You are on page 1of 6

CASE REPORT

A Novel Sarcoma With Dual Differentiation
Clinicopathologic and Molecular Characterization of a Combined
Synovial Sarcoma and Extraskeletal Myxoid Chondrosarcoma
Maria E. Vergara-Lluri, MD,* Bradley A. Stohr, MD, PhD,w Balaram Puligandla, MD,z
Pauline Brenholz, MD,y and Andrew E. Horvai, MD, PhDw

Abstract: We report on an unusual case of a 43-year-old woman
who developed a malignant soft tissue tumor of the arm with
overlapping morphology between synovial sarcoma (SS) and extraskeletal myxoid chondrosarcoma (EMC). The tumor recurred
7 years after the initial diagnosis and continued to demonstrate
both SS and EMC histology. Immunophenotypically, the primary
and recurrent tumors were both positive, focally, for cytokeratin,
S-100, bcl-2, and epithelial membrane antigen. At the time of
recurrence, the primary and recurrent tumors were further characterized for genetic and molecular abnormalities. Intriguingly,
fluorescence in situ hybridization of the primary tumor revealed
rearrangements of both the SS18 and EWSR1 genes. Furthermore, reverse transcriptase-polymerase chain reaction studies of
both the primary tumor and the recurrence confirmed the presence
of both SS18-SSX2 and EWSR1-NR4A3 (exon 3) gene fusions,
characteristic of SS and EMC, respectively. This is the first reported case of a remarkable soft tissue sarcoma that exhibits overlapping morphologic features between SS and EMC and that also
harbors a combination of SS18-SSX2 and EWS-NR4A3 gene
fusions. This case supports the fact that specific, reproducible gene
fusions frequently direct, cooperatively or competitively, basic
histogenetic processes to produce tumor phenotypes.
Key Words: synovial sarcoma, extraskeletal myxoid chondrosarcoma, dual histotype, gene rearrangement
(Am J Surg Pathol 2012;36:1093–1098)

S

ynovial sarcoma (SS) and extraskeletal myxoid chondrosarcoma (EMC) are rare, malignant soft tissue
tumors of uncertain differentiation.11 SS is a highly

From the *Department of Pathology, University of California Los
Angeles, Los Angeles; wDepartment of Pathology, University of
California San Francisco, San Francisco; zKaiser Oakland Hospital,
Oakland, CA; and yIntegrated Genetics/Integrated Oncology, LabCorp Specialty Testing Group, New York.
Conflicts of Interest and Source of Funding: Supported by the UCSF
Department of Pathology. The authors have disclosed that they have
no significant relationships with, or financial interest in, any commercial companies pertaining to this article.
Correspondence: Andrew E. Horvai, MD, PhD, Department of Pathology, University of California San Francisco, 1600 Divisadero Street,
B220, San Francisco, CA 94115 (e-mail: Andrew.Horvai@ucsf.edu).
Copyright r 2012 by Lippincott Williams & Wilkins

Am J Surg Pathol 

Volume 36, Number 7, July 2012

aggressive spindle cell neoplasm occurring in adolescents
and young adults with, in some cases, morphologic or
immunophenotypic evidence of epithelial differentiation.
By contrast, EMC affects middle-aged and elderly individuals and is associated with prolonged survival. EMC
is composed of a mixture of round cells, often forming
chains or clusters amid a myxoid stroma.11 Not only are
these sarcomas morphologically and clinically distinct,
they can also be distinguished by unique, reproducible,
genetic abnormalities. SS is characterized in >95%
of cases by t(X;18)(p11;q11), resulting in an in-frame
fusion of the SS18 gene on chromosome 18 with the
SSX1, SSX2, or SSX4 gene on chromosome Xp11.28,30,31
A novel, albeit rare, translocation t(X;20) involving
an SS18 homolog on chromosome 20 resulting in an
SS18L1-SSX1 fusion gene has also been described.29 In
contrast, EMC most commonly demonstrates a (9;22),
(9;17), or (9;15) translocation, which account for 89% of
cases.24 Approximately 70% of these cases occur as a
balanced translocation in t(9;22)(q22;q12), which creates a
fusion pair between EWSR1 on 22q12 with NR4A3 (also
known as CHN, TEC, or NOR1) on 9q22.24 The remaining 20% of cases involve fusion gene NR4A3-RBP56 (also
known as TAF15), resulting from t(9;17)(q22;q11). A third
translocation containing NR4A3 and TCF12 has also been
described, involving t(9;15)(q22;q21).21
Herein, we report a unique case of a novel soft tissue
sarcoma that exhibits overlapping morphologic features
between SS and EMC and also harbors both SS18:SSX2
and EWS:NR4A3 gene fusions. Although each of these
genetic changes has been identified in isolation, to date,
no reported cases harbor both abnormalities in a single
tumor.

CASE REPORT
The patient is a 43-year-old woman who presented to a
referring institution in 2004 with a 5-year history of a left arm
mass. Her medical history was significant for a probable cystic
dysplastic kidney but no malignancies. A 7.55.54 cm soft
tissue mass was resected at the referring institution with a microscopically positive margin. On the basis of histologic and
immunophenotypic findings, a diagnosis of EMC was rendered.
The patient unfortunately lost her medical insurance, did not receive any adjuvant therapy after surgery, and was lost to follow-up.
www.ajsp.com |

1093

chromogranin. The RT-PCR products were analyzed on 3% agarose gels.25 mM of each primer.com  Volume 36. the immunophenotype of primary and recurrent tumors was identical: both were at least focally positive for cytokeratin cocktail (AE1/AE3+CAM5. All RTPCRs were performed using a 2-step RETROscript Kit (Ambion) according to the manufacturer’s directions. The mass measured 9. 1 mg of total RNA was reverse transcribed in 20 mL at 421C for 1 hour followed by inactivation of the reverse transcriptase at 921C for 10 minutes. requiring further molecular analysis to resolve this diagnostic conundrum. and MUC4 and diffusely for bcl-2 by immunohistochemistry (Figs.Vergara-Lluri et al Am J Surg Pathol She re-presented at our institution in 2011 for management of an apparent recurrent tumor at the same site. Wilmington. multiple chromocenters. Further reverse transcriptase-polymerase chain reaction (RT-PCR) and direct sequencing of primary and recurrent tumors revealed the presence of both an SS18-SSX2 gene fusion and an EWS-NR4A3 fusion (Figs. analysis of the fine needle aspiration material by fluorescence in situ hybridization (FISH) revealed the presence of an SS18 rearrangement. The spindled cell areas showed fascicular to whorled growth and blended subtly with myxoid areas containing rounder cells. Tumor necrosis was approximately 20%. glial fibrillary acidic protein. Two hundred cells were scored for each probe. Ipswich. The hematoxylin and eosin-stained sections of both tumors demonstrated a multinodular neoplasm with subtle transitions between spindled and round cell areas. TX) or RecoverAll Kit (Ambion) according to the manufacturer’s directions. Austin. and LSI SS18 1094 | www. IL). FISH was also positive for a rearrangement involving the EWSR1 gene at chromosome 22q12 in 70 of 200 cells (35%). mapped to 18q11. and myogenin were negative.16 The probes were LSI EWSR1 Dual Color Break Apart Rearrangement Probe. We considered a variety of possible diagnoses to explain the histologic and/or genetic findings. this possibility is excluded by the EWSR1NR4A3 and SS18-SSX2 fusions identified by RT-PCR.1. 1. and a scant to moderate amount of eosinophilic cytoplasm. In light of the discrepant initial diagnosis of EMC with an SS18 rearrangement in the tumor recurrence. Similarly. desmin. Morphologically. although some areas resembled EMC. Mitoses were readily appreciated. we considered the possibility of a sarcoma harboring a novel EWSR1-SS18 fusion gene. On the basis of the diagnosis of a high-grade sarcoma. Rarely. The neoplastic cells had round to oval nuclei. calponin. Briefly. She elected not to receive any additional therapy and was disease free 5 months after surgery. the histopathology of myoepithelioma can be indistinguishable from SS. Further diagnostic workup did not demonstrate any regional or distant metastasis. synaptophysin.5 cm. immunophenotypic. A soft tissue myoepithelioma (also known as soft tissue mixed tumor or parachordoma) was also considered because it can have morphologic and immunophenotypic overlap with both EMC and SS. Remarkably. Intron-spanning primers specific for the GAPDH gene were run in parallel to control for RNA quality. the primary and recurrent tumors were indistinguishable. 2C–E) METHODS FISH Slides of 4-mm thickness obtained from formalinfixed paraffin-embedded sections were hybridized with fluorescent probes using standard techniques.125 mM of each dNTP. DE). and 0. and molecular studies. However.13. Most notably.ajsp. mapped to 22q12. respectively. 1H–L).7 The vast majority of myoepitheliomas display immunopositivity for cytokeratin and S-100. First. B). the current case represents the first report of a malignant soft tissue tumor harboring mixed morphologic and genetic phenotypes of SS and EMC. Lymphovascular space invasion was identified in the primary tumor. Immunohistochemistry results for CD99. which was protuberant and firm and located along the posterior arm/triceps muscle. RT-PCR RNA was prepared from paraffin or frozen tissue using an RNAqueous-4PCR Kit (Ambion. A parallel reaction was carried out without addition of the reverse transcriptase (no-RT). Intriguingly.2. Each PCR reaction contained 1 to 2 mL of template RNA solution.6 7. and thus a diagnosis of SS was made. CA) PCR Cleanup kit according to the manufacturer’s directions and analyzed by direct automated sequencing using the PCR primers. The RNA was eluted into 30 mL of elution solution and quantified using a NanoDrop spectrophotometer (NanoDrop Products. with up to 12 mitotic figures per 10 highpower fields. others were morphologically compatible with monophasic SS or morphologically transitional between the two (Figs. epithelial membrane antigen (EMA). MA). On the basis of the unexpected genetic findings. some with eccentric cytoplasm. 2 U Taq (New England Biolabs.23 All primers and conditions have been summarized in Table 1.6 6.5 mM MgCl2. B) with intraoperative and subsequent external beam radiation (27 fractions). 2A. the patient elected to receive induction chemotherapy with ifosfamide-epirubicin (3 cycles). 1A. 1C–G). recent studies have demonstrated EWSR1 gene fusions in soft r 2012 Lippincott Williams & Wilkins . smooth muscle actin. followed by resection (Figs.11 which can resemble EMC. DISCUSSION To our knowledge. The PCR conditions and primer pairs to detect specific EWS-NR4A3 and SS18-SSX fusion genes were exactly as reported previously. tissue from the primary resection specimen was studied for both SS18 and EWSR1 rearrangements (Figs. the original and recurrent tumors were evaluated by morphologic. The reactions yielding a band of the expected size were purified using the Qiagen (Valencia. irregular and lobulated nuclear contours.2). and EMC was favored in the differential diagnosis. The cytomorphology was consistent with a sarcoma. Its broad histologic spectrum can include a monomorphic neoplastic population embedded in a hyalinized to chondromyxoid matrix. given the initial FISH results. A fine needle aspiration biopsy was performed on the recurrent soft tissue mass. FISH analysis was positive for a rearrangement involving SS18 in 188 of 200 cells (94%). Number 7. which detected break-apart rearrangements of SS18 and EWSR1. Controls without template or with “no-RT” RNA from the previous step were run in parallel.18 further blurring the distinction from SS and EMC. vesicular to coarse chromatin. July 2012 Dual Color Break Apart Rearrangement Probe. S-100. both from Vysis (Abbott Park. Unexpectedly. 0.

Hematoxylin and eosin-stained sections (C–G) demonstrated a multinodular neoplasm (C.  400). r 2012 Lippincott Williams & Wilkins www. the tumor was relatively encapsulated. B). some areas resembled EMC (F. Morphologic and immunophenotypic features. E. S-100 (I). 200).com | 1095 .Am J Surg Pathol  Volume 36.ajsp.  200) or SS (G. Focally. 40) with subtle transitions between spindled and round cell areas (D. fleshy with cystic spaces containing myxoid material. Immunohistochemical stains ( 100) showed that the tumor was focally positive for cytokeratins (H). Grossly (A. July 2012 A Novel Sarcoma With Dual Differentiation FIGURE 1. Number 7. EMA (J). and diffusely positive for bcl-2 (L). MUC4 (K).

com EMC is a histologically distinctive neoplasm embedded within abundant myxoid stroma.12 However. some examples of EMC have shown ultrastructural and immunophenotypic evidence of neuroendocrine differentiation. SS18-SSX1. Lane M. lanes 19 to 21. no RT. lanes 1 to 3) corresponds to cDNA. Detection of fusion transcripts by RT-PCR in 3% agarose gel (C): each triplet of lanes (eg.Vergara-Lluri et al Am J Surg Pathol  Volume 36. the fusion partners described to date include PBX15 and POU5F1. and water templates. molecular weight markers (100 bp). A positive signal of the expected size is identified for EWS exon 12-NR4A3 exon 3 fusion and SS18-SSX2 fusion. lanes 7 to 9. Therefore.ajsp. The sequence-specific primers for each triplet are listed above the lane numbers. FISH using EWSR1 (A) and SS18 (B) break-apart probes demonstrating the presence of both rearrangements. respectively. with a characteristic multinodular growth pattern of cords and clusters of chondrocyte-like cells. lanes 13 to 15. EWS exon 11-NR4A3 exon 2. lanes 10 to 12. July 2012 FIGURE 2. lanes 22 to 24. Sequence chromatograms of RT-PCR products confirming the presence of EWS-NR4A3 fusion (D) and type 1 SS18-SSX2 fusion (E). Genetic and molecular features. Number 7.3 whereas the SS18-SSX and EWSR1-NR4A3 fusions have not been described in soft tissue myoepitheliomas. EWS exon 12-NR4A3 exon 3. SS18-SSX4.14 However. GAPDH controls. 1096 | www. lanes 1 to 6. SS18-SSX2. EWS exon 7-NR4A3 exon 2. lanes 16 to 18. tissue myoepithelial tumors. Interestingly. EMC can display a wide morphologic spectrum with more r 2012 Lippincott Williams & Wilkins . the genetic findings of the current tumor are not compatible with this diagnosis and instead support a distinct tumor with a combined genotype and phenotype.

the disordered structure of some EWS fusion proteins also allows interaction with a myriad of intracellular pathways.20 The biological implications of the combined SS18SSX2 and EWS-NR4A3 fusions in a single tumor are unclear but intriguing.17. Early publications suggested a common histogenesis between SS and EMC on the basis of ultrastructural evidence and morphologic overlap. 10 min 721C ATATTGGGCTTGGACGCAGGG 40 cycles(1 min 941C. cytogenetic. Mod Pathol.50:559–570. 45 s 561C. In EMC. hyalinization.15 The current paradigm.32. Katabi N. Bernardi Fdel C. Detection of SS18SSX fusion transcripts in formalin-fixed paraffin-embedded neoplasms: analysis of conventional RT-PCR. is that these are tumors of uncertain differentiation and their classification depends on their respective. however. possibly through cyclin D1-dependent mechanisms. including soft tissue. other translocations [t(9. EWSR1-ATF1 fusion is a novel and consistent finding in hyalinizing clear-cell carcinoma of salivary gland.9 An attractive hypothesis is that the C-terminal fusion partner determines the specificity of EWS transactivation and thus determines the phenotype and clinical behavior of the tumor. presence of EWSR1-NR4A3 or SS18-SSX fusions can confirm the diagnosis of EMC and SS. GGACGTCCGGCGAGGCGAAGC 50 s 721C). A molecular analysis of sixty-six cases. It remains to be determined whether genetic instability or other mechanisms might give rise to similar biphenotypic tumors. Nevertheless. we present here a highly unusual sarcoma with unique dual morphologic. Number 7. predicting the biological behavior of this unusual tumor on the basis of a single case is impossible. unraveling the diagnosis of SS in this tumor was the most important determinant of the management and treatment of this patient given current treatment protocols. Summary of Primers and PCR Conditions Transcript GAPDH1 GAPDH2 EWS12NR4A33 EWS7NR4A32 EWS11NR4A32 SYT SSX1 SYT SSX2 SYT SSX4 PCR Product (bp) 87 156 89 146 133 108 108 108 Forward Primer TGCAACAACAACTGCTTAGC CATGTTCGTCATGGGTGTGAACCA GCGATGCCACAGTGTCCTATG CTCCAAGTCAATATAAGCCAAC TCTGGCAGACTTCTTTAAGCA AGACCAACACAGCCTGGACCAC Reverse Primer ACACTCCCTTCGAATCATTTTCG GCACTTCCTCCGAATCATTTC GCACTTCCTTCAAACCATTTTCT cellular variants being difficult to distinguish from other small.22) is most common.11.27 That NR4A3 is conserved as the C-terminal partner in these fusions lends support to the hypothesis that this protein promotes the EMC phenotype. Antonescu CR. As the prevalence of comprehensive genetic testing of sarcomas increases. 2011. ATGGCATGGACTGTGGTCATGAGT 30 s 721C).22). additional tumors with dual genotypes may better elucidate how molecular signatures drive tumor morphology.20 Although the product of either fusion gene disrupts cell cycle regulation. reportedly useful for the diagnosis of EMC.4 SSs may contain less cellular areas with calcification.22) has not been previously described in a single tumor. et al. 90 s 721C). 2007. genetic features.26 r 2012 Lippincott Williams & Wilkins Conditions GGCATGGACTGTGGTCATGAG 40 cycles(30 s 951C. more in keeping with EMCs than SS. July 2012 A Novel Sarcoma With Dual Differentiation TABLE 1. 3.17) and t(9. round. Amary MF. showing www. can be focally positive in SS. it is an interesting observation that this tumor has demonstrated a relatively indolent clinical course. In difficult cases. 45 s 661C [decreasing 11C per cycle for 10 cycles].6.18) and t(9. Zhang L. and EWS fusions in other tumors seem to be initiating events in a variety of mesenchymal tumors. EMC can also exhibit complex secondary cytogenetic aberrations in addition to t(9. 45 s 551C. 10 min 721C 7 min 951C. For SS. and visceral lesions. EWS-ATF1) manifest in tumors with disparate morphologic and clinical pictures.33 the SS18-SSX1 protein seems to be more permissive to epithelial differentiation by allowing greater expression of e-cadherin.10 complicating the distinction between the two entities. However. 2. and.9 Further. prominent myxoid change. respectively.ajsp. blue cell tumors and at times resembling poorly differentiated and/or monophasic SS. Berisha F. the variable relationship between genotype and phenotype is likely affected by the genetic background of the host cell. Chang NE.8 However. Genes Chromosomes Cancer. and molecular signatures of SS and EMC. the connection between genotype and phenotype is best supported by the discovery that the biphasic subtype more commonly displays the SS18-SSX1 rather than the SS18-SSX2 fusion.com | 1097 . as well as regions of overlapping histomorphology. unique. Of course.22 Similarly. The S-100 immunostain.18) in multiple chromosomes.2. et al. long survival with late local recurrence is not entirely incompatible with the diagnosis of SS. The protein product of the EWS domain is a powerful transactivator. However. Zhang L.25 Thus.16. occasionally. 10 cycles(45 s 941C.15)] have been described. the combination of t(X. In conclusion. SSs are known to exhibit genetic instability and can show secondary complex or variant translocations in addition to t(X.19 raising the differential diagnosis of EMC. 5 min 721C The functional significance of the EWS-NR4A3 fusion and its role in promoting the EMC phenotype is less clear. REFERENCES 1. Antonescu CR. 20:482–496. et al. underscores the link between specific gene rearrangements and phenotype. EWSR1-POU5F1 fusion in soft tissue myoepithelial tumors. 90 s 721C).31 The observation that the current tumor displayed morphology characteristic of SS and EMC. 1 min 551C. qRT-PCR and dual color FISH as diagnostic tools for synovial sarcoma. some fusions (eg. bone. although t(9.Am J Surg Pathol  Volume 36. 30 cycles(45 s 941C.24. From a clinical perspective.

S-100 protein positive synovial sarcoma.2) and the cell cycle machinery.2. et al. Cancer. Xie Y. Synovial sarcoma: identification of low and high risk groups. SS18L1/SSX1. Uversky VN. Extraskeletal myxoid chondrosarcoma: a clinicopathologic. 17. Meis-Kindblom JM. 2001. Ladanyi M. 2002. Nagai M. 1098 | www. Hisaoka M. Complex tumor-specific t(X. Sun B. 28. Molecular genetic characterization of the EWS/ATF1 fusion gene in clear cell sarcoma of tendons and aponeuroses. Mertens F. Skytting B. 30. Genetics of chondrosarcoma and related tumors. EWSR1 gene rearrangement occurs in a subset of cutaneous myoepithelial tumors: a study of 18 cases. Panagopoulos I. Bertoni F. Goldblum JR. Toretsky JA.39:514–524. Wang J. et al. Most osteomalacia-associated mesenchymal tumors are a single histopathologic entity: an analysis of 32 cases and a comprehensive review of the literature. 12. Sjogren H. Mandahl N. et al. Schofield JB.19:375–377. 1999.37:195–200.439:141–151. Myxoid synovial sarcoma: an underappreciated morphologic subset. 2008.2. Cancer Sci. Genes Chromosomes Cancer.62:3861–3867. Shiu MH.com Am J Surg Pathol  Volume 36.ajsp. Cancer.22)(q12. Okamoto S. EWSR1-CREB1 and EWSR1ATF1 fusion genes in angiomatoid fibrous histiocytoma. 10.98:2700–2707.16:342–354. 2010. Erkizan HV.3:e242. 2002. in synovial sarcoma. Horvai AE. A novel fusion gene. Extraskeletal myxoid chondrosarcoma: a light microscopic. q11. 2002. 1999. Nilsson G. Gherlinzoni F. immunohistochemical. et al. Number 7. et al.12:456–462. Cancer. Cancer Res. 2005. 26. St Louis: Mosby.13:7322–7328. Unni KK. Codrington R. Histopathology. Hostein I. ultrastructural and immuno-ultrastructural study indicating neuroendocrine differentiation. Spagnolo DV. 21. r 2012 Lippincott Williams & Wilkins .22)(q23. Association of functionally different RUNX2 P2 promoter alleles with BMD. Saito T. Kilpatrick SE. et al. et al. 2006. 2004. Int J Cancer. Hum Pathol. Ishiguro M. Clin Cancer Res.47: 558–564. Detection of a t(1. Xie Y. Beta-catenin nuclear expression correlates with cyclin D1 expression in primary and metastatic synovial sarcoma: a tissue microarray study. Day CJ. Folpe AL. 15.32:1116–1124. 5. Bergh P. 2010. Pathology and Genetics of Tumours of Soft Tissue and Bone. Oncogenic partnerships: EWS-FLI1 protein interactions initiate key pathways of Ewing’s sarcoma. Forster A. 1999. Hajdu SI. Histopathology. Mertens F.39:1201–1217. et al. 11.137:23–28. 8. Rossi S. 29. 31. Cancer. Nilsson G. Sandberg AA. O’Donnell R. Coindre JM. Mod Pathol. 7. Am J Surg Pathol. Fletcher CD. 2002. SYT-SSX1 and SYT-SSX2 interfere with repression of E-cadherin by snail and slug: a potential mechanism for aberrant mesenchymal to epithelial transition in human synovial sarcoma. Arch Pathol Lab Med. et al. Krane JF. 62:135–140. et al. 18. Szuhai K.91:974–975. Skytting B.21:265–273. J Bone Miner Res. Lyon: IARC Press. 20. et al.q12). et al. Choong PF. 33. Iliszko M. Genes Chromosomes Cancer. Sun Y. 2001. et al. Stephens AS.77:1450–1458.24:1444–1450. A study of 95 cases. Antonescu CR. 189:118–121. 2006. Clin Cancer Res.Vergara-Lluri et al 4. Genes Chromosomes Cancer.2) translocation. Weiss SW. Iwasaki H. Oncogene. 27. Cancer Res. Goh YW. et al. Pelmus M. The clinicopathologic spectrum of myxoid and round cell liposarcoma. Mod Pathol. Nilsson G. 16. Storlazzi CT. 2008.q12) translocation leading to an EWSR1-PBX1 fusion gene in a myoepithelioma. Doyon J. Cancer Res. Mertens F. et al. July 2012 19. 32. Nishio J. 23. et al. Fletcher CDM. Doecke JD. The SYT-SSX1 fusion type of synovial sarcoma is associated with increased expression of cyclin A and D1.99:1355–1361. Kramer MJ. Pannell R. Billings SD. common involvement of the EWSR1 gene. et al. Virchows Arch. et al. et al.18)(p11. and molecular analysis of 18 cases. A link between t(X. 9. 14.49:1114–1124. in synovial sarcoma.28:1–30. Debiec-Rychter M. Wozniak A. 2003. 1977. 2008. Flucke U. 2009. Synovial sarcoma with a secondary chromosome change der(22)t(17. Impact of SYT-SSX fusion type on the clinical behavior of synovial sarcoma: a multiinstitutional retrospective study of 243 patients. Brandal P. 2002:427. immunohistochemical.130:792–798.16:4077–4083.21:5791–5796. The diagnostic value of SYT-SSX detected by reverse transcriptase-polymerase chain reaction (RTPCR) and fluorescence in situ hybridization (FISH) for synovial sarcoma: a review and prospective study of 255 cases. Tendosynovial sarcoma: a clinicopathological study of 136 cases. Rys J. Cancer Genet Cytogenet. 2001. Cancer Genet Cytogenet. 13. Ladanyi M.66:6919–6927. Brodin B. Cytogenetic and molecular genetic analyses of liposarcoma and its soft tissue simulators: recognition of new variants and differential diagnosis. Curr Opin Oncol. 2004. The Ews-ERG fusion protein can initiate neoplasia from lineage-committed haematopoietic cells. Blankenhorn N. 2003. Fortner JG. 6.18) in seven synovial sarcoma tumors. Palmedo G. Should molecular testing be required for diagnosing synovial sarcoma? A prospective study of 204 cases. 1996. SYT-SSX is critical for cyclin D1 expression in synovial sarcoma cells: a gain of function of the t(X. Enzinger and Weiss’s Soft Tissue Tumors. A novel fusion gene. Kindblom LG. 24. Platten M. 2011. et al. J Natl Cancer Inst. Bjerkehagen B. 25.q11.18)(p11. Ishida T. Fanburg-Smith JC. Fisher C. 2007.85:2596–2607. 2002. Ijszenga M. 1991. SYTSSX4. Panagopoulos I. 2006. et al. PLoS Biol. Leung DH. Skytting B. 22. Meis-Kindblom JM.99: 560–567.