You are on page 1of 47

UNIVERSIDAD NACIONAL “SAN LUIS GONZAGA” DE ICA

DIRECCION GENERAL DE INVESTIGACIÓN

INFORME FINAL DE INVESTIGACION

TÍTULO:

“Diagnóstico Bacteriológico de Pasteurella
multocida Biotipo A, en Bovinos Benefeciados en el
Camal Municipal de Chincha”

PRESENTADO POR:

MSC. VIOLETA ENRÍQUEZ PÉREZ.
M.V. CARLOS DEL SOLAR MORALES.

CHINCHA
FEBRERO 2015.
1

ÍNDICE
Pag.
RESUMEN............................................................................................... 5
SUMMARY…………………………………………………………………… 6
I.

INTRODUCCIÓN……………………………………………………… 7
II.

MARCO TEÓRICO …………………………………………………… 8

2.1

Antecedentes. ………………………………………………….

8

2.2

Encuadre taxonómico/filogenético…………………………… 9

2.3

Características generales de P. multocida………………….. 10

2.4

Ecología. ………………………………………………………… 12

2.5

Identificación de especie. ……………………………………… 13
2.5.1 Métodos tradicionales………………………………….. 13
2.5.2 Métodos moleculares…………………………………… 14
2.5.3 Metódos de tipado fenotípico………………………… 15

2.5.3.2

2.5.3.1 Determinación de biovares…………………………

15

Determinación del tipo capsular…………………………………….

15

2.6 Patogenicidad…………………………………………………… 16
2.7 Factores de virulencia………………………………………….

16

2.8 Patologías en diferentes animales. ………………………….

17

2.8.1 Aves…………………………………………………….

17

2.8.2 Conejos………………………………………………..

18

2.8.3 Humanos………………………………………………

18

2.8.4 Ganado Porcino………………………………………

20

2.8.5 Ganado Bovino………………………………………

21

2.9 Términos básicos……………………………………………..…

23

2

III.

IV.

MATERIALES Y METÓDOS………………………………………

24

3.1 Ámbito de estudio……………………………………………..

24

3.2 Materiales y Equipos………………………………………….

24

3.3 Método estadístico…………………………………………….

25

3.3.1 Tipo, Nivel y Diseño de la Investigación……………

25

3.3.2 Tamaño de la muestra……………………………….

25

3.4 Hipótesis y Variables de estudio……………………………

26

3.4.1 Hipótesis………………………………………………

26

3.4.2 Variables………………………………………………

26

3.5 Técnicas de Recolección de Información…………………

27

3.5.1 Recolección…………………………………………….

27

3.5.1.1 En el Camal Municipal………………………

27

3.5.2 En el laboratorio……………………………………….

27

RESULTADOS Y DISCUSIÓN……………………………………

31

4.1 Total de muestras bovinas procesadas……………………..

31

4.2 Resultado de los cultivos en Agar Sangre al 5% en
Anaerobiosis……………………………………………………..…

31

4.3 Resultado de las Pruebas Bioquímicas (Hisopado nasal)…

33

4.4 Resultados del cultivo de Pulmón y Tonsilas en Agar
sangre…………………………………………………………………

35

4.5 Resultado de las Pruebas bioquímicas de las muestras de
Pulmón y

de Tonsilas…………………………………….…….

36

4.6 Resultado de la Prueba Molecular (PCR)para la detección
de P. multocida……………………………………………….……..

3

37

V.

CONCLUSIONES…………………………………………….………

39

VI.

RECOMENDACIONES………………………………………………

40

VII. FUENTES DE INFORMACIÓN……………………………………… 41

LISTA DE FIGURAS
Figura 1. Colonia de P. multocida en Agar sangre…………………….

10

Figura 2. Lesiones causadas por P. multocida…………………………

22

LISTA DE TABLAS
Tabla 1.sub especies de P. multocida………………………………….

12

Tabla 2. Cebadores de PCR específica de especie………………….

28

Tabla 3. Volúmenes empleados en la PCR………………………….

29

Tabla 4. Condiciones de PCR específica de especie……………….

29

LISTA DE CUADROS.
Cuadro 1. Perfil bioquímico de P. multocida………………………….

14

Cuadro 2. Cultivo directo en Agar sangre 5%.....................................

32

Cuadro 3. Pruebas bioquímicas de muestras sospechosas
De hisopado nasal…………………………………………………………

34

Cuadro 4. Cultivo de pulmón y tonsilas en Agar sangre……………..

35

Cuadro 5. Pruebas bioquímicas de muestras sospechosas
De pulmón y tonsilas……………………………………………………..

36

Cuadro 6. PCR múltiple de muestras de hisopado nasal,
Pulmón y tonsilas…………………………………………………………

4

38

. procedentes de las crianzas lecheras de la Provincia de Chincha. multocida. biotipo A. El 6. presentándose con mayor frecuencia en los de crianza extensiva porque están más expuestos a diversos factores. Según los reportes de diversos investigadores este problema existe a nivel mundial. mediante el cultivo en Agar sangre al 5% y en anaerobiosis. Esta investigación se realizó durante los meses de Marzo 2014 a Febrero 2015. se les aplicó una prueba molecular de PCR múltiple. Adicionalmente. Todas las muestras sospechosas.57 % (131/140) de los animales dieron reacción negativa en el cultivo con agar sangre. El 93. 2001). Neumonía.RESUMEN Las enfermedades respiratorias inmuno deprimen a los animales y en los bovinos de cualquier edad es el problema relevante. Para confirmar los resultados se cultivaron en agar sangre muestras de pulmón (n=10) y de tonsilas (n=5). obteniéndose 1 y 2 colonias sospechosas en los cultivos de pulmón y tonsilas respectivamente. multocida. multocida. en bovinos mayores de 8 meses de edad.a los 140 cultivos de hisopado nasal y las muestras de pulmón y tonsilas. en Bovinos Benefeciados en el Camal Municipal de Chincha. pero en Chincha aún no se ha realizado ningún estudio.473 % (9/140) de las muestran formaron colonias sospechosas de P. dando resultados negativos para la presencia de P. por lo que el presente estudio tuvo como principal objetivo realizar el diagnóstico Bacteriológico de Pasteurella multocida Biotipo A. Respiratoria 5 dando . para encontrar el gen KTM1 (Townsend et al. resultado negativo. se sometieron a una batería convencional bioquímica. Bovino. Se tomaron muestras de hisopado nasal en 140 hembras para la detección bacteriológica de P. tanto de hisopado nasal como de pulmón y tonsilas. Palabras clave: Pasteurella. habiéndose aislado en diversas localidades de nuestro país.

having been isolated in different localities of our country. at 140 nasal swab cultures and samples of lung and tonsils were applied molecular multiplex PCR test to find the KTM1 gene (Townsend et al. underwent a conventional battery biochemistry. giving negative results. but in Chincha has not been any studies. multocida.57 % (131/140) of the animals had negative reaction onblood agar culture he 6. . multocida. 2001) .473 % (9/140) of the samples formed suspect colonies of P. This research was conducted during the months of March 2014 to February 2015. Respiratory. Pneumonia. All suspicious samples. both nasal swabs and lung and tonsils. 6 .According to reports from various researchers this problem exists worldwide. Keywords:Pasteurella. Bovine Benefeciados in the Municipal slaughterhouse of Chincha. multocida . in cattle older than 8 months old. by culturing in 5% blood agar and in anaerobiosis. biotype A. Cattle. Nasal swab samples were taken in 140 females for germ detection of P. The 93. Additionally. giving negative for the presence of P. To confirm the results were cultured onblood agar lung samples (n = 10) and tonsil (n = 5) to give 1 and 2 suspect colonies in lung and tonsil cultures respectively. so this study’s mainobjective was to perform the Bacteriological Diagnosis ofPasteurella multocida biotype A. from dairy breeds of Chincha Province. occurring more frequently in extensive rearing because they are more exposed to various factors.SUMMARY Immuno depress respiratory diseases to animals and cattle of any age is the major problem.

La neumonía es la inflamación del parénquima pulmonar que se acompaña frecuentemente con la inflamación de los bronquiolos y a veces con pleuritis [9]. pues al bajar las defensas del aparato respiratorio pueden descender y colonizar los pulmones. Las neumonías son causadas por diferentes agentes bacterianos y virales. la falta de alimento y agua (no comen ni beben). En Chincha hay más explotaciones de tipo extensivo. En el Perú y por ende en Chincha. siendo la Pasteurella multocida el agente predominante. la fatiga. estando más expuestos a contraer enfermedades la explotación extensiva por obvias razones. INTRODUCCIÓN. 7 . MARCO TEÓRICO.1 Antecedentes. considerándosele como oportunistas. multocida afecta a varias especies de animales e inclusive al ser humano [22]. etc. Por lo general la productividad de ésta ganadería se ve afectada desde el nacimiento de las crías por la presencia de enfermedades infecciosas como las diarreas y las neumonías [1]. pues por lo general provienen de la serranía (SENASA-CHINCHA). La pasteurelosis neumónica bovina es una enfermedad infecciosa aguda que es producida por la Pasteurella multocida biotipo A.] Todos estos factores predisponentes se presentan en los bovinos que llegan al camal municipal de Chincha. Por ello esta investigación ha tenido como objetivo general determinar la presencia de Pasteurella multocida mediante hisopados nasales en bovinos que se benefician en el Camal Municipal de Chincha. la crianza de bovinos se realiza mediante dos sistemas: la intensiva y la extensiva. que se presenta en los animales estresados por diferentes causas. [9. La P. como son: el transporte a largas distancias. II. y como objetivo específico diagnosticar bacteriológicamente a la Pasteurella multocida biotipo A en bovinos. II.I. sufren los cambios de climas. La Pasteurella multocida suele formar parte de la flora normal de las vías respiratorias altas.

Más tarde se agruparon diferentes bacterias que presentaban características morfológicas y bioquímicas similares en P. séptica. Al año siguiente Hueppe lo renombró como Bacterium septicaemiahaemorrhagica. multocida usualmente pueden ocurrir a partir de mordeduras de perros y gatos provocando linfangitis. El nombre genérico de Pasteurella fue propuesto por Trevisan EN 1887. en pacientes inmunocomprometidos. 8 . septicemia hemorrágica en el ganado [4]. multocida fue asignado por Rosenbusch y Merchant en 1939 [81]. avicida. E. Algunos serotipos están relacionados con varios tipos de pasteurelosis. Pasteurella multocida es un patógeno oportunista de amplia distribución mundial tanto en veterinaria como para la salud humana [1. P. caballos y cerdos enfermos.15]. Pasteurella multocida es una especie que habita normalmente como saprofito en la región naso faríngea (tracto respiratorio superior) de los bovinos. denominándolo Bacterium bipolarmulticidum[41]. D.2]. B. tales como: cólera aviar en especies aviares [3].Louis Pasteur aisló en 1880 esta bacteria a partir de sangre de aves que padecían cólera aviar. bovicida. En 1885. calificando como septicemia hemorrágica a la enfermedad que producía esta bacteria en ganado bovino [36]. Lignieres propuso una clasificación de las pasteurelas en función del hospedador (P. pudiendo ser Micrococcus gallicidus el primero de ellos [14]. Kit aisló el microorganismo de sangre de ganado vacuno. caracterizándola morfológica y bioquímicamente [55] Este microorganismo ha tenido distintos nombres a lo largo del tiempo. El nombre definitivo de P.6 a 89% en bovinos de todas las edades pero de preferencia en terneros de 6 meses a 2 años de edad [15]. en conmemoración al trabajo de Louis Pasteur sobre dicho microorganismo. Las infecciones humanas por P. rinitis atrófica o neumonía en el cerdo [9]. P. boviseptica )[47]. F [46]. así como meningitis y endocarditis [13. de los cuales el biotipo A al exacerbarse puede ocasionar una morbilidad de 4. De ésta especie se conocen 5 biotipos capsulares: A.

Es un coco bacilo.[ 52]. la humedad.cict. [68. muchas corrientes de aire. identificaron. Bibersteinia. Aggregatibacter. Gallibacterium. II. Leotta y col. agar chocolate Mueller Hinton pero no en agar MacConkey. que se ha sometido a múltiples reclasificaciones y sobre la que. biotipificaron y caracterizaron 30 cepas de Pasteurella multocida. 69]. anaerobio facultativo. Lonepinella. y de olor característico (debido a la gran producción de indol). debido a factores pre disponentes que desencadenan la neumonía. a partir de pulmones neumónicos de bovinos. inmóvil. no esporógeno. Mannheimia. multocida.2 Encuadre taxonómico/filogenético. todavía. reportan que con frecuencia aíslan el biotipo A. Haemophilus. multocidaes una especie bacteriana encuadrada en el ordenPasteurellales. circulares. Gram negativo. Histophilus. etc.bacterio. La familia Pasteurellaceaees una familia muy heterogénea. como son: el estrés por el transporte. Phocoenobactery Volucribacter[63. grisáceo o blanquecino (Figura 1). 9 .Koneman y col. la falta de alimento y agua. generalmente de aspecto mucoso. 2006[45]en Argentina. 54].3 Características generales de P. II. capsulado. Avibacterium.fr/):Actinobacillus. se continúan cuestionando sus relaciones taxonómicas. Estudios realizados en México. Nicoletella. En agar sangre las colonias se observan pequeñas. Actualmente comprende 13 géneros según la “FormerlyList of Bacterialnameswith Standing in Nomenclature”(http://www. pleomórfico. recomendaron la metodología para aislar o identificar bacterias mediante pruebas bioquímicas específicas. que presenta una tinción bipolar típica y crece bien en agar sangre. P. convexas y de 1 a 3 mm de diámetro. 1992 [42]. familia Pasteurellaceaey género Pasteurella. Pasteurella.

[46]. cefalotina. tetraciclina y tiamulina. Allan y col. florfenicol. 2006. Son pocos resistentes a los agentes físicos y químicos y sobreviven muy poco tiempo en el medio ambiente [33]. multocida en placa de Agar sangre.Esta bacteria produce en su fase de crecimiento logarítmico una sustancia soluble que es 10 . B. identificando 5 biotipos: A. Towsend y col.Pueden aparecer sueltos o agrupados en parejas o cadenas cortas. D. lograron la tipificación capsular. F. Por ello es que puede aislarse de animales clínicamente sanos [52].[2] reportaron niveles de resistencia superiores al 80% para estreptomicina y tetraciclinas y Clavijo y col. Figura 1. Leotta y col. enrofloxacina. ceftiofur. reducen los nitratos a nitritos y son indol positivos [43]. particularmente en las amígdalas y las criptas amigdalinas [27]. Colonias de P. 2001[78]. 2002. Se les consideran como oportunistas pues al bajar las defensas del aparato respiratorio pueden descender y colonizar los pulmones. gentamicina. utilizando la técnica de PCR múltiple. [23] hallaron una resistencia de 50. 1989. Dan reacciones de oxidasa y catalasa positivas.8% a la estreptomicina. realizaron pruebas de sensibilidad y hallaron que este microorganismo es sensible a: ampicilina. E. Forma parte de la flora normal de las vías respiratorias superiores en animales sanos. estreptomicina.

perros y. siendo las subespecies gallicida y septicamucho menos habituales. gallicida Dulcitol ₊ Sorbitol ₊ ₊ La subespecie multocida es la más frecuente en todo tipo de hospedadores. multocida.5 a 5u. 26. Tienen membrana citoplasmática compuesta por fosfolípidos y algunos poseen cápsula. Son los organismos más abundantes del planeta y se les encuentra en todos los hábitats terrestres y acuáticos.En humanos esta subespecie se asocia frecuentemente a infecciones de heridas o mordiscos producidos por 11 . aves y gatos [75. Carecen de mitocondrias. 57].. 26. Ultra estructuralmente. en gatos [76. Poseen un nucleoide de ADN y en el citoplasma contienen plásmidos. multocida. 53]. multocida.tóxica para macrófagos y leucocitos de rumiantes. además de ganado bovino [7]. y más aún lo es en el caso del ganado porcino [80]. multocida Subespecie P. sobre todo. Para su crecimiento y desarrollo necesitan de un aporte energético y se reproducen por fisión binaria. Subsp. La subespecie septica es aislada normalmente en aves (especialmente en salvajes). la subespecie multocida es la más común en ganado porcino[8]. séptica P. que por lo general tienen un tamaño de 0. y perros [53]. sin núcleo definido. 21. multocida P.En ganado vacuno los datos de aislamiento de esta subespecie son escasos [5. Subsp.6]. poseen una pared celular compuesta de peptidoglicano y algunos tienen flagelos y pilis. Así. 59. aparato de Golgi y retículo endoplasmático[13]. Subsp.Subespecies de P. son microorganismos unicelulares procariotas. Tabla N° 1. 51. llamada leucotoxina (exotoxina) que es considerado como el principal factor de su virulencia. vacuolas y ribosomas.

Además. pollos. existenotras especies con un aspecto 12 . P. multocida ha sido aislada de muchas especies animales (vacas. fundamentalmente.1 Métodos tradicionales. Debido a la gran heterogenicidad que presenta P. a partir de animales aparentemente sanos y enfermos [75]. pero se inactiva tras la exposición directa al sol durante 10 minutos [54]. Este microorganismo no persiste mucho tiempo en el medio ambiente dependiendo su viabilidad de las condiciones de temperatura y humedad [70]. la subespecie gallicida es la menos común de las tres. cerdos. Puede permanecer viable en el agua de 7 a 25 días y en suelo durante más de 21 días.). etc.5 Identificación de especie. cabras. búfalos. especialmente acuáticas y salvajes[35]. por lo tanto. Además puede sobrevivir durante largos períodos en materia orgánica [12].4 Ecología.la utilización de pruebas bioquímicas no se considera un método preciso para laidentificación de esta especie bacteriana [26]. Los miembros del género Pasteurella se encuentran habitualmente como comensales de las mucosas del tracto digestivo y respiratorio superior de mamíferos y aves aparentemente sanos de todo el mundo. multocida. perros.perros o gatos. mientras que la subespecie multocida se asocia más frecuentemente a procesos respiratorios [17]. produciéndose la transmisión. II.5% en 15 min [74].5. y es típica de muestras procedentes de aves. pavos. Por último. patos. aerosoles o ruta fecal-oral [70]. El hábitat ideal de esta bacteria es el tracto respiratorio de aves y mamíferos. mediante contacto directo. II. gatos. y a que lascondiciones de cultivo pueden influir en la expresión de ciertos caracteresfenotípicos disminuyendo. gansos. la repetibilidad y fiabilidad de estosmétodos para la identificación [49].Se inactiva a 60°C en 1 min o en fenol al 0. II.

El método convencional de identificación de P.macroscópico o microscópico similar. multocida. Perfil Bioquímico de Pasteurella multocida. por ejemplo. Se describió.2. Cuadro 1. como por ejemplo Manheimmia haemolytica o Pasteurella pneumotropica [49]. como pueden ser las galerías multisustrato API 20NEy API20E (Biomerieux). ₊ ₊ _ ₊ _ _ _ ₊ _ ₊ ₊ Catalasa Oxidasa Mac Conkey Indol Gelatina Urea Motilidad ODC Fermentación Maltosa Fermentación Glucosa Fermentación Manitol 2. y que.5. pueden tener características bioquímicas muysimilares.afectando a los mismos animales. Métodos moleculares.Aun así. Se han descrito varias técnicas de reacción en cadena de la polimerasa (PCR) para identificar P. (Cuadro 3). multocida implica lautilización de una serie de pruebas bioquímicas[69] que pueden realizarse de manera tradicional o mediantealgún sistema comercial. es un sistema fundamental parauna identificación básica y para clasificar los aislados en los diferentes biovaresy subespecies. una PCR que detectaba el gen psl que codifica para una proteína similar a P6 de 13 .

No obstante. Más tarde se describieron nuevos métodos rápidos y sensibles para identificar el tipo capsular A mediante la prueba de la hialuronidasa estafilocócica [16]. la sub especie multocida comprende los biovares 1.4.3.14. 2.7. El antiguo sistema para determinar el tipo capsular estaba basado en lahemaglutinación pasiva de eritrocitos sensibilizados frente a los antígenos capsulares [11]. tiene definidos ciertos biovares. como son la prueba de la inmunización pasiva en ratones [69]y la prueba de coaglutinación [68]. Cada sub especie. (1997) [29. dulcitol. 2. por ejemplo. la más utilizada es la PCR descrita por Townsend en (2001)[79].2. 2. además de poseer una alta 14 . que detecta una secuencia de ADN única en P. y manitol.6. que incluyen una batería de 7 azúcares: glucosa.3 Metódos de tipado fenotípico. para el tipo capsular A [73]. causante de la septicemia hemorrágica [78]No obstante. y la sub especie galliúnicamente el biovar [29].12.1 Determinación de biovares.2 Determinación del tipo capsular. multocida y que ha demostrado una alta sensibilidad y especificidad.que es capaz de identificar todos los tipos capsulares en la misma reacción.y el tipo capsular D mediante la prueba de la acriflavina [16]. la sub especie septica los biovares 5.5. lactosa. si es posible. y 10.9. xilosa.Haemophilus influenzae[8]. La determinación de biovares se realiza mediante las pruebas bioquímicas descritas por Feagan et al. cada biovar. trehalosa.8]. Los tipos capsulares B y E han sido identificados también mediante diferentes métodos. Así. se ha diseñado una PCR múltiple [79].3.5.3. a su vez. (1995) y Blackall et al. Actualmente se utilizan técnicas moleculares para la diferenciación de los5 tipos capsulares. como. además de la prueba de la ODC y la producción de ureasa. sorbitol. Se han descrito técnicas de PCR simples y específicas para la detección de un determinado tipo capsular.5. Mediante el patrón bioquímico derivado de estas pruebas se clasifica.y el B.

y al morir. las endotoxinas son parte estructural de la pared del microorganismo. 2. patogenicidad yespecificidad de antígenos [16]. 15 . LEUCOTOXINAS: Es el principal factor de virulencia de la bacteria ya que ataca letalmente los leucocitos comprometiendo aún más los mecanismos de defensa pulmonar[44]. multocida tiene un papel primario en los procesos desepticemia hemorrágica en ganado bovino y búfalo [16].62].especificidad y sensibilidad. permitiendo de esta manera la sobrevivencia y su proliferación en el tracto respiratorio [44]. neumonía en cerdos [61. multocida produce numerosas enfermedades en un amplio rango deespecies animales. con unaenorme variación respecto al hospedador al que afecta. provocando.en conejos [25]. esta bacteriaes la responsable del cólera aviar [16]. aunque algunos autores sugieren que su papel es meramente secundario [68]. Como ya se indicóanteriormente. yen RAP en cerdos [9]. P. esta se libera provocando una serie de alteraciones en cadena que causando fiebre y serios trastornos circulatorios[44]. ENDOTOXINAS: Como todas las bacterias Gram. Se considera que P. afectando a mamíferos y aves (tanto domésticos comosalvajes) en todo el mundo.-negativas.7 Factores de virulencia: CÁPSULA: La cápsula protege a la bacteria de la fagocitosis y de la actividad bactericida mediada por el complemento. por ejemplo. multocida. En el caso de las aves.6 Patogenicidad. provocando en muchos casos importantes pérdidaseconómicas [83]. se trata de una especie bacteriana muy heterogénea. 2. En elcaso del desarrollo de afecciones respiratorias sí parece claro su papel comopatógeno oportunista. en bovinos y ovinos [5]. por lo que se considera la mejor opción para detectar los distintos tipos capsulares de P.

19.18.aunque de vez en cuando aparezcan brotes agudos [58]. su edad y línea genética. Se presenta generalmente como una enfermedad hiperaguda que cursa con bacteriemia generalizada.2. Desde entonces se han reseñado brotes en una granvariedad de especies aviares y en distintos lugares del mundo [31. parece ser que las . 53.que afecta a aves salvajes y domésticas y que tiene una importancia económicamundial [68. habiéndose demostrado que P. etc. estado sanitario (estrés. 2004.71.1 Aves.). multocida [68]. tráquea y cloaca de animales asintomáticos [24. con forma crónica y síntomas clínicos y lesiones relacionadas con infecciones localizadas (OIE. de alta morbilidad y mortalidad. OIE.8 Patologías en diferentes animales. aunque en la mayoría de los casosagudos de enfermedad están implicados aislados de tipo capsular A y serotipo 1 [82. Al parecer. 68. 32]. 2004). también. inmunosupresión). 7]. En aves P. EnEspaña esta enfermedad no supone un problema grave. pero. además de la cepa bacteriana y factores ambientales [20. 2.53] 16 Además.Estaenfermedad ha sido reconocida y asociada a las aves desde hace más de 200años [71]. las aves portadoras (domésticas y salvajes) juegan un papel fundamental en la transmisión y en el mantenimiento de esta enfermedad. La epidemiología de la enfermedad es bastante compleja.73].causando la muerte de miles de animales cuando se producen brotesimportantes [65.71]. factores de manejo (densidad animal. multocida produce cólera aviar. cambios bruscos de temperatura. multocida se encuentra en la mucosa de faringe. [71]. enfermedad muy frecuente. 57]. otras enfermedades concomitantes. ya que ha sidodesplazada por la implantación de medidas higiénico-sanitarias y terapéuticas.8.El cólera aviar es causado por diferentes tipos capsulares y somáticos deP. Se trata de la enfermedadinfecciosa más importante en aves acuáticas en Norte América [31]. dependiendo la gravedad de la misma de numerosos factores como la especie de ave hospedadora.

zapatos y equipo. pero también de 17 . en condiciones favorables.8.2 Conejos. En la mayoría de las ocasiones se aíslan cepas de tipo capsularA o D y. sin embargo. sobre todo.3 Humanos La pasteurelosis es considerada como una enfermedad zoonótica. La forma de transmisión más frecuente es mediante el contacto directo aveave. No se ha demostrado que la infección pueda transmitirse de un humano a otro. de gatos. sobre todo en poblaciones densas [10].8. ya que esta bacteria puede estar presente en muchos tejidos de las aves muertas [ 31. aunque el agente puede distribuirse.La pasteurelosisque se produce en estos animales es muy contagiosa. por medio de jaulas. pudiendo causar la muerte del animal [69]. a través del huevo [11]. aunquegeneralmente las consecuencias no son graves para el hombre [81].Cuando se presenta un brote.avesmigratorias pueden extender la enfermedad. el medioambiente. sacos de comida.Esta enfermedad parece que no se transmite. una importante vía de transmisión. ni que elagua y/o alimentos puedan ser fuentes de infección [ 81]. P. 2. produciendo abcesos y mastitis [27] y representando el patógeno respiratorio más importante en aquellos animales empleados en laboratorio [69]. El canibalismo es también. multocida afecta también a los conejos.Se pueden afectar todas las especies de aves. por ejemplo [67]. 71]. Lo másfrecuente es que las infecciones se produzcan a consecuencia de mordiscos y/oarañazos de perros y. 2. actúa como fuente de contaminación.al tracto respiratorio superior. 49]. aunque los pavos son especialmente susceptibles [66. a veces. Además. multocida sobrevive durante largos periodos de tiempo en sedimentos. transmitiendo la bacteria a las aves domésticas [18]. afectando principalmente. de tipo capsular F [39]. además. especialmente el agua. P. especialmente pantanosos [10].

[3].Estos procesos son causados por las subespecies multocida y septica. dando lugar. multocida pueda ser debida a la exposición al ganado porcino [64]. conejos. También se ha descrito la infección mediante el mero lamido demascotas en piel dañada o aparentemente intacta. veterinarios.) y. P. endocarditis. etc. celulitis. en general. multocida entre personasencontacto con cerdos con y sin PMT [61].8.especialmente. Es una enfermedad bacteriana que se caracteriza por bronconeumonía y evoluciona ocasionalmente. con 18 pericarditis y pleuritis. por lo que no es de extrañar que tras un mordisco/arañazo de estos animales se produzca la infección de la herida y. En último caso se pueden producir septicemias graves. 53]. incluso. etc. [81]. Por lo tanto. ancianos. normalmente en pacientes que presentan disfunción hepática y. se ha sugerido que la colonización y/o infección del tracto respiratorio en el hombre por P. las personasen contacto con estos animales (operarios.otros animalescomo ratas. 2. En pacientes con alteraciones respiratorias. 51. son las más susceptibles a padecer algún tipo de pasteurelosis. normalmente. afectando . osteomielitis. ganaderos. leones. las que tienen alguna enfermedad pulmonar o inmunosupresiónde algún tipo. la formación de abcesos que se pueden llegar a complicar. etc.4 Ganado Porcino. inhalación delagente o. dando lugar a Teno sinovitis. multocida actúa como patógeno oportunista y puede llegar a producir infecciones graves. a peritonitis. empiema y abcesos pulmonares [81]. ya que son las que se encuentran con mayor frecuencia en mucosas de perros y gatos [35. entre otros procesos. En pacientes inmunodeprimidos. panteras. Por otra parte. abcesos en cerebro y meningitis [81].siendo habitual encontrar portadores de P. el microorganismo coloniza el pulmón. sin contacto aparente con animales [81]. enfermos de SIDA…). Se ha estimado que el 66% de los perros y el 90% de los gatos son portadores de este microorganismo. artritis. inmunodeprimidos (recién nacidos. pudiendo producir neumonía.

Con el "objeto de tomar las medidas de protección que correspondan. se puede observar respiración bucal. también en los lóbulos diafragmáticos. pero persisten la tos y la fiebre [27].mortem: frecuentemente el cadáver está congestionado y existe presencia de espuma en la tráquea.8. parasuis o infecciones virales.41. sugieren una condición de neumonía.1 °C.5 Ganado Bovino. Frotis de la superficie de corte de los pulmones afectados o de sangre cardiaca en tinción Leishman. En la forma aguda: los cerdos muestran disnea y respiración abdominal dificultosa.61]. y creando severas pérdidas a nivel industrial[8. fuertes. disnea y cianosis sin compromiso entérico. El edema que se observa al corte del tejido pulmonar es evidente. Los signos clínicos más importantes son fiebre. muestran masas de cocobacilos con una coloración bipolar. Los hallazgos post . Las neumonías asociadas a P. se observa una pleuresía fibrinosa [79]. áreas atelectásicas son observadas en los lóbulos pulmonares anteriores y. Haemophilus pleuropneumoniae o H. en casos graves. cianosis de las extremidades y los ruidos pulmonares son. multocida son usualmente consideradas como secundarias a la neumonía enzoótica por Micoplasmas. Por lo general. tos. Salmonelosis y Disentería porcina.generalmente a cerdos mayores de un año. Se observa una neumonía exudativa. fiebre de 40 . siempre se deberá considerar a nivel de campo que la sospecha es de PPC" [27]. Erisipela. Por su similitud clínica a la Peste Porcina Clásica (PPC). Esta infección bacteriana puede ser subclínica o asociada con neumonía y septicemia de diferente intensidad. descargas nasales no muy abundantes. se requiere el diagnóstico diferencial. que producen muertes de los animales y una menor tasa de crecimiento[11]. La forma crónica o Pasteurelosis subaguda: la neumonía es menos severa. 2. 19 . por lo general.

se encuentra P. Es una afección respiratoria aguda que afecta sobre todo a terneras y vaquillonas de raza de carne y a vacas adultas cuando se les somete al estrés de un transporte prolongado. lagrimeo.La pasteurelosis neumónica raras veces ocurre en el animal sano o no estresado [30]. debido a su asociación con el estrés producido por el transporte de los animales [4. haemolytica biotipo A. laringe. apatía. cesa la rumia. tos. Para el diagnóstico. descenso de la producción de leche.En bovinos. Se elimina por la saliva y las heces [62] Puede empezar después de 5 a 14 días después del estímulo estresante. P. inflamación mucohemorrágica en nariz. secreción nasal serosa o mucopurulenta. Entre las pasteurelas aisladas con frecuencia en casos de fiebre del transporte. estornudos. tráquea. tratándolos con agentes antibacterianos de amplio espectro de 3 a 5 días [27]. estornudos. Si se produce bacteriemia hay toxemia [9].9]. 20 .Los animales enfermos deben ser identificados y aislados. Se observa fiebre. incremento de la frecuencia respiratoria. A la necropsia se observa la hepatización de los pulmones. anorexia. La identificación se realiza aplicando la técnica de PCR o ELISA [79].El estrés suprime los mecanismos de defensa de los bovinos lo cual permite la proliferación de las pasteurelas en las vías respiratorias superiores.Es cosmopolita. multocida produce neumonías. además del cuadro clínico se le puede aislar mediante hisopados. pues se han reportado casos en casi todos los países del mundo [77]. etc. serotipo I y varios serotipos del grupo A de P. dificultad para respirar y beber. llamada también Fiebre del Embarque. para después bajar y colonizar las vías respiratorias inferiores y causar bronconeumonía con una distribución cráneo-ventral en el pulmón [27]. bronquios y pulmones. para luego sembrarlo en agar sangre.La presencia de la cápsula favorece la resistencia a la fagocitosis [3]. La transmisión es por vía digestiva y respiratoria. fiebre del transporte y enfermedad respiratoria bovina. multocida.

2. Figura 2. multocida en bovinos. [27]. IM de 3 a 5 días..9 Términos Básicos. por 3 días IM o SC. Para Leotta y col 2006 [45]. dihidroestreptomicina 25 mg/kpv/día. A: Adenina ADH: Arginina Hidrolasa 21 . . Ceftiofur 1-2 mg/kpv/día. IM o IV de 3 a 5 días. alojamientos bien ventilados sin humedad y también existen las vacunas.Aplicar oxitetraciclina 10 mgr/kpv/día. Aplicando buena higiene y alimentación. La vacunación debe hacerse no menos de tres semanas antes del embarque o el traslado a los corrales de engorde y puede repetirse cuando llegan al corra. enrofloxacina 2 a 5 mg/kpv/día de 3 a 5 días[48]. el principal método para el control de las enfermedades causadas por Pasteurella multocida en animales de cría intensiva es un adecuado manejo sanitario. Lesiones producidas por P.

AMY: Amigdalina ARN: Ácido Ribonucleico CIT: Citrato Cm: Centímetro ELISA: Enzyme-Linked InmunoSorbent Assay G: Guanina H2S: Ácido sulfhídrico IND: Indol INO: Inositol Kb: Kilobases L: Litro Pb: Pares de bases PFGE:Pulsed Field Gel Electroforesis (Electroforesis en campo pulsado) PMT:Pasteurella Multocida Toxin PCR:Polimerase Chain Reaction U:Unidades URE:Ureasa V:Voltio µg:Microgramo. III. µl: Microlitro. 22 . III. Asimismo. Esta investigación se realizó en el Camal Municipal de Chincha y en el laboratorio de Microbiología de la Facultad de Medicina Veterinaria de la UNICA. MATERIALES Y METÓDOS. durante los meses de Marzo 2014 hasta Febrero 2015.1Ámbito de estudio.

biotipo A en bovinos sacrificados en el Camal Municipal. cuadros y fotos. . III.1 Tipo. Indol. para lo cual se emplearon 140 muestras de hisopado nasal.3. Temperatura promedio: 26oC III.Tubos de ensayo . Maltosa. Esta investigación esun estudio de tipo descriptivo. Glucosa. se contó con la colaboración del Laboratorio de Biotecnología y Genómica FARVET de Chincha. por un periodo de 7 meses. Las coordenadas de ubicación de la Ciudad de Chincha son: Latitud: 12o 48” sur Longitud: 75o 38” occidental.para corroborar los resultados. . transversal que buscó realizar el diagnóstico bacteriológico de P. Como el presente trabajo de investigación es de tipo descriptivo. Láminas porta y cubreobjetos Asa de siembra Estufa Autoclave Estereoscopio Microscopio de Campo Claro. mediante cultivos en agar sangre al 5% en anaerobiosis.3Método estadístico III. porcentajes. técnicas bioquímicas y pruebas moleculares. - Ornitina (ODC). . multocida.Placas petri. histogramas. 23 . Oxidasa.2Materiales y Equipos MATERIALES Y MEDIOS DE CULTIVO.Hisopos y Cooler. como gráficos.3.Reactivos para pruebas bioquímicas: Catalasa. Urea. Manitol Reactivos para la coloración Gram.Medio de cultivo: Agar Mac Conkey .Agua peptonada 1% . se utilizaron medidas de tendencia central. Gelatina.2 Tamaño de la muestra. Altitud: 200 msnm. 3. así como pulmones y tonsilas provenientes de los animales sacrificados en ese centro de abasto. Nivel y Diseño de la Investigación.

n = 3. 1990). así como se aplicó pruebas moleculares al 24 .005)2 n = 0. se trabajó con 140 muestras de hisopado nasal para una mayor confiabilidad de los resultados. en bovinos procedentes de las diversas crianzas distribuidas en diferentes áreas geográficas de la Provincia de Chincha. haciendo un total en 7 meses de 1.07823616 0. q= Probabilidad negativa. Sin embargo.q . se benefician bovinos los días lunes. p = Nos indica la proporción de unidades que poseen el atributo de interés en la población.96. miércoles. para 95% le corresponde Z2α/2 =1.4% de animales persistentemente infectados. es decir se utilizaron un total de 140 bovinos.84. con un nivel de confianza del 95%: n= Z2. es decir 60 semanales. (0. y adicionalmente. viernes y sábados.0025 n = 36. E= Es el error máximo permisible que estamos dispuestos a cometer para estimar µ para un nivel de confianza establecido.680 bovinos. El tamaño muestral fue obtenido mediante la fórmula de muestreo de prevalencia límite (Ahlbom y Norell. 0.024.976) (0. 240 mensuales. tomándose como referencia una prevalencia mínima de 2. Se tomaron 5 muestras al azar de hisopados nasales una vez por semana durante 7 meses.El estudio de campo se realizó durante los meses de Junio a Diciembre 2014.p . con un promedio de 15 reses diarias. se añadieron las muestras de pulmón y tonsilas. E2 Donde: Z2 = Es el coeficiente de confianza cuyo valor depende del nivel de confianza. En el Camal Municipal de Chincha.

III.4. d) Inmediatamente tomada las muestras. se introdujo y se frotó en la cavidad nasal el hisopo estéril.1 Hipótesis HO: Presencia de Pasteurella multocida biotipo A Ha: Ausencia de Pasteurella multocida biotipo A. se procedió a colocar cada hisopo conteniendo la muestra en un tubo de ensayo que contenía agua peptonada al 10% preparada para tal fin y se depositó dentro del Cooler con hielo para su conservación.2 Variables Independiente: Las muestras de hisopado nasal. se transportaron hacia el Laboratorio de Microbiología de la Facultad de Medicina veterinaria de la Universidad “San Luis Gonzaga” de Ica. c) Las placas se incubaron a 37°C durante 72 horas. para su posterior estudio.5Técnicas de Recolección de Información.1 Recolección III.1. b) Se procedió a la siembra de las muestras en las respectivas placas mediante el método de diseminación en placa.1 En el Camal Municipal: a) A cada animal escogido al azar. III. III.2 En el laboratorio.4.5. 25 . III. se le asignó un número (número de muestra) y se rotularon los números en los tubos de ensayo correspondiente. Dependiente: Pasteurella multocida biotipo A.5. a) Se preparó el Columbia Agar sangre al 5% (Biomerieux) en anaerobiosis.5.100% de los hisopados nasales y a las muestras sospechosas de los órganos (pulmón y tonsilas). c) Seguidamente.4Hipótesis y Variables de estudio III. b) Las muestras se recogieron por medio de hisopado nasal previo lavado de las fosas nasales del animal con suero fisiológico para quitar las impurezas propias del transporte. y se depositó en las cajas petri. III.

que detecta una secuencia de ADN única en P. es capaz de identificar todos los tiposcapsulares en la misma reacción.d) Transcurrido ese tiempo. único en P. Donde se busca amplificar el fragmento KMT1. multocida. fueron remitidas al Laboratorio de Biotecnología y Genómica FARVET de Chincha. Indol. se realizó la extracción de ADN hirviendo dos colonias en 100 ul de agua Mili-Q en un baño maría a 100°C durante 10 minutos. (Laboratorio FARVET): a) En primer lugar. multocida. Cebadores de PCR específica de especie. y sometidas a la prueba molecular de PCR múltiple para el diagnóstico confirmativo. y se sometieron a pruebas bioquímicas convencionales (catalasa. Protocolo de Townsend y col. Ornitina desacarboxilasa. (2001). siguiendo el protocolo propuesto por Townsend y col. esta se hizo en base a las características macroscópicas y microscópicas de las colonias (tinción Gram). oxidasa. se hizo la lectura de las placas. Mac Conkey. Motilidad. c) Todos los cebadores utilizados fueron sintéticos preparados por Roche diagnosis y según el modelo propuesto por Townsend et al. (Biomerieux). Nombre cebador KMT1T7 KMT1SP6 Secuencia de cebadores (5’ – 3’) ATCCGCTATTTACCCAGTGG GCTGTAAACGAACTCGCCAC 26 . Fermentación en maltosa. Gelatina. y según la técnica propuesta por el fabricante (Roche): Tabla2.multocida y que ha demostrado una alta sensibilidad y especificidad y además. por lo que se considera la mejor opción para detectar los distintos tipos capsulares de P.. las colonias sospechosas del géneroPasteurellase identificaron según los siguientes criterios: presencia de colonias mucoides medianas. Urea. los cultivos de hisopado nasal y de las muestras sospechosas de pulmón y tonsilas. glucosa y manitol). b) El extracto se mantuvo congelado a -20°C y se utilizó para todas las reacciones de PCR. cocobacilos gramnegativos. Adicionalmente.

Las amplificaciones se realizaron en todos los casos en un termociclador modelo Rotor-Gene 3000 (Corbet. Las cantidades utilizadas se detallan en la tabla 3.1 µl 5 µl 25 µl Tabla 4. cuyo genoma figura en el Gene Bank.5) (Biotools) ADN extraído Total volumen 14. se utilizó la cepa de referencia NCTC 10322. Condiciones de PCR de especie P. Australia). siguiendo las instrucciones del 27 .5 µl 0. mientras que las condiciones de la reacción se describen en la tabla 4.Como control positivo. Tabla 3. Purificación El producto de cada PCR (ADN amplificado) fue purificado utilizando el kit QIAquick PCR Purification (QIAGEN).5 µl 1 µl de cada uno 0. Volúmenes empleados en la PCR específica de especie. Sydney.9 µl 2. multocida Fase Desnaturalización inicial Desnaturalización Hibridación 30 ciclos Elongación Elongación final Temperatura 95° 95° 55° 72° 72° Tiempo 5 minutos 30 segundos 30 segundos 30 segundos 10 minutos.La mezcla de PCR se llevó a cabo en un volumen final de 25 ul. Reactivos Agua bidestilada estéril (Sigma) Tampón 10 X con MgCl2µ Desoxinucleótidostrifosfato (dNTPs)(250µl/10mM) (Biotools) Cebadores (20 µM) Taq DNA polimerasa (0.

Este ADN purificado se utilizará para su posterior secuenciación . Secuenciación: Para secuenciar el ADN purificado se utilizó un secuenciador automático modelo ABI PRISM 3730 DNA (Applied Biosystems) (Lab. Este protocolo consta de una serie de pasos que incluyen diversas centrifugaciones con diferentes tampones. multocida estaba presente o no enlos bovinos beneficiados en el Camal Municipal de Chincha. En la columna. el ADN se adsorbe a la superficie de la membrana de la columna de purificación silica-gel.uk/clustalw). si la P. Para ello se utilizó el programa FASTA y el software BLAST (www.5 ml).fabricante.se tienen los siguientes resultados: 28 .pubmed/BLAST/nucleotide). éstas fueron comparadas con las incluidas en las bases de datos GeneBank. FARVETChincha). CONTRASTACIÓN DE LA HIPÓTESIS: Ante la hipótesis formulada en el proyecto. manteniéndose congelado a -20º C de temperatura. en presencia de sales y a un determinado pH. IV. RESULTADOS Y DISCUSIÓN. Las impurezas se eliminan mediante sucesivos lavados con otro tampón y finalmente se eluye el ADN purificado con un tampón específico en un eppendorf (1. pasando los contaminantes a través de la columna.ac.ebi. Tras efectuar el análisis de las secuencias. Las secuencias fueron alineadas mediante el software ClustalW(http://www. pasando la muestra por una columna con un filtro.

1 Total de muestras bovinas procesadas: Se estudiaron un total de 140 (n= 140) muestras.2 Resultado de los cultivos en Agar Sangre al 5% en anaerobiosis: Los resultados se muestran en el cuadro 2: Cuadro 2.4. Todos los bovinos beneficiados se encontraban en aparente buen estado de salud. procedentes de los bovinos beneficiados en el Camal Municipal de Chincha. Cultivo directo en Agar Sangre 5% en Anaerobiosis (Hisopado Nasal) MESES 29 . 4.

43 % de muestras positivas: 0 Como se puede apreciar en este cuadro.57 Negativas: 131 Sospechosas: 9 % de muestras sospechosas: 6.Mues tra N° de Muest ra Junio Julio Agos Setiembr to e Octub re Noviemb Diciembr re e Resultados 1 - 2 Hisop ado Nasal Sospech oso Sospech oso - - - Sospech oso - - - - - - - - - - - - - - - Sospech oso Sospech oso - - - - - - - - - 3 Sospech oso 4 - 5 6 7 - 8 - Sospech oso Sospech oso - - - - - - - 10 9 - - - - - - - 11 - - - - - - - 12 - - - - - - - 13 - - - - - - 14 Sospecho so - - - - - - 15 - - - - - - - 16 - - - - - - - 17 - - - - - - - 18 - - - - - - - 19 - - - - - - - 20 - - - - - - - Total de muestras: 140 % de muestras negativas: 93. 30 . confluentes sin presencia de hemólisis en placas de agar sangre y que equivale a un 6. solo se pudieron observar 9 (n=9) muestras sospechosas de P. lo que equivale a un 93. multocida. dieron negativo al cultivo. 43% del total de muestras.Las restantes (n=131).57% del total.las cuales mostraron colonias grises mucosas.

formando colonias grandes.[7. multocida. de color blanquecino. Se puede observar en el cuadro 3. por lo que las muestras sospechosas se sometieron a las pruebas bioquímicas para llegar a determinar si eran de la especie Pasteurella. Todas estas características eran indicativas de que las muestras sospechosas podrían pertenecer al género Pasteurella. no produjeron hemólisis y resultaron positivos a la prueba de la oxidasa (reacción débil) y de la catalasa. 45]. 31 . Por lo tanto. En la tinción de Gram se observaron bacilos cortos que presentaron una bipolaridad típica. 4. que se indica como útil para identificar las bacterias pertenecientes a P. mucosas y de olor característico.3 Resultado de las Pruebas Bioquímicas (Hisopado nasal). se utilizó la galería de pruebas bioquímicas convencionales ya que es un sistema rápido y sencillo de realizar y.Todas las muestras sospechosas presentaron un aspecto macroscópico similar enmedio agar-sangre Columbia (Biomerieux). Ninguno de ellos creció en agar McConckey (Biomerieux).

6.3 Identificación Cuadro 3. Manitol _ _ _ ₊ ₊ ₊ ₊ _ _ _ _ _ De las 9 muestras de hisopado nasal sospechosas especie Ningun o P. lo que supone que los microorganismos que formaron las colonias pertenecen a otra especie. ninguna fue identificada por la galería multisustrato como P. multocida. Glucosa Ferment. multocida.(por sus _ _ de pertenecer a la características macroscópicas. . con algunas características 32 semejantes a Pasteurella m (P. Maltosa Ferment. microscópicas y pruebas bioquímicasbásicas). (Muestras sospechosas de Hisopado Nasal) Meses Juni Agost Setiem Octub Noviem Diciemb o Julio o bre re bre re Pruebas N° de muestra sospechosa Ningu Ningu 3 4 2 3 5 no 4 5 no 1 9 Oxidasa ₊ ₊ ₊₊₊ ₊ ₊ ₊₊₊ Mac Conkey _ _ _ _ _ Catalasa Indol _ ₊ ₊ ₊ ₊ _ _ _ _ _ _ _ _ _ _ _ _ _ ₊ _ _ ₊ ₊ _ ₊ _ _ ₊ _ _ _ _ _ _ _ _ _ ₊ ₊ ₊₊_ _ ₊ ₊ _ ₊ ₊ _ ₊ ₊_ ₊ _ ₊ _ _ ₊ _ _ ₊ ₊ ₊₊₊ _ ₊ ₊ _ _ ₊ _ ₊ ₊ ₊_ _ ₊ ₊ _ ₊ _ _ ₊_ ₊ _ ₊ ₊₊_ ₊ _ ₊_ ₊ _ _ ₊_ ₊ _ _ Gelatina Urea Motilidad Ornitina Desacarboxila sa (ODC) Ferment. Pruebas Bioquímicas.

33 . solo se encontraron una muestra sospechosa de P. N° de Muestra Setiembre Pulmón 1 - 2 Sospechoso 3 - 4 - 5 - Total de muestras de pulmón: 10 Meses Noviembre Pulmón Tonsila - Sospechoso Sospechoso - Total de muestras de Tonsilas: 5 Muestras negativas: 90% Muestras negativas: 60% Sospechosas: 10% Sospechosas: 40% Positivos: 0 % Positivas: 0%. etc).pneumotropica. A los cultivos de las muestras de pulmón y de tonsilas de los bovinos. Con la finalidad de estar más seguros con el diagnóstico. Cuadro 4. o quizás pertenecen a alguna especie de bacterias no fermentadoras (Non fermenter sp). Mannheimia haemolytica. Cultivo de Pulmón y Tonsilas en Agar sangre (anaerobiosis). multocida en pulmón y 2 en las tonsilas.4 Resultados del cultivo de Pulmón y Tonsilas en Agar sangre. se procedió también a evaluar muestras de pulmón y de tonsilas de alguno bovinos muestreados al azar. consiguiendo los siguientes resultados: 4.

f. como se detallaba en la bibliografía consultada. y f. urea. la identificación mediante estas 34 . Estos resultados de identificación bioquímica fuerontomados con cautela ya que. a la glucosa y manitol. en cambio dieron positivo para catalasa y oxidasa. Maltosa Ferment. ODC. gelatina. Pruebas Bioquímicas de Muestras sospechosas (Pulmón y Tonsilas) Meses Pruebas Setiembre Pulmón N° muestra 2 Noviembre Tonsila N° de muestra 1 4 ₊ ₊ ₊ ₊ ₊ ₊ _ _ _ Indol ₊ _ Gelatina _ _ Urea ₊ _ ₊ _ ₊ _ _ _ ₊ ₊ ₊ _ ₊ ₊ _ ₊ ₊ ₊ ₊ ₊ Catalasa Oxidasa Mac Conkey Motilidad Ornitina Desacarboxilasa (ODC) Ferment.4. Glucosa Ferment. motilidad. a la maltosa. Indol.5 Resultado de las Pruebas bioquímicas de las muestras de Pulmón y de Tonsilas. todas las muestras presentaron perfiles parecidos: dieron negativo para el agar Mac Conkey. Cuadro 5. Manitol Como se puede observar en este cuadro.

se pudo observar un comportamiento bioquímicovariablehecho ya destacado e investigaciones como las Christensen et al. Los resultados tan variados que se obtuvieron. salvo excepciones. Asimismo.7. multocida. multocida. por lo que se decidió que todas las muestras tanto del hisopado.67 % de los casos.En el caso del indol se observaron 6 muestras (3/12) (25%) negativos a esta prueba. ya - que las variantes negativas suelen ser mucho menos frecuentes [75. .pruebas resulta en ocasiones problemática en el caso de la especie P. donde finalmente se realizó y se obtuvieron resultados: 35 los siguientes . multocida. coincidiendo con otras investigaciones. no se ajustaron exactamente al perfil bioquímico de P.67 % de resultados sospechosos. hecho que puede llevar a confusión en la delimitación e identificación de las especies y subespecies dentro del género Pasteurella [6. 2004 - La actividad enzimática de la Ornitina decarboxilasa (ODC) fue positiva en un 91.Debido a estos resultados inusuales se procedió a realizar la prueba molecular de PCR múltiple. a priori. multocida. 4. ya que clásicamente se considera que esta especie es. positiva a la prueba del indol [54].59.60] ..En el caso de la utilización de la D-glucosa se obtuvo un 91. lo que indicaba. Resultado de la Prueba Molecular para la detección de P. . para lo cual se solicitó la colaboración del laboratorio FARVET de la Ciudad de Chincha. Un 100% de los sospechosos utilizó la catalasa y oxidasa. .6.. Ello es debido a la gran variabilidad existente en los perfiles bioquímicos. que no pertenecían a la especie P. como de los órganos muestreados se sometieran a la prueba molecular de PCR múltiple. .84].El 75% de los aislados utilizó el D-manitol.

El 100 % de las muestras dieron negativo para el gen KMT1. pulmón y tonsilas. y se obtuvieron 9 colonias sospechosas.5 ** *Suspensión del medio de transporte **Órgano ***Townsend 2001. se llega a las siguientes conclusiones: 1. Se realizaron los cultivos de hisopado nasal (n=140) en agar sangre. y órganos de bovinos beneficiados en el Camal Municipal de Chincha.Cuadro 6. multocida. 36 . PCR múltiple de muestras de Hisopado nasal. Después de haber realizado el diagnóstico bacteriológico de las muestras de hisopado nasal. V. Muestra Pasteurella multocida (Gen KMT1)*** 1 – 20 * 21 – 30 * 31 – 40 * 41 – 50 * 51 – 60 * 61 – 70* 71 – 80 * 81 – 90* 91 – 100 * 101 – 110 * 111 – 120 * 121 – 130 * 131 – 140 * Pulmón 1 – 10 ** Tonsilas 1. por lo que no corresponden a P. CONCLUSIONES.

VI. dando como resultado negativo al perfil de P. RECOMENDACIONES. multocida no está presente en los bovinos beneficiados en el Camal Municipal de Chincha. se aplicó a todas las muestras una prueba molecular de PCR múltiple. Para realizar una identificación rutinaria deP. las mismas que fueron sometidas a cultivo en agar sangre al 5% y en anaerobiosis.2. Asimismo. Las colonias sospechosas de hisopado y de órganos. multocida las galerías API 20E pueden suponer una buena opción. por lo que en el estudio bioquímico se pudo observar distintos comportamientos de cada una de las colonias. Se obtuvieron una muestra de pulmón (10%) y dos muestras de tonsilas sospechosa a P. Seguir haciendo diagnósticos bacteriológicos constantes en bovinos y en otras especies beneficiadas en el Camal Municipal a fin de detectar la P. fueron sometidas a una batería de reactivos bioquímicos. se recomienda lo siguiente: 1. multocida. 2. Se concluye que P. 6. multocida. multocida. Dada la naturaleza heterogénea de P. Para mayor seguridad en el diagnóstico. 3. Después de haber realizado este trabajo de investigación. 4. se agregaron al azar muestras de pulmones (n=10) y tonsilas (n=5) de los bovinos beneficiados en el Camal Municipal. 5. están descritas multitud de variedades bioquímicas dentro de la especie [62]. obteniendo todos los resultados negativos a P. multocida(40%). multocida. y en el caso de que existan dudas sobre el resultado se puede recurrir a la realizaciónde ciertas 37 .

Zentralbl. Ecology and significance of Pasteurellaceae in animals. Debido a la gran variabilidad existente enlos perfiles bioquímicos.978. multocida [72b]. VII. 1ra edic. 1. debido a que esta técnica presenta una elevada tipabilidad y poder discriminatorio aplicada a la caracterización de este patógeno. 1. tales como REA. Editorial Acribia. E. Enfermedades infecciosas de los animales domésticos. 5. 1. Selman. Vet.pruebas bioquímicas de forma convencional (especialmente ODC.999. Tomo II. H. 4. hecho que puede llevar a confusión en la delimitación eidentificación de las especies y subespecies dentro del género. descrita como el sistema de tipado “gold standar” para la caracterización molecular de P. J. 1. Veterinaria tropical. 396 págs. multocidautilizando la técnica de electroforesis de campo pulsado (PFGE).. A. 3. O. Pág. Jones.M. 2. Alfaro. Díaz. RAPD y REP-PCR. 1ra edic.Bakteriol.sorbitol.siendo estos parámetros superiores a los obtenidos con otras técnicas de tipificación molecular. se recomienda realizar estudios de genotipificación de P. Rec. 38 . Beer. confirmarlo. WIseman. 3. H. Tirado. 279. 104. Allan. S. Caracterización sanitaria de la ganadería doble propósito en el municipio Ezequiel Zamora del estado Monagas. España. 24:2. 7-26. (1993). Bisgaard. 117:629-63. Patología veterinaria. 1. Gibbs.981. FUENTES DE INFORMACIÓN.989. C. M. Atmore. así como una buena reproducibilidad [57]. C. Editorial Acribia. indol) para. J. de este modo. Pasteurella species isolated from the bovine respiratory tract and their microbial sensitivity patern. 103-109. ribotipado.

. 11. 39 . V. 428-429. Medicina veterinaria. Boyce.C. J. S. y Adler. S. 9. N.. Trigo. M. British and Dutch isolates of so-called Pasteurella multocida obtained from pneumonic calf lungs. Pasteurella multocida capsule:composition. 10. 128. Reclassification of German. Bojesen.. No 1. Chung. 1. Palmer. J. J. J. Z. Gonzales. A. 319-320. comb. 14. B. New species of Micrococcirs (bacteria). T. R. or a combination of both organismsonsubsequentinfectionwith Pasteurella multocida in pigs.. 12. J. R.Dis. Vet. Mutters.. 232-239. 13. M. G. Bisgaard. Christensen. Radostits. y Botzler.. Burril. Blackall. Ann. J.Nat 17.. Abdullahi. A.Res. Y.. F.6. 83. Brockmeier. Bredy.Evol.Syst.Microbiol. Houghton. R. Hernandez. (2000). P. Reclassification of [Pasteurella] trehalosi as Bibersteinia trehalosi gen. Vet. Botzler.N. D. 15. Effects ofintranasalinoculationwithBordetellabronchiseptica. y Stenzel. J.Microbiol. y Gilmour..Y. Bolin. 57. A. Vet. 666-674. V.M. Editorial Interamericana.. G. (1989). (2002). 153-160. B. H. Caracterización fenotípica y molecular de cepas de Pasteurella multocida aisladas de exudado nasal de bovinos. (1991a). 969. M. S. y Rimler.J.987. Jaramillo. Int. Suarez. 115-124. (2001). D. Bisgaard.. en dos cuencas lecheras de México. 62. 224-228. R. Vol 42. Campuzano. The effects of sixenvironmental variables onPasteurella multocida populations in water. Mex. Avian cholera onnorthcoast California: distinctiveepizootiologicalfeatures. 26. 521-525. Henderson. L. function and genetics. B.J. porcinereproductive and respiratory syndrome virus.Wildl.Biotechnol. (1883). (2007). 2. 25. P. 5ta edic.Rec.Vet.. nov. J. C. R. Am. y Bisgaard. 7. M. Am. D.Sci.. (1991b). 8.Acad.. M. F. 1441 págs. Further studies on theidentification of pasteurellaceae from cattle lungs. nov. J.011. Blood. R.A. M.

J. 50 Pt 3. Identification of types B and E Pasteurella multocida bycounterimmunoelectrophoresis. 22.. Olsen. 17. Vol.. I. E. K.M... (1981). 3438-3441. Y. J. R. 40 . Santander. H. XII. G.. O. J.. Resistencia y sensibilidad a antimicrobianos de cepas de Pasteurella multocida aisladas de terneros con neumonías en el estado de Monagas Venezuela. Hird. Clavijo.. E. Pasteurella III (2002). 21. M. Pg. (1997). W. M. Revised description and classification of atypical isolates of Pasteurella multocida from bovine lungs based on genotypic characterization to include variants previously classified as biovar 2 of Pasteurella canis and Pasteurella avium. Taxonomicsubgroups of y Clarridge. K. Venezuela. multocida correlatewithclinicalpresentation. H. 23. J. Restrictionendonucleaseanalysis of Pasteurella multocida isolates from three California turkeypremises. Carpenter. A. Christensen.002. C. H. Alfaro.. (2000). M. 145-146. Hulten. 36. G. Christensen.1767. P.16. Rolo. Christensen. (2004).Clin. Angen. Santander. Olsen. Snipes. C. Y. Chen. Memorias del II Congreso de ciencias veterinarias. Angen.Rec. 272-281. y Bisgaard. Coa.Evol. Carter. 19. H. A. 26. M. Maracay. J.. P. Int. Avian pasteurellosis: Taxonomy of theorganisms involved and aspects of pathogenesis.. J. Clavijo. Avian Pathol.Microbiol. E. F. K. 108. y Ghazikhanian.993. 10951102. T.Syst. D.. 1. aponte. Suplemento 2: 626629. 2..M. Revista científica.. 1757. C. Gallardo. Microbiology 150. Vet. Pineda. R. Estudio preliminar sobre la etiología bacteriana de las infecciones respiratorias en terneros de raza lechera. M. 40. 16.. 20. Parra.J. (1992). 461-483. AvianDis. y Chengappa. M.Microbiol. Christiansen.. J. Mutters. y Bisgaard. A. 18. Diaz. DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA. P. O. E. y Bisgaard.

Fegan. 82. 108. El Manual Merck De Veterinaria. Phenotypiccharacterisation of Pasteurella multocida isolates from Australianpoultry.981. 47. 4ta edic. J. J. (1981).002.Virulencegenotype of Pasteurella multocida strains isolated from different hosts with various disease status. J. P. J. (1999). Vet. Editorial Océano/Centrum.. Gunawardana. Vet. 7ma edic. A.. y Ollerhead.. 833-834. Hernandez. Wisconsin. Pasteurella multocida. 32. Molecular characterisation of avian Pasteurella multocida isolates from Australia and Vietnam by REP-PCR and PFGE. (1995). Townsend. Enfermedades infecciosas de los animales domésticos.S. Madison. 29. España. Pasteurelosis neumónica. Sevilla.C. A. Kiessling. M.Information BiologicalresourceDivision.. M. Lubke-Becker. y Pahoff. Bethe. A. 25. Dziva. Academic Press.993.. K. M. diseases and of birds. 1. 26.P. A. Vet. H. Vet. S. London. Guillespie. 420-423. L. Christensen. Pg. E. y Wieler.S. J. Avian cholera. Investigation to determine whether healthy chickens and turkeys are oral carriers of Pasteurella multocida. 2. H. 1. N. Gray. L. 33. timoney. 281-286.Friend TechnologyReport U.H. Ewers. Hospital universitario Virgen Macarena. Blackall. G.. Hagan. 41 . y Frost. G. 97-109.Microbiol. Pasteurellosis of cattle in: Pasteurella and pasteurellosis.. Curtis.Rec. Ithaca.. Págs. (2006). 34..24.Microbiol. E. Bruner. A. 198. New York: CornellUniversityPress. In Field manual of wildlife diseases: General fieldprocedures J. 72. 75-92.998. De Cueto.F. 206-207.Microbiol. S. 1. Friend. C.GeologicalSurvey.. (1996). (2001). P. 27. Filter. Departamento de microbiología.M. H. J. In A System of Veterinary Medicine 1. H. E..Franson and (eds. Olsen. 30. Vet. M. and 1999-01.. F. y Mohan.Microbiol. 361372.). (2000). Frank. 28. Barcelona. Randomamplification of polymorphic DNA and phenotypictyping of Zimbabweanisolates of Pasteurella multocida. 31. K.

Allen. K. E. Diagnóstico Microbiológico.Health 60. 204-209. Ueber die Wildseucine und ihre Bedeutung für die Nationalökonomie und die Hygiene. Boyce. G. Hueppe.. 26. 1154 págs.. A. A. RIvas. Koneman. Vigo. Infect. 42. 38. K.Microbiol. M. M.996. Microbiología médica. Identificación. León. D.. 72. 3-25. E. H. J. K. (2001)... 41. Ed: Lippincott company. T.M. E. Loyola R.35. Pasteurella multocida Infections: I. 15ava edic. P.Buenos Aires. Vol 14. Kasten. W. 1. Koneman. D. 36. Nª2.. 40. J. W. Dowell. E. Avian Dis.Immun.. Hunt. Hirsh. 3004-3012. 753-758. L. D. G. G. (1886).. Color atlas and texbooth of diagnostic microbiology. Argentina. Berliner Klinische Wochenschrift 44. E. y Hirsh. P. 388-461. Snipes. (1999). H. U. C. Boucher. Carpenter. I. 39. Williams. Prodanim.. D. W. Editorial El Manual Moderno.992. Stephen. A. D. Detection of Pasteurella multocida-specific DNA in turkey flocks by use of the polymerase chain reaction. 38. 1103-1108. W. T. Chinen. 41. Canada. Characteristics of Pasteurella multocida isolated from waterfowl and associatedavian species in California.. Pasteurella multocida InfectionDueto Animal Bite. 43. B.. P. 37. 44. 69.Wildl. R. y Townsend. R.B. 2002. (1970). N. E. Bakterienkunde und Pathologische Mikroskopie 304. Hird. Análisis de la presentación de Pasteurelosis bovina.A. M.D.W. M. D. y McCapes. Carpenter. y Schrenberger. 1. J. Hubbert. Págs. y Rosen. T.. Am. B. (1997).bHunt. et al. Th (1983). M. biotipificación y caracterización de cepas de Pasteurella 42 .. Prieto. y Adler. Sommers. 676-682. J. 45. Adler. (2000). Kitt. (1990).M. Jessup. Snipes. M..J.Dis.. Leotta. C. Jawetz. Editorial Médica Panamericana. L. 832-838..R. Vet. F. Callejo. D. The molecular biology of Pasteurella multocida. In vivo-expressed genes of Pasteurella multocida.PublicHealthNations. R.

Pasteur.. 20. W. (1880).. México. Revista Argentina de microbiología. J. A. P. M. Matsumoto. MoralesAlvarez. Olson. J.. . M. Muvavarirwa. y Pawandiwa.Sci 90. Bacteriología y virología veterinaria. Leotta.999. 38. A. Christensen. 133-142.. 7. P.Dis. 55.Inst. (1968).Infect. y Bisgaard. Hill.. y Bond. Ann. Pathogenicity of Pasteurella multocida: itsvariable naturedemonstratedby in vivo passages. water. 72. M.. 50. (1997). J. 244-246.Rend.ArgentMicrobiol. Investigationson the carrierrate healthycommercialpoultryflocks of and Pasteurella multocida flocksaffectedbyfowl in cholera. Phenotype and serotype of Pasteurella multocida isolates from diseases of dogs and cats in Zimbabwe. 734-736. 54. Aznar. G. L.. 43 del poules. J. 1. Proc. R.Pasteure 15. M (1990). 781-785. G. 48.006.970 51. 38: 125-129.. Les Pasteurelloses. K. 46. AvianPathol. E. P. D. Muhairwa. Género pasteurella. Sur les maladiesvirulents et en particulier sur la maladieappeleevulgairement cholera Comp. Chinen. Merchant. G. and in the mouths of various birds and mammals. 2.985. Martínez. A. Ligniéres.Meet. (2006a). Revista Salud animal. Rev. Muerte súbita asociada a pasteurelosis neumónica en bovinos.. B. 1030. P. (2000). Pg. CompImmunol. 29-34.S. P. J. carcasses. (1993). 49. E. R. F. Gugliada.Acad. 37. Vigo. AvianDis. 190-196.Microbiol. Kelly.. 53. VIña. Mohan. 239.multocida aisladas en la Argentina. y Strain. Pasteurella multocida tipo A en tracto respiratorio de ternero. INIFAP. J. 348. y Rivas. packer. 47.Anim Health Assoc. 29. Survival of Pasteurella multocida in soil. Vol 9(1): p. 1.U.F. [Evaluation of twotechniques of molecular subtypingto study Pasteurella multocida]. I. A. 52. 952. Contribution à létude et à la classification des septicèmieshémorrhagique. 1. J.Annu. L.

Departamento de Sanidad Animal.Zimmerman. Jorgensen.Wildl. T. Christensen.. H. y Andersen. Pasteurelosis neumónica. 61. Bregnballe. J.). K.Dis. K. T..999.rtf 57. 245-253. E. In Haemophilus. Enfermedades infecciosas. T. (2001). H. 808-816. AcademicPress. 1-12. S (1981). P. y D.uco.rtf 59. 64. 1-12. (2003). Universidad de Córdoba.999. A. H. London. M.Straw. y Olsen. J. Morales. 63. 9 thedition.Dállaire. Pasteurella and Actinobacillus. 39.uco.Biberstein (eds. Iowa. W.. Prescott. B. 44 . Pasteurelosis neumónica. Ames. Perea. Pijoan. Petersen. J. J. 719-726. (1998). Christensen. J.Taylor (eds..Frederiksen and E. Vet. Editorial McGrawHill Interamericana de España.J. 30(2). F. Pohl. Universidad de Córdoba. 288.. 2739-2748.. Pasteurella multocida from outbreaks of avian cholera in wild and captive birds in Denmark. DNA relatedness among members of Haemophilus. Pijoan. K. 1. México.56. D. (2005). (2006). Phenotypic and genotypicdiversity of organismspreviouslyclassified as maltose positive Pasteurellamultocida.es/dptos/sanidadanimal/ Enf_Infecciosas. Baja California. D. J. P.L. Microbiología. Rinitis atrófica progresiva.. 1. PneumonicPasteurellosis. Mex.). 58. S. J. Blackwell Publishing. Zentralbl. Geneticdiversity of Pasteurella multocida fowl cholera isolates as demonstratedbyribotyping and 16S rRNA and partialatpDsequencecomparisons. K. Christensen. Caracterización de los procesos neumónicos en becerros lecheros de la región de Tijuana. Microbiology 147. C. www.. In Diseases of Swine. 149-155.M. UnitedKingdom.. Petersen. 1-12. Págs. L.Bakteriol. Pasteurella and Actinobacillus. Aguilar. USA.J. M. M. Pedersen. C. y Bisgaard. 62. Rinitis atrófica no progresiva. Departamento de Sanidad Animal. H.es/dptos/sanidadanimal/Enf_Infecciosas.. Dietz. 60.Kilian. www. Enfermedades infecciosas. Bisgaard.

R. B. (2000). R.W. A. y Wobeser. J. 34.F. In Topley and Wilson´s. Avian Dis. R. 129-138. Pasteurella and Actinobacillus. E.Springfield. B. 68. B. USA: C.Thomas. K. (2005). Price. P. A comparative study of the virulence of Pasteurella multocida from rabbits (O. In Diseases Transmitted from animals to Man...Ames. G.Corvallis. J. Rosen. 239-269.J.. Vet. J.Atkinson (eds. Avian cholera.Hubbert. M. 49. K. Reporte de un caso. R. K. S.. Saxena. G.. Botzler. A. R. M.Principles 45 of Bacteriology.Dis. Rimler. W. Inf. Identification of avianstrains of Pasteurella multocida in India by conventional and PCR assays. (1990b).. Blackwell Publishing. Kumar. V. Coudert. Rhoades. R. B. Avian Dis. 6th edition. 66. y Rimler. J. G. Pasteurellosis (P. Sanchez.Microbiol. J. P. I. 74. Gautam. Singh. 72. (1990). (1984). R.. Smith. R. 34.). B.J. Gomez. In Infectious Diseases of Wild Birds. D. Virology and .. Persistence of Pasteurella multocida in Nebraska wetlands under epizootic conditions. (2006). y Rimler. S.Med. 9094. 67.McCulloch. Samuel. Neumonía por Pasteurella multocida en un adolescente. B. R. Virulence and toxigenicity of capsular serogroup D Pasteurella multocida strains isolated from avian hosts. P. Restriction endonuclease analysis using Hhal and Hpall to discriminate among group B Pasteurella multocida associated with haemorrhagic septicaemia. 20. 71. (1990c). Fifth World Rabbit Congress. 193-195. y Philips. y Hervouet. 73. 1389-1400. 69.J. Illinois.Wildl. 70. Shivachandra.). cuniculus). M.. Mercier.. Rhoades.Hunter and C. y Srivastava. Iowa.009. jarillo. Enf. 2. R. Somatic serotypes of Pasteurella multocida strains isolated from avian hosts (1976-1988).T. 29(2): 8185.N.T. 384-388. P. P. 8187. (1975).65. C. N. (1992). multocida). P. y Brand. Rideau. J.Schnurrenberger (eds. Microbiol. K.

Phenotypic and genotypic characterisation of Pasteurella multocida strains isolated from pigs in Hungary. H. T... K. A.Clin. 44.. Hird. Genetic organization of Pasteurella multocida cap loci and development of a multiplex capsular PCR typing system. D. Vet. M. Wilson.J. 81. Acta Vet. 69-78. BerlMunch. Hansen..Duerden (eds. Z. 75. J. A.T.). I. D. y McCapes. (1990). y Magyar. 1. Snipes. T. T. T. 83. y Frost.J. 2. Microbiol.. 55. A.990... Weber. Hirsh. Homogeneity of characteristics of Pasteurella multocida isolated from turkeys and wildlife in California. G. [The detection of Pasteurella multocida toxin using a commercially available ELISA]. R.C.Microbiol. Wilkie. y Heil-Franke. X. (1993).. (2000). E. 328-330. 1336-1338.Immunology. Wijewardana. Snipes. 2. M.D. Morgan. 78.Decker Inc. T. P. Epidemiología veterinaria.. A. 31.. H. Singer.Hung.. Comparison of DNA fingerprinting and serotypingforidentification of avian Pasteurella multocida isolates. W. T. Fowl cholera outbreak in domesticpoultry and epidemiologicalproperties multocida isolate. 255-259.. E. 80.Wochenschr. B. y Barger.Microbiol. P. M. D. N. Wachowitz. Thursfield. (2006). L. 39: 924-9. J. Plasma. J. B. 383-399.. y Hirsh. Carpenter. R. 344-353. y Kim. 49.. Varga. M.. 82. W.. (2007). 425-434. 46 of Pasteurella . Am. (1993). 1985-88. C. D. J. Chung.Microbiol. J.Usa. J. G. T.001.. J. 72. C.. M. K. España. Avian Dis. Trung. R. K. Sellyei. 76. 34.I. K. Kasten. Hanh. Editorial Acribia. PCR detection and analysis of Pasteurella multocida from the tonsils of slaughtered pigs in Vietnam..Tierarztl. J. K. 79. M. Woo.D. 77. (1988b). H.and ironregulated expression of high molecular weight outer membrane proteins by Pasteurella multocida. Clin.Parker y B. Townsend. B. G. 315-320. Adler. Y..Res. O'Boyle. 106.Vet. Towsend. Phan.M.. Frost. Boyce.

Zinsser. y Molitor. (http://www.fr/). Use of restrictionendonucleaseanalysis and ribotypingto study epidemiology of Pasteurella multocida in closedswineherds.. Infect.Immun. G. 86. T. 60. M.bacterio. A. 20ava edic.. 208-211.997. Editorial médica panamericana. Murtaugh. 85.. Microbiología. W. 47 . P.84. (1992). 1. 14011405.cict. C. Págs. Zhao. Pijoan.