CHAPTER- 3

MATERIAL AND METHODS
The experimental materials used and methods adopted during the present
investigation entitled “MOLECULAR CHARACTERIZATION OF INBREDS;
HETEROSIS AND STABILITY OF THEIR HALF-DIALLEL CROSSES IN
MAIZE (Zea mays L.)” have been described as follows:

Experimental Material: first season, Kharif 2012:

Molecular

characterization was done for assessment of diversity of 8 inbred lines
of maize (Zea mays L.) ( received & assessed at Directorate of Maize
Research, abbreviated DMR, New Delhi) using Simple Sequece
Repeat (SSR) markers. Thereafter, morphological characterization and
seed multiplication of these 8 inbred lines was done at the Gwalior
campus. Their sources have been presented in Table-2.
Table-2: Source of 8 inbred lines.
S.N.

Parents

Source

Source of
material

1.

HKI-163

CML 163

DMR
New Delhi

2.

HKI-1105

Kargil 633

DMR
New Delhi

3.

HKI-1128

Hybrid (FF)

DMR
New Delhi

4.

DMRPE-6

CA 14524-1

DMR
New Delhi

5.

CML-285

CIMMYT line

DMR
New Delhi

6.

CML-292

CIMMYT line

DMR
New Delhi

7.

CML-132

8.

LM16

CIMMYT line
SE 539

DMR
New Delhi
DMR
New Delhi

Morphological characters studied are described as under (listed in
Table 3):
1. Leaf angle: It was recorded by measuring the angle between blade
and stem (leaf just above upper ear).
2. Tassel attitude: Measured as attitude of tassel.
3. Brace root colour: Observation of anthocyanin colouration of
brace roots.
4. Anther colouration: Measured as anthocyanin colour of anther (in
middle thired of main axis).
5. Spikelets density: Density of the spikelets measured in middle
thired of main axis.
6. Tassel angle: Measured as angle between main axis and lateral
branches (in lower third of the tassel).
7. Silk colouration: Anthocyanin colouration of silk observed at the
time of emergence.
Methodology for Molecular characterization Of 8 Inbred lines:
A set of 36 markers has been analyzed for molecular characterization
of 8 parental lines. Details regarding the SSR markers, their bin locations,
sequences of the forward and reverse primers and nature of SSR repeats at
each of these loci are provided in Table.
The SSR markers utilized in the present study were designated as ‘bnlg’ or
‘phi’, umc, and dupssr6 indicating the organization which was responsible for
their identification and characterization. The ‘bnlg’ markers were characterized
by Buookhaven National Laboratory and the ‘phi’ markers were characterized
by Pioneer Hi-Bred International, USA.

Table: Details of thirty six SSR markers used for study of genetic
diversity among eight inbred lines.

(47)

02 (CAC)4 6.08-5.00 (CGG)4 9.00 (CAG)5 (CAG)4 4.03 (CCG)6 3.00 4.01 (AG)14 (GGA)1 0 (AC)6 7.03 5.06 (CAG)4 4.01 6.08 (AT)6 3.03 (AG)20 1.S.06 AAAG 5.03 10.N 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 primer bnlg112 6 umc232 4 bnlg110 8 umc179 3 umc203 9 umc205 3 umc230 7 bnlg152 3 umc225 9 umc230 5 phi1091 88 umc120 9 umc123 2 umc165 2 bnlg224 8 umc184 5 bnlg112 4 umc234 6 umc126 5 umc196 2 umc157 4 bnlg138 2 bnlg129 2 umc107 2 umc167 4 umc159 4 umc100 8 umc129 6 umc141 5 umc102 1 umc140 2 dupssr6 umc167 3 bnlg126 8 umc137 8 umc126 Forward Sequence (5’-3’) Reverse Sequence (5’-3’) GAGATCGAAGGTCATGGC AC GATCCTCTGTCGCCAAACA CTAAG GGATTCCTTTATGACGGG GT TGCACACCCTTTATTGAAT CATCA CATCTCCTACCAGCTCACC CC ATCTCTCCCTCGCTCTCCTT CTC ATGGTTCCTGGTTCAGA TGG AGATGGTGACGATGAGT GATGAAC AGTAACAACCAAGGCA TCGG CGTATAAGCTTTTTGGG GTCCTCT GCTCGGGGTAGTAGTGT TCTCCTT AGCAGCAGGTTGGTCG AATG GTCGACATCGTCTTCCCCA GAGCACAGCTAGGCAAAA GG GGCTCGACTTCGAGGACA CC CTCTGCCTGCCTTTATAAAT CACC GTAGGAAGCCACGTACG CTCGCACGCTCTCTCTT CTT GAGGAGGAGAGGGACA GGGAAG CTCCTCTTTCCCCTCCAT TGTT GGTCATCAAGCTCTCTG ATCG CCAGCTAGTCGTCGTAG CCAAG AGGCTCTAGCTACCTGG CTACGTT CACTCGACCTCGATCGG AAC ACTTTGACACCGGCGAA TAC TGGTAACCAGATTCCCA CAGATG TGGCACATCCACAAGA ACAT CTTTCTGCAGTTCTGCTA GCTGTG TGTGTTCTTGATTGGGT GAGACAT GAGAACCAACCACCAAA GAAGTCC GTCATGCAAGTATCCGC TGTCTT GCAGGATTTCATCGGTT GTT AAGCTCAGAAGCCGGAGC GTCGTCGACCACTACGTCC AC GGAATTACCACAACAAACT AAACTTGG GAGAGCAGTAGCACTGAC CCTTTC CCACCACATCCGTTACATC A TGGTTGAACTGTTAAATCT GTCCTGA TCTTCATCTCTCTATCAAA CTGACA GTACATGATCTCGAGAAAG CCGAT GCCTAGTCGCCTACCCTAC CAAT ATAAGTGGGGGAGGCGAG CTA TTTCATGTGCTTGCAGAGT TTGAC TTTTCTTTCAAAAATATTCA GAAGC GGCGCGCACATAGCTC GCCTGGGCTGGCTTCA GAGGAGACCGCCTCTGGT CTTCGGGTTCCTGGACC TC TTCT ACGAGGTCCACGACTATG AGTAGTACACGGCTGAC GATCTT GGCAC GCCAGGGGAGAAATAAAA CACTGCAGGCCACACAT TAAAGC ACATA TCTAGCTTGTGGTGGTGGT ACATGAGCACAAAGACT TGA GACGC CTCTCCCGGCTCTGACCTA GCTGGAGATAGGCATCC GC AGACAC GTGAGATATATCCCCGCCT AGACTTCCTGAAGCTCG TCC GTCCTA AGCCTCCTGAGACCTCTCG ACTTCGCCACCTTACATT ATT CTTGA TACACGCAGCTCTGGGTTT GTGATCCGGGTAGAGG TG AATGTG GATCCTACCAAAATCTTATA ACAGCTAGCCAAGATCT GGC GATT AAGCTCAAGCTCCTAGCTC GAGGAGCGTCTCCAGA (47) TTCCT AGGAC TCCACGGTGACTGTAGAAC CACTTCCCCCAGATCATT G TG GAAGTCGCTGATGAGAAC GCTAGCTAGTGTGAGTT GTAACC CTTCCGC TTACAACACGCATGCATCT AACAACAAAGAACTCAC No.05 (AG)30 2.08 .09 (CGC)6 7.10 AG(20) 1.01 (TA)7 (GT)4 (GA)6 (GGT)7 (GAC)1 0 (GT)4 (GCCC) 4 (CA)6 (A)5(CA )9 (TCC)5 3.09-3.08 (AG)21 3.04 2.03 (AG)8 2.02 5.02 10.01 (TA)7 (TCAC) 4 9.07 8.05 9. of Repeats bin Location (AG)20 4.09 (AG)17 3.09 (AG)25 5.0110.02 8.06 4.03 (GA)6 5.03 (GCC)5 4.04 1.07 3.03 (GAG)5 (ACAG) 4 (CCG)5 3.03 10.

Equal volume of chloroform: isoamyl alcohol (24:1 v/v) was added and thereafter.5M - 1. Leaf sampling at seedling stage Isolation of genomic DNA DNA purification by RNase treatment DNA amplification using specific SSR primers by PCR Agarose gel electrophoresis of PCR products. Sample tubes were put in water bath at 650c for 1 hr with occasional and gentle but proper mixing after every 10 minutes. The fine powder was then transferred to labelled 50 ml centrifuge tube containing 10ml c-TAB extraction buffer. Final volume concentration 5m 1m 0. Sample was wrapped in labled aluminum foil and then frozen in liquid nitrogen before storing at -800c. DNA isolation: DNA isolation was done of individual plant sample by cutting the leaf samples with sterile scissors into small pieces and then transferred to autoclaved chilled pestle and morter and ground to a fine powder with liquid N 2. 1. verification and analysis. Then. 2. leaf sampling was done by taking 1 gm leaf from 3 week old seedlings of each genotype. just prior to use. Extraction buffer: Chemical Nacl Tris EDTA c-TAB H2O Stock Working conc. 2. Leaf sampling: Randomly ten uniform plants of each genotype were selected from all three replications.Molecular Analysis comprised of following steps.6 vol. 1. data entry. scoring. of isopropanol was added to it. 4. 6.4m 100m 20mM 2% - (100 ml) 28ml 10ml 4ml 2gm 58ml Tubes were removed from water bath and then contents were allowed to cool to room temperature. the contents were mixed thoroughly by gently thimbling the sample tubes for 10 minutes. The clear aqueous phase (supernatant) was carefully pippeted out into new tubes and 0. the contents were centrifuged at 15000 rpm for 15 minutes at 20 oC temperature. 5. 3. The contents were mixed gently by (46) . Molecular profile.

for 1 hr or overnight to allow DNA precipitation. Tubes were incubated for 1hr at -20oC and subsequently centrifuged at 15000 rpm for 15 minutes. Protocol for quantification Appropriate quantity of agarose was weighed and added to 1x TAE. 3. they were dissolved in 1ml sterile double distilled water at room temperature for about 2 hrs. Subsequently. followed by centrifugation at 10. The cooled but not solidified gel was poured into the casting tray and left for solidification for 1 hr. pellets were dried at room temperature and dissolved in 1000 µl double distilled water. and finally. 4. Required (47) . and doubling the volume by adding ice cold ethanol. The comb was properly fitted to the gel casting tray in such a way that 2 mm gap was maintained between the bottam of the tray and comb tip.5%. The content was cooled to around 55-600C and 2 µl ethidium bromide (10mg l -1) was then added. RNase treatment ( DNA-purification) To the dissolved DNA (1000 µl). the dissolve pellets of DNA were transferred to autoclaved eppendrof tubes each. subsequently. supernatant was discarded and pellets were washed twice with 70% ethanol.000 rpm for 10 minutes. pellets were allowed to dry in air. After proper solidification of the gel. It was followed by separation of aqueous phase in the fresh eppendrof tubes and addition of one-tenth volume of chilled 3M sodium acetate (pH 5. When pellets got fully dried.inversion and stored at -20oC. Then. Agarose was dissolved properly by boiling in microwave oven. Subsequently. Pellets were washed with 70% ethanol and centrifuged at 10. This step was repeated twice. tubes were centrifuged at 15000 rpm for 15 miutes. Subsequently to the tube equal volume of phenol chloroform isoamyl alcohol (25:1) was added and mixed thoroughly. the tubes were centrifuged at 15000 rpm for 15 minutes at -20oC. 25 µl RNase was added and it was incubated at 370C for 1hr. The supernatant was then gently discarded by inverting the tube on blotting paper for 2-5 minutes.2). the comb from casting tray was removed carefully and the casting tray was placed horizontally. to make final concentration 1.000 rpm for 10 minutes. in electrophorosis apparatus.

3µl 0. uncut DNA of known quantity having concentration of pure DNA as 25ng/µl.) was added. Final extension was carried out at (48) . and 72 0C for 1 min. which was further followed by 35 cycles 94 0C for 1 min. was centrifuged at 1000 rpm for 1 minute and loaded in a 96-well thermal cycler. was also put on parafilm and mixed with loading dye. till the tracking dye migrated to 1/3 rd of the distance in the gel.. Mullis et al.5 µl 0. The PCR mix.5mM 0. Good quality. Reaction mixture used for SSR PCR is as follows: Stock components 10x buffer 25 mM Mgcl2 10mM dNTPs Taq Polymerase (3 U/µl) d H2O (sterile) 20 mM primers Working conc.16µl 4.. 5.9µl 0.5µl-F 1. 1986). The most essential requirement of PCR is the availability of a pair of short length (typically 20-25 nucleotides). Thus total quantity in each tube was maintained at 15 µl. to which further 2 µl of 6 x bromophenol blue (loading dye) was added.2mM 0. The gel was run at 70v (70-80v). Polymerase chain reaction (PCR) Polymerase chain reaction (PCR) is used to selectively amplify in vitro a specific segment of the DNA to a billion fold (Soski et al. primers having sequence complementary to either end of the target DNA segment (called template DNA). 1x 1. The electrophoresed DNA samples were visualized using a UV Transilluminator GelDoc system and the same photographed and documented.5 U 1µM Requirements of one reaction 1.amount of 1x TAE working solution was added to the apparatus. 550C for 30 sec. 1985. DNA samples for loading were prepared by taking 5 µl of DNA on para film. Initial denaturation at 940C for 4 min.5 µl-R 50ng DNA was used per PCR to which 10 µl master mixture (PCR reaction mix.14µl 1. The DNA samples from parafilm were gently loaded on the gel.

The agarose gel was prepared by adding 10. and maintained at 4 0C for ever. Finally alleles were numbered as ‘a1’. Two bands with equal intensity in a genotype was considered as heterozygous. To the DNA sample with 3 µl 6x loading dye was added and the whole mixture was loaded in the gel carefully. Scoring of SSR amplification patterns After separation of amplified products of each reaction on 3. we could identify between heterozygous and homozygous inbred lines. The solidified gel was transferred to horizontoal electrophoresis apparatus and 1x TAE was added to over the gel. Scoring was done manually for each of the gel sections. ethidium bromide (10 mg/ml) was added and the gel was poured in the tray containing the comb. In heterogeneous condition. Since SSR are codominant marker.5% metaphore agarose gel. For each allele each genotype was scored for presence (1) or absence (0) of allele. the missing data was not (49) . band with higher intensity was used for scoring and lower intensity was rejected. it was photographed using a gel documentation system. Band patterns for each of the microsatellite markers were recorded for each genotype. under equal magnification. After cooling the gel to 55-600C 7 µl agarose.5gm of metaphore agarose to 300 ml 1 x TAE buffer in a flask of 1000ml capacity and boiled carefully till the agarose was completely melted. where as in case of variable intensities and of superimposed conditions. Separation of PCR amplified producing on metaphore agarose gel The amplified products were resolved on 3. (i. avoiding air bubbles to form. Any band thought to be an artifact. The gel was run at a constant voltage of about 70 v for about 4 hrs. These missing data were designated as ‘9’ (in comparision with ‘1’ for presence of a band and ‘0’ for absence of a band) in the data matrix. The amplified products were used for electrophoresis. Mongarth sample 50 bp ladder was also loaded.e. ‘a2’ etc. until the tracking dye has migrated to the end of the gel).5% metaphore agarose gel.720C for 7 min. or bands which are either diffused was considered as ‘missing data’. it was considered as heterogeneous.

9). PIC is a measure of allele diversity at a locus and is equal to 1-∑(P 2ij). freq. has overall less discriminative capability than a locus that also has five alleles. all groups are fused in to a single cluster. where Pij is the frequency of jth allele for ith locus summed across all alleles in the locus. with many alleles in equal frequencies) provide an estimate of the discriminatory power of a marker by taking into account not only the number of alleles at locus. a marker locus that reveals five alleles. For example. so that individuals with similar descriptions are mathematically gathered in to a small cluster. The results of cluster analysis may be displayed in the form of a two dimensional diagram known as dendrogram. This method proceeds by either a series of successive mergers or by a series of successive division of group of individual or objects. Monomorphic markers were not excluded from data analysis. and these initial groups are merged according to their similarities. but in which those alleles are found in more equal frequencies. (1998). Clustering methods can be categorized in two groups: Hierarchical and Non-hierarchical clustering methods. PIC is synonymous with the term “gene diversity” as described by Weir (1996). The most similar individuals are first grouped. Eventually as the similarity decreases. Hierarchical clustering methods are more employed in research. = 0. but where one allele is found in very high frequency (ex. Cluster analysis The basic aim of cluster analysis is to group individuals or objects based on the characteristics they posses. but also the relative frequencies of those alleles in the genotypes under study. This method is termed as agglomerative method. ‘polymorphism information content’ (PIC) was determined as described by Senior et al. Mean PIC value was calculated based on PCR values obtained across various SSRs loci. The PIC values ranging from ‘0’ (monomorphic) to ‘1’ (very high discriminative. The (50) .considered while analyzing the genetic similarities. analyzing genetic diversity. since they all have equal affects during dendogram construction and cluster analysis. Molecular marker data analysis For each SSR marker. The molecular marker data were entered directly into Excel sheet.. with microsatellite alleles under rows and the genotype under columns.

and vice and versa for N01. (1992).dendrogram illustrate the mergers or divisions which have been made at successive levels. Values of GS may range from ‘1’ (identical profiles for all markers in the two inbreds) to ‘0’ (no band in common). or molecular data. including morphological. In the present investigation. The equation for Jaccard’s coefficient is as follows: J = N11/N11 + N10 + N01 Where N11 is the band present in both individuals. (51) . cluster analysis was used for grouping of inbred lines based on SSR data and morphological.  SECOND SEASON Rabi (2012-13): Growing of the 8 inbred lines for making half diallel crosses among them by hand pollination. Generating the test material: During Rabi.  Table-3: List of maize crosses (28 F 1S) produced by crossing 8 inbred lines in half diallel. In the present study Jaccard’s (1908) coefficient was used to study the genetic similarties. N10 is the number of bands present in one genotype but absent in other. 2013 the experimental material was generated by crossing eight inbred lines in half diallel resulting 28 F 1s (Table-3). Properties of these genetic distance/similarity measures and their relationship to other measures used in the literature have been discussed by Boppenmaier et. There are several agglomerative hierarchical methods that are commonly used in clustering techniques. biochemical. al. Analysis of Genetic Similarity (GS) based on SSR data: GS between genotypes (inbreds) based on molecular marker data can be calculated for all possible pairs of genotypes using various coefficient. To estimates similarities/dissimilarities between genotypes. this in turns provides information about the genetic distance between genotypes as genetic distance GD = 1-GS. different types of data can be used as ‘input’ for cluster analysis.

. 7. medium in phosphorus and high in potash with pH of 8. 4. 280 N Latitude and 770 12´ E Longitude.5.52m MSL. 6. The Gwalior is situated at an altitude of 211. The soil is sandy loam. THIRD SEASON Kharif (2013): Cross HKI1128XCML285 HKI1128XCML292 HKI1128XCML132 HKI1128XLM16 DMRPE6XCML285 DMRPE6XCML292 DMRPE6XCML132 DMRPE6XLM16 CML285XCML292 CML285XCML132 CML285XLM16 CML292XCML132 CML292XLM16 CML132XLM16 A study was carried out by undertaking multi-location trials of 8 inbred lines and their 28 hybrids and 4 national check hybrids in three locations viz.N.5. Location and Climate: E1 (Gwalior): irrigated environment. 23. 18. 3. 1. The Delhi is situated at an altitude of 228. 260 13´ N Latitude and 780 14´ E Longitude. 24.S. low in available nitrogen. 10. 17. E2 (Delhi): irrigated environment. Gwalior. New Delhi. 28. 16. 26. 5. 15. (52) . The Delhi is situated at an altitude of 228. The soil is loam to sandy loam. 21. 19.N. 14. 9. 280 N Latitude and 770 12´ E Longitude. 20. 13. 11. low in available nitrogen. College of Agriculture. 2. 27.1m MSL. and College of Agriculture. The soil is loam to sandy loam. E3 (Indore): irrigated environment.  Cross HKI 163XHKI1105 HKI163XHKI1128 HKI163XDMRPE6 HKI163XCML285 HKI 163XCML292 HKI163XCML132 HKI163XLM16 HKI1105XHKI1128 HKI1105XDMRPE6 HKI1105XCML285 HKI1105XCML292 HKI1105XCML132 HKI1105XLM16 HKI1128XDMREPE6 S. 25. Indore. Indian Agriculture Research Institute. 8. low in available nitrogen.1m MSL. medium in phosphorus and high in potash with pH of 8. 22. 12.5. medium in phosphorus and high in potash with pH of 8.

5 91.2 91.8 70. 30 Jul to 05 Aug.4 22.3 32.1 32.9 4. Week 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Date 25 Jun.4 55.9 31. 16 to 22 Jul.8 82. 30 Oct.2 88. Humidity (%) Temperature (C) Max.7 72.0 000. 27 Aug.0 91.7 33. 02 to 08 Jul.8 2.8 3.1: Meteorological data of Gwalior during crop season 2013-14 Met.0 102.1 74.3 20.0 000.4 000.0 003.0 14.4 41.3 2.2 2. Morning Evening 35.0 000.8 24.2 83.2 114.1 7.8 059.7 57.5 89.9 24.0 045. to 1 Jul.4 34.4 89.8 48.Table 1.2 3.7 73. Gwalior (53) 5.9 32.8 24.4 039.9 23.9 64. College of Agriculture. 13 to 19 Aug.1 3.9 2.1 65.2 10.5 .2 3. 10 to 16 Sept.1 32.4 88.7 34. 20 to 26 Aug.0 Source: Meteorological Observatory.0 036.4 86.5 2.00 044.7 93. to 2 Sept.00 000.1 28.6 24. 06 to 12 Aug.5 25.3 35.1 73.1 3.7 25.6 24.6 78.6 22.2 25. Min.7 76. 03 to 09 Sept.6 32.8 31.5 94.4 51.5 25.2 3. 01 to 07 Oct.7 6. 22 to 28 Oct.7 89.2 29.7 52. 17 to 23 Sept.6 30.9 31.8 6.4 2.4 63.9 33.0 34.7 67..2 31.8 87.8 25.8 76.4 092.8 93.3 32.5 25.0 070.9 3. 09 to 15 Jul. 23 to 29 Jul. 15 to 21 Oct. 24 to 30 Sept.2 71.5 92.1 Rainfall Evapo(mm) ration (mm) 12 001.4 46. 08 to 14 Oct.8 032.5 88.6 17.7 3.6 26.9 24.

to 1 Jul..5 2. 02 to 08 Jul. 16 to 22 Jul.5 25. 15 to 21 Oct. to 2 Sept. 01 to 07 Oct.3 2. 13 to 19 Aug.2 3.1 3.7 73.1 32.5 2.4 55.0 14.7 33.4 41.7 89.9 32.8 3.8 82.8 48.00 000.1 32.7 3.4 22.4 46.7 34.9 64.0 045..0 036. Humidity (%) Temperature (C) Max.5 89.2 114.8 24.8 2.0 070.6 78. 03 to 09 Sept.8 032.0 102.8 87.7 6.4 000.8 87.2 3. 27 Aug.9 33.4 51.2 3.3 32.7 93.2 10.2 91. 10 to 16 Sept.5 .1 3.6 30.4 039. 02 to 08 Jul.8 6.4 86.7 25.7 76. Morning Evening 35.9 2.1 73.4 092.0 91.3 35.1 28. 09 to 15 Jul.7 52.5 25.5 25. 17 to 23 Sept. Week 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Date 25 Jun. 27 Aug.3 20.0 000. to 2 Sept.1 32.9 33.1 32.6 24.0 000.1 Rainfall Evapo(mm) ration (mm) 12 001.1 7.Table 1.8 24.8 76. 30 Oct.7 57.1 74.0 34.8 059. 24 to 30 Sept.4 34. 30 Jul to 05 Aug.0 Source: Meteorological Observatory. 13 to 19 Aug.2 29.2 83.00 044.6 26.0 14.9 64.3 32.7 93.6 24. 20 to 26 Aug.3 20.7 72.1 65.5 88.4 51. 06 to 12 Aug. New Delhi.2 29.6 22.7 52.8 93.1 3.0 91. 03 to 09 Sept.7 72.1 65.4 092.8 70.1 3.4 34.9 23.8 25.7 34. IARI.1 28.0 102.4 22.9 24.6 22.2 31.8 25.2: Meteorological data of Delhi during crop season 2013-14.2 10.2 88. 24 to 30 Sept.00 044.0 000. 06 to 12 Aug.6 17.5 25. 30 Jul to 05 Aug.2 3.8 2.4 41. Indore.5 Source: Meteorological Observatory.8 31.9 31.9 23.1 7.8 6.2 114.9 31.2 25.6 32.6 32.7 6.4 63.2 3. 08 to 14 Oct.6 30.2 91.5 25. 08 to 14 Oct.2 83.4 000.9 2.0 003.0 5.8 70.9 31.6 24.7 67. 16 to 22 Jul.8 48. Humidity (%) Temperature (C) Max.00 000.4 2.4 88. Table 1.0 000.8 059.9 32. Met.8 76.2 2.5 92.2 71.3: Meteorological data of Indore during crop season 2013-14 Met. (47) 5.4 039.8 82. 22 to 28 Oct. College of Agriculture.4 55.5 94. 10 to 16 Sept.0 000. 17 to 23 Sept.5 89.1 74.0 036.3 32. Min.7 3. 23 to 29 Jul.9 24.9 24.7 33.0 34. 22 to 28 Oct.4 88.1 73. 09 to 15 Jul. 30 Oct.4 89.7 67.8 31.2 88.6 24.1 Rainfall Evapo(mm) ration (mm) 12 001.5 91.8 24.2 2.6 26.7 57.4 89.6 17.0 000. 15 to 21 Oct.0 070. 23 to 29 Jul.7 76.4 2.4 63.9 4.9 3.5 25.5 91.0 045.7 25.2 3.9 31.7 73. 20 to 26 Aug.0 003. Week 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Date 25 Jun.8 24.9 3. Min.3 32. 01 to 07 Oct.2 25.3 2.9 24.5 88.4 46.2 71.7 89. Morning Evening 35.2 31.4 86.8 032.8 3.3 35.5 92.6 78. to 1 Jul.9 4.8 93.5 94.

E.6 27.20 84.36 6 21.60 6.43 4. 47 21 to 27 Oct. 40 2 to 8 Sep.29 6 26.79 7 21.86 4.00 4 22.8 25.00 6 21.54 18.44 15.59 84. 16 to 22 Sep.29 3.29 6.71 2.4 32.43 84.00 9 21.50 0.61 82.33 85.80 7.8 28.43 5.94 82.36 6 28.57 2.49 3. Rainfal l (mm) Wind Velocity Humidity % 6.54 6.2 28. 37 12 to18 Aug.86 7.84 82.61 27.14 87.27 85.36 1 22. Week Date 27 1 to 7 Jun.1 27.57 73. to 4 Aug. 43 44 23 to 29 Sep 30 Sep to 6 oct 45 7 to13 Oct.93 78.80 82.34 11.89 2.4 29.79 11. 32 6 to 13 Jul.59 82.6 30.86 3 20.19 84.71 6.71 3 22.96 6. 41 42 9 to15 Sep.to 5 Jul.29 4.86 7 21.29 3 23.2 32.29 4.57 0.81 3.77 3. 33 14 to 21 Jul.69 9. 38 39 19 to25 Aug.00 1.00 1.56 10.86 4.90 0.64 10.3 33.67 .00 0 22.37 2.86 12.2 33.67 0.01 84.43 4 21.93 26.37 84. 46 14 to 20 Oct.70 0.Table: Met.74 0. 36 5 to 11 Aug.89 88.86 5.17 3 Experimental Details (48) P.5 26.14 6. 30 31 22 to 28 Jun.79 3 15.11 7. 48 28 to 30 0ct.29 8.9 27. 34 35 22 to 28 Jul.00 2.06 4.29 7.8 30.9 37.69 80.9 33.00 2. 29Jun.87 11.41 20. 29 15 to 21 Jun.29 99.57 4 14. 26 Aug to 1 Sep.71 16.00 4 22.86 4.71 6.29 2.6 29.00 5.4 31.53 79.64 3 23.3 24.00 5.43 5.14 2. Min.60 5.17 76.0 25.10 7.31 5.79 1. 24.71 1 22.21 6 20. 29 Jul. 28 8 to 14 Jun.77 9.00 3 21.3 29.39 12.47 0.00 4. Temperature (C) Max.5 27.36 85.

The following 13 quantitative characters were recorded: 1 Days to 50 per cent tasseling (DAS): The number of days taken from the date of sowing to the day on which 50 per cent of plants in a treatment showed anthesis (anther dehiscence) was recorded as days to 50 per cent tasseling. 4 Plant height (cm): The height of the individual plant was recorded (in cm) at the time of maturity from the ground level to the last node that bears the tassel of the plant. The fertilizer was applied at the dose of 120:60:40 kg NPK /ha. selected randomly from each row in each replication during 2013.0 m x 0. Observations recorded: The observations were recorded on 5 competitive plants. 7 Ear diameter (cm): Ear diameter was measured and recorded in centimetres at the maximum thickness of the ear. The observations were recorded on the following characters. 6 Ear length (cm): Length of the ear was measured and recorded in centimetres at the time of harvest (from the base to the tip of the ear). The sample size constituted 5 randomly selected plants of each genotype in each replication. The plot size for each genotype was 3. 2 Days to 50 per cent silking (DAS): The number of days taken from the date of sowing to the day on which 50 per cent of the plants in a treatment showed silk emergence was recorded as days to 50 per cent of silking.The experiment was laid out in RCBD in three replications. (47) . One healthy seedling per hill was kept after proper thinning at two weeks after germination. 5 Ear height (cm): Ear height was measured and recorded in centimeter as the length of plant from the ground level to the upper most ear bearing node.75 m. 3 Days to maturity 50 per cent maturity (DAS) : Days taken from planting to the day on which 50 per cent of the plants got physiological maturity of seeds was recorded as days to 50 per cent maturity. Standard agronomic practices were followed and plant protection measures were taken when required to ensure normal growth and development of the plants.

coefficient of variation and critical difference were calculated. standard error. 12 Shelling percentage: Average grain weight at 15 per cent moisture as per cent of total cob weight of randomly selected plants was used to compute the shelling percentage by using the following formula.8 Number of kernel rows per cob: The number of kernel rows per cob was counted and recorded. Shelling percentage = Grain Weight (at 15 moisture) x 100 Total cob weight at 15 moisture Statistical Methods: 1. = General mean gi = Effect of the ith genotype bj = Effect of jth replication over the genotypes eij = Error associated with each observation. Moisture determination was done from shelled samples of five random ears of each plot with the help of electronic moisture meter. 10 100-grain weight (gm): Weight of 100 grains drawn from a random sample at 15 per cent moisture from each plot was recorded in grams. genotypic and environmental variance. Analysis of variance: The data on various crop characters were subjected to statistical analysis by using appropriate method of analysis of variance as described in the book by Panse and Sukhatme (1954). 11 Grain yield per plant (gm): At the time of harvesting. 9 Number of kernels per row: Number of fertilized and developed kernels in each kernel row was counted and average was recorded as number of kernels per row. fresh ear weight was recorded in grams per plant. phenotypic. The range and estimates of mean. (48) . The model of analysis of variance is given below: The model of randomized compete block design is expressed as follows: yij =  + gi + bj + eij Where. The fresh weight of ear data was then reduced to that at 15 per cent moisture.

C D = Critical difference.1) 85 Where. E .Table 3: Analysis of variance in randomized block design Source of variance Replications Genotypes Error Total Degree of freedom (r – 1) 1 (g -1) 42 (r . S Em  = Standard error of mean MSSe =Error mean sum of square r (ii) = Number of replications Standard error of difference: Standard error of difference was calculated using the following formula. S E(d) = Standard error difference 't' = Table value at error degree of freedom at 5 % (49) . (b) Mean sum of square MSSr MSSt MSSe g = number of genotypes. (iii) SE (d) = Standard error of difference MSSe = Error mean sum of squares r = Number of replications Critical difference: It was calculated as formula given below C D (5%) = S E (d) x’t’ value at 5% level of significance Where. r = number of replications. critical difference and coefficient of variation: (i) Standard error of mean: using the following formula: MSSe S . SE (d )±= √ 2 MSSe r Where.( m)±= √ r Standard error of mean was calculated Where. Standard error of mean.1) (t -1) 42 (rt .

G(s). medium (10-20%) and high (>20%). C V (%) = √ Me X Where.(IV) Coefficient of variation: The coefficient of variation as percentage of mean was estimated as mentioned bellow. Me = Error mean sum of square X = Sample mean of observations (ii) Estimation of phenotypic and genotypic coefficients of variation: The phenotypic and genotypic coefficients of variation in per cent were computed by the following formulae given by Burton (1952). (iii) Estimation of heritability and genetic advance: Heritability in per cent in broad sense was estimated by the following formula given by Singh and Choudhary (1977): Heritability (h2) Genotypic variance  100 = Phenotypic variance Genetic advance: The estimates of expected genetic advance from selection. Phenotypic standard deviation  100 Mean Phenotypic Coefficient of Variation (PCV) = Genotypic standard deviation  100 Mean Genotypic Coefficient of Variation (GCV) = The PCV and GCV values are ranked as low (0-10%). C V (%) = Coefficient of variation in percent. G(s) = k × h2 × σp (50) . Comstock. and Harvey (1949). was obtained by the formula suggested by Robinson.

.Where. c μ = Population mean gi = General combining ability (GCA) effect of ith parent gj = General combining ability (GCA) effect of jth parent Sij = Specific combining ability (SCA) effect of (i × j) thecross eijkl = Environmental effect associated with the ijklth Individual observation n = Number of parents.. S.2. i. σp = Phenotypic standard deviation 2..06 for 5% selection intensity..………. Combining ability analysis: When the data were found statistically significant for a given character in randomized block design.f. b l = 1.………. (51) MSS . h2 = Heritability in broad sense. it was subjected to combining ability analysis according to the procedure given Griffing. k = Selection differential in standard deviation units which is 2. Xij = μ + gi + gj + sij +1 / bc _ _eijkl Where.2. 1956 method 2 and model-1.S. n k = 1. .. b = Number of replications c = Number of individual in each replication The model assumes that a= ∑i gi = 0 and ∑ Sij = 0 (for each i) b = the error (eijkl) is normally and independently distributed with mean equal to zero and variance equals σ2 c Combining ability variance: The analysis of variance table for combining ability is as follows: Source d.j = 1..……….2.

F1 = Mean value of the F1 hybrid. 6. Computation of heterosis (i) Heterosis over mid parents: The heterosis over mid parents was estimated as formula mentioned bellow F1 -MP h= X 100 MP Where. MP = Mean value of parents involved in a particular cross (ii) Heterosis over better parents: The heterosis over better parents was estimated as formula mentioned bellow F1 -BP h= Where.n−1 ) ¿ n(n−1) 2 l−1 ( n−l )(l−1) n ( n−1 ) (l−1) 2 l ( v−1 ) (b−1) GCA SCA enviroment GxL SxL Error SS g Mg SS s Ms SS l SS gl SS sl Ml M gl M sl M Me Where. (iiI) Standard Heterosis: The heterosis over standard parent was estimated as formula mentioned bellow F1 –SC h= x 100 SC Where. F1 BP X 100 BP = Mean of the F1 hybrid = Mean of the superior parents of the particular cross under Study. F1 = Sc = Mean of the F1 hybrid Standard Check (52) .

The form of analysis of variance for pooled data is given as under: Statistical analysis 1 Statistical model: The statistical model for a randomized complete block design in single environment can be defined as: Yijk= µ + gi +bij+ eijk (53) . half diallel of 8 present day inbred lines and their 28 test hybrids tested against 4 national check hybrids of maize were grown in 3 environments viz. and college of agriculture. EMS = Error mean sum of square Stability analysis: Pooled analysis of data: Since. Gwalior.Test of significance for heterosis: Test of significance of heterosis over mid parents was calculated by applying t. Indian Agriculture Research Institute. Delhi. College of Agriculture. EMS = Error mean sum of square Test of significance of heterosis over better parents and standard parent was done by applying t-test F1 – BP or Standard variety (!) t = SE (H) SE (h) =  2/r x EMS Where.. Indore. the data were pooled over environments to get information on genotype × environment (g×e) interaction.test F1 – MP (!) t = SE (H) SE (h) =  3/2r x EMS Where.

(54) Observed mean sum of squares m s1 m s2 m s4 m s5 m s6 -- .Where.f.f. r -1 g -1 (r-1) (g-1) rg -1 Expected mean sum of squares 2 ei + 2 gri 2 ei + 2 rgi 2 ei Statistical model for pooled analysis: Statistical model for pooled analysis of variance may be defined as follows: Yijklt = µ + ti + bij + gik + riki +grijkl +brijl +eijklt Statistical model for pooled analysis: Statistical model for pooled analysis of variance may be defined as follows: Yijklt = µ + ti + bij + gik + riki +grijkl +brijl +eijklt Where. The skelemetric ton for pooled analysis of variance is as follows: Sources of variation Replications Environments or planting times (E) Genotypes (G) GxE Error Total d. µ = the general mean gi = the effect of i th genotype bij = the effect of j th replication in i th genotype ei jk = the error associated with each observation The skelemetric ton for analysis of variance for randomized complete block design is given below: Source of variation Replications Genotypes Error Total Observed mean sum of squares ms 1 ms 2 ms 3 d. r -1 e -1 g -1 (e -1) (g -1) e(r -1) (g -1) rge-1 Where. µ = General mean ti = The effect of ith treatment bij = The effect of jth replication in ith treatment rjkl = The effect of ith environment to kth genotype in ith treatment eijklt = Error associated with each observation.

δ ij = The deviation from regression of the ith varieties at jth environment Ij = The environmental index which is defined as the deviation of the Mean of all the varieties at a given location from over all mean (55) . Yij = Mean of ith variety in jth environment µ = Mean of all the varieties over all the environments βi = The regression coefficient of the ith varieties on the environments index which measures the response of this variety of varying environments. SEm± for genotype = √Pooled error MSS/ (Replication x Environment) SEm ± for environment = √Pooled error MSS/ (Replication x genotype) CD for genotype = Pooled SEm for genotype x t 5% CD for environment = Pooled SEm for environment x t 5% Analysis of variance for stability parameters Stability parameter model was used as suggested by Eberhart and Russell (1966).e = Number of environments r = Number of replications t = Total number of treatments g = Number of genotypes Standard error of mean (SEm±). The model of stability is defined as follows: Yij=µ +βiIj+ δ ij Where. SEd± = √ (2ve / r). CD = SEd x t5 % and CV = √ (ve) / x x 100 ve = Error mean sum of squares r = Number of replications t5 % = table value of “t” x = general mean of the character Where. Critical difference (CD) and Coefficients of Variation (CV) were calculated as given below: SEm± = √ (ve / r). Standard error of differences (SEd±).

S.f. and (ii) S.CF n i Environment (n-1) 1  Yij2 .S.Env (lin.S. due to variety x environment (linear) which was in fact S.S.CF i j Varieties (t-1) 1  Yi2 .e. due to deviation from linearity of response (i. The later was partitioned into as many components as number of varieties with (n-2) degree of freedom each. Yij/t .S j j j MS2 Pooled deviation t (n-2)   Sij2 i j MS3 Variety 1 (n-2)  Yij2 . Total (nt-1)   Yij .CF t j Variety x environment (t-1)(n-1)   Yij2 .) S.(Yt)2 .S. due to pooled deviation).( Yij Ij)2 /  Ij2 i n i j =  S2ij J Variety t (n-2)  Ytj2 . due to regression.(Yi)2 . Yj2/t i j i j Environments (linear) 1 1 ( Yi Ij)2 /  I j2 t j j Varieties x environments (linear) (t-1)  ( Yij Ij)2 /  I j2 . Sum of squares M.  Yij /ts j i j The analysis of variance was further extended where the total sum of squares was partitioned into various parts as given below: Table: Analysis of variance for stability parameters Environmental Index Ij= Source of variation d. Two stability parameters were calculated as below: (i) Regression coefficient: It was estimated as follows : bi =  Yij Ij /  Ij2 j j Where. r = number of replications n = number of environments The other main features of this model was that the sum of squares due to varieties x environment has been further partitioned into two parts (i) S. Yi2/n .S.  Yij Ij = the sum of products j (56) .( Ytj Ij)2 /  Ij2 i n i j =  S2tj J Pooled error n(r-1)(t-1) 2 MS1 where.

...(S2e/r) j Where... S2e/r = the estimate of pooled error 2 Y ij = total of the variety over all environments (Yij2-Yi2/n) = sum of squares due to dependent variable j Sum of squares due to pooled deviation was calculated by the sum of S... distributed uniformly on both arms of all the 10 chromosomes was used in the study (Table 2). ßt F = MS2/MS3 (c) Individual deviation from linear regression was tested as follows: F = [(Yij2)/n-2] / pooled error (B) Primers and PCR amplification –A set of 36 SSR primers. primer annealing at 55°C for 30 sec and primer extension at 72°C for 1 min.S. The PCR amplification cycle consisted of initial denaturation at 94°C for 4 min followed by 35 cycles of denaturation at 94°C for 1 min... due to deviation from individual varieties.. HO = µ1 = µ2 = µr The appropriate 'F' test was defined as F = MS 1/MS3 (b) To test the hypothesis that there are no genetic differences among varieties for their regression on environmental index: HO = ß1 = ß2 = ..... 1 μM of each forward and (57) ... i. The final extension step was performed at 72°C for 7 min...e... Ij2 = the sum of squares of all the environmental index j bi = regression coefficient (ii) Mean sum squares deviation from linear regression: Sij2 = (Yij2/n-2) . F test (a) In order to test the significance of the difference among the variety means. PCR was carried out in a volume of 15 μl... containing 50 ng of template DNA..

(58) . Alleles with frequency of less then 0.02(16) to produce an agglomerative hierarchical classification by employing UPGMA (Unweighted Paired Group Method using Arithmetic Averages) with average linkage. Bootstrap analysis. 0. 0. The amplified products were resolved on 3. Discrimination Rate (DR) was calculated according to Selvi et al (15). The gel was run in 1x TBE buffer at a constant voltage of 70 V for about 4 h (until the tracking dye migrated to the end of the gel). Null allele for any specific marker in a genotype was considered as absence of primer binding site. Goodness of fit of clustering was tested by estimating cophenetic values using COPH and MXCOMP options of the NTSYSpc programme. There was carried out using Win boot software with 1000 replicates. The polymorphism information content (PIC) was determined as described by Senior and Henn (13).reverse primers. Genotypes showing two allelic bands with equal intensity were considered as heterozygous for the locus. Jaccard’s coefficient (J) (14) was used to calculate the genetic similarities among pair wise comparison of genotypes based on SSR data. The similarity matrix was analyzed using NTSYS pc 2. SSR data analysis – Scoring of the SSR alleles was performed manually in terms of positions of the bands relative to the ladder sequentially from the smallest to the largest-sized bands.20 were considered as rare alleles and such allele representing a particular genotype was considered as unique allele for that genotype. after reruns with specific check and was designated as ‘0’.5% metaphor agarose gel along with 50 bp ladder (Fermentas). N10 is the number of bands present in one genotype (lane) and N01 the number of bands present in the other genotype.5 U Taq polymerase and 1. The gel image was documented using a gel documentation system (Alpha Imager® HP). Diffused bands or bands revealing ambiguity in scoring were considered as missing data and designated as ‘9’ in comparison with ‘1’ for the presence of a band and ‘0’ for the absence of a band in the data matrix.2 mM dNTPs. which is equal to 1-∑ Pij2 frequency of j th allele at I th where Pij is the locus summed across all alleles in the locus.5 mM MgCl2 (Fermentas). as follows: J = N11 / (N11 +N10 + N01) where N11 is the number of bands present in both genotypes.

(59) .