You are on page 1of 6

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD

Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente


203022 Organismos Transgnicos

EVALUACIN INICIAL CURSO ORGANISMOS TRANSGNICOS


Estimado estudiante, en el presente documento encontrar una serie de
preguntas que pretenden evaluar el nivel de comprensin y conocimiento que
usted tiene sobre temas relacionados con la biologa molecular. Los temas
especficos son fundamentales para la comprensin de conceptos que usted
manejar en la unidad correspondiente al ADN recombinante y que son base
para la construccin de un Organismos Genticamente Modificado (OGM).
Individualmente deben responder a este cuestionario, pueden consultar libros
y documentos cientficos de Internet, las respuestas deben ser discutidas en el
foro.
Cada estudiante debe subir en este foro su documento con las respuestas a las
preguntas, cuando todos los documentos este completos ustedes iniciarn la
discusin para consolidar un solo documento que se anexar en el Entorno de
Evaluacin y Seguimiento (Momento uno) por la persona que ustedes han
seleccionado. Deben tener en cuenta la agenda pues no podemos dar inicio a
la segunda actividad sin que esta sea cumplida en las fechas dispuestas.

CUESTIONARIO

1.

Cul es la diferencia de composicin y estructura entre el ARN y el ADN,


entre la ribosa y la desoxirribosa

DIFERENCIAS EN LA ESTRUCTURA
ADN
Es doble cadena, lo que confiere una
mayor proteccin a la informacin
contenida en el
DIFERENCIAS EN COMPOSICION
En su composicin de azucar
Compuesto por desoxirribosa
Compuesto por Adenosina, Timina
guanina y citosina.

ARN
Es monocatenaria, aunque puede
presentarse en forma lineal como el
ARNm o en forma plegada cruciforme
como ARNt y ARNr
En su composicin de azcar
Compuesto por ribosa
Sustituye la Timina por Uracilo.

DIFERENCIAS EN LA ESTRUCTURA y COMPOSICION


RIBOSA
DESOXIRRIBOSA
Es un azcar de formula C5H10O5.
Es un azcar de formula C5H10O4.
Derivado de la ribosa por perdida de
un atomo de oxigeno.
DIFERENCIAS EN COMPOSICION
Es soluble en agua y tambin
Es bastante soluble en agua

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD


Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
203022 Organismos Transgnicos

ligeramente en alcohol.
Es uno de los componentes de los
nucletidos que constituyen el acido
ribonucleico (RNA) se encuentra
tambin en la vitamina B2 y el ATP
Es una azcar

2.

Forma parte de los nucletidos que


constituyen las cadenas del acido
desoxirribonucleico
Es una azcar derivada de la ribosa

El ARN es fcilmente hidrolizado por lcalis, en cuanto que el ADN no lo


es, por qu?

La hidrlisis qumica proporciona poca informacin pues el DNA es resistente a


los lcalis y el tratamiento con cidos causa frecuentemente una depurinacin
o sea la prdida de las bases purnicas
El ARN es hidrolizado fcilmente debido a la presencia del hidroxilo libre 2de la
ribosa, esto permite la formacin de fosfo diesteres los cuales hidrolizan dando
nucletidos 2y 3. El ADN no contiene un grupo hidroxilo en la posicin 2y es
por lo tanto relativamente estable al lcali diluido.
3.

Explique por qu los cidos nucleicos son denaturados cuando son


sometidos a altas temperaturas o pH extremos. Una molcula de ADN
denaturada por calor puede ser nuevamente renaturada? Cmo?

Temperaturas de 80 90C, as como valores de pH extremos, provocan la


desnaturalizacin del DNA que consiste en la ruptura de los puentes de
hidrgeno entre bases apareadas y la prdida de las interacciones hidrofbicas
entre las bases apiladas. Como resultado de este proceso la doble hlice de
DNA se desenrolla.
Cuando la temperatura o las condiciones de pH retornan a valores fisiolgicos,
los segmentos de DNA desapareados vuelven a enrollarse, es decir, sus bases
complementarias se aparean nuevamente y se obtiene la estructura de doble
hlice. Este proceso se denomina renaturalizacin del DNA.

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD


Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
203022 Organismos Transgnicos

4.

Considere la siguiente secuencia de un fragmento de ADN aislado de una


bacteria:
5'CTGATAAGGGATTTAAATTATGTGTCAATCACGAATGCTAATCGCTTAACACTT
C 3'
Asumiendo que esta secuencia corresponde a la secuencia de la hebra
codificadora, cul sera la secuencia de aminocidos del polipeptido
producido cuando un ARN mensajero (ARNm) transcrito de este gen sea
traducido?

5.

Considere el fragmento de ADN:

5AAGAATTGCGAATTCGACTTAAGGGCCGCGCCGAAGCTTTAAAGGTTATATTTCC-3
Cuantos fragmentos resultaran del corte con las siguientes enzimas de
restriccin, indique el nmero de pares (pb) de base de cada fragmento

6.

EcoRI: (G AATTC): 2
HaeIII: (GG CC): 2

NotI: (GC CCGG):

Con las tres enzimas juntas: 3

Considere la secuencia 5- 3 de ADN


1
5
1

ACGTAGCTAG TAAAGTCTGT CCTTGATAGA AGCTTCGACT


GACTAGTACT
GGACTATCAC CTTGAAGGAC CTGTGGACTT AGTCTGATCG
TGACCGTAAG

Este
fragmento de ADN fue colocado en una solucin con la endonucleasa de
restriccin HindIII que reconoce la secuencia 5-AAGCTT-3 e hidroliza el
ADN entre los dos residuos de cido adenlico. Con relacin a este
enunciado, responda: Cuantos pb presenta el fragmento de ADN y
cuantos fragmentos de ADN resultaran de la digestin con HindIII?
Pb fragmento ADN: Tiene 4: Timina, Adenina, Guanina, Citosina
Fragmentos ADN digestin Hindlll: 3 fragmentos
7.

Un cientfico analiz la secuencia de bases nitrogenadas del ADN de una


bacteria y verific que era formada por los codones AGA-CAA-AAA-CCGAAT. Verific tambin que la secuencia de aminocidos en el polipeptido
correspondiente era serina-valina-fenilalanina-glicina-leucina. Al analizar
el mismo segmento de ADN de otra bacteria de la misma colonia,

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD


Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
203022 Organismos Transgnicos

verific que la secuencia de bases era AGA-CAA-AAG-CCG-AAT, sin


embargo no verific cualquier alteracin en la composicin de
aminocidos de la cadena polipeptdica. Cmo usted explica el hecho de
bacterias de una misma colonia presenten, para el mismo segmento de
ADN, diferentes secuencias de bases y que esas bacterias presenten la
misma composicin de aminocidos en la cadena polipeptdica
correspondiente?
Esto se presenta debido a un error en el paramiento de bases durante la
transcripcin del DNA causando mutacin, que es un cambio, ya sea
espontneo o inducido, en la secuencia del ADN. Todos los organismos
experimentan un cierto nmero de mutaciones como resultado de sus procesos
celulares normales o de interacciones aleatorias con el ambiente. En este caso
se puede ver una mutacin puntual que es la sustitucin de una base por otra
en la secuencia de nucletidos del ADN. Un error en la replicacin del ADN.
AGA-CAA-AAA-CCG-AAT
AGA-CAA-AAG-CCG-AAT

8.

La profesora del curso Organismos Transgnicos


inform a sus
estudiantes que un cientfico espaol afirm haber encontrado protenas
en el huevo fsil de un dinosaurio que podran ayudarlo a reconstituir el
ADN de esos animales.
a) Haga un esquema demostrando cmo, a partir de una secuencia de
ADN se obtiene una protena.

b) A partir de una protena, es posible recorrer el camino inverso y llegar


a la secuencia de ADN que la gener, justifique.

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD


Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
203022 Organismos Transgnicos

Si se puede que a partir de una protena, se pueda recorrer el camino


inverso y llegar a la secuencia de ADN que la gener, mediante una
enzima que se llama transcriptasa inversa, es una enzima usada para
generar ADN complementaria a partir de una plantilla de ARN, un
proceso denominado transcripcin inversa, que es un proceso de la
biologa molecular que implica la generacin de una cadena de cido
desoxirribonucleico (ADN) de doble cadena a partir de un cido
ribonucleico (ARN) de cadena simple.
9.

Imagine que un determinado individuo, reciba un gen de otra especie,


este gen es responsable por la produccin de una protena compuesta
por los siguientes aminocidos: cistena - serina - arginina - alanina leucina - glutamina - valina - glutamina - treonina - lisina.
Como es de su conocimiento, el cdigo gentico universal y la sntesis
de esa protena depende da accin conjunta del ARN mensajero (ARNm),
del ARN de transferencia (ARNt) y del ARN ribosomal (ARNr). Indique si
las siguientes afirmaciones son verdaderas o falsas, sustente cada una
de las respuestas.

a) Esta protena no podra ser producida porque el receptor del gen no posee
los ARNr necesarios para la fase final de traduccin, encontrados solamente en
el donador del gen.
F- Los ribosomas son las organelas de la clula donde se sintetizan la
protenas. Los ribosomas estan formados por una subunidad pequea (30S) y
una subunidad grande (50S) el ARNr difiere en cada uno de ellos. La 30S tiene
un ARNr 16S y 21 proteinas diferentes. La 50S consiste en ARNr 23S y 5S y 34
protenas diferentes.

La subunidad pequea tiene el sitio para que se pegue el ARNm.


La subunidad grande tiene dos sitios para el RNAt.

b) La molcula de RNA, transcrita por ese gen tendra mnimo una serie de 10
codones con un total de 30 nucletidos, presentando bases pricas de adenina
e guanina e bases pirimdicas de citosina y uracilo.
V-En el cdigo gentico, cada aminocido est codificado por un codn o
varios codones. El codn es la unidad de informacin bsica en el proceso de
traduccin del ARNm. Cada uno de los codones codifica un aminocido y esta
correlacin es la base del cdigo gentico que permite la traduccin de la
secuencia de ARNm a la secuencia de aminocidos que compone la protena.
Cada codn porta la informacin para pasar la secuencia de nucletidos del
ARNm a la secuencia de aminocidos de la protena en el proceso de
traduccin

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD


Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
203022 Organismos Transgnicos

c) Esa molcula proteica no podra ser producida por el receptor del gen porque
los aminocidos necesarios para la traduccin slo son encontradas en el
organismo donante del gen.
d) La molcula proteica podra ser perfectamente montada en el organismo del
receptor del gen desde que fueran tambin transfundidos los anti-codones del
ARNt del donante.
V-La sntesis de protenas o traduccin tiene lugar en los ribosomas del
citoplasma. Los aminocidos son transportados por el ARN de transferencia,
especfico para cada uno de ellos, y son llevados hasta el ARN mensajero,
dnde se aparean el codn de ste y el anticodn del ARN de transferencia, por
complementariedad de bases, y de sta forma se sitan en la posicin que les
corresponde.