You are on page 1of 47

introduction to real time PCR

technology

Sawitree Suklour (Meow)

BasicTheoryofPCR
1

Denature Anneal

3
Extend
Repeatstep1-3
25-30cycles

94
Temperature

72

DenatureDNA
Single-strandDNA

Amplifytarget
DNAfragmentto
1millioncopies

Target
DNAdoubled

55
Anneal
Primers

22
DoublehelixDNA

3
Time

min

PCR Process
1. Temperature Cycling
Denaturation
Annealing
Extension

94
55
72

2. Every cycle DNA


between primers is
duplicated

PCR Amplification

Exponential Amplification

30 cycles --- 1 billion copies in theory

What is RTRT-PCR?
PCR?
RT-PCR: Reverse Transcription Polymerase
Chain Reaction
A method to amplify a piece of a ribonucleic acid (RNA)
molecule. The RNA strand is first reverse transcribed into
its DNA complement or complementary DNA followed by
amplification of the resulting DNA using PCR. This can
either be a 1 or 2 step process.

One step Vs Two step RT


RT--PCR
One step
cDNA synthesis to PCR
amplification is performed in
a single tube.
Minimizes experimental
variation because both
enzymatic reactions occur in
a single tube
Uses RNA starting template.
Prone to rapid degradation if
not handled well.
Not suitable in situations
where the same sample is
assayed on several occasions
over a period of time.
Less sensitive than two step
protocols

One step Vs Two step RT


RT--PCR
Two step
Reverse transcription and
PCR occur in separate tubes
Allows several different real
time PCR assays on dilutions
of a single cDNA.
Reactions from subsequent
assays have the same amount
of template to those assayed
earlier.
Date from two step is quite
reproducible.
Allow for increased DNA
contamination.

Real--time PCR
Real
Real time PCR: a technique used to
monitor the progress of a PCR
reaction in real time

Real Time PCR is based on the


detection of the fluorescence
produced by a reporter molecule
which increases

Fluorescent reporter molecules


Dyes that bind to the double-stranded
DNA
-SYBR Green

Sequence specific probes


- Hydrolysis probe
- Hybridization probe

SYBR Green

SYBR Green is the


most widely used
double-strand DNAspecific dye
reported for real
time PCR.
SYBR Green binds to
the minor groove
of the DNA double
helix.

Hydrolysis probe
1. TaqMan probe
The reporter dye (R) represents the quenching dye that disrupts
the observable signal from the quencher dye (Q) when it is within
a short distance.

2. Molecular Beacons
Molecular beacons are hairpin
shaped molecules with an
internally quenched fluorophore
whose fluorescence is restored
when they bind to a target
nucleic acid
Molecular Beacon Example Sequence
Fluorophore at 5' end;
5GCGAGCTAGGAAACACCAAAGATGATATTTGCTCGC 3'-DABCYL

3. Scorpion probe
The oligonucleotide that consists of a probe
and primer linked together is called a Scorpion
probe or Scorpion primer.
The advantage of
this technique is
that the detection
of the amplicon is
much faster due
to the unimolecular
reaction.

Hybridization probe

Which RealReal-Time Chemistry Is Right for You?

Application reference guide

Fluorophores and Quenchers

Instrument compatibility

What happens during


a PCR reaction ?

AMOUNT OF DNA

1.6E+09
1.4E+09
1.2E+09
1E+09
800000000
600000000
400000000
200000000
0
0

AMOU N T OF D N A

1
2
4
8
16
32
64
128
256
512
1,024
2,048
4,096
8,192
16,384
32,768
65,536
131,072
262,144
524,288
1,048,576
2,097,152
4,194,304
8,388,608
16,777,216
33,554,432
67,108,864
134,217,728
268,435,456
536,870,912
1,073,741,824
1,400,000,000
1,500,000,000
1,550,000,000
1,580,000,000

AMOUNT OF DNA

CYCLE NUMBER
0
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34

10
15
20
25
PCR CYCLE NUMBER

30

35

30

35

10000000000
1000000000
100000000
10000000
1000000
100000
10000
1000
100
10
1
0

10

15

20

25

PCR CYCLE NUMBER

23

Amplification curve

Amplification curve
Baseline: The initial cycles of PCR, in which there is little
change in fluorescence signal.
Threshold: The location on the graph where the values of the
samples are determined. The threshold should be set in
the region associated with an exponential growth of PCR
product.
CT: (threshold cycle) The cycle number at which the
fluorescence passes the threshold. Lower Ct indicates
higher starting amount; lower Ct for the same starting
amount indicates higher detection sensitivity

Threshold line
The Threshold line is the level of detection or the
point at which a reaction reaches a fluorescent
intensity above background.
threshold

Ct

Standard curve method

Standard curve: a dilution series of known concentrations, used to


calculate unknown amount
Slope: indicates amplification efficiency, ideal slope = -3.32 with 100%
efficiency, values between 90% -110% considered good
Correlation Coefficient (R2): indicates reproducibility, ideal R= 1.000,
values above 0.990 considered good
Y-intercetp: the y-intercept corresponds to the theoretical limit of
detection of the reaction, or the Ct value expected if the lowest copy
number of target molecules denoted on the x-axis gave rise to
statistically significant amplification.

Melting curve (disassociation curve)


Melting curve (below, left): plot of fluorescence vs. temperature; done
following PCR cycling
Derivative (below, right): most common view; plot of dF/dT vs.
temperature
Application: indicates specificity, ideal is single peak; multiple peaks
indicate non-specific amplification including primer-dimers
No-template control reactions must be run to ensure specificity

Quantitative & Qualitative assay


in Real time PCR

Absolute vs Relative Quantification


Absolute Quantification(Standard
Curve Method)

Relative Quantification

overview

you quantitate unknowns based on a


known quantity First you create a
standard curve; then you compare
unknowns to the standard curve and
extrapolate a value.

you analyze changes in gene expression


in a given sample relative to another
reference sample (such as an untreated
control sample).

Example

Correlating viral copy number with a


disease state.

Measuring gene expression in response


to a drug.In this example, you would
compare the level of gene expression
of a particular gene of interest in a
chemically treated sample relative to
the level of gene expression in an
untreated sample

Absolute vs Relative Quantification

Absolute quantification without


standard curve

Absolute Quantification Using the


Standard Curve Method
The standard curve method for absolute quantification is similar to the
standard curve method for relative quantification, except the absolute
quantities of the standards must first be known by some independent means.

http://cels.uri.edu/gsc/cndna.html

How to create the standard curve


- known copy number
or concentration.
- at least 3 points and
cover concentration
area.
- duplicate or triplicate
of each point.

Consideration of good standard


curve

Relative Quantification
Methods for relative quantitation of gene expression allow
you to quantify differences in the expression level of a
specific target (gene) between different samples. The data
output is expressed as a fold-change or a fold-difference of
expression levels
- Comparative Ct method
- delta delta Ct

Relative Quantitation
Comparative Ct (
Ct
Method)

Compares the Ct difference for calibrator (GOI minus


HK) and the sample (GOI minus HK)

The Reaction Components


1) Target DNA, RNA - contains the sequence to be amplified
2) Pair of Primers - oligonucleotides that define
the sequence to be amplified.
3) dNTPs - deoxynucleotidetriphosphates: DNA building
blocks.
4) Taq polymerase, reverse transcriptase - enzyme that
catalyzes the reaction
5) Mg++ ions - cofactor of the enzyme
6) Buffer solution maintains pH and ionic strength
of the reaction solution suitable for the activity of the
enzyme
7) Fluorescent dye

PCR Master Mix


Commercial master mixes, which are
widely available,simplify the
optimisation and are convenient.

Real time PCR Master Mix


SYBR green base detection
qPCR
- Plantinum SYBR Green qPCR SuperMix-UDG
- SYBR GreenER qPCR SuperMix Universal
- Express SYBR GreenER qPCR Supermix universal
- InnuMix qPCR MasterMix SyGreen

qRT-PCR
- SuperScript III Plantinum SYBR Green One-step qRT-PCR kit
- EXPRESS One-Step SYBR GreenER Universal
- InnuScript One Step RT-PCR Sygreen kit

What is difference between SYBR


green& SYBR GreenER

Real time PCR Master Mix


Probe detection base
qPCR
- Platinum qPCR SuperMix-UDG

- Express qPCR SuperMix-UDG


- InnuMix qPCR MasterMix Probe

qRT-PCR
- SuperScript III Platinum one-step qRT-PCR SuperMix

- Express one-step qRT-PCR SuperMix


- InnuScript one-step qRT-PCR superMix

Advantages of the kits

Thank you for your attention