Arch Virol

DOI 10.1007/s00705-013-1973-3

ORIGINAL ARTICLE

Detection of antibodies specific for foot-and-mouth disease virus
infection using indirect ELISA based on recombinant
nonstructural protein 2B
Jitendra K. Biswal • Sarita Jena • Jajati K. Mohapatra
Punam Bisht • Bramhadev Pattnaik

Received: 7 October 2013 / Accepted: 29 December 2013
Ó Springer-Verlag Wien 2014

Abstract Foot-and-mouth disease (FMD) is a highly
contagious viral disease of transboundary importance. In
India, since the launch of the FMD control programme,
there has been a substantial increase in the vaccinated
bovine population. In this scenario, there is a need for
additional locally developed non-structural protein (NSP)based immnoassays for efficient identification of FMD virus
(FMDV)-infected animals in the vaccinated population. The
2B NSP of FMDV, lacking the transmembrane domain
(D2B), was expressed successfully in a prokaryotic system,
and an indirect ELISA (I-ELISA) was developed and validated in this study. The diagnostic sensitivity and specificity
of the D2B I-ELISA were found to be 95.3 % and 94.6 %,
respectively. In experimentally infected cattle, the assay
could consistently detect D2B-NSP-specific antibodies
from 10 to approximately 400 days postinfection. The assay
was further validated with bovine serum samples collected
randomly from different parts of the country. The performance of the D2B I-ELISA was compared with the in-house
r3AB3 I-ELISA, and the overall concordance in test results
was found to be 86.49 %. The D2B I-ELISA could be useful
as a screening or confirmatory assay in the surveillance of
FMD irrespective of vaccination.

Introduction
Foot-and-mouth disease is a highly contagious viral disease
of both domesticated and wild ruminants as well as pigs.

J. K. Biswal  S. Jena  J. K. Mohapatra  P. Bisht 
B. Pattnaik (&)
Project Directorate on Foot-and-Mouth Disease (ICAR),
Mukteswar, Nainital 263138, Uttarakhand, India
e-mail: pattnaikb@gmail.com

Owing to its contagiousness and potential for rapid spread
among susceptible animals, the disease poses a serious
threat to the international trade of animals and animal
products. Culling of infected and in-contact animals is the
favoured method of control of FMD in many parts of the
world that are free from FMD. However, prophylactic
biannual vaccination with extensive serosurveillance has
been preferred over culling in India. Nevertheless, the
strategy of vaccination has its own problems, and the most
important one is that vaccinated animals may sometimes be
infected with FMD virus (FMDV) with or without showing
overt clinical signs [12]. Therefore, identification of
FMDV-infected individuals among vaccinated animals is
of utmost importance, especially in ruminants, which may
act as carriers of the virus and can potentially become the
source for new outbreaks. In this respect, it is imperative to
develop highly sensitive and specific discriminatory assays
to detect infection regardless of vaccination status.
Detection of serum antibodies against FMDV nonstructural protein (NSP) in FMD-vaccinated and subsequently infected animals is used as a differential marker of
infection, since vaccination with purified vaccine elicits
antibodies only against the structural protein (SP) of
FMDV [7]. A range of different ELISAs have been
developed to detect antibodies against NSP of FMDV [16],
and these assays have a further advantage over the conventional tests in that they are not serotype specific.
However, the current NSP-based assays are not able to
detect infection reliably in a vaccinated population [5].
During the validation of various NSP ELISAs in an international workshop at Brescia, Italy, it was found that none
of the assays could provide a categorical assurance of
detecting infection [5]. Therefore, it was suggested to use
more than one NSP assay in order to enhance the overall
sensitivity and specificity of determination of infection

123

3AB1 and/or 3C) for identification of FMDV replication in vaccinated cattle. Based on a series of experiments. and five commercial healthy bovine sera. Bovine serum samples collected at random Serum samples (n = 3500) that had been collected at random from different parts of the country were also analysed in D2B I-ELISA in order to determine the prevalence of 2B antibodies in bovines. These samples were collected at different time points during the outbreaks. these peptides were thought to be too expensive and poorly antigenic for use in ELISA [8]. K. India. Serum samples (n = 312) from FMD control programme (FMD-CP) areas without any report of FMD for the last five years were also included in the study. [4] suggested to use NSP 2B along with other NSPs (2C. we report the expression in Escherichia coli of recombinant truncated 2B NSP lacking the transmembrane domain (D2B) and the development of a differential indirect ELISA (I-ELISA) for serosurveillance of FMD. Serum samples from infected bovines A total of 178 serum samples that were collected sequentially between 10 and 1000 days postinfection (dpi) from four unvaccinated bull calves were obtained from the serum repository of PDFMD. test systems based on recombinant NSP could be designed as a relatively cost-effective alternative.J. Hilden. and the term ‘bovine’ in this manuscript implies both of them. Mukteswar. The extracted RNA was reverse transcribed using oligo (dT)20 primer (Invitrogen. 60 serum samples collected at day ‘zero’ from cattle used in FMD vaccine potency studies. Samples (n = 60) were also collected at 21 dpv from cattle that were used in FMD vaccine potency studies. Germany) from baby hamster kidney cells (BHK-21) infected with FMDV isolate O IND R2/1975. This study complied with international standards for animal welfare. Molecular cloning. All of these 516 serum samples collected from vaccinated. USA). while the other two calves were contact infected after being co-housed separately with each of the inoculated animals [19]. there is a need to produce a new NSP-based ELISA that can be used either as the screening or confirmatory method along with existing NSP tests or one that can be used in a multiple NSP-antigen-based assay [24] to enhance the confidence of detection of infection. Although the ELISA based on synthetic 2B peptides had shown some promising results [21] and was comparable to the Prio CHECK-NSP assay [10]. Infection-related linear B-cell epitopes on the 2B NSP of FMDV have been mapped by analyzing synthetic peptides in an indirect ELISA [9]. USA) and ThermoScriptTM reverse transcriptase enzyme (Invitrogen. Two of them were inoculated intradermolingually with either FMDV A IND 40/2000 or Asia 1 IND 63/1972. Bovine serum samples (n = 1259) from clinical cases of FMD field outbreaks were also included in this study. ranging from the acute phase to nearly one year post-outbreak. uninfected animals along with the serum samples from naı¨ve bovines (n = 196) were used for the determination of the cutoff value and diagnostic specificity of D2B I-ELISA. Therefore. The majority of the adult bovines in the FMD-CP areas had received at least 8 rounds of prophylactic biannual vaccination. Considering that recommendation. Serum samples collected from naı¨ve. from 72 cattle) were collected from an FMD-free dairy cattle herd that was vaccinated 123 routinely at six-month intervals with a trivalent inactivated vaccine. These samples included 131 serum samples derived from an unvaccinated. Biswal et al. clinically healthy bovine population without any history of FMDV infection for at least 10 years. These samples were collected at 28 and 180 days post-vaccination (dpv). vaccinated bovines Serum samples (n = 144. 120 out of these 178 serum samples (from 10-400 dpi) were used for the estimation of the cutoff value and diagnostic sensitivity of the D2B I-ELISA. Serum samples from a naı¨ve bovine population A total of 196 serum samples collected from clinically healthy animals and found negative for anti-FMDV structural protein antibodies in liquid-phase blocking ELISA were used in this study. Berger et al. The full-length coding sequence of 2B NSP was amplified by PCR using upstream primer 2BF (GATCGGATCC . In this study. expression and purification of recombinant 2B non-structural protein Construction of recombinant 2B gene expression vectors Total RNA was extracted using a QIAamp Viral RNA Mini Kit (QIAGEN. infected (both experimentally and naturally) and uninfected vaccinated animals were obtained from the serum repository maintained at Project Directorate on Foot and Mouth Disease (PDFMD). Serum samples from uninfected. Materials and methods Serum samples Serum samples used in this study were collected either from cattle or buffalo. status.

pooled. 200 mM NaCl. the concentrations of various components of the assay were optimised by the checkerboard titration method. Purification and immunological characterisation of recombinant D2B NSP Expression and affinity purification of the recombinant MBP-D2B fusion protein was performed according to the manufacturer’s instructions (NEB. CA. These fragments were combined in a subsequent fusion reaction in which the overlapping ends served as primers for the extension of complementary strands. Positive clones were subsequently subjected to protein expression screening. The D2B-NSPcoated ELISA plates were washed three times with PBS. 15 g of glycine. Madison. Finally. the bacterial culture was incubated further at 28 °C for 5 hours. USA) to generate the recombinant plasmids pMAL-2B and pMALD2B. Briefly. which encodes the maltose binding protein (MBP). USA). In these plasmids. 25 ml of an overnight culture of a JM109 clone harbouring the MBP-D2B construct was inoculated into 250 ml of LB medium and grown at 37 °C until the optical density (O. All of the PCRs were carried out using a KOD Hot Start DNA polymerase kit (Novagen. and the test samples (mODsample) were determined after subtracting the mean OD value of the background control wells (mODBG).4]. F2. Germany).6-0.) at 600 nm reached 0. Differential reactivity of the recombinant NSP protein was also verified by western blot using FMDV-infected bovine serum (28 dpi) and naı¨ve serum diluted 1:100 in blocking buffer. 96-well. coli JM109 cells (Promega. The resultant recombinant clones were selected on ampicillin plates and screened by restriction enzyme digestion analysis. Roskilde. and the fusion protein was eluted with column buffer containing 10 mM maltose. The entire experiment was carried out as per the protocol developed by Urban et al. The resin was washed four times with column buffer. coefficients of variation (CVs) were calculated based on the PP values from intra-plate replicates (four replicates per sample). [27]. and dialyzed against PBS.5 mM. which has a BamHI site (bold and underlined). Fractions were collected. and diluted serum (100 ll/well) was transferred to duplicate wells of the ELISA plate and incubated at 37 °C for one hour. The optical density (OD) values were measured at 492 nm.ELISA for detection of antibodies against FMDV 2B protein CCCTTCTTCTTC). The bacterial suspension was subjected to one freeze-thaw cycle and sonicated. nucleotides 412 to 462). Serum samples were diluted (1:15 dilution) and pre-absorbed for one hour with purified MBP in a serum dilution buffer containing 10 g of BSA per litre of PBS. 1 mM EDTA. The immunoreactivity of recombinant D2B protein was analysed by western blot using anti-MBP monoclonal antibody and rabbit antimouse HRP-conjugated secondary antibody. F1 and F2 (F1. Development of recombinant D2B I-ELISA During the development of the D2B I-ELISA. Subsequently the agarose gel purified 2B and D2B amplicons were ligated into the Bam HI and Hind III sites of bacterial expression vector pMAL-c5X (NEB. The 2B NSP gene without the sequence encoding the transmembrane region (D2B) was amplified by an overlap extension PCR (OEP) in which two rounds of PCR were carried out to amplify two DNA fragments. The OD for each test serum sample was expressed as a percentage of the positive control using the following formula: Percent of positive control (PP) = [mODsample] 9 100 / [mODPOS] Determination of the precision of D2B I-ELISA For the precision analysis. The ligated products were used to transform chemically competent E. while serum dilution buffer without any serum was included as conjugate control to determine any background activity. rabbit anti-cow immunoglobulin/HRP conjugate (DAKO. after washing. The nucleotide sequences of the inserts were confirmed using gene-specific primers in an ABI 3130 DNA automated sequencer (Applied Biosystems. The corrected mean OD values of the positive control (mODPOS). The clarified supernatant was loaded onto a column containing amylase resin. Following addition of IPTG to a final concentration of 0. flat-bottom polystyrene plates (Nunc. the negative control (mODNEG). Bacterial cells were harvested by centrifugation at 4000 g for 20 minutes and then resuspended in 20 ml of column buffer (20 mM TrisCl [pH 7. and 40 g of sucrose in one litre of PBS. and 1 mM dithiothreitol). of the 2B NSP gene with an overlap of 15 nucleotides.D. Subsequently. nucleotides 1-339. Briefly. The positive and negative sera were included as internal controls. The coated plates were washed four times with PBS and blocked with a buffer containing 10 g of fraction V bovine serum albumin. substrate solution containing o-phenylenediamine dihydrochloride (OPD)/H2O2 was added. and downstream primer 2BR (GATCAAGCTTCTGTTTTTCTG). the 2B and D2B genes were ligated in frame with the malE gene. USA). inter-plate replicates 123 . USA). The purity of recombinant D2B NSP was assessed by SDS-PAGE [14].7. Denmark) diluted 1:2000 in dilution buffer was added and incubated for 1 hour. and the reaction was stopped after 12 minutes of incubation by adding 1 M H2SO4. Denmark) were coated with recombinant purified MBPD2B protein diluted in carbonate-bicarbonate buffer and incubated at 4 °C overnight. which has a HindIII site (bold and underlined).

a selected set of serum samples (n = 2500) were also tested by r3AB3 I-ELISA as described earlier [19].17 8.97 11.8 WT 2B .83 Intra-plate CV 2. 5 serum sample from a naı¨ve calf used in a vaccine potency experiment CV: coefficient of variation (three plates per day).dk/services/TMHMM). pET28) and transformation of different E.4 0.org/software/TMPRED_form. coli culture medium containing the full-length 2B protein was found to decrease significantly after induction was not possible to express the recombinant 2B NSP (data not shown). coli culture medium containing the expression vector (pMAL-2B) was found to drop significantly after induction (Fig.12 6. 1 Cytotoxic activity of FMDV 2B protein in E. Estimation of the cutoff value and other assay parameters were performed by receiver operating characteristic (ROC) curve analysis using XLstat software (Addinsoft. r3AB3 I-ELISA In order to determine the concordance between D2B I-ELISA and the in-house r3AB3 I-ELISA. and inter-day replicates (between five different days) of five selected serum samples (Table 1) in D2B I-ELISA.5 hours.sbc. SDSPAGE analysis revealed a protein band of approximately 60 kDa (Fig.8 21. The serum dilution was selected to attain an acceptable signal-to-noise ratio at the minimum concentration of recombinant antigen.org/).IPTG 1. D2B protein lacking its transmembrane domain (amino acid residues 114-137) could be cloned and expressed successfully.predictprotein. [11]. pET-45.11 Inter-plate CV Inter-day CV 2. it 123 0 30 60 90 120 150 180 210 Minutes post induction Fig. ch.78 11. pQE30Xa.su.71 1.06 4. 2 serum sample collected from a FMDV infected bull at approximately two months post infection. expression.2 0 * 1 51 dpi serum sample from A IND 40/2000 intradermolingually infected calf.727 Global CV 5. Biswal et al. The optical density at 600 nm of uninduced (diamonds).4 7. including DAS (http://www.529 7. cbs. coli host cells. whereas no visible reactivity was observed with naı¨ve serum (Fig. and TMpred (http://www. Further.embnet. Bioinformatics and statistical analysis The prediction of transmembrane helices of FMDV 2B protein was carried out using various methods. 3b and c).526 11.J. TMHMM (http://www. Development of recombinant D2B I-ELISA For the standardisation of the I-ELISA protocol.07 2. PHDtm (http://www. Interestingly. The optimal coating antigen concentration and serum dilution were finalized at 0. 2). Results Cloning. coli.2 1 0. The purified recombinant D2B protein also showed differential immunoreactivity in I-ELISA with serum samples (n = 5) collected from experimentally infected calves and serum samples (n = 5) collected from naı¨ve calves. http://www. K.4 2.07 5.87 3. 4 serum sample from a calf at 21 dpv with a single dose of FMD monovalent vaccine.se/*miklos/DAS).D of E. The precision estimation of the D2B I-ELISA was carried out as described by Jaworski et al. purification and immunoreactivity of MBP-D2B protein Even after cloning the full-length 2B gene in various expression vectors (pMAL-c5X.63 168. D2B protein readily reacted with 28 dpi bovine serum in western blot. full-length 2B (squares) and D2B-expressing cultures (triangles) was determined at 30-minute intervals for 3. confirming the suitability of recombinant D2B protein as an ELISA antigen.8 0. 1).350 lg per well of the ELISA plate and 1:15.61 4.91 12. 3a). the O. which corresponds to the calculated molecular weight of MBP-D2B NSP.6 WT 2B + IPTG 1.4 Δ2B + IPTG 1. However. 2 Table 1 Estimate of the precision of the D2B I-ELISA based on a set of five serum samples Mean PP 1 2 3 4 5 134.82 72.com/en/home/).xlstat. .95 34.htm).dtu.34 3.6 0. The optical density of E. the optimum concentration of recombinant antigen and test serum dilutions were fixed after conducting a checkerboard titration. The immunoreactivity of recombinant MBP-D2B was confirmed by western blotting with an MBP-tag-specific monoclonal antibody (Fig.D at 600 nm Serum sample* 1. mostly in soluble form.29 11. 3 135 dpi serum sample from A IND 40/2000 contact infected calf.46 O.

0 to 1. lane 1. Lane M. lane 1. protein marker. respectively Determination of the cutoff value. IPTG-induced purified D2B protein. diagnostic specificity. coli lysate. 4). Lane M. IPTGinduced purified MBP M 1 2 3 76 kDa Induced Δ 2B protein (~60 kDa) 52 kDa 38 kDa 31 kDa 24 kDa a M 2 3 b c 3 2 1 M M 1 2 3 76kDa 55kDa 76kDa 55kDa 38kDa 38kDa 31kDa 31kDa 24kDa 24kDa 17kDa 17kDa 12kDa Fig. lane 2. consisting of samples from known naı¨ve (n = 196). coli lysate.ELISA for detection of antibodies against FMDV 2B protein Fig. purified D2B protein respectively (Fig. lane 3. (b) FMD-infected serum and (c) naı¨ve serum. and sensitivity of recombinant D2B I-ELISA Normalised PP values of serum samples (n = 2091). lane 2. 2 SDS-PAGE profile of expressed D2B protein. purified MBP. lane 3. To ensure the validity of the assay. uninduced E. uninfected 123 . (ii) The PP values of the negative and conjugate control should not exceed 20 % and 10 %. 3 Western blot analysis of expressed D2B protein to determine its reactivity with (a) anti-MBP monoclonal antibody. the following criteria were chosen: (i) The corrected mean absorbance of the positive control should be between 1. uninduced JM109 E. protein marker (NEB).4.

However. 90.7 0. and infected (n = 1379) animals.9 0.3 0.8 0. Antibody response to 2B protein in vaccinated animals In an FMD-free dairy cattle herd that had undergone regular biannual vaccination.83 %) at 28 dpv. By 10 dpi.6) and a diagnostic sensitivity of 95.6 0. A detailed analysis of assay parameters at different cutoff values is shown in Table 2.34 %) were found positive in D2B I-ELISA.5 0. all four calves had seroconverted against D2B NSP (Fig. in serum samples collected from various vaccine potency experiments at 21 dpv. 5a and b). (a) Sensitivity over 1 and specificity at different cutoff values.8 1 False negative rate (1 .35 0.4 11.2 0.973 Performance of D2B I-ELISA as compared to 3AB3 I-ELISA The in-house r3AB3 I-ELISA has been used extensively throughout the country for differentiation of the FMDVinfected from the vaccinated bovine population for the last four years [3]. the 2B antibody seroconversion rate was 6.8 1.5 0 22.2 0.9 0.087 Recombinant 2B antigen in µg/well Fig. Therefore.5 Optimal Δ2B antigen concentration and serum dilution O.4 0.1 0. followed by a pattern of intermittent positivity varying from 530 to 1000 dpi (Fig. 4 3.6 2. only 2 out of the 60 primo-vaccinated animals (3. serum samples were selected arbitrarily. However. Twofold dilutions of positive control serum indicated by different markers are shown at one side of the plot vaccinated (n = 516). At a cutoff value of 50 PP. 93.3 0.5 P1:20 1 P1:30 Postinfection kinetics of 2B antibody response 0. @492nm 3 2.175 0.2 5. K.4 0.1 0 0 0 0.4 0.Specificity) Fig.8 Sensitivity / Specificity True positive rate (Sensitivity) a The postinfection kinetics of the 2B antibody response was studied using four sets of serum samples collected sequentially from four bull calves following experimental infection.5 % (4 out of 72) at 180 dpv.2 Sensitivity Specificity 0. an antibody response to the 2B protein was detected in 15 out of 72 serum samples (20. were used for the determination of the cutoff value of D2B I-ELISA by ROC and TG-ROC analysis (Fig. serum samples collected at random from FMD-CP areas with no history of an FMD outbreak for the last five years where animals underwent intensive biannual vaccination.7 0. In addition.6 % (95 % confidence interval.9) were achieved. For making this comparison. 0. representing various epidemiological situations. 5 ROC and TG-ROC analysis for determination of the cutoff value of the D2B I-ELISA.9–96. The highest level of concordance was observed b 1 1 0. it was necessary to compare the newly developed D2B I-ELISA with that of the r3AB3 I-ELISA. the duration of persistence of the 2B antibody response varied widely among the infected calves. a diagnostic specificity of 94.J.D.6 0.4 0.4–96.5 P 1:5 2 P1:10 P1:15 1. 6). (b) Curves of the relative sensitivity and specificity of D2B I-ELISA produced by TG-ROC analysis . Each point on the ROC plot represents a pair 123 0 100 200 300 400 500 PP values of sensitivity and specificity values for a particular cutoff value. 6).08 % (19 out of 312 animals). 4 Checkerboard titration to optimise D2B protein concentration and serum dilution.6 0.5 0. this antibody response was of low titre and waned to 5.3 % (95 % confidence interval. In AUC=0. Consistent positivity was observed until 306 to 900 dpi in the individual calves.7 0. Biswal et al.

658 0. the availability of a locally produced efficient diagnostic assay making use of an NSP 123 .286 0. Further.2 0.700 LR? Likelihood-ratio for a positive test result. LR.0 0.1 0. vaccination-based FMD-CP was launched in 2003-04 with the aim of creating disease-free zones.993 1.598 0.050 60.1 0. However. In India. Discussion NSP ELISAs have become an essential part of the vaccination-based control and serosurveillance policy in many FMD-endemic countries.800 0.934 0. there is a need to use more than one NSP assay to increase the efficiency of detection [22]. The infection status of each calf is indicated 160 Type A intradermolingual infection 140 Type A contact infection Type Asia 1 intradermolingual infection 120 Type Asia 1 contact infection PP value 100 80 60 40 20 0 12 28 37 51 64 78 94 106 121 135 149 163 171 191 219 304 389 451 524 555 604 755 816 878 939 998 Days post infection for naı¨ve serum samples (98.031 0.421 80.771 0.306 0. For this purpose.953 0.2 0.997 36. it is imperative to have information on the level of FMDV exposure in domesticated large ruminants irrespective of vaccination status.646 0.989 0.Likelihood-ratio for a negative test result Fig.946 0. as per the suggestions made at an international NSP test validation workshop at Brescia.000 0.005 0. Furthermore. national FMD serosurveillance is being carried out in India by determining seroconversion against 3AB3 NSP using an in-house r3AB3 I-ELISA [19].589 0.48 %).992 0.962 0.091 1.ELISA for detection of antibodies against FMDV 2B protein Table 2 Diagnostic sensitivity and diagnostic specificity of the recombinant D2B I-ELISA at different cutoff points as determined by ROC analysis.554 90.453 0.1 0.990 23.999 0.416 0.341 0.739 0. The overall concordance between these two I-ELISAs was found to be 86.934 0. it is important to establish the reliability of the screening test results through the profiling of multiple NSP antibodies in the serum samples [20].635 100.991 0.970 1.021 50.983 0.984 23.553 0. In this context.406 0. Italy.966 0.49 % (Table 3).4 %). when the epidemiological picture does not correlate with the screening test results. The selected cutoff point (50 PP) is highlighted Cutoff values Sensitivity 95 % confidence interval Specificity Lower limit Upper limit 95 % confidence interval Lower limit Upper limit LR? LR- 10.909 0.501 0.225 0.835 2. 6 Postinfection kinetics of the anti-2B antibody response in experimentally infected calves.564 0.399 0.000 0.992 0.997 0. non-endemic countries are seriously debating in favour of vaccinating animals in order to obviate the need for stamping out susceptible in-contact animals under a ‘vaccinate-to-live’ policy [2].0 40.674 0.005 30.000 44.625 0.000 20.000 0.370 0.237 70.000 36. The cutoff points are given as percentage of positivity.233 0.788 0.988 0.347 1.857 0.968 1.975 0.0 1.336 0.732 0.0 0.625 0.991 1.945 0.967 0. while the lowest level of concordance was observed for serum samples collected at random (84.352 0. in particular because of vaccinal NSP response.000 0.489 0.0 0.969 17.289 4.054 0.968 1.273 0.057 0. Therefore.

as evidenced by the false-positive reactions with naı¨ve and vaccinated uninfected serum samples. This was shown in a study [23] in which. The diagnostic sensitivity and diagnostic specificity of indirect r3AB3 I-ELISA for bovines were found to be 96 % and 96. Although the precise time of onset of 2B antibodies could not be deduced in this study. the D2B assay has the potential to be used as either a screening or confirmatory assay in conjunction with the r3AB3 I-ELISA. no surveillance plan can provide an absolute guarantee of freedom from infection. Therefore. an attempt was initially made to express the full-length 2B protein in prokaryotic cells. The earliest possible detection of FMD post-exposure by anti-NSP antibody assay is of paramount importance for adopting control measures. Further. This response could be explained 123 0 either by nonspecific binding or by the residual anti-NSP response from unreported past infections. the possibility of residual anti-MBP antibodies leading to some nonspecific reaction. At the fixed cutoff value of 50 PP. to confirm the FMD infection in sheep. as described by others [13. In serum samples from multiply vaccinated.3 % and specificity of 94. cannot be ruled out completely. D2B could be expressed successfully as a recombinant MBP-tagged protein of *60 kDa (43 kDa from MBP and 16 kDa from 2B) in soluble form. serosurveillance should be seen as a part of a package of risk-mitigation measures that will include movement restriction. coli cells containing the prokaryotic expression vector pMAL-2B started to decline following induction with IPTG. As the performance of the recently developed recombinant D2B I-ELISA is comparable to that of the r3AB3 I-ELISA. uninfected animals. coli. the 2B-antibody response declined from 20. further experimental analysis needs to be conducted in order to confirm the viroporin activity of FMDV 2B. which might be attributed to the cytotoxicity of the heterologous recombinant protein to E.5 % (at 180 dpv). there has been variation in the time at which early detection of antibodies against various NSPs is possible [25]. K. Further.48 % (2112/2500) Random samples other than 3AB3 could be a suitable alternative to the expensive kits available commercially. a sensitivity of 95. the recombinant D2B demonstrated differential reactivity with FMD convalescent and naı¨ve serum. In the present study. Similar observations have been reported for the expression of the 2B protein of poliovirus in prokaryotic cells [15]. epidemiological tracing. a variation in the persistence of 2B antibodies was observed. attention was paid to reducing the nonspecific reactivity of the serum antibodies with the large MBP tag by pre-adsorbing the serum samples with the purified MBP protein. However. which uses a different NSP.75 % (225/240) Samples from field outbreak 500 465 35 482 (440) 18 (10) 90. inter-plate and inter-day replicates showed the CV values to be within the acceptable limits.0 % (450/500) 2500 730 1770 605 (515) 1895 (1597) 84. which were attributed to viroporin-mediated permeabilization of the cell membrane [1. the 2B NSP of FMD virus may be considered as a putative viroporin. While studying the post-infection kinetics of 2B antibodies in serum samples collected from four experimentally infected calves.83 % (at 28 dpv) to 5. a good overall concordance was observed between the 3AB3 and D2B I-ELISAs. In that respect. Although the . preliminary precision studies based on PP values from intra-plate. 6. it was not possible to express the full-length 2B NSP. respectively [19]. A typical feature exhibited by viroporins is the presence of at least one transmembrane sequence. seroconversion to 2B protein was evident at 10 dpi in the serum samples collected from four experimentally infected calves. However. Table 3 Comparison of the performance of 2B I-ELISA with that of r3AB3 I-ELISA Sera Total number tested r2BL ELISA 3AB3 ELISA (no. it is also preferable to have the second test. Also.J. in support of the repeatability of the optimised assay (Table 1). Biswal et al. concordance) Positive Positive Negative Concordance rate Negative Unvaccinated naı¨ve samples 130 2 128 130 (128) 98. It was decided to express the 2B region lacking the transmembrane domain. 17]. than the first test to confirm the presence of infection.4 % (128/130) Vaccinated uninfected samples 240 18 222 15 (12) 225 (213) 93. coli cells. a 2B-peptide-based indirect ELISA was used to confirm the result of the PrioCHECK-NSP assay. Owing to the cytotoxic nature of the FMDV 2B protein to E. While developing and validating the MBP tagged recombinant D2B I-ELISA. Interestingly. a transmembrane domain was predicted between amino acid residues 114 and 137. 26]. However. and clinical surveillance [22]. During the current analysis.4 %. Considering that there are no assays with absolute sensitivity and specificity.3 % were determined for the D2B I-ELISA.08 % false positivity was observed in serum samples collected from FMDCP areas where there had been no reported outbreaks or cases for five years. the optical density of the E. In a western blot assay. However. This variation in antibody response could be attributed to a difference in the route of infection or load of virus challenge.

Delhon G. Pore formation by nonstructural poliovirus 2B protein. Zhang J. Lu Z. It would also be useful to evaluate the D2B NSP I-ELISA using serum samples from FMD-vaccinated and/or infected small ruminants and pigs in the future. Carrasco L. Singh in sorting the serum samples is appreciated. it could not be determined for D2B I-ELISA due to the unavailability of known serum samples derived from other clinically similar diseases because most of these diseases are exotic to India at present. Oh Y. J Virol 79:4382–4395 19. Nagendrakumar SB. As the amino acid sequence of the 2B NSP region is known to be highly conserved among the different serotypes of FMDV [6]. Anonymous (2012) PD-FMD annual report. Rajendra L. Pandey LK. Modification of membrane permeability induced by 2B and 3A. Gubbins S. Jaworski JP. In: Project Directorate on foot and mouth disease. Revue Scientifique et Technique 21:531–538 13. Belsham GJ.41 %). Berger HG. Paton DJ. 2011–12. Wright P. Mohapatra JK. At the same time. Parida S. Brocchi E. Goris N. Vedovato N. McElwain T (1996) Antibody against an anaplasma marginale MSP5 epitope common to tick and erythrocyte stages identifies persistently infected cattle. Sorensen K. Lama J. Haas B. Trono K. Hohlich BJ. Kutish GF. Madan V. Testing of random bovine serum samples collected from different parts of the country in D2B I-ELISA suggested an overall seroconversion rate of 29. A short peptide mimics viroporin activity. Howell G. J Clin Microbiol 34:2225–2230 14. Fondevila N (2011) Validation of an r3AB1-FMDV-NSP ELISA to distinguish between cattle infected and vaccinated with foot-andmouth disease virus. Sanyal A. Haas B. Sammin DJ. Grazioli S. Neitzert E. J Virol 77:8633–8639 10. from earlier findings of others [10. Knowles D. In conclusion. Carrasco L. Liu YS (2011) An overview on ELISA techniques for FMD. Off J Eur Union L 306:46 3. the recombinant 2B protein assay is expected to detect infection-specific antibodies against all seven serotypes of FMDV. Vagnozzi A. Saeki T (2006) Development and evaluation of an indirect enzyme-linked immunosorbent assay for detection of foot-and-mouth disease virus nonstructural protein antibody using a chemically synthesized 2B peptide as antigen. the use of more than one NSP ELISA would be helpful in increasing the efficiency of detection of infection. Stiller D. De Simone F. Perez M. Rock DL (2005) Comparative genomics of foot-andmouth disease virus. it should be emphasised that there is a significant difference between the 2B protein sequences of members of various genera of the family Picornaviridae [18]. N. The apparent prevalence of 2B NSP antibody estimated in the current work is similar to that against 3AB3 NSP (26. Mackay D. Chen HT. 21] it can be proposed that recombinant-D2BNSP-based I-ELISA could be used for the identification of persistently infected animals. Compaired D. Straub OC. Yadin H. Ding YZ. Hema M. could be used for the serological detection of FMDV circulation. Pfaff E. Malirat V. Inoue T. Bergmann IE. Tulman ER. Ryan MD. Barco A. Virol J 8:419 17. Pattnaik B (2011) Recombinant non-structural polyprotein 3AB-based serodiagnostic strategy for FMD surveillance in bovines irrespective of vaccination. S. Parida S. Chandran D. De Clercq K (2006) Comparative evaluation of six ELISAs for the detection of antibodies to the non-structural proteins of foot-and-mouth disease virus. Saalmuller A (2003) Identification of foot-and-mouth disease virusspecific linear B-cell epitopes to differentiate between infected and vaccinated cattle. Although analytical specificity is an important parameter for any newly developed assay system. McGuire T. Carrillo C. Bulut N. Ahl R. Kitching P (2004) Developments in diagnostic techniques for differentiating infection from vaccination in foot-and-mouth disease. it could be presumed that there may be less chance of cross-reaction of FMDV 2B protein with antibodies against other related picornaviruses that cause clinically indistinguishable vesicular diseases in cattle. Nieva JL (2002) Viroporinmediated membrane permeabilization. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. which has been developed for the first time. Vaccine 25:4784–4794 9. Yamini R. J Virol Methods 177:184–192 123 . J Virol Methods 178:191–200 12. Clavijo A. Schlapp T. J Biol Chem 277:40434–40441 2.2 %. which was determined under the national FMD serosurveillance programme [3]. In that case. Kitching RP (2002) Identification of foot and mouth disease virus carrier and subclinically infected animals and differentiation from vaccinated animals. Anonymous (2003) Council Directive 2003/85/EC on Community measures for the control of foot-and-mouth disease repealing Directive 85/511/EEC and Decisions 89/531/EEC and 96/665/ EEC and amending Directive 92/46/EEC. Agirre A. Rispoli G. The assistance of Mr. Wileman T (2005) Effects of foot-and-mouth disease virus nonstructural proteins on the structure and function of the early secretory pathway: 2BC but not 3A blocks endoplasmic reticulum-to-Golgi transport. Therefore. J Mol Biol 374:951–964 18. Trotta M. Tesar M. Paton DJ. Vaccine 8:213–216 5. Nieva JL (2007) Plasma membrane-porating domain in poliovirus 2B protein. J Virol 79:6487–6504 7. J Biol Chem 267: 15932–15937 16. Wiesmuller KH. A situation of controlled FMD incidence due to extensive vaccination is expected in India after a few years of successful FMD-CP. Moffat K. Greiner M. Carrasco L (1992) Expression of poliovirus nonstructural proteins in Escherichia coli cells. Acknowledgement This work was supported by Indian Council of Agricultural Research under the project IXX08487. Aunpomma D. Marquardt O (1990) Identification of foot-and-mouth disease virus replication in vaccinated cattle by antibodies to non-structural virus proteins. Nature 227:680–685 15. Thiagarajan D. Vaccine 24:6966–6979 6. Paton DJ. Parida S. Linchongsubongkoch W. Knox C. Srinivasan VA (2007) Chimeric tymovirus-like particles displaying foot-and-mouth disease virus non-structural protein epitopes and its use for detection of FMDV-NSP antibodies. Dekker A. Zhou JH. Sanchez-Martinez S. J Vet Diagn Investig Off Publ Am Assoc Vet Lab Diagn Inc 18:545–552 11. Palmer G. an I-ELISA based on recombinant D2B NSP. References 1. Ma LN. Carreno A. Vet J 167:9–22 8. Monaghan P. Mukteswar 4. Torioni de Echaide S.ELISA for detection of antibodies against FMDV 2B protein relationship between the persistence of 2B antibody and identification of known FMD carrier animals was not determined in the current study.

Suarez CE. Clavijo A. Greiner M. Lenhoff RJ. Knowles DP. Perkins J. Urban A. Madsen ES. McElwain TF (1998) Detection of cattle naturally infected with Anaplasma marginale in a region of endemicity by nested PCR and a competitive enzyme-linked immunosorbent assay using recombinant major surface protein 5. Keel P. Georgiou K. Palmer GH. Inoue T. 20. Paton DJ. Nucl Acids Res 25:2227–2228 . Ferris NP. Neukirchen S. Vaccine 24:6503–6512 23. Cox SJ. McGuire TC. Anal Chem 78:5462–5468 25. Gubbins S.J. Biswal et al. de Clercq K. Office International des Epizooties (chapter 2. Nqindi J. Reid SM. K. Hamblin P. Parida S. Salt JS. Bergmann I. Transboundary Emerg Dis 56:321–328 123 24. Dekker A. Hindson BJ. J Clin Microbiol 36:777–782 27. Paton DJ (2005) The application of new techniques to the improved detection of persistently infected cattle after vaccination and contact exposure to foot-and-mouth disease. Torioni de Echaide S. Swabey K. Kakoyiannis C (2009) Investigations into the cause of foot-and-mouth disease virus seropositive small ruminants in Cyprus during 2007. OIE (2004) Foot and mouth disease. Anderson J. Parida S (2006) Application of non-structural protein antibody tests in substantiating freedom from foot-and-mouth disease virus infection after emergency vaccination of cattle. Mackay DK (1998) Differentiation of infection from vaccination in footand-mouth disease by the detection of antibodies to the nonstructural proteins 3D. Barnett PV. Sammin DJ. France 21.1). Vaccine 23:5186–5195 22. 5th edn. Li Y. Hutchings GH. Paris. Ebert K. Sorensen KJ. Madsen KG. Savva S. Reid SM. McBride MT (2006) Multiplexed detection of antibodies to nonstructural proteins of foot-and-mouth disease virus.1. King DP. Hamblin P. Paton DJ. Manual of standards for diagnostic tests and vaccines. Jaeger KE (1997) A rapid and efficient method for site-directed mutagenesis using one-step overlap extension PCR. 3AB and 3ABC in ELISA using antigens expressed in baculovirus. Parida S. In: OIE Standards Commission (ed). Brocchi E. Arch Virol 143:1461–1476 26.