You are on page 1of 13

Ejercicios de Bioinformtica Flores Snchez Mnica Arisbet

2.-Ejercicio de MapViewer.
a) Seleccionar en la ventana de la izquierda el organismo y lo que se quiere buscar (usar
nombre del gen, o genes implicados en una funcin (cncer related genes, diabetes related
genes, hypertension related genes, obesity, Alzheimer, sex, inteligence, oncogenes y tumor
supresor genes, etc).
a) Seleccione dos tema cualesquiera y haga una tabla que contenga: Cuntos genes estn
relacionados a la obesidad /diabetes, y su localizacin cromosmica.
Pan troglodytes (chimpanzee) genome view
Enfermedad
Alzheimer (APP)

No. de genes
1498

No. de Cromosomas
11, 17 ,21 , X

http://www.ncbi.nlm.nih.gov/mapview/map_search.cgi?taxid=9598&query=APP
Canis lupus familiaris (dog) genome view
Enfermedad
No. de genes
Fibrosis Qustica (CFTR)
15 hits

No. de Cromosomas
14

COMENTARIO:
Este programa permite detectar los genes presentes en algn organismo seleccionado , la
estructura y organizacin que maneja hace que su manipulacin sea fcil y rpida , de
hecho da pie a que sigas buscando genes en ms especies.La nica desventaja que
encontr (quiz porque no busqu lo suficiente) fue el hecho de que debes conocer la
abreviatura del gen de inters y el nombre cientfico del organismo, infiero que esto no es
problema para las personas que continuamente consultan esta base de datos , no obstante
sugiero que exista un programa adicional que apoye en este tipo de inconveniente.
3. Ejercicio de Genomes. Uso de GENOME-NCBI
En la seccin de GENOMES del sitio NCBI seleccione la liga Browse genomes y haga una
tabla que contenga 3 genomas de cada uno de los siguientes organismos:
Nombre
Virus

bacterias

Protozoarios

Plantas

Mamferos (no
humanos)

Tamao
No. de
genoma
cromosomas
(Mb)
Abelson murine leukemia virus 0.005894
1
Acholeplasma phage L2
0.011965
1
Abalone herpesvirus
0.211518
1
Victoria/AUS/2009
Escherichia coli O157:H7 str.
5.59448
Sakai
Abiotrophia defectiva
2.04
-Chrysanthemum coronarium' 0.74
phytoplasma
Babesia bovis
8.17971
4
Cryptosporidium
9.50978
Leishmania mexicana
32.1087
34
Beta vulgaris
568.609
9
Fragaria vesca
214.373
14
Micromonas
21.1093
17
Bos taurus
2983.31
31
Chinchilla lanigera
2390.87
31
Mus musculus (house mouse)
2800.06
21

No. de genes
1
14
118
5,360
2,010
928
Chr 2- 785
6
Chr1-83
Chr 1- 1,755
LG7-- 3,110
Chr 1-- 754
334
CAMBIAR
11510

Ejercicios de Bioinformtica Flores Snchez Mnica Arisbet


Primates
Pan troglodytes (chimpanzee)
3309.58
Papio anubis (olive baboon)
2948.4
Pongo abelii
3441.24
Humano
Homo sapiens
9506.67
Homo sapiens
16.565 KB
neanderthalensis (Neandertal)
Homo sapiens ssp. Denisova
16.570 KB

25
21
24
25
-

Chr 1- 3,145
Chr1 -- 3,629
Chr 1-2,916
Chr1 -- 3,958
37

36

COMENTARIO:
Por medio de este programa se puede obtener de manera general datos como tamao de
genoma, cromosomas y nmero de genes de un organismo. Es importante mencionar que
la pgina se encuentra totalmente organizada de manera que se pueda hacer tanto una
bsqueda general utilizando todas las clasificaciones con las que cuenta la pgina. Para el
caso de del nmero de genomas no se aprecia en todos los organismos la cantidad total,
por lo que slo se seleccion un cromosoma y de ste se report el nmero de genes.
9.-GEN asignado: Se les mandar una lista de genes (uno para cada alumno) y
reportarn la siguiente informacin:
a) Nombre oficial del gen y alias
Nonmbre oficial : MBP ID Entrez Gene :4155 ID Ensembl : ENSG00000197971
Aliases
Myelin Basic Protein1

Myelin A1 Protein2

Myelin Membrane Encephalitogenic Protein2

Nombre corto: MBP


Nombres alternativos:Myelin A1 protein ,Myelin Membrane Encephalitogenic Protein
Nombre de genes: MBP Organismo: Homo sapiens (Humano)
b) Contexto genmico:
Localizacin del gen

18q23

En que cromosoma se encuentra

Cromosoma 18

De qu cadena se transcribe

Cadena -

Cules son sus genes vecinos: Algunos de los genes vecinos se encuentran en la siguiente
captura de pantalla esto se consiguio al entrar en GenCards --> Genomic Views y
seleccionar GeneLoc location for GC18M074690: view genomic region.
Se pueden apreciar algunos genes vecino , la mayora de ellos se encuentran en la cadena
negativa , entre ellos destaca GALRI exon structure el cual es receptor 1 de Galina.

Ejercicios de Bioinformtica Flores Snchez Mnica Arisbet

Otros genes vecinos tambin se pueden apreciar con Map viewer


c) Secuencia genmica y su ID (solo reporte el tamao, no muestre la secuencia, puede ser
muy grande!)
La secuencia genomica se encuentra en:
LOCUS NC_000018 154857 bp

DNA linear CON 13-AUG-2013

DEFINITION Homo sapiens chromosome 18, GRCh37.p13 Primary Assembly.


ACCESSION NC_000018
REGION: complement(74690783..74845639) GPC_000000042
GENE
gene 866..154851 /gene="MBP" /note="myelin basic protein;
GeneID:4155" /db_xref="HGNC:HGNC:6925" /db_xref="HPRD:01158"
/db_xref="MIM:159430"
Ensembl version ID : ENSG00000197971 .Este mapa del gen va de 74,690,783-74,845,639
en GRCh37.
La manera ms sencilla de buscar esta informacin fue en GeneCards en el apartado de
Genomic Views ; pero para confirmar se us el NCBI en concreto Entrez y despus
Ensembl.Las bases de datos empleadas presentan la misma informacin ,pero en lo
personal ENSEMBL tiene ms estructura, y GeneCards es el ms sencillo de entender.
MBP myelin basic protein [ Homo sapiens (human) ]
Gene ID: 4155, updated on 8-Feb-2015
http://www.ncbi.nlm.nih.gov/gene?cmd=Retrieve&dopt=full_report&list_uids=4155
d) Secuencia de cDNA y su ID (reporte el tamao y caractersticas importantes, no imprima
toda la secuencia!).
154876 bp DNA linear LOCUS NC_000018.10

Ejercicios de Bioinformtica Flores Snchez Mnica Arisbet


e) Procesamiento post-transcripcional. Tamao del mRNA, (cDNA ID) Nmero y tamao de
exones, explicar si existe ayuste alternativo (nmero de variantes). En caso de que lo hay,
reportar el nmero de variantes y su protena respectiva.
NOTA: En caso de ayuste alternativo solo muestre los datos de una variante!
MBP presenta seis isoformas , producidas por ayuste alternativo.
NCBI Reference Sequences (RefSeq)
mRNA ID : NM_001025081.1 Isoforma 1 : Golli-Mbp1, HOG7
Se analizaran el tamao de los exones a esta isoforma
En Gen Bank
LOCUS NM_001025081 2300 bp mRNA linear PRI 19-APR-2014
DEFINITION Homo sapiens myelin basic protein (MBP), transcript variant 1, mRNA.
ACCESSION NM_001025081
KEYWORDS RefSeq. SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
STS

63..708 /gene="MBP"

CDS

92..685 /gene="MBP"

Exon

269..346 /gene="MBP

77 pb

Exon

347..451 /gene="MBP"

104 pb

Exon

452..487 /gene="MBP"

35 pb

Exon

488..520 /gene="MBP

32 pb

Exon

521..640 /gene="MBP"

119 pb

Exon

641..2279 /gene="MBP"

1638 pb

STS

717..1596 /gene="MBP"

STS

750..1084 /gene="MBP"

STS

1833..2135
/gene="MBP"

STS

1877..2051
/gene="MBP"

STS

1882..2048
/gene="MBP"

STS

2031..2233
/gene="MBP"

STS

2031..2126
/gene="MBP"

STS

2132..2255
/gene="MBP"

Ejercicios de Bioinformtica Flores Snchez Mnica Arisbet


regulatory

2254..2259
/gene="MBP

regulatory

2262..2267
/gene="MBP"

polyA_site

2279 /gene="MBP"

La nica CDS , empieza en 92 y termina en 685 , por lo que el codn de inicio para la
traduccin se encuentra 92 pb despus del primer exn , y el codn de termino se
encuentra 1594 pb antes que termine el ltimo exn que es 2279 , en este sitio est la
cola de pol- que hace referencia a modificaciones transcripciones en el extremo 3que
refieren a un mRNA maduro.
OTRAS ISOFORMAS SON:
NM_001025100.1 Isoforma 2 ,Tambin conocido como: Golli-MBP2, HOG5
NM_001025090.1 Isoforma 3 , conocida como : MBP1, 21.5 kDa
NM_001025092.1 Isoforma 4 , conocida como : MBP2, 20.2 kDa
NM_001025101.1 Isoforma 5 , conocida como MBP3, 18.5 kDa
NM_002385.2 Isoforma 6 , MBP4, 17.2 kDa
f) Secuencia de la protena codificada por el gen asignado, con su ID. Caractersticas
generales de la protena (tamao en aa, PM, PI, etc).
Isoforma 1 , Protena : NP_001020252.1 : Golli-Mbp1, HOG7
NP_001020271.1 Isoforma 2, Tambin conocido como: Golli-MBP2, HOG5
NP_001020261.1 Isoforma 3 , conocida como : MBP1, 21.5 kDa
NP_001020263.1 Isoforma 4 , conocida como : MBP2, 20.2 kDa
NP_001020272.1 Isoforma 5 , conocida como MBP3, 18.5 kDa
NP_002376.1

Isoforma 6 , MBP4, 17.2 kDa

CARACTERISTICAS:
La mielina protena bsica MBP.
Tamao: 304 aminocidos; 33117 DaSubunit Homodmero.
Isoforma 3 existe como una etapa comienza abruptamente en 14-16 semanas de edad
fetos. Incluso isoformas ms pequeos parecen producirse durante la embriognesis;
Algunos de estos persistir en el adulto. Isoforma 4 expresin es ms evidente a los 16
semanas y su proporcin relativa disminuye posteriormente.

g) Analizar la secuencia de protena y reportar si existe procesamiento post-traduccional (al


analizar la secuencia indique si hay sitios de modificacin como por ejemplo; pptido seal,
sitio de fosforilacin, glucosilacin, etc).
Isoforma 1 , Protena : NP_001020252.1 : Golli-Mbp1, HOG7
Se evaluar esta isoforma de la protena MBP.

Ejercicios de Bioinformtica Flores Snchez Mnica Arisbet


LOCUS NP_001020252
197 aa linear

PRI 19-APR-2014

DEFINITION myelin basic protein isoform 1 [Homo sapiens]. ACCESSION NP_001020252


Protein 1..197 /product="myelin basic protein isoform 1" /note="Golli-MBP; myelin A1
protein; myelin membrane encephalitogenic protein"
Region 16..153 /region_name="Myelin_MBP"
CDS

1..197 /gene="MBP" /coded_by="NM_001025081.1:92..685"

ORIGIN
1 masqkrpsqr hgskylatas tmdharhgfl prhrdtgild sigrffggdr gapkrgsgkv
61 pwlkpgrspl psharsqpgl cnmykdshhp artahygslp qkshgrtqde npvvhffkni
121 vtprtpppsq gkgrglslsr fswgaegqrp gfgyggrasd yksahkgfkg vdaqgtlski
181 fklggrdsrs gspmarr
En el grfico se alcanzan a apreciar 15 sitios de fosforilacin y uno de metilacin.
METILACIN:
La metilacin post-translacional de las protenas ocurre en los Nitrgenos y en los Oxgenos,
el donador de grupos metilos activado es la S-adenosilmetionina (SAM). Las mutilaciones
ms comunes estn en la -amina de los residuos de lisina, metilaciones de nitrgeno
adicionales se encuentran en el anillo imidaslico de la histidina, en el grupo guanino de la
arginina y en los grupos R del glutamato y del asparato.
FOSFORILACIN:
La fosforilacin post-translacional es una de las modificaciones ms comunes de las
protenas que ocurre en las clulas animales. La extensa mayora de fosforilaciones ocurren
como un mecanismo para regular la actividad biolgica de una protena y por tanto son
transitorias. En otras palabras un fosfato (o ms de uno en muchos casos) es aadido y
luego es removido. En las clulas animales la serina, la treonina y la tirosina son los
aminocidos sujetos de fosforilacin. El grupo ms grande de cinazas son aquellas que
fosforilan las serinas o las treoninas y como tal se denominan serina/treonina cinazas. El
cociente de fosforilacin de los tres diferentes aminocidos es aproximadamente
1000/100/1 para serina/ treonina/tirosina.

Ejercicios de Bioinformtica Flores Snchez Mnica Arisbet

Modificaciones postraduccionales:
Varios ismeros de carga de MBP1 (el ms catinico, menos modificado, y la forma ms
abundante), C2, C3, C4, C5, C6,C7, C8 y C8-A-B (la forma menos catinico); se producen
como resultado de la PTM opcional, tales como fosforilacin,desamidacin de glutamina o
asparagina, arginina y citrullination metilacin. C8-A y C8-B contienen cada dos isoformas
de masas denominado C8-A (H), C8-A (L), C8-B (H) y C8-B (L), (H) de pie para una mayor y
(L) para la parte inferior molecular de peso. C3, C4 y C5 son fosforiladas.
La alanina N-terminal est acetilado (isoforma 3, isoforma 4, 5 y isoforma isoforma 6) 1
Arg-241 se encontr que era 6% monometilado y 60% simtricamente dimethylated1
h) Reportar al menos una STS que nos permita identificar el gen. Reporte el ID de la STS, su
localizacin, los primers y el tamao y secuencia del fragmento amplificado.
LOCUS NM_001025081 2300 bp mRNA linear PRI 19-APR-2014
DEFINITION Homo sapiens myelin basic protein (MBP), transcript variant 1, mRNA.
ACCESSION NM_001025081
KEYWORDS RefSeq. SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
En la isoforma 1 se encuentra un STS a 63 ...708 , con un tamao de 645pb
ID: STS probe UniSTS: 483755
Sequences
>Probe|31813198|PRIMERF Forward PCR primer (outermost) (20b)
GTGCAGCCACCTCCGAGAGC
>Probe|31813198|PRIMERR Reverse PCR primer (outermost) (20b)

Ejercicios de Bioinformtica Flores Snchez Mnica Arisbet


GGATTCCGGAACCAGGTGGG
En los nucletidos de transcrito que pertenecen a la STS seleccionada aparecen marcados
en la regin:

Las STSs son secuencias genmicas nicas son tiles localizar secuencias genmicas
(aproximadamente 500 pb) .Proporcionan informacin acerca de la localizacin de mapas
genticos y Homologa putativa a travs de otras entradas a travs de BLAST. Es decir que
son sitios de etiquetado, y que gracias a ellos podemos localizar un gen especfico.

i) Con la secuencia de aminocidos de la protena busque los homlogos reportados


(Homologene). Reporte resultados como un MSA o con la figura del rbol filogentico.

Ejercicios de Bioinformtica Flores Snchez Mnica Arisbet

La homologa entre dos secuencias es, usualmente, una indicacin de una relacin
evolutiva.
Este rbol filogentico , est basado en comparacin de secuencia de aa y bases , para ver
la identidad relacionada a la homologa. De acuerdo a la figura antes presentada, somos
ms parecidos al Gorilla con respecto a la protena MBP isoforma 1.Se pueden observar
varios nodos de especiacin , los cuales indican la especiacin o la formacin de nuevas
especies, se puede considerar como el proceso evolutivo por el que algunas poblaciones de
una especie se diferencian estableciendo barreras de flujo gentico consecuencia del
desarrollo de mecanismos de aislamiento reproductivo.

j) Identificar los tipos de motivos y dominios reportados en la protena, use CDART. Anexe
figura

Ejercicios de Bioinformtica Flores Snchez Mnica Arisbet

Un motivo es un elemento conservado en la secuencia de aminocidos, que habitualmente


se asocia con una funcin concreta. Los motivos se generan a partir de alineamientos
mltiples de regiones con elementos funcionales o estructurales conocidos, por lo que son
tiles para predecir la existencia de esos mismos elementos en otras protenas de funcin y
estructura desconocida.
Un dominio es un trmino ms genrico que designa una regin de una protena con
inters biolgico funcional o estructural. Tambin se llama dominio a una regin de la
estructura tridimensional de una protena con una funcin concreta, que incluye regiones
no necesariamente contiguas en la secuencia de aminocidos.

k) Reportar el interactoma o Reactoma: Indicar con que productos gnicos interacta su


protena.
MBP interacta con MAPK1. Esta interaccin se inspir en una interaccin demostrada entre
MBP de una especie no especificados, y el mono y MAPK1 ratn. NP_002376.1 NP_002728.1
PKC-alfa fosforila e interacta con MBP. Esta interaccin fue modelado en una interaccin
demostrada entre PKC-alfa y MBP, tanto a partir de especies no especificados. NP_002376.1
PKC-delta fosforila e interacta con MBP. Esta interaccin se inspir en una interaccin
demostrada entre PKC-delta y MBP, tanto de especies no especificadas. NP_002376.1
NP_002731.3
PKC-lambda fosforila e interacta con MBP. Esta interaccin se inspir en una interaccin
demostrada entre PKC-lambda y MBP, tanto de especies no especificadas. NP_002376.1
NP_002735.3
PKC-zeta fosforila e interacta con MBP. Esta interaccin se inspir en una interaccin
demostrada entre PKC-zeta y MBP, tanto de especies no especificadas. NP_002376.1
NP_005397.1

Ejercicios de Bioinformtica Flores Snchez Mnica Arisbet


ROCK1 (ROCK) interacta con y fosforila MBP. NP_002376.1 NP_004841.2 ROCK2
ROCK2 (ROCK) interacta con y fosforila MBP. NP_002376.
NS3 interacta con MBP. Esta interaccin se inspir en una interaccin demostrada entre
HCV NS3 y MBP de una especie no especificados.
l) Patrn de expresin. En qu tejidos se expresa principalmente? Solo mencione los
tejidos de mayor expresin
Isoformas de MBP se encuentran tanto en la central y el sistema nervioso
perifrico.Mientras que las isoformas Golli -MBP se expresan en el timo fetal , bazo y la
mdula espinal , as como en lneas celulares derivadas de la publicacin sistema inmune.
m) Relacionar alteraciones de la protena y la presencia de enfermedad. Use dbSNPs y
OMIM o MALA cards. En este punto, la informacin puede ser variada y en algunos casos
extensa. Solo reporte lo ms importante (mximo 10 renglones).
Esclerosis mltiple, tambin conocida como MS. Un gen importante asociado a la esclerosis
mltiple es IL17A ( 17A interleucina ) , y entre sus vas relacionadas son citoquinas y la
respuesta inflamatoria y de citoquinas. La ciclofosfamida y hidroxocobalamina
medicamentos y los compuestos, pptido de control y NDT . Tejidos afiliadas incluyen las
clulas T , el cerebro y la mdula espinal , y fenotipos ratn relacionados son sistema
hematopoytico y sistema inmunitario .
Genes relacionados con esclerosis mltiple:
Related Disease

Score

Top Affiliating Genes

relapsing-remitting multiple sclerosis

32.6

MBP, IFNB1

optic neuritis

32.0

MBP, IFNB1

neuromyelitis optica

32.0

IFNB1, MBP

n) Comentarios finales (mximo 10 renglones!).


La bsqueda de mi gen me permiti conocer y manipular una serie de bases de datos, as
como desarrollar la habilidad y criterios para discernir la informacin encontrada. De esta
manera puedo inferir que de las tres bases de datos empleadas: NCBI , Ensembl y
GeneCards , la de mejor organizacin (en lo personal) fue NCBI , ya que te mostraba los
nmero de referencia de nucletidos ,protena y daba lugar a que pudieses entrar a otras
pginas de la misma base de datos para buscar ms informacin o diagramas. Sin
embargo, la base de datos ms sencilla de utilizar fue GeneCards , ya que esta te
presentaba toda la informacin digerida del gen de inters , y organizada de manera
clara. Para finalizar Ensembl , fue la base de datos que ms diagramas mostraba y estos
iban desde trascritos hasta rboles filogenticos. En lo que respecta a mi gen: MBP , se
logr encontrar la mayora de la informacin solicitada , no obstante con este ejercicio me
di cuenta que algunos conceptos no me quedaron claros o quiz no supe depurar
correctamente la informacin que encontraba .

Ejercicios de Bioinformtica Flores Snchez Mnica Arisbet

REFERENCIAS:
http://www.ensembl.org/Multi/Search/Results?q=MBP;site=ensembl Consultado el
27/02/2015 a las 3:00pm
http://www.ensembl.org/Homo_sapiens/Gene/Compara_Tree?
g=ENSG00000197971;r=18:76978827-77133683 Consultado el 27/02/2015 a las 3:30 pm
http://www.malacards.org/card/multiple_sclerosis?search=MBP Consultado el 27/02/2015 a
las 5:05pm
http://www.ensembl.org/Homo_sapiens/Gene/Variation_Gene/Table?
collapse=none;db=core;g=ENSG00000197971;r=18:76978827-77133683 Consultado el
27/02/2015 a las 5:30 pm

http://www.genecards.org/cgi-bin/carddisp.pl?
gene=MBP&search=83152927692cdd03d2f5aabc1971646c#pathways_source Consultado
el 28/02/2015 a las 3:00pm
http://www.proteinatlas.org/ENSG00000197971-MBP/subcellular Consultado el 2/02/2015 a
las 5:30pm
http://www.ncbi.nlm.nih.gov/Structure/lexington/lexington.cgi Consultado el 28/02/2015 a
las 8:00pm
http://www.omim.org/search?index=entry&sort=score+desc
%2C+prefix_sort+desc&start=1&limit=10&search=MBP Consultado el 28/02/2015 a las
9:00pm
http://www.ensembl.org/Homo_sapiens/Gene/Splice?
collapse=none;db=core;g=ENSG00000197971;r=18:76978827-77133683 Consultado el
1/03/2015 a las 3:00pm
http://genecards.weizmann.ac.il/geneloc-bin/display_map.pl?
chr_nr=18&range_type=gc_id&gc_id=GC18M074690&contig= Consultado el 1/03/2015 a
las 3:10pm
http://www.ncbi.nlm.nih.gov/gene?cmd=Retrieve&dopt=full_report&list_uids=4155
Consultado el 1/03/2015 a las 3:30pm
http://www.ncbi.nlm.nih.gov/projects/mapview/map_search.cgi?taxid=9606&query=MBP
Consultado el 1/03/2015 a las 3:55 pm
http://www.genenames.org/cgi-bin/gene_symbol_report?hgnc_id=HGNC:6925 Consultado el
1/03/2015 a las 4:00pm
http://www.informatics.jax.org/homology/1788 Consultado el 1/03/2015 a las 4:10pm

Ejercicios de Bioinformtica Flores Snchez Mnica Arisbet


http://www.ncbi.nlm.nih.gov/protein/68509930?report=graph Consultado el 1/03/2015 a las
4:30pm