You are on page 1of 14

LCT&I

Laboratorio de Cultivo de Tejidos
G Ingeniería Genética

&

Aislamiento del RNA total
De frijol común (Phaseolus vulgaris)
1. Recolectar tejido fresco en una hielera con hielo seco. Se recomienda usar guantes. La cantidad
de
muestra dependerá de realizar previamente un ensayo en el cual definas el total de la
muestra necesaria.
2. Moler las hojas en un mortero (eliminar nucleasas a 220ºC toda la noche) con Nitrógeno líquido.
Transferir de 50-100 mg de tejido en un tubo de polipropileno de 1.5 ml para centrifugación. El
tejido restante lo puedes almacenar en un tubo de polipropileno a -80ºC.
3. Agregue 1ml de Trizol ( Invitrogen No. Cat. 155596-026). Mezclar con vortex por 30’’
4. Incube durante 10 min. a TA
5. Centrifugue en una centrifuga de mesa durante 10 min. A 10,000 rpm ó 12,000 xg.
6. Trasfiera el sobrenadante ( RNA) a un tubo nuevo de 1.5 ml. Incubar a TA 5 min.
7. Agregue 200 μl de Cloroformo. Mezclar vigorosamente de forma manual por 15 ’’. Incube por 23 min. A TA.
8. Centrifuge durante 15 min. A 10,000 rpm o 12,000 xg.
9. Con una pipeta, traslada la capa acuosa superior a otros tubos de 1.5 ml nuevos.
10. Agregue 500μl de isopropanol (2-propano) frío ( almacenado en un congelador a -20ºC) . Mezcle
invirtiendo con suavidad los tubos. Incube la muestra a TA por 10 min.
11. Centrifugue 10 min. A 13,000 xg. Decantar el líquido.
12. Lave la pastilla con 500 μl de Etanol 75% ( Frío) ( almacenado en el congelador a -20 ºC). Mezcle
con vortex. Centrifuge 5 min. A 14,000 xg.
13. Decante el etanol y seque la pastilla colocando el tubo hacia debajo de 5-10 min. ( no secar en
exceso, ya que pierde solubilidad).
14. Agregue de 20-50 μl de ddH2ODEPC estéril, de acuerdo al tamaño de la pastilla.
15. Almacenar a -80ºC o si va hacer utilizado comúnmente almacenar a -20ºC
16. Si se requiere almacenado por más tiempo, agregue 5 υl de NaOAc 2.5 M y 150 υl de etanol
Absoluto. Almacenado a -20ºC.
…………………………………………………………………………………………
Soluciones
75% Etanol
Sol. Conc.
ETNOL ABSOLUTO
ddH2O dEPC – aforar-

100 ml
75 ml
100 ml

ddH2O DEPC
Sol. Conc.
ddH2O
DEPC

1 litro
999 ml
1 ml

200 ml
150 ml
200 ml

2 litros
1999 ml
1 ml

Nota: Mezclar esta solución y dejarla a TA toda la noche. Esterilizar y eliminar el DEPC a 115ºC por 10
min.
2.5 M NAOAc
Sol. Conc.

100 ml

NaOAc (P.M. 82.03)
ddH2o dEPC-aforar-

20.5 ml
100 ml

200 ml
41 g
200 ml

13

Disolver la pastilla en 50 μL de ddH 2O DEPC estéril. 9084-03) frío al 70 % (almacenado a -20 °C) y centrifugar 5 min a 14. 12091-021. 0596-01). Sacar del baño maría y esperar por 2 min hasta que se enfríe a temperatura ambiente. de esta manera la muestra se enfriará a temperatura ambiente. para precipitar el DNA.5 mL ) de muestra molida a un tubo eppendorf estéril de 1. 6. Agregar 500 μL de cloroformo-octanol 24:1 (Karal: No. 3.T Baker: No.5 mL. 5. Agregar al sobrenadante 600 μL de isopropanol (J.000 rpm. Sacar las muestras del baño maría y esperar por 2 min. Para aislar ADN de tejido fresco moler las hojas de frijol con nitrógeno líquido en un mortero hasta obtener un polvo fino.000 rpm. 8. decantar el isopropanol para dejar solamente la pastilla en el fondo del tubo (cuidado de no eliminar la pastilla de ADN). Agregar 10 μL de RNasa (20 mg/mL) (Invitrogen. incubar en baño maría a 65 °C durante 1hr.5 mL) aproximadamente.) mezclar manualmente (por inversión por 2 min) e incubar por 30 min a 37°C en baño maría. mezclar manualmente (por inversión) y almacenar a -20 °C por 30 min. 7. 10. Transferir la fase acuosa (sobrenadante) a un tubo nuevo estéril de 1.LCT&I Laboratorio de Cultivo de Tejidos G Ingeniería Genética & Aislamiento de DNA de tejido foliar de frijol común (Phaseolus vulgaris) con CTAB 2X (Basado en el método de Doyle & Doyle.5 mL de un tubo eppendorf de 1. Para el tejido liofilizado molido utilizar 100 mg (0. 2. Centrifugar por 14 min a 12. 11. Centrifugar por 8 min a 14. Agregar 700 μL de buffer CTAB 2X. una vez pulverizado el tejido se transfieren aproximadamente de 100 a 500 mg (0. No. 3052) (Sigma: No. Cat.T Baker: No. Si se mantiene caliente la muestra se corre el riesgo de inactivar la RNasa que se adiciona en el siguiente paso. Cat. según la frecuencia del uso para evitar su degradación. Cat.5 mL etiquetado utilizando una espátula. 1987) 1. Desechar el etanol y dejar secar la pastilla colocando el tubo boca abajo sobre una toalla absorbente por 20 min. Cat. Lavar la pastilla con 200 μL de etanol (J. 4. 9084-03) frio (almacenado a -20 °C) y 200 μL de CH 3COONH4 7M (J.000 rpm. El ADN puede ser almacenado a -20 o -80 °C. Cat.T Baker: No. Cat. 9. mezclar manualmente por 2 min (dando pequeños golpes con pluma o lápiz) (no vórtex).1 mL de un tubo eppendorf de 1. 13 . 112615) y homogenizar en vórtex.

4 M - 10 mL 0.171g 200 mL 24.228g 50 mL 2. se agrega el CTAB y se deja en estas condiciones hasta disolverse.5275g 100 mL 29.057g 100 mL 12.5 M EDTA pH 8 Reactivo EDTA 50 mL 10.T Baker:372201) ddH2O-aforarAjustar pH (Sigma: 258148) (Sigma: 258148) (Sigma: 258148) (Sigma: 258148) Nota: Esterilizar en autoclave.4 g 0.215g 200 mL 41.6 mL 11.4 mL 1 mL 2.8 mL 20 mL 0. hasta disolverlo 50 mL 100 mL 150 mL 200 mL 3 mL de HCl 6 mL de HCl 9 mL de HCl 12 mL de HCl (J.62g (Sigma: ED4SS) NaOH (perlas) En 30 mL ddH2O agregar el EDTA y mezclar Para disolver el EDTA agregar una a una las perlas de NaOH.405g 100 mL 20. 5 M NaCl Reactivo NaCl 50 mL 14.35 mL de HCl 200mL 9.0 NaCl 5 M ddH2O (aforar) CTAB (USB: 13353) & Final 20 mM 100 mM 1.45 mL de HCl 100 mL 4.6 mL 30 mL 1.81g 150 mL 31. SOLUCIONES STOCK 0.8 mL 2 mL 5. ddH2O DEPC Reactivo ddH20 DEPC 1000 mL 999mL 1 mL (Research Organics: 13 .6 g 50 mL 2 mL 5 mL 14 mL 29 mL 1g NOTA: Al final de la preparación del buffer se coloca en una plancha de calentamiento y agitación. 1 M TRIS pH 8 Reactivo TRIS base 50 mL 6.LCT&I Laboratorio de Cultivo de Tejidos G Ingeniería Genética BUFFER CTAB 2X Solución/Reactivo EDTA 0.8 mL de HCl (Sigma: 258148) (Sigma: 258148) (Sigma: 258148) (Sigma: 258148) (Sigma:93362) ddH2O-aforarAjustar pH Nota: Esterilizar en autoclave.2 mL 3 mL 8.8 mL 5.5 M TRIS 1M pH 8.11g 100 mL 150 mL 200 mL (Sigma: S7653) ddH2O-aforar50 mL Nota: Esterilizar en autoclave.9 mL de HCl 150 mL 7.5825g 200 mL 58.4 mL 17. observando una solución completamente clara.4 mL 2X (2%) 0.114g 150 mL 18.055g 150 mL 43.2 g 0.

13 .LCT&I Laboratorio de Cultivo de Tejidos G Ingeniería Genética & 2106D) Nota: Mezclar esta solución. Esterilizar y eliminar el DEPC a 115°C por 10 min. incubar a TA toda la noche.

8. Soliman. Cuando se ablande. 13 . Agite suavemente los tubos durante 5-10 min para mezclar. Con una pipeta.LCT&I Laboratorio de Cultivo de Tejidos G Ingeniería Genética & Aislamiento del DNA genómico de tejido foliar de maíz (Zea mays) (Basado en el método de Saghai-Maroof et al. 9. esto podría arruinar la preparación y dañar la centrifugadora. Agregue 4. Retire el DNA precipitado con un gancho de vidrio 2. Es mejor distribuir el tejido sobre las paredes laterales del tubo antes de agregar la solución amortiguadora. M. 2. Se obtienen de 50 a más de 100 µg de DNA/100 mg de tejido seco. 1984*) Ponga 300-400 mg de tejido liofilizado y molido en un tubo de polipropileno de 15 ml para centrifugación. Mezcle invirtiendo con suavidad los tubos e incube durante 30 min a TA. Ribosomal DNA spacerlength polymorphisms in barley: mendelian inheritance. 1. calentada (65°C). Jorgensen and R. 3.W. 10. Los ganchos usados se pueden limpiar lavándolos en dH2O y EtOH.0 ml de isopropanol (2-propanol). deje que la punta se doble para formar un gancho. agitando los tubos continuamente con suavidad. calentando el extremo en una llama durante unos segundos. K. 1 3000-3200 rpm en una centrifugadora Beckman GP o GPR con rotor oscilatorio (que puede contener 56 x tubos de 15 ml). con el fin de evitar que se apelmace el tejido seco en el fondo.5 ml de cloroformo/octanol y agite suavemente durante 5-10 min.. espere 4-5 min para que se enfríen los tubos y agregue 4.A. 6. R. Enfríe antes de usarlo. NOTA: a menos de 15°C.. Retire los tubos del horno. Allard. 1984. por lo general no es necesaria esta opción a menos que el DNA no se digiera adecuadamente. Incube durante 60-90 min en un horno a 65°C. 4.0 ml de solución amortiguadora CTAB para extracción. Mezcle invirtiendo con suavidad los tubos.5 ml de cloroformo/octanol (24:1). De hecho. el complejo de CTAB/ácido nucleico puede precipitarse.A. comience con 1 g de tejido liofilizado en un tubo de polipropileno de 50 ml para centrifugación y triplique todas las cantidades dadas anteriormente. traslade la capa acuosa superior a otros tubos de 15 ml que contengan 25-50 µl de 10 mg/ml de RNasa A (hervida previamente). Agregue 6. Centrifugue en una centrifugadora de mesa durante 10 minutos a 1300-1500 x g2 a TA. Agregue 9. 2 Prepare el gancho de vidrio sellando primero el extremo de una pipeta de vidrio de 23 cm para transferencia. Centrifugue en una centrifugadora de mesa durante 10 min a 1300-1500 x g 1 a TA. OPTION A: Extracción con fenol para obtener DNA de mayor pureza NOTAS: Se recomienda mucho esta opción para los análisis del DNA basados en la reacción en cadena de la polimerasa (PCR). B o C. es mejor realizar una extracción con fenol sólo después de la digestión * Saghai-Maroof. Vierta la capa acuosa superior en otros tubos de 15 ml. como los RAPDs. a los 300-400 mg de tejido liofilizado molido. chromosomal location . 5. Para los análisis de RFLPs. Caliente luego 1 cm de la punta mientras hace rotar la pipeta. and population dynamics. Mezcle invirtiendo el tubo varias veces con suavidad. PNAS 81:8014-8018. Continúe con las OPCIONES A. Si se requieren cantidades mayores. 7.

14.5 M EDTA-8.0 ml 50. 17.0 ml 390.5 ml 65.1 ml 0.0 ml 325.5-1.0 ml de TE. Solución amortiguadora con CTAB para extracción 1 SOL. 15.5 el volumen original de TE).0 ml 10. Transfiera la capa (acuosa) superior a otro tubo. Extraiga cada muestra con 1 ml (1 x el volumen original de TE) de fenol equilibrado. Transfiera la capa (acuosa) superior a un nuevo tubo. Tape los tubos y agite suavemente durante toda la noche a temperatura ambiente para disolver el DNA. Enjuague brevemente el DNA del gancho en 1-2 ml del LAVADO 2 y transfiéralo a un tubo de plástico de 5 ml que contenga 0. Continúe con el paso 14 de la OPCION B.050 mM 6. Extraiga el DNA con 1 ml (1 x el volumen original de TE) de cloroformo/octanol.4 1.0 ml 70. Deje el DNA en el gancho dentro del tubo durante unos 20 min. OPCION B: precipitación con etanol 13. CONC.0 ml 84.5 g 1.5 1. Coloque el gancho con DNA en un tubo de plástico de 5 ml que contenga 3-4 ml de LAVADO 1.5 ml 6. Continúe con el paso 16 de la Opción C.5 100 mM 5 M NaCl 700 mM 0. Tape el tubo y agítelo con suavidad a la temperatura ambiente hasta el día siguiente. 13 . haga girar con suavidad el gancho hasta que el DNA se deslice del gancho.0 ml 20.0 ml 2.0 ml 5. esto mejora la separación en bandas y la resolución de éstas después de la electroforesis del DNA (véanse más detalles en las secciones posteriores). haga girar con suavidad el gancho hasta que el DNA se deslice de él.5 g 6. [FINAL] 1 RXN 5 RXN 10 RXN 20 RXN 50 RXN 56 RXN 10 ml 50 ml 100 ml 200 ml 500 ml 600 ml dH2O 1 M Tris-7.0 ml ml ml ml 1 Use la solución recién preparada. Coloque el gancho con DNA en un tubo de plástico de 5 ml que contenga 1 ml de TE.0 ml 28. Centrifugue la muestra durante 10 minutos a 1300 x g 2 en un rotor de cubeta oscilatoria. Tape los tubos y agítelos suavemente a la temperatura ambiente hasta el día siguiente.0 1.0 ml 50. rote con suavidad el gancho hasta que el DNA se deslice del gancho. Centrifugue la muestra 10 minutos a 1300 x g2 en un rotor con cubeta oscilante.0 ml 1% 3 14 M BME 140 mM ml 32.1 g 0.0 ml 10. Retire el DNA precipitado con el gancho de vidrio.LCT&I Laboratorio de Cultivo de Tejidos G Ingeniería Genética & con enzimas de restricción.0 ml 5.0 g 0.0 CTAB2 0. 11.0 ml 60.0 ml 130. para disolver el DNA. 2 CTAB = bromuro mixto de alquiltrimetil-amonio (Sigma M-7635) 3 Agregue BME (ß-mercaptoetanol) justo antes del empleo. para disolver el DNA. Precipite el DNA agregando 50 µl de 5 M NaCl y luego 2. 10. Almacene las muestras a 4°C.0 ml 7. OPCION C: lavados del DNA 16.0 ml 60.0 g 2.0 g 4.0 ml 14.0 ml 20. 12. mezcle invirtiendo con suavidad el tubo. Coloque el gancho con DNA en un tubo de plástico de 5 ml que contenga 1 ml de TE.0 ml 4.5 ml de EtOH absoluto (2.5 ml 1. caliéntela a 60-65°C antes de agregar el CTAB y el BME. bajo una campana para emanaciones.

CONC. 10 mM NH4OAc SOL.5 M NaOAc dH2O 100 ml 200 ml 300 ml 400 ml 500 ml 76 ml 8 ml 16 ml 152 ml 16 ml 32 ml 228 ml 24 ml 48 ml 304 ml 32 ml 64 ml 380 ml 40 ml 80 ml LAVADO 2: 76% de EtOH. EtOH absoluto 2. CONC.LCT&I Laboratorio de Cultivo de Tejidos G Ingeniería Genética & LAVADO 1: 76% de EtOH. EtOH absoluto 1 M NH4OAc dH2O 100 ml 200 ml 300 ml 400 ml 500 ml 76 ml 1 ml 23 ml 152 ml 2 ml 46 ml 228 ml 3 ml 69 ml 304 ml 4 ml 92 ml 380 ml 5 ml 115 ml 13 .2 M NaOAc SOL. 0.

asegúrese de que el vacío siempre sea de ≤ 100 micrones y de que la temperatura del condensador sea de ≤ -60°C. 2. 5. Almacene a -20°C las muestras molidas. muela hasta obtener un polvo en un mortero con una pizca de arena lavada con ácido. Molienda 1. preferiblemente. elimínela. pero también se pueden emplear hojas algo más viejas que no estén en la senescencia. Las muestras deben secarse en 72 horas. Ponga las muestras de hojas en un recipiente de espuma de poliestireno o algún otro tipo de recipiente que pueda contener nitrógeno líquido. Coseche hojas de plantas cultivadas en el invernadero o el campo. Corte o doble las hojas en secciones de 10-15 cm y colóquelas en una bolsa de malla de fibra de vidrio junto con el rótulo que identifica la muestra (se pueden utilizar papel de aluminio o bolsas de papel si se perforan para permitir el flujo del aire). NOTA: Si el material vegetal pesara menos de 4 g (peso fresco). Las muestras se mantienen estables durante varios años. Las muestras de hojas secas se pueden conservar a temperatura ambiente por unos días en bolsas de plástico cerradas herméticamente o. mayor será la cantidad de DNA obtenida de una determinada cantidad de material. Coloque las bolsas en una hielera u otro recipiente con hielo para mantener frías las muestras (pero no las deje congelar). 13 . Si la nervadura central es gruesa y dura. 3. Cuanto más fino se muela. Asegúrese de que el liofilizador esté a una temperatura baja (la cámara debe estar a ≤ -60°C) y produce un vacío adecuado (≤ 10 micrones Hg) antes de cargar las muestras. Muela las hojas con un molino mecánico (Tecator Cyclotec Sample Mill. Model 1093) hasta obtener un polvo fino. Agregue nitrógeno líquido para congelar rápidamente las muestras. a -20°C para almacenarlas por varios años. 2. Llene una hoja de registro de la cosecha. NOTA: Las muestras de hojas pueden ser conservadas a -80°C hasta el momento de liofilizarlas. No permita que se descongelen las muestras hasta que estén liofilizadas. 6. Por lo general el peso de las hojas frescas equivale a ≈ 10 veces el peso en seco. No cargue excesivamente el liofilizador. 4. en frascos cerrados herméticamente. Es preferible usar hojas jóvenes sin áreas necróticas o lesiones. en un frasco de plástico para detección de centelleos o en cualquier otro recipiente apropiado de plástico que se pueda cerrar herméticamente. Transfiera las muestras de hojas congeladas al liofilizador.LCT&I Laboratorio de Cultivo de Tejidos G Ingeniería Genética & Liofilización 1.

5. Cuantifique la producción de inserto usando el ensayo de fluorescencia de puntos o el fluorómetro. Pase la capa acuosa superior a un tubo nuevo usando una pipeta. 1 mM EDTA. Mezcle brevemente y centrifugue. y coloque los tubos en la máquina de PCR.5 µl Iniciador 2 (2 µM) 3. Prepare una mezcla de reacción que contenga todos los componentes enumerados a continuación.3’ 5 Condiciones óptimas para el termociclador de sistema TwinBlockTM de ERICOMP. Agregue 5 µl de plásmido a cada tubo. SOL. Cubra cada muestra con 25 µl de aceite mineral ultrapuro.GCGCAACGTTGTTGCCAT . 7.0. 13 .4 0.1 µl Iniciador 1 (2 µM) 3.3’de pUC y M13CV765’ AAACAGCTATGACCATGATTACGCC .75 µl Mezcla dNTP (c/u a 10 mM) 50 µM c/u 0.5 µl (0. 8.2 µM 2.5-3.5 µl 3 Plásmido (1 ng/µl) 5 ng 5.0 µl Glicerol2 10-15 % 2.0 µl 2. Mezcle y centrifugue.125 c/u) 1 Enzima Taq (5 U/µl) 0.5 U 0.3’insertos en CV2365’ . 2 Se ha encontrado que este ingrediente optativo ayuda a amplificar insertos grandes o "difíciles". Retire el aceite agregando 25 µl de TE + 25 µl de cloroformo. excepto el plásmido.2 µM 2. [FINAL] RXN normal Ejemplo de mezcla de 25 µl de reacción p/ 40 RXNs ddH2O — adjustar a 25. Amplifique usando el siguiente programa 5 : 1 ciclo de: 25 ciclos de 1 ciclo de 94°C por 1 min 94°C por 1 min 72°C por 1 min 55°C por 2 min 72°C por 2 min* * Nota: puede ser necesario duplicar el tiempo de extensión para los insertos más largos de 1. variable 100 µl 40 µl 100-150 µl 20 µl 4 µl 100 µl 100 µl — Traslade con una pipeta la cantidad correspondiente de mezcla de reacción dentro de cada tubo. 3. 6. 9. 10 mM NaCl). CONC. 3 Diluido en "solución amortiguadora para dilución de DNA" (10 mM Tris. 4 Ejemplos de secuencias de iniciadores: vectores derivados CV725’ . Taq (10X.ACGACGTTGTAAAACGACGGCCAGT .4 0.5 µl MgCl2 (50 mM)1 2 mM 1.3’pBR322 PstICV2375’ . libre de Mg) 1X 2. 1 Puede ser necesario determinar las concentraciones óptimas de MgCl y Taq con cada lote 2 nuevo de enzima. pH 8.0 µl Amortig.5 Kb.0%. Asegúrese de que hay suficiente aceite en cada pozo de la máquina de PCR para que exista un contacto apropiado con el tubo. Verifique la amplificación cargando 5 µl de cada muestra (1 µl de DNA + 1 µl de 5X SGB + 3 µl de dH2O) en un gel al 1. 4.CGAGCGTGACACCACGAT .LCT&I Laboratorio de Cultivo de Tejidos G Ingeniería Genética & Amplificación de insertos de plásmidos con la PCR 1.

Cargue 100 ng (de una dilución de 10 ng/µl) de este marcador para verificar tanto la calidad como la cantidad de los DNA de las muestras. Incluya por lo menos una pista por peine de DNA Lambda ( ) no cortado como marcador del peso molecular. 4. Después de la cuantificación con UV. Cargue 100 ng de cada muestra diluida (10 µl de DNA + 2 µl de 5X SGB) en un gel de agarosa al 0. Para una resolución adecuada de los RFLPs.3 µg/µl con TE y almacene a 4°C.2 ó 0. 3. CONTROL DE LA CALIDAD DEL DNA 1. el cual efectúa la entrada automática de las muestras (con un dispositivo absorbedor) y calcula todos los valores apropiados para cada muestra.LCT&I Laboratorio de Cultivo de Tejidos G Ingeniería Genética & Cuantificación y control de calidad del DNA CUANTIFICACION DEL DNA CON UV Agregue 15 µl de cada muestra a 735 µl de TE. Una relación inferior a 1. verifíquelas a todas. Consulte en los Apéndices las instrucciones sobre cómo usar el espectrofotómetro DU-65 de Beckman y el listado del programa para la lectura automática de muestras. 2.8 indica que pueden existir proteínas y/u otros elementos absorbentes de UV en la muestra. En caso contrario. Vea en la sección sobre electroforesis en gel los detalles sobre la preparación del gel. es probable que la absorción sea causada por los ácidos nucleicos. Prepare una dilución de 10 ng/µl de las muestras seleccionadas (por ejemplo. ajuste la concentración de cada muestra de DNA a 0. No obstante. Corra el gel a 50 mA por unos 90 minutos. en este caso.3 µg/µl + 116 µl de TE). Si tiene pocas muestras de DNA (digamos. es inevitable la degradación de una parte del DNA aislado y el protocolo presentado a continuación está diseñado para correr el DNA en condiciones óptimas con el fin de asegurar las cantidades relativas de DNA degradado y de DNA de alto peso molecular. el DNA original debe emigrar como una banda apretada de peso molecular ≥ 40 kb.3 µg/µl o a una concentración que usted escoja.0 indica que las muestras pueden estar contaminadas con cloroformo o fenol y se debe volver a efectuar la precipitación con etanol (OPCION B). Si esa relación es de 1. mezcle bien y lea la DO 260 y la DO280 para determinar la pureza.0. las condiciones de corrida y la visualización del DNA. Una relación superior a 2. Este paso es esencial para verificar que el DNA aislado es de alto peso molecular. Diluya la muestra a 0. Concentration del DNA (µg/µl) = Es preciso determinar la relación DO260/DO280 con el fin de evaluar la pureza de la muestra.7%. 4 µl de DNA a 0. El procedimiento también permite verificar la cuantificación con UV señalada antes. En los Apéndices se incluye un programa para espectrofotómetro DU-65 de Beckman.8-2. verifique sólo el 10-20% de las muestras asegurándose de que la selección es totalmente aleatoria. 13 . menos de 25). es conveniente volver a precipitar el DNA. La muestra se mantendrá utilizable por hasta seis meses.

8. Incube a 37°C (o a la TA) durante 15 min. Disuelva el precipitado en 190 µl de dH 2O. Agregue 5 µl de 10 mg/ml de Proteinasa K. 15. 9. and J. 14.C. Resuspenda el precipitado de células revolviendo en un Vortex y agregue 200 µl de Solución I que contenga 5 mg/ml de lisozima (agregue la lisozima dentro de la hora anterior a la utilización). centrifugue 5 min a velocidad máxima en la microcentrifugadora. 13. vierta la capa sobrenadante y seque el tubo en el desecador de vacío. mezcle. Agregue 100 µl de 7.) * Birnboim. Centrifugue durante 2 min a velocidad máxima en la centrifugadora de mesa (1300-1500 x g). incube a -80°C durante 30 min. 12. Deseche la capa sobrenadante. Es más fácil volver a suspender las células si se las revuelve en el Vortex antes de agregar la mezcla de lisozima. CUANTIFICACION DEL DNA CON UV Agregue 5 µl de cada muestra a 745 µl de TE. 11. Lave el precipitado con 1 ml de 75% EtOH. Incube un cultivo bacteriano de 10 ml hasta el día siguiente. Disuelva el precipitado en 50 µl de TE-8. 16. centrifugue 5 min a velocidad máxima en la microcentrifugadora (~12. vierta la capa sobrenadante en un tubo de 1. Extraiga con 200 µl de fenol [o 200 µl de fenol/cloroformo (1:1)]. 5. Agregue 750 µl de EtOH absoluto y mezcle. 7. H.0. Transfiera la capa (superior) acuosa a otro tubo para microcentrifugadora. Incube a 37°C (o a la TA) durante 20 min. Agregue 300 µl de Solución III. lea la DO 260 y la DO280 para determinar la pureza.LCT&I Laboratorio de Cultivo de Tejidos G Ingeniería Genética & Minipreparaciones de plásmidos (basado en el método de Birnboim y Doly. Conserve a -20°C. Agregue 600 µl de isopropanol helado. Se podrá usar la muestra durante un período de hasta 6 meses. Agregue 5 µl de 1 mg/ml de RNAasa A y 5 µl de 500 U/ml de RNAasa T1. (Vea en los apéndices el programa del espectrofotómetro de Beckman. 6. Nucelic Acid Research 7:1513-1518. 10. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. 1979*) 1. Agregue 400 µl de Solución II.5 ml para microcentrifugadora.5 M NH4OAc. mezcle e incube 10 min sobre hielo (la solución debe estar clara). vierta la solución y seque el tubo. 13 . 3. Coseche las células centrifugando todo el cultivo en un tubo de 15 ml para centrifugadora durante 5 min a velocidad máxima en una centrifugadora de mesa (1300-1500 x g). 1979. Diluya la muestra con TE a 1 µg/µl. 2. Revuelva y deje a la temperatura ambiente durante 5 min. Centrifugue 15 min a velocidad máxima en la centrifufadora de mesa. centrifugue 3 min en la microcentrifugadora.000 rpm). Doly. mezcle e incube 15 min sobre hielo. 4.

Agregue suficiente ácido acético glacial para llevar el pH a 5.0 250 µl 500 µl 750 µl 1000 µl 1250 µl 0.5 M EDTA-8. dilúyala y agregue la lisozima.2 M NaOH.0 200 µl 400 µl 600 µl 800 µl 1000 µl Glucose 90 mg 180 mg 270 mg 360 mg 450 mg NOTA: La solución I se puede preparar como una solución concentrada 10X y conservarse distribuida en pequeñas partes iguales a -20°C.5 (aproximadamente 11 ml). Para el empleo. 50 mM glucose SOL.0 M Tris-8. pH 5. 10 mM EDTA.0. CONC.5 Disuelva 29. 13 . 100 ml 200 ml 300 ml 400 ml 500 ml 1.0% SDS SOL. 10 ml 20 ml 30 ml 40 ml 50 ml 1. 1.5 g de acetato de potasio en 60 ml de dH 2O. Complete el volumen hasta tener 100 ml. CONC. descongélela. Solución II: 0. para su uso posterior.LCT&I Laboratorio de Cultivo de Tejidos G Ingeniería Genética & Soluciones Solución I: 25 mM Tris-8.0 M NaOH 20% SDS 20 ml 5 ml 40 ml 10 ml 60 ml 15 ml 80 ml 20 ml 100 ml 25 ml Solución III: 3 M KOAc.

Coloque sobre el hielo durante al menos 1 h. Centrifugue las células durante 7 min a 3500 rpm a 4°C. Una vez que las células están nuevamente en suspensión. Transfiera las células a botellas de 250 ml para centrifugadora y enfríe sobre hielo durante 10 minutos. 7. 6.LCT&I Laboratorio de Cultivo de Tejidos G Ingeniería Genética & Preparación de células competentes congeladas NOTA: Se recomienda este protocolo para la producción de grandes cantidades de células competentes de eficiencia mediana para la subclonación rápida de insertos individuales. Centrifugue las células durante 7 min a 3500 rpm a 4°C. CONC. 1. 3. 20 % Glicerol SOL. Diluya el cultivo obtenido con caldo LB (sin antibiótico) en una proporción de 1:100 y agítelo a 37°C hasta que la DO600 llegue a 0. esterilizados. Congele rápidamente las células en hielo seco/baño de etanol (o en etanol a -80°C) y conserve a -80°C hasta el empleo. 10. CONC. agregue otros 120 ml de 10 mM MgCl2. 2.3-0. Elimine con cuidado la capa sobrenadante y vuelva a suspender el precipitado pipeteando con suavidad 5 ml de 10 mM MgCl 2 estéril y helado. 4. 20% de glicerol. estériles y helados. 8. 5. 20% de glicerol. agregue otros 5 ml de 50 mM CaCl2. 9.4. 100 ml 200 ml 300 ml 400 ml 500 ml 1. Cultive hasta el día siguiente la cepa deseada en 5 ml de caldo LB (sin antibiótico). Elimine con cuidado la capa sobrenadante y vuelva a suspender el precipitado pipeteando con suavidad 5 ml de 50 mM CaCl 2.0 M CaCl2 Glicerol ddH2O 5 ml 20 ml 75 ml 10 ml 40 ml 150 ml 15 ml 60 ml 225 ml 20 ml 80 ml 300 ml 25 ml 100 ml 375 ml 13 . 100 ml 200 ml 300 ml 400 ml 500 ml 1. Soluciones 10 mM MgCl2 SOL.0 M MgCl2 ddH2O 1 ml 99 ml 2 ml 198 ml 3 ml 297 ml 4 ml 396 ml 5 ml 495 ml 50 mM CaCl2. Una vez que las células están nuevamente en suspensión. Transfiera porciones iguales de 400 µl de células a tubos individuales de 500 µl para microcentrifugadora.

Agregue 80 µl de caldo LB (sin antibióticos). Cultive hasta el día siguiente a 37°C (o hasta que se vean con nitidez las colonias). 13 . 5. 7. Mezcle muy suavemente. Siembre en forma homogénea las células sobre una placa de LB + el antibiótico adecuado. 6. 8. 2. 9. Agite durante 2-4 h a 225 rpm a 37°C.LCT&I Laboratorio de Cultivo de Tejidos G Ingeniería Genética & Trasformaciones bacterianas 1. Provoque un choque térmico a 42°C durante 40 segundos en baño de María. Agregue 40 ng de DNA de plásmido a 20 µl de células competentes descongeladas. Coloque sobre hielo durante 30 min. 3. Coloque sobre hielo durante 10 min. 4.