucleoside. downregulated in chicks fed AFB1.1 ENSGALG00000001139.1 PBE ALG6 HERC4 PTK7 Down. 0. Differentially expressed genes associated with metabolism are listed in Table 3.1 ChEST993m11 ChEST568g13 ENSGALT00000000960. Down.1 MULLER Cellular macromolecule metabolism Up.53 ENSGALT00000025553. 1.52 12.72 12. Furthermore. E1 component Malic enzyme 1 NADP(+)dependent cytosolic Peroxisomal bifunctional enzyme Hepatocyte growth factor-like hect domain and RLD 4 Fibroblast growth factor receptor CPE-FGFR FDR = false discovery rate.71 12. 0. nucleoside.73 Up.69 12. nucleotide and nucleic acid metabolism Coenzyme metabolism porphyrin metabolism Down. 1.74 12.02 12.2-oxoglutarate diox Solute carrier family 45.1 SCP-2 YBX1 LIMK2 PTPRG Amino acid derivative metabolism Lipid metabolism.61 ENSGALT00000001542. 0.03 Up. 1. 0. Down. phosphorus metabolism Protein metabolism Amino acid metabolism Cellular protein metabolism. Down.62 0.1 RPL35 RCJMB04_9m1 RPL5 RPL7A LOC395465 Ribosomal protein 135 Lysyl-trna synthetase Ribosomal protein 15 Ribosomal protein 17a cbp/p300-interacting transactivator Down. likely resulting in an upregulation of gluconeogenic pathways.366 YARRU ET AL. Down.1 LOC395492 RPL30 PKNOX2 Aldolase a Ribosomal protein 130 pbx/knotted 1 homeobox 2 Down. 1.1 ENSGALT00000008794.61 12.26 13. (1988). steroid metabolism Nucleic acid metabolism Nucleic acid metabolism Protein metabolism Protein metabolism Up. Previous reports suggest that AF at dietary concentrations of 1 mg/kg or more causes severe reduction in growth of broiler chicks Table 3.1 ENSGALT00000007741. Differentially expressed genes associated with metabolism in aflatoxin B1-fed chicks compared with control birds at the end of 21-d treatment period1 Ratio. GTP = guanosine triphosphate. 1.1 ENSGALT00000022490.1 ALAS1 5-aminolevulinate synthase Cellular lipid metabolism Protein metabolism Protein metabolism Cellular macromolecule metabolism. Up. presenilin 1.55 12.1 ENSGALT00000001334.1 ChEST496l3 lplp PDK3 Carbohydrate metabolism Protein metabolism Cellular lipid metabolism.66 12.1 ENSGALT00000000422. a decreased number of long chain fatty acids would be able to cross the mitochondrial membranes leading to a decrease in ATP production.54 1. some of the genes associated with carbohydrate metabolism [glycogen synthase 1.76 12. peroxisomal bifunctional enzyme) were downregulated in birds fed AFB1 compared with controls. % Transcript ID Gene symbol Gene name Gene ontology ENSGALT00000021664. 0. hect domain. fatty acids were not metabolized and they accumulated in the liver.58 Up.78 12.49 0. aflatoxin/ control (log values) FDR. and regulator of chromosome condensation 1 domain 4) were upregulated in birds fed 2 mg of AFB1/kg. To compensate for the reduced caloric intake and energy utilization. 0. 0.71 ENSGALT00000017326.03 ChEST771a4 RPL5 Carboxylic acid metabolism Up.61 12.1 ME1 Carboxylic acid metabolism Up. 1.51 GLUL Carbohydrate metabolism Coenzyme metabolism.81 Up.33 Up.1 ENSGALT00000011263. 1. Similar increases in the relative liver weights were observed in chicks fed AF by Ortatatli and Oğuz (2001) and Huff et al.69 Up.

1.1 M13454. 2002). β Mitogen-activated protein kinase kinase 2 ggTRAIL TNFSF10 ChEST691m6 IL6 Tumor necrosis factor (ligand) superfamily. Immune Response: Many genes associated with immune function. 2005). Differentially expressed genes associated with biotransformation. they can also generate reactive oxygen species.59 10.86 Up. xenobiotic biotransformation (phase I metabolism) and the subsequent conjugation of the resulting metabolites (phase II metabolism).66 12.. such as mitogen-activated protein kinase kinase 2. 0. aflatoxin/ control (log values) FDR. detoxification.53 12. member 10 Interleukin 6 receptor Immune response Immune system Plays a critical role in the production of cytokines Tumor necrosis factor receptor binding Immune system Ratio.70 12. Cytochrome P450 enzymes are associated with several biological interactions involving hydroxylation.28 Down.1 Gal d I IL10 MAPKK2 Ovomucoid precursor Interleukin 10 receptor. dehydrogenation.. LOC395611 EH P24369 CYP1A1 CYP2H1 GPx ChEST807d3 ChEST175g3 X99454. Although CYP-mediated reactions are essential for xenobiotic detoxification.1 % Down.07 12. and antioxidant activity are summarized in Table 5. The CYP1A1 Table 5. and interleukin 6 receptor were downregulated. 0.53 12.77 12..28 12. 2. 2. ovomucoid precursor. (Verma et al. 1988). Because AF exerts part of its immunosuppressive effects through cytokines (Han et al.13 Down.53 Epoxide hydrolase CYPB Peptidyl-prolyl cis-trans isomerase Cytochrome P450 1A1 Cytochrome P450 2H1 Glutathione peroxidase Detoxification Xenobiotic metabolism Xenobiotic metabolism Xenobiotic metabolism Xenobiotic metabolism Down.01 Down. 1. Similar reductions in immune response were also reported earlier in chicks fed 1 mg of AF/kg of diet (Shivachandra et al.. an important growth promoting gene was downregulated in birds fed 2 mg of AFB1/kg.28 Down. and antioxidant activities in aflatoxin B1fed chicks compared with control birds at the end of 21-d treatment period1 Transcript ID Gene symbol Gene name Gene ontology ChEST332h21 IMP-3 Metalloproteinase inhibitor ENSGALT00000027702. 1.60 12.66 Down.81 12. and oxidative deamination (Kumar et al.02 11. 0. and these results are consistent with earlier reports on the growth depressing effect of AF in broiler chicks (Huff et al. epoxidation.1 FDX1 ChEST492f11 ENSGALT00000020496. making them more water soluble and available for excretion from the body. 1.. % Down. downregulation of interleukins (interleukin 10 and interleukin 6) in the current study is consistent with earlier reports..1 CYP2C45 TGFB3 Adrenodoxin mitochondrial precursor (Adrenal ferredoxin) Cytochrome p-450 2c45 Heme oxygenase Endopeptidase inhibitor activity Electron transport ENSGALT00000008501.59 12. Insulin like growth factor-1. aflatoxin/ control (log values) FDR. 1. antioxidant Electron transport Antioxidant activity Down. 1. 1999). . Decreased immunity in chicks fed AF could make them susceptible to secondary bacterial and viral infections. Detoxification. Various CYP isoforms exist in species ranging from archaebacteria to humans (Zuber et al.1 NC0061002 1 Ratio. detoxification. 2004). 0.1 ChEST691m10 ENSGALT00000001934.. 0. This hypothesis is supported by the increased mortality rates that were observed in chicks fed AFB1 in the present study. These results indicate an immunosuppressive effect of AF on both humoral and cell-mediated immune responses. The microsomal CYP-dependent mono-oxygenase system in the liver plays an essential role in the metabolism of xenobiotics (Akahori et al. nitrogen dealkylation. NADH = nicotinamide adenine dinucleotide phosphate.1 ChEST126e10 CYB5R GST α.00 1 FDR = false discovery rate.80 NADH-cytochrome b5 reductase Glutathione s-transferase class-α Electron transport Antiinflammatory. Biotransformation.66 12. 0. 2003).63 Up. which could cause detrimental effects and even lead to death.71 12. 2004). and Antioxidant Activity.57 Up. 2006).72 Down. interleukin 10 receptor β. whereas tumor necrosis factor 10 was upregulated in chicks fed 2 mg of AFB1/kg suggesting that AF is also immunotoxic (Table 4)..80 12. Previous reports suggest that AF at dietary concentrations of 1 mg/kg or more causes a significant reduction in the immune response (Verma et al.57 Down.59 Up. 1. Differentially expressed genes associated with immune system in B1-fed chicks compared with control birds at the end of 21-d treatment period Transcript ID Gene symbol Gene name Gene ontology ENSGALT00000005554.65 Up. Differentially expressed genes associated with biotransformation.49 12.63 FDR = false discovery rate. Primary hepatic detoxification processes include.HEPATIC GENE EXPRESSION IN BROILER CHICKS FED AFLATOXIN B1 367 Table 4. 1. Phase I metabolism mainly involves the cytochrome P450 (CYP) enzymes. This could contribute to the observed reduction in growth rates of birds fed AFB1.

59 Down. CYP 2H1 is known to be actively involved in xenobiotic metabolism (Hamilton et al.1 NCL ENSGALT00000003436.67 12.1 ENSGALT00000023380.56 12.1 FRZB LDB2 ESR1 ENSGALT00000018678.09 12. 0. 9-epoxide and less chance for AFB1 detoxification. aflatoxin/ control (log values) Cytoplasmic polyadenylation element binding protein 3 Nucleolin Nucleophosmin Ubiquitin-conjugating enzyme e2i (ubc9 homolog.1 NM_205187. Cell Proliferation.59 Up. nucleoside. which could protect against oxidative stress.1 HDAC2 DKK3 FKBP1B P50594 Histone deacetylase 4 forkhead box O1A (rhabdomyosarcoma) Fibroblast growth factor receptor Sox11 transcription factor btb and cnc homology 2 α-fetoprotein enhancer-binding protein v-jun sarcoma virus 17 oncogene homolog (avian) Transcription factor sox-9 sry (sex determining region y)-box 5 Peroxisome proliferator-activated receptor α Cell division cycle 10.61 12.65 Down.19 Down. 0.1 CDC2 ENSGALT00000024179. there could be a greater chance for formation of AF-8.52 Down. and nucleic acid metabolism Cell cycle progression Nucleic acid metabolism.56 12.51 12. nucleoside.51 12..65 ENSGALT00000006994. Furthermore. 1993).40 Up.38 12.368 YARRU ET AL. Similarly. 0.44 12. and this could further hamper the bird’s ability to protect itself from oxidative damage. possibly leading to hepatocellular injury and death (Kumar et al. 0. 1. 0.50 Down.. Pyrimidine-specific nuclease with preference for C Nucleotide-binding Down. antioxidant genes such as GST and glutathione peroxidase. 0. 9.1 HDAC4 FOXO1A ENSGALG00000001139.86 12.73 12. 2001) and GST enzymes (Tiemersma et al. Inhibits Wnt signaling pathway Cellular protein metabolism mRNA splicing.55 12. 2003). were downregulated in birds fed 2 mg of AFB1/ kg. 2006. 0.53 12.. Furthermore.. 2006).. 0.61 Cell proliferation Transcription regulation Transcriptional regulator Transcription factor Up.80 12. JUN Ratio.98 Down. It is evident from the results of the present study that transcriptional activation of CYP1A1 and CYP2H1 isoforms. overexpression of these CYP450 isoforms was shown to induce chronic oxidative stress by generating more reactive oxygen species.68 12. nucleotide. 2006). Klein et al.1 NPM1 UBE2I ChEST200b24 TGFB3. in response to AF has the potential to increase oxidative stress.6 kda Protein mago nashi homolog ChEST90f21 ENSGALT00000026527.. 0. 0. Kumar et al.80 12.54 Down.79 Up. Table 6.67 12.1 ENSGALT00000000605.44 Up..89 Required for entry into S-phase and mitosis in cell proliferation Cell cycle progression and development.71 Down. 2. is known to metabolize various drugs and xenobiotics (Klein et al.1 DAX1 ENSGALT00000006822. Differentially expressed genes associated with cell proliferation in aflatoxin B1-fed chicks compared with control birds at the end of 21-d treatment period1 Transcript ID Gene symbol ChEST752c24 NR1D2 ENSGALT00000026260. 0. 0.1 ENSGALG00000017034. nonsense mediated decay pathway Nucleic acid metabolism Rate-limiting step in the pathway of polyamine biosynthesis Regulate cell growth and differentiation Transcription cofactor activity Cellular proliferation and differentiation in target tissues.70 12. g1 to s and g2 to m Histone deacetylase 2 Dickkopf homolog 3 (Xenopus laevis) fk506 binding protein 1b. 1.1 ChEST372k22 Contig_114_reverse ENSGALT00000017388.82 Up.1 ENSGALT00000021168. yeast) Transforming growth factor. 1.1 NPM1 Frizzled-related protein Lim domain binding 2 Estrogen receptor (ER.76 12.71 Up. 1. % Gene name Gene ontology Nuclear receptor subfamily 1.1 ENSGALT00000001011. Aflatoxin-8.. 9-epoxide in poultry (Klein et al. 3. These CYP isoforms are involved in biotransformation of AFB1 to the highly toxic and carcinogenic metabolite AF-8. All of these factors could contribute to the toxicological and pathological effects of AF. β 3 rRNA transcription and ribosome assembly Nucleolar ribonucleoprotein structures Covalent attachment of ubiquitin-like protein SUMO-1 to other proteins Cellular morphogenesis.62 12. 0. 0.44 Down.74 Up.57 Up. transcription Up. 12.02 Up. and is also known to activate certain pro-mutagens to their carcinogenic forms (Haas et al. 2001.53 Up. and nucleic acid metabolism Nucleobase..53 12.epoxide is detoxified by epoxide hydrolase (Tiemersma et al. 0.14 12. 0.51 Up. Aflatoxin .79 12.69 12. 1. member 2 Adrenal hyoplasia protein Nucleobase.79 11. regulation of cell size 1 FDR = false discovery rate.82 12. 1.54 Transcription factor Transcription Nucleic acid metabolism Up. Cell proliferation is a representation of cell growth and its active cell division.12 12.20 Down. 1. nucleotide.66 Up.56 12. group d. 0.1 ENSGALT00000010377. regulation of cell cycle. 2003).1 FGFRL1 SOX11 Bach2 ATBF1 FDR.1 PAPOLA ODC1 Poly(a) polymerase α Ornithine decarboxylase 1 ENSGALT00000026837. 1. estradiol receptor) Ribonuclease ChEST200a12 Cpeb3 ENSGALT00000012486. Because CYP genes were upregulated and epoxide hydrolase and GST genes were downregulated in birds fed 2 mg of AFB1/kg. 0.59 Down.1 ChEST752i6 ChEST800g22 TF9 SOX5 PPARA M_001012559. 2003).67 Transcription factor Up.

0.1 ENSGALG00000016833. including peroxisome proliferator-activated receptor α. 0. Differentially expressed genes associated with blood clotting in aflatoxin B1-fed chicks compared with control birds at the end of 21-d treatment period Transcript ID Gene symbol ENSGALT00000010110. transcription factor sox-9.. Obasi et al.99 12. Baker and Green (1987) stated that the coagulation defect in aflatoxicosis is primarily due to diminished hepatic synthesis of coagulation factors. aflatoxin/ control (log values) Heparan sulfate 2-O-sulfotransferase Heparan sulfate 6-O-sulfotransferase-2 Anticoagulant protein C precursor Coagulation factor IX Coagulation factor X precursor (Stuart factor) Coagulation factor Antithrombin-III precursor Blood coagulation Up. Previous reports suggest that AF intoxication would lead to changes in coagulation profiles in lambs leading to an increased prothrombin time (Fernandez et al. 0. α 2 Decorin Down. and X in the plasma of birds fed AF. histone deacetylase 2.1 arp3 Cell motility ENSGALT00000019859. α 2. Down.26 0.60 Inactivator of coagulation factors va and viiia Blood coagulation Blood coagulation Up. coagulation factor X precursor (Stuart factor)] were downregulated.1 ENSGALT00000009107.36 12.1 % 1 FDR = false discovery rate. % Up. VIII. VII.01 12.57 11.1 F9 VAP ENSGALT00000010525.1 F9 ATIII Gene name Gene ontology Ratio. 1981).36 12. 1981). α-fetoprotein enhancer-binding protein. Down. 0.1 GJA1 Gap junction protein ChEST148d1 LOC396480 Otokeratin Microtubule-associated forceproducing protein Form connexons between cells for low molecular weight material diffusion Cytoskeleton ENSGALT00000014968. 0. Blood Clotting.97 .89 12.55 Transcript ID Gene symbol Gene name Gene ontology ChEST471d22 Dnm1 Dynamin-1 ENSGALT00000008890.81 11.58 1.70 12. They concluded that the coagulation factor deficiencies were the result of decreased factor synthesis due to hepatic insufficiency. Bababunmi and Bassir (1982) found relatively low concentrations of blood clotting factors II. This could be the reason for hepatocarcinomas observed in rats fed AF (Kalengayi and Desmet. Differentially expressed genes associated with cell skeletal structure in aflatoxin B1-fed chicks compared with control birds at the end of 21-d treatment period1 Ratio. and anticoagulant protein C precursor.1 HS6ST2 ENSGALG00000001780. Even though broilers do not generally live long enough to develop cancer.29 Up. which is an inactivator of coagulation factors Va and VIIIa.1 ACTA2 LOC395261 RCJMB04_23c5 DCN Actin-related protein 3 homolog (yeast) Actin. 1. 0. 1. 0. AF-related diseases adversely affect their health and could cause slowing of growth and decreased resistance to microbial pathogens. v-jun sarcoma virus 17 oncogene homolog. 1994).1–1 PROC ENSGALT00000010525. 0. aflatoxin/ control (log values) FDR.48 13.369 HEPATIC GENE EXPRESSION IN BROILER CHICKS FED AFLATOXIN B1 Table 7.0 µg/g of AF (Doerr and Hamilton. Butler and Hempsall.76 12.58 Cell motility Actin binding F-actin cross-linking bundling protein Affect the rate of fibril formation Down.71 0.76 13.77 12. bHLH transcription factor.63 12. Down.01 Down.97 12. and in chicks fed 10. 1975.1 ENSGALT00000015293. IX.01 Up.72 Up. 0.52 Blood coagulation Generation of antithrombin-III Down. Genes involved in blood coagulation [coagulation factor IX.1 ENSGALT00000018395. and antithrombin-III precur- sor were upregulated in birds fed 2 mg of AFB1/kg (Table 7). aorta Filamin Actinin. smooth muscle.29 Down.77 Down.87 FDR.94 12. and forkhead box O1A (Table 6).59 12. 1 FDR = false discovery rate. Increased clotting time was observed previously in chicks treated with single oral doses of AFB1 (50 µg/kg of BW.. and V activities in AF-treated rabbits.1 KRT19 Keratin 19 Cytoskeleton ENSGALT00000019859.1 HS2ST1 ENSGALT00000009795. 2. nuclear receptor subfamily 1 d 2.75 Blood coagulation Up.61 12. Upregulation of the above mentioned genes could contribute to increased cell proliferation rates in birds fed 2 mg of AFB1/kg. Clark et al. (1986) observed a significant decrease in factor IX. B1 in the present study upregulated many genes associated with cell proliferation.1 ENSGALG00000004591. Alteration in the expression of the above-mentioned genes could be the reason Table 8.68 13. 0. The authors suggested that prothrombin times could be used as an indicator of aflatoxicosis in lambs. 1995). ornithine decarboxylase.

Columbia. No regional differences of cytochrome P450 expression in the liver of cynomolgus monkeys (Macaca fascicularis). E. 35:2845–2852. Toxic synergism between aflatoxin and T-2 toxin in broiler chickens. Nutrient Requirements of Poultry. to assist in the regeneration of surrounding cells. E. Mycotoxins: Risk assessment and legislation. Saez.. Baker. Histochemical studies of hepatocellular carcinomas in the rat induced by aflatoxin.. Rottinghaus. 9th rev. Bull. changes in the expression of genes associated with cytoskeletal structure may negatively affect cell function. Eraslan. 26:180–184. S. A. Fernández. E. 67:1418–1423. Sci. Stuart. W. Wahle. Lett. Toxicol. Yea. Reddy. Ca. M. and H. C. Altintas. 1995). J.. D.. J. J. A. Efficacy of hydrated sodium calcium aluminosilicate to reduce the toxicity of aflatoxin and T-2 toxin. 24:62–70. Effects of dietary butylated hydroxytoluene on aflatoxin B1-relevant metabolic enzymes in turkeys.. A. Hamilton. . Acad. National Research Council. Poult. J. Ellinger-Ziegelbauer et al. H. Y. H. S.. Kalengayi.. T. Natl. Klein. C. Bababunmi. A. L. Inhibition of drug metabolizing enzymes (Cytochrome P450) in vitro as well as in vivo by Phyllanthus amarus Schum & Thonn. Cell Skeletal Structure. 86:353–361. B. B. Hall. 78:204–210. 1981. Green. T. A. B. and G. Poult. Anim. 2003.. The cytoskeleton of cells is a dynamic structure whose functions include maintaining cell shape. C. Clin. A. Bomann. and M. 1975. J. J. Kubena. future studies with pair fed birds will determine whether the differential hepatic expression of these genes is related to direct effects of AFB1 or to secondary effects on the liver associated with reduced feed intake. Sahindokuyucu. 1993. J. USA 95:14863–14868. A. and R. Vet. Lane. P. Rabstein. or both. 134:157–170. C. Toxicol. Poult. Turk. News 25:1–3. 25:616– 624. G. Ellinger-Ziegelbauer et al. for his valuable suggestions. U. Poult. I also thank Roxanne Kutz. Biol. 2005. Coulumbe. Ellinger-Ziegelbauer. D. D. 1988. Van Vleet. associate professor. R. M. M. Kubena. J. and O. Sci. Dermatol. Huff. 41:671–678.. changes in gene expression in the current study may be an effort by cells to prevent cell necrosis. K. H. 61:166–168. Alonso– Debolt.. F. USA 98:8961–8965. H. Jeon. and M. Clark. B. DC. 1982. A. W. Kawamura. Huff. and G. Sequential histological and histochemical study of the rat liver during aflatoxin B1induced carcinogenesis. Columbia. 29:1310–1313. ACKNOWLEDGMENTS I would like to thank Chada S. Botstein. Cancer 119:1785– 1791. Hempsall. D. Bhaskarannair. Sci. P. N. Kuttan. J. and D. Advances in microgenomics: Less is more. Mol. E. R. Kumar. Churchill. BW gain. and P. Anim. University of Missouri. Calpin. Aflatoxicosis and intrinsic coagulation function in broiler chickens. B. and A. J. Pesch. T. V. Phillips. Res. Exposure of chicks to a 2 mg of AFB1/kg of diet results in physiological responses associated with altered gene expression in broiler chick livers. R. and liver weights and adverse effects on serum TP. O. Innate immunity and antimicrobial defense systems in psoriasis. Hosack. cell protection. Toxicol. H. Vet. and H. and it also plays important roles in intracellular transport and cellular division. Desmet. Sanz. (2004) hypothesized that changes in gene expression associated with cell structure organization may also be related to the lesions observed in the hepatocytes of rats fed AF. Bootstrapping cluster analysis: Assessing the reliability of conclusions from microarray experiments. B. R. X. 2003. Preferential alteration of inducible gene expression in vivo by carcinogens that induce bulky DNA lesions. W. 2002. The effects of aflatoxins on oxidative stress in broiler chickens. Sci. S. Poult. 1998. Lempicki.. Carcinog. Expression of xenobiotic and steroid hormone metabolizing enzymes in human breast carcinomas. Churchill. Cancer Res. Louis. Nine genes associated with cell skeletal structure were differentially expressed in the livers of chicks fed AFB1 (Table 8)..370 YARRU ET AL.. C. Efficacy of hydrated sodium calcium aluminosilicate to ameliorate the toxic effects of aflatoxin in broiler chicks. Vet. R. Therefore. and integrated discovery. Bruning.. Hamann. D. B. 1981. Yarsan. M. Flanagan. H. B.. S. Haas. M. E. S. 2006. ed. Sci. Kerr. Bassir. 1999. (2004) dosed rats with AF and observed an upregulation of several genes encoding proteins that function in cytoskeletal organization. Ramos. M. G. and R. Yoshikawa. Corrier. O. Rottinghaus. 69:1078–1086. University of Missouri. DAVID: Database for annotation. Yang. Appl. MO for ordering materials and reagents required for the study. for the impaired coagulation in birds fed AF ultimately leading to hemorrhaging in the birds (Sandhu et al. 2003. Doherty. 7:19–34. P. 8:34–43. 82–83:853–859. Treadwell. 2004. MO.. S. Genome Biol. E. W. Coagulation defects of aflatoxin intoxicated rabbits. A. Ahr. and L. visualization.. W. Rottinghaus. Büchau. F. enabling cellular motion. 1986. Hatch. M. C. Harvey. 4:3. E.. W. Sci. 4:210–215. and V. Akdogan. Hamilton. Sci. Food Chem. Current findings suggest that AFB1 at concentrations of 1 and 2 mg/kg has detrimental effects on feed intake. Pharm. Itagaki. Pharmacol. Induced aflatoxicosis in rabbits: Blood coagulation defects. J. Natl. Doerr. Toxicol. J. 1987. (2004).. As suggested by Ellinger-Ziegelbauer et al. 2006. Hunt. 1999. 54:131–136. D. Genet. J. Brown. and G. Butler. 1995. Jain. Sherman. and V. 1990. Washington. and R. Brauch. Sci. Cluster analysis and display of genome-wide expression patterns. Sci. 29:701–707.. J. and R. 108:1–10. Ledoux. J. Department of Animal Sciences. and G. and R. Harvey. Toxicol. and M. Gallo. Reed. Acad. 1994. L. R. Sci. A. and P.. Pathol. Exp. E.. A. biomedical sciences. Pierl. D. K. Spellman. Characteristic expression profiles induced by genotoxic carcinogens in rat liver. Y. T. and 3 were upregulated. 60:1406– 1411.. and Y. S. D. Gao. C. Proc. Kuiper-Goodman. J. Ko. Int. Natl. REFERENCES Akahori. and K. T. 2005. However. T. T. M. Eisen. 2007. K. Proc. P. V.. Verde. Cui. The authors concluded that changes in the cytoskeleton are likely both induced by and have an influence on the necrotic process. F. S. Dennis.. Changes in the coagulation profile of lambs intoxicated with aflatoxin in their feed. A. Genome Biol. Fischer. Acad. 1995.AT and AP-1 transcription factors. Harth. S. Yang. G. E. C. Essiz. L. Han. 2005. Takatori. Lett. Pathol. Suppression of the interleukin-2 gene expression by aflatoxin B1 is mediated through the down-regulation of the NF. H. Six of the 9 genes were downregulated. Bermudez. Statistical tests for differential expression in cDNA microarray experiments. Eng. laboratory technician. A delay in blood clotting of chickens and ducks induced by aflatoxin treatment. Justenhoven. Greene.

J. and G. 2002. J. Indian J. J. Role of mycotoxins in human and animal nutrition and health.com/2002/3/8/ software/0003 Saeed. Cary. A. T. Poult. E. Lee. D. and R. I. D. O. Effects of dietary citrinin and aflatoxin on leg problems of broilers grown on wire floors. Toxins 3:187–192. Bunschoten. Troein.. 8:625–637. NC. 1976. and R. Singh. Sci. F. Physiol. O. Role of genetic polymorphism of glutathione-S transferase T1 and microsomal epoxide hydrolase in aflatoxin-associated hepaticellular carcinoma. Anzenbacherova. 2001. Anim. Heat shock transcription factors: Structure and regulation. G. Sci. Anzenbacher. 45:512–518. Verma. Nottingham University Press. Wyatt. S. Br. A. E. L. S. J. ochratoxin and their combinations on the performance and immune response of broilers. P. Fedail. Manimaran. 2002. 2003. G. A. 1994. and H. Surai. Effects of single oral doses of scopoletin and aflatoxin B1 on the clotting time. S. Gruvberger. E.. Li. I. G. Cytochrome P450 and experimental models of drug metabolism. D. L. 38:89–94.. A. Cell Dev. Positive regulation of hepatic carnitine palmitoyl transferase 1A (CPT1A) activities by soy isoflavones and L-carnitine. Churchill. 2004. J. J. 2002. E. Kataria. C. Res. 1996. White. Kadaru. Cho. Ames. Annu. Zuber. B. Assessing gene significance from cDNA microarray expression data via mixed models. S. Saal. Rev. Sharov. Peterson. C. A. S. Wolfinger. NY. Wu. K. 1995. Natural antioxidants and mycotoxins. and O. Bushel.. Popov. S. Comput. . V. C. J.. Johri. Cell. Pharmacol. J. Paules. Maanova: A software package for the analysis of spotted cDNA microarray experiments. open-source system for microarray data management and analysis. 2003. P. Snuffin. and T. D. M. Obidoa. J. V. W. F. J. Y. Hamadeh. Lewis. and J. B. 27:39–51. Biomarkers Prev.. 1st ed. Thiagarajan. I. S. 1995. R. Washburn. and B. Sci. Bhusari. T. Anderson. 1995. E. M. Idris. Liang. 2001. Swain. E. H. Sah. Commun. A. and J... Smith. C. A. Kok. E. R. Tiemersma. J. Hearne. Z. S. Njoku. S. S. R. Gibson. U. H. Ortatatli.. Vet.. Solomons. Braisted.. 2003. E. 19:27–37. Sci. Quackenbush. Kerr. 2006. UK. and K. Antoniou. Bennett. S. A. 10:785–791. Currier. Omer. N. Mol. Vet. Genomic analysis of the impact of fescue toxicosis on hepatic function. serum cholesterol and phospholipid levels of chicks. Singh. Pages 455– 509 in Natural Antioxidants in Avian Nutrition and Reproduction. P. 55:1977–1979. Bhagabati. E. H. B. S. Sandhu. and P. Vet. Rezantsev. M. K.. Chang. R. R. Cancer Epidemiol. W. New York. Springer. Ameliorative effects of dietary clinoptilolite on pathological changes in broiler chickens during aflatoxicosis. Wolfinger. S. Settivari. and C. and S. Vinsavich. L. B. 2006. Singh. Nottingham. 11:441–469. 2001. M. T. P. Borg. Borisovsky. E. R. SAS User’s Guide: Statistics. M. Biol. Res. Lee. Commun. and D. J. M. Eur. D. Med. 84:1279–1294. D. Evans. C. Biol. Effect of graded levels of aflatoxin. Nutr. Eichen. L. Van’t veer. and E. Kostukovich..HEPATIC GENE EXPRESSION IN BROILER CHICKS FED AFLATOXIN B1 Obasi. Oğuz. Ameena. Poult. Res. 71:59–66. SAS Institute. Wu.. E. 45:159–164. Immunosuppression in broiler chicks fed aflatoxin and inoculated with fowl adenovirus serotype-4 (FAV-4) 371 associated with hydropericardium syndrome. http://genomebiology. Spiers. Klapa. Pages 313–431 in the Analysis of Gene Expression Data: An Overview of Methods and Software. 6:189–198. BioArray Software Environment (BASE): A platform for comprehensive management and analysis of microarray data. Biotechniques 34:374–378. Ryltsov. Kampman. S. TM4: A free. Lee. Strun.. SAS Institute. S. Shin. Afshari. Vallon-Christersson. M. Nat. K. A. H. Pathological studies in broiler chicks fed aflatoxin or ochratoxin and inoculated with inclusion body hepatitis virus singly and in concurrence. W. Shivachandra. Liu.