You are on page 1of 4

Guía de estudio para el tercer parcial de Biología Molecular

Regulación genética.
1.- Define los siguientes conceptos brevemente:
a) Regulación
e) Represor
k) Potenciador o
positiva
f) Activador
enhancer
b) Regulación
g) Inductor
l) Silenciador
negativa
h) Correpresor
m) Transactivador
c) Operon
i) Coactivador
n) Atenuación
d) Sitio operador
j) Inactivador
o) Regulón
p)
q) 2.- Explique cómo funciona la regulación positiva y negativa en el
operón de la lactosa
r) 3.- Explique cómo funciona la regulación por atenuación
s) 4.- Explique cómo funciona el regulón SOS
t) 5.- En qué consiste la respuesta de “austeridad”
u) 6.- Una mutación en la región promotora de un gen puede provocar
tanto una sobreexpresión como una subexpresión de los genes
correspondientes. Explique los dos fenómenos desde el punto de vista
molecular
v) 7.- Células de E. coli son colocadas en un medio de cultivo que
contiene lactosa; indique cuáles de las siguientes circunstancias
afectaría la expresión del operón de la lactosa provocando ya sea un
aumento, una disminución o bien si no se produciría ningún cambio
w)
a) Adición de altos niveles de glucosa
b) Una mutación que inactive a la β galactosidasa
c) Una mutación que inactive a la galactósido permeasa
d) Una mutación en el represor Lac que evite la disociación del mismo
del sitio operador
e) Una mutación que evite la unión de la proteína CRP a su sitio de unión
cerca del promotor lac
x) 8.- Explique brevemente
a) ¿Por qué hay un retraso en el crecimiento celular cuando las bacterias
son cambiadas de un medio que contiene glucosa a uno que solo
contiene lactosa?
b) ¿Cuándo el medio contiene tanto glucosa como lactosa, cuáles
proteínas estarán unidas a la región reguladora del operón lac?
c) Si solamente hay lactosa en el medio ¿cuáles proteínas estarán
unidas a la región reguladora del operón lac?
y) 9.- Describa brevemente las características y los mecanismos de
acción de los miRNA, los siRNA y los lncRNA en la regulación de la
expresión
z) 10.- ¿Cuál es el papel de la remodelación cromatínica en la regulación
de la expresión genética?
aa)
ab)
ac)
ad)
ae)
af)
ag)

Defina los siguientes conceptos: ao) a) Codón i) Aminoacil b) Anticodón tRNA sintetasa c) Marco de j) Peptidil lectura abierto transferasa d) Hipótesis del k) Sitio P bamboleo ribosomal e) Codón de l) Sitio A inicio ribosomal f) Codón de m) Factores de terminación traducción g) Código n) Sitio de unión genético al ribosoma h) Degeneración (RBS) del código o) Secuencia genético Kozac p) IRES q) Péptido señal r) Partícula de reconocimient o de señal s) Destinación de proteínas t) Modificación postraduccion al u) .ah) ai) aj) ak) al) Traducción am) an) 11..

x) Proponga un modelo que explique estos hallazgos y) 13. antes EF-G) ap) aq) 19.... Describa cómo los procariontes y los eucariontes determinan el marco de lectura correcto am) an) 18. Se aislaron varias mutantes.A continuación se muestra un fragmento de una cadena molde de transcripción z) aa) 5’ CTTTGATAAGGATAGCCCTTC3’ ab) a) ¿Escriba la secuencia de bases del fragmento de mRNA transcrito a partir de esta cadena b) ¿Cuál es la secuencia de aminoácidos que sería codificada por este fragmento iniciando por el primer marco de lectura en el extremo 5’ c) Suponga que la cadena complementaría es la que se usa como molde de transcripción.v) w) 12.. Las secuencias de aminoácidos correspondientes son: ae) a) M-S-I-R b) L-W-I-R c) L-S-R-R d) L-S-I-P e) L-S-I-W af) ag) ¿Cuál es la secuencia de nucleótidos del fragmento de mRNA silvestre que codifica para el péptido original? ah) ¿Cuáles fueron los cambios que produjeron cada una de las secuencias mutantes? ai) aj) 16.Numere los siguientes eventos de la síntesis de proteínas bacteriana en el orden correcto ar) .La siguiente secuencia de 4 aminoácidos es parte de un polipéptido encontrado en la especie silvestre (wild type) de un organismo: Leu-Ser-Ile-Arg.. ¿Cuál sería la secuencia de aminoácidos del péptido resultante.Explique por qué si existen 61 codones que codifican para 20 aminoácidos.¿Cuáles son TODOS los resultados posibles del cambio de una base en una cadena de mRNA? ad) 15. cada una de las cuales contiene una mutación simple (de un solo nucleótido).-Un mRNA dado puede ser traducido en uno de tres diferentes marcos de lectura. otra vez iniciando del extremo 5’ en el primer marco de lectura ac)14. El fragmento es de 400 pares de bases a) ¿Por qué consideraría inusual esto? b) Al secuenciar las dos proteínas no hay homología en sus secuencias.. la mayoría de los organismos solamente utilizan 32 diferentes tRNAs para reconocer a los 61 diferentes codones ak) al) 17.Ha aislado un fragmento de DNA viral que codifica para al menos dos proteínas de 120 y 80 aminoácidos cada una.Describa brevemente el papel de los siguientes componentes en la síntesis de proteínas bacteriana ao) a) Factor de inicio 2 (IF-2) b) RNA 16S c) Factores de terminación d) Factor de alargamiento 2 (EF-2..

Describa brevemente el papel de las moléculas de rRNA 23S (28S en eucariontes) y 16S (18S en eucariontes) durante la síntesis de proteínas az) ba) 21. describa la serie de eventos que ocurren entre la transcripción de un mRNA para una proteína secretada y la llegada de esa proteína al lumen del retículo endoplásmico bb) . Mediante un esquema o diagrama de flujo..as) _____Unión del aminoacil-tRNA al sitio A at) _____ El tRNA desacilado sale del ribosoma au) _____ La formación del enlace peptídico provoca una translocación del péptido creciente del sitio P al sitio A av) _____ La subunidad 50S se une al complejo de inicio formado por la subunidad 30S y el mRNA aw) _____ El factor de inicio 2 acarrea al fMet-tRNA al sitio P ax) ay) 20.