You are on page 1of 37

Genetics - deals with problems of heredity and variation

on the molecular level


Inheritance -Transmission genetics and DNA REPLICATION We know how DNA replicates,
interactions between DNA and a host of proteins which open replication forks, unwind, replicate
and eventually twist and stabilize a daughter and parental strand into a molecule of DNA or a
chromosome. We know how chromosomes replicate, how they assort in meiosis and something
about how genes are organized in a chromosome - as a stand alone unit of inheritance,
variation and expression.
Variation MUTATION AND VARIATION - Molecular and Visible We know there are alleles
!!
and
that genes
could mutate. Single base substitutions may cause amino acid and transcript
length changes. Furthermore, chromosome pieces could be inserted, deleted, inverted,
duplicated, translocated and otherwise rearranged. Unless single base or chromosome
fragments are repaired, mutations are replicated in mitosis as cells divide and meiosis as germ
cells replicate. We also know how fragments can migrate throughout the genome, transposed by
several mechanisms: families of cut and paste transposons that move and sometimes take
fragments with them; retrotranspons and transposons that replicate themselves and other
contained fragments and then they delete or insert (indels). These are the mechanisms generating
genetic variation, some silent, nonfunctional or hidden, some with little difference from the wild
or standard phenotype or neutral, some variants associated with significant character changes, for
better or worse, they are tested in the laboratory of life.

Cutting and Inserting


recombinant DNA!

DNA Technology I: making fragment


libraries and identifying genes
Wwill look at how the following,!
familiar definitions and topics are applied:!

(1) endonucleases and chromosome cuts!


(2) extrachromosomal DNA e.g. plasmids that can carry foreign DNA!
(3) reverse transcriptase and cDNA!
(4) Southern blots and fragment sorting!
(5) complementary binding and probes!

(6) plasmids and bacterial chromosomes!

OBJECTIVES!
To:(a) store and replicate specific fragments of DNA,!
(b) identify specific genes, or,!
(c) express large amounts of protein.!

In 2010, a completely synthetic genome was inserted into a


Mycoplasma cell, a small prokaryote.

DNA technology is a term that describes the collective


techniques for: maintaining, manipulating and amplifying
different DNA fragments.(pp 342 Griffiths et al 10e).
In the mid 1970s the first methods for making recombinant DNA
molecules and transferring them to E. coli were developed.
Currently, genes from practically every organism can be cloned,
identified, characterized and expressed. DNA can be even be cloned
from long dead organisms (100,000 years !) if the DNA is still
preserved.
Modified genes can be reinserted into the genome of many species
the list of species for which this is possible is somewhat limited, but
growing.

Gene cloning refers to the insertion of foreign DNA into a


vector, a molecular container for a foreign fragment of DNA,
a chromosome that can be replicated or cloned in a host cell.
Sequence:
1) recombinant DNA- a foreign fragment of DNA (gene ?) is inserted
into a vector.
2) The vector transports the gene into a host cell (bacteria?).
3) Within a host the vector may replicate and express the gene.
4) If the host cell divides, recombinant DNA is inherited.
5) If it survives, a colony or clone of identical host cells is produced
each with one or more recombinant vector chromosomes, or a
recombinant clone .

(1)Cutting a
chromosome or a
genome into small
pieces.!
(2) Inserting the
chromosome
fragment(s) into
vectors. !
(3)Getting the vectors
with fragments into
bacteria hosts and in a
library for storage and
reference.!
(4) Identifying,
Indexing and selecting
from a library.

Forward analysis in
molecular genetics
(phenotype to genotype)

cutting
inserting
transformation
Marker
selection

Foreign DNA for fragmentation and cloning may be


obtained from:
Genomic DNA from the organism of interest, for
example, a Drosophila strain.
Complementary DNA - a double stranded,
complementary version of an mRNA molecule. It is
generated by reverse-transcribing DNA from an mRNA
template (using reverse-transcriptase).
Synthetic, or chemically- constructed DNA(Oligonucleotides)

Cutting DNA in manageable pieces

Endonucleases break internal phosphodiester bonds within DNA


strands, many of them make random cuts. !
!
The most useful restriction enzymes are (restriction)
endonucleases which are site specific. Type II restriction
endonucleases cut DNA in a precise way, only at specific
nucleotide sequences called restriction or cut sites.!
!
Restriction enzyme is name that refers to their function,!
bacteria have these enzymes to restrict infection by!
foreign DNA by cutting and digesting it. !
!
Bacteria protect their own DNA by methylation, recognized by its
own restriction enzymes!

Restriction Enzyme Nomenclature:first letter of the genus


(Escherichia), two letters of the species (coli), specific strain first
8
letter (Ry13) rank order of discovery (1) = EcoR1

Restriction sites often have specific cutting sequences with


twofold rotational symmetry. While this is not an actual
palindrome which has symmetry within a line, it is called a
DNA palindrome

5GAATTC 3
3CTTAAG 5

5GAATTC 3
3CTTAAG 5

5GAATTC 3
3CTTAAG 5

PREVIOUSLY ENCOUNTERED 2-FOLD


ROTATIONAL SYMMETRY
Operator site 2 fold
rotational symmetry!

Inverted terminal repeat


sequences identify family
in cut and paste
transposons

10

The EcoRI enzyme will cut the recognition sequence


anywhere it encounters it in DNA.

11

5 GATTAGCCGGAATTCTATACCGAC 3
3 CTAATCGGCCTTAAGATATGGCTG 5
5 GATTAGCCGG
5AATTCTATACCGAC 3
3 CTAATCGGCCTTAA5
GATATGGCTG 5
The short regions of single stranded DNA from cut
DNA are complementary, they overlap and they have the same
linkage site (3, 5). The overlapping ends are called sticky
ends.
They can re-anneal to complementary sequences to form doublestranded DNA (with DNA ligase).

(1) Eco RI digestion leaves 5 single stranded overhang. !


!
5CTGCTAACG 3
!
AATTCCATCGTACT!
3GACGATTGCTTAA 5
!
GGTAGCATGA!

12

(2) Pst I leaves 3' overhang - sticky ends joined by DNA ligase.!
5------------------------CTGCA
G------------------!
3------------------------G
ACGTC------------------!
(3) Sma I leaves blunt ends joined by a viral T4 DNA ligase.!
-------CCC 3
GGG------!
-------GGG
3CCC------!
To make a blunt end cut more useful !
Add linkers (small DNA fragment with a restriction sequence) with T4 DNA
ligase so the foreign DNA can be cut by a staggered endonuclease of your
choice. CCCTGCA ..
GGG!
GGG
ACGTCCC!
!
Thus a restriction site can be cut at or near almost any location and specific
restriction target sequences engineered into a vector!

Digestion of DNA - Predicting Fragment Sizes

13

Recognition sequences can be 4, 5, 6, and 8 base pair!


long 6 base sites are those most often used.
The expected frequency of a specific restriction site in !
any genomic DNA or cDNA is !
(1/4)n !
where n is the number of bases in the recognition sequence,
that is, the number of cuts declines or fragments are larger on
average with a longer base cutter.!

Expected frequency of restriction sites in any long


piece of DNA:
Hae I

GGCC

Tfi I

GAATC

(1/4) 5 = 1/1024 bases

Not I

GCGGCCGC

(1/4) 8 1/66,000

Bam HI GGATCC

14

x x x = 1/256 bases

(1/4) 6 = 1/4096

The AVERAGE observed size of DNA digested by Bam


HI is about 4000 bp.

What would be the average expected number of


bases DNA digested by Hind I which recognizes
the sequence:
GT (A or G) (T or C) AC ?

1/4 x 1/4 x 1/2 x 1/2 x 1/4 x 1/4 = 1/1024


Assuming :(1) equal frequency of bases (GC = 50%),
and (2) a random sequence of bases

15

16

How do you measure the fragment size ?


DNA is digested with restriction enzymes.
The size of a fragment affects its migration rate on a
polyacrylamide gel.

17
The size of DNA is readily measured by electrophoresis.
Put size markers in one well, cut genomic DNA with one or more
restriction enzymes, load it into the other wells and put it into an
electric field. Chromosome fragments move because they are
charged and carried with the polar buffer as it flows.

Visualize (1) Radioactive label, (2) stain with EtBr, or


(3) use non mutagenic stains in the buffer of gel

18

Agarose gel from


electrophoresis
of DNA fragments
stained with
Ethidium bromide a powerful
mutagen.

8
4
2

Use non-mutagenic
dyes that can be
included in the buffer
1
solution

Electrophoresis
of DNA in an
agarose gel

12
10
8

DNA fragments
migrate a distance
that is proportional
to the log of their molecular
weight (MW) in kilobases after
any fixed period of time.

4
2
1

D = (a-b) *(log M)
M = molecular mass,
D= distance,
a &b = electrophoresis constants

19

DNA Electrophoresis
Restriction site order
Undigested: 12 kb
Eco RI: 2, 10 kb
Bgl I : 4.5, 7.5 kb
Eco RI + Bgl I :
2.0, 2.5, 7.5 kb

Molecular
Weight
Standards
(in kilo bases)
12
10
8
4
2
1

20
un- Eco Bgl Eco+
cut R1
Bgl

10
7. 5
4. 5
2. 5
2. 0

(1)Eco RI gives
(2)Bgl I gives
(3) Bgl and Eco RI gives

21

2 and 10 kb DNA
4.5 and 7.5 kb DNA
2.0 , 2.5 kb and 7.5 kb.

The position of the sites are important which is in the middle?

or ?
4.5L 7.5 R

Bgl I
7.5L 4.5 R
10

2
Restriction Map

12
Eco RI

DNA of interest can be put into vectors, and cloned.


VECTORS are any DNA vehicle used for DNA replication
in an organism.
DNA vectors differ in the fragment size they can carry including:
Smaller fragments
plasmids (5-15kb) circular
lambda bacteriophage cloning vectors (12-30kb) linear packaged
cosmid hybrid phage & plasmid (35-52kb) linear packaged
Larger fragments - cloning vectors for eukaryotes
PACs or P1 artificial chromosome (80-100 kb) packaged, circular
BACs or bacterial (F) artificial chromosomes(150-300kb)circular
based on the F plasmid
YACs or yeast artificial chromosomes (300kb+) linear
22

Plasmids in general
Most animals do not have circular plasmids, yeast and
few plants have them. Rare among other eukaryotes!
!
Several of the following kinds of plasmids may be found
in one bacterial cell but they must be compatible- if not,
one will be lost from a cell.!
!
F plasmids!
R plasmids!
Col plasmids- kill other bacteria!
Degradative plasmids- degrade unusual chemicals or
protein!
Virulence Plasmids - confer pathogenecity!
23
Ti Plasmid!

24
Insert
Cut:
(1) foreign DNA (with
Eco R1)
(2) cut the plasmid (with
Eco R1)
Bind
Enhance complementary
binding, DNA
polymerization, add
DNA ligase
Create:
a plasmid with foreign
DNA (chimera) or
recombinant DNA

staggered cutting a
specific sequence
means they can be
precisely excised and
and precisely ligated
into a plasmid - with
the same restriction
site.

Once you have DNA in a vector, how do you


deliver the vector into Bacteria

25

A useful vector is 1: right size

A useful vector has (2) more than one insertion site


(3) Selection sites
(4) an origin of replication (ori)
and termination sequences

26

27
(1) the vector
contains multiple
insertion sites inside screening
or selection sites.
(2) cells containing
the vector can be
selected easilyidentified as
bacteria with a
recombinant
plasmid

28

Transformed bacterial
colonies in a medium
containing X gal. !
!
When intact,
galactosidase cleaves
Xgal and bacteria turn
blue!

How amplification works, or why you need a replication origin!

Figure 20-4!

29

Replicate
plasmids,
clone your
DNA if you
have a
replication
origin

30
A useful vector :

(1)A vector should be the right size to carry the DNA fragment

(2) there are (engineered) restriction sites in the vector and the
fragment that can be cut by different endonucleases (restriction
sites)

(3) The vector has to be easily inserted in a host cell

(4) there are engineered selectable phenotypic characters, characters
that can be used to identify and select plasmids that actually
incorporated foreign DNA, usually disrupting a marker gene (a
selection site).

(5) an origin of replication in the vector -so it can replicate

(6) Is it the right DNA ? You have a screening test for the gene of
interest.


31

You screen for transformed bacteria, by selecting for


bacteria with fragment insertion markers.
How do you screen the wide variety of fragments for a gene
or sequence of interest ?
(1) looking for an extrachromosomal foreign DNA
sequence that can restore a mutant (mutant rescue) to a
wild-type phenotype (functional complementation)!
!
!
!or !
(2) molecular probes using complementary DNA or RNA

DNA hybridization (and ID) by complementary binding.


Two single stranded pieces of DNA that are
32
complementary will spontaneously form a double helix
Even if the match is not perfect.
Probe DNA

32P

32P

32P

TGTCTTTCCACTTCTCTTGGCTTGCTTTTGGAGGACCAGGTTGAG
Target DNA
ACAGAAAGTTGAAGAGAACCCAACGAAAACCTCTTCTTCCAACTC

32P

32P

32P

TGTCTTTCACCTTCTCTTGGCTTGCTTTTGGAGGACCAGGTTGAG
||||||||| |||||||||| |||||||||||| || ||||||||
ACAGAAAGTTGAAGAGAACCCAACGAAAACCTCTTCTTCCAACTC

Getting a
sequence of
interest from
a phage
library by
finding the
clone of
interest by
using DNA or
RNA probes
that
hybridize
with specific
(target)
plaques or
colonies!

33

Lyse phage and


denature DNA
(NaOH)
or a
florescent
tag

34
Where do you get the DNA or RNA probes ?
(1) A homologous gene from a related organism.
(2) mRNA synthesized from a minimally degenerate
amino acid sequence of a known protein.
(3) mRNA collected from a tissue expressing a specific
protein.
(4) Complementary DNA (cDNA) isolated from a tissue
with a high level of a specific gene expression, made
with reverse transcriptase
(5) Another clone

A useful vector :

35

(1)A vector should be the right size to carry the DNA fragment

(2) there are (engineered) restriction sites in the vector and the
fragment that can be cut by different endonucleases (restriction
sites)

(3) an origin of replication in the vector -so it can replicate

(4) there are engineered selectable phenotypic characters, characters
that can be used to identify and select plasmids that actually
incorporated foreign DNA, usually disrupting a marker gene (a
selection site).

(5) The vector has to be easily inserted in a host cell

(6) You have a screening test for the gene of interest.

If the goal is not just cloning a fragment or identifying a gene, but


expressing a protein, a foreign gene is inserted into an expression
vector containing transcription & translation sequences ( bacterial
promoter, initiation and termination sequences regulator and
operator genes, ribosome binding site, etc. )


36