You are on page 1of 7

Mol Biol Rep (2012) 39:9521–9527

DOI 10.1007/s11033-012-1816-4

Characterization of a novel ERF transcription factor
in Artemisia annua and its induction kinetics
after hormones and stress treatments
Xu Lu • Weimin Jiang • Ling Zhang • Fangyuan Zhang • Qian Shen
Tao Wang • Yunfei Chen • Shaoyan Wu • Zongyou Lv • Erdi Gao •
Bo Qiu • Kexuan Tang

Received: 26 November 2011 / Accepted: 10 June 2012 / Published online: 20 June 2012
Ó Springer Science+Business Media B.V. 2012

Abstract The full-length cDNA sequence of AaERF3
was cloned and characterized from Artemisia annua. The
bioinformatic analysis and phylogenetic tree analysis
implied that the AaERF3 encoded a putative protein of 193
amino acids which formed a closely related subgroup with
AtERF1, ERF1 and ORA59 in Arabidopsis. The result of
subcellular localization showed that AaERF3 targeted to
both of the nuclei and the cytoplasm. The qRT-PCR
analysis showed that Green young alabastrums had the
highest expression level of AaERF3 in the 5-months-old
plants. The qRT-PCR analysis also revealed that ABA,
Wound and Cold treatments significantly enhanced the
transcript expression of AaERF3. MeJA and Ethylene
treatment could also slightly induce the accumulation of
AaERF3 transcription.
Keywords Ethylene response factor  Induction kinetics 
Subcelluar localization

Xu Lu and Weimin Jiang contributed equally to this work.
The novel nucleotide sequence data published here has been
deposited in the EMBL/DDBJ/GenBank databases under accession
number JN695782.

Electronic supplementary material The online version of this
article (doi:10.1007/s11033-012-1816-4) contains supplementary
material, which is available to authorized users.
X. Lu  W. Jiang  L. Zhang  F. Zhang  Q. Shen  T. Wang 
Y. Chen  S. Wu  Z. Lv  E. Gao  B. Qiu  K. Tang (&)
Plant Biotechnology Research Center, SJTU–Cornell
Institute of Sustainable Agriculture and Biotechnology,
Fudan-SJTU-Nottingham Plant Biotechnology R&D Center,
School of Agriculture and Biology, Shanghai Jiao Tong
University, Shanghai 200240, People’s Republic of China
e-mail: kxtang1@yahoo.com

Introduction
Plant hormones such as abscisic acid (ABA), jasmonic acid
(JA), and ethylene (ET) are important components in
stress-related signaling pathways [1–3]. The AP2/ERF
transcription factors are one of the most important families
that are involved in plant response to biotic and abiotic
stresses, and regulation of metabolism and development
processes in various plant species [4]. The AP2/ERF
superfamily is defined by the AP2/ERF domain, which
consists of about 60–70 amino acids and is involved in
DNA binding. The AP2 family proteins contain two repeated AP2/ERF domains, the ERF family proteins contain a
single AP2/ERF domain, and the RAV family proteins
contain a B3 domain and a single AP2/ERF domain [5, 6].
More and more proteins in the ERF family were identified,
for instance 122 and 139 ERF family genes were identified
from Arabidopsis (Arabidopsis thaliana) and rice (Oryza
sativa), respectively, by a comprehensive computational
analysis [5].
Artemisia annua is an important source of the antimalarial drug artemisinin. Artemisinin (a sesquiterpene lactone) are extensively used in the treatment of malaria,
mostly in combination therapies [7]. However, the artemisinin content of A. annua is very low (0.01–1 % dry wt),
and this limits the commercialization of artemisinin
greatly. Recently, some researchers found that the treatment of ABA and JAs could significantly increase the
content of artemisinin [8–10]. Therefore, the ERFs of A.
annua which are responsive to the treatment of ABA and
JAs may be participating in the regulation of secondary
metabolism of Artemisinin.
The objectives of this study were: (1) to isolate a novel
ERF transcription factor of A. annua, AaERF3, and characterize the molecular and biochemical properties; (2) to

123

were pooled and collected for roots and stems (Root and Stem).expasy. Subcellular localization of AaERF3-YFP fusion proteins The AaERF3 cDNAs were then recombined into pEarlyGateway104 vector by Gateway LR recombination reaction (Invitrogen) to generate pEarlyGateway104-AaERF3.1 [14]. Based on the sequence.7 % agar (pH 5. 12. annua after treatments with hormones and stress treatments. All of the plants with ABA.5 % sodium hypochlorite solution with 0.81) using default parameters.ncbi. annua were cut some 2–3 mm nicks and kept at 22 °C under humidified conditions. annua grown in field for 5 months. A 209 objective was used for confocal imaging. the 30 end sequences of the ERF gene were obtained by RACE (rapid amplification of cDNA end) method according to the manufacturer’s instructions (Invitrogen). A phylogenetic tree was constructed by neighbor-joining method [13] using software MEGA version 3.nlm. The fulllength AaERF3 from A. reversely (provided in the kit). annua EST (expression sequence 123 Mol Biol Rep (2012) 39:9521–9527 tags) (EZ141721) which was from the flowerbud trichome cDNA library. annua at 4 °C. Wound treatments added a time point of 0. Cloning of AaERF3 by 30 -RACE primers AaERF3-3-1 and AaERF3-3-2 were designed according to the EST fragment of AaERF3 gene. USA) and 500 lM ethephon. The cDNA synthesis was performed with the SMART technology (SMARTTM RACE cDNA Amplification Kit) for 30 -rapid amplification of cDNA ends (RACE. which were just during floral budding. Different tissues of A.). Then. After rinsing 5 times thoroughly with sterile distilled water. 5 plants of A. USA) and Vector NTI software (Invitrogen). Materials and methods Plant materials The seeds of A. All the primers used were listed in Table 1. RNA was transcribed with the 30 -RACE CDS Primer A. 100 lM MeJA (Sigma Aldrich. annua. Low temperature treatment was given by keeping the same mixed plants of A. Cloning of AaERF3 full-length cDNA The sequence of Arabidopsis ORA59 (NM100497) was used as a query sequence for a BLAST search on GenBank. The first round of PCR was performed with primer AaERF3-3-1 and Universal Primer A Mix (provided in the kit). a pair of primers AaERF3-F and AaERF3-R were designed. 10 plants were transfers to new petri dishes and pooled for each treatment respectively [11. Inc. The plasmids were used for transient expression in tobacco (Nicotiana tabacum) epidermal cells as described previously [15]. USA) with 88 mM sucrose and 0. the same mixed plants of A. synthesized.1 % Tween 20 for 10 min. The YFP fluorescence was imaged using a Leica TCS SP5 laser scanning confocal microscope. CLONTECH Laboratories. People’s Republic of China. And white alabastrums (Bud1) and the flowers (Flower) were collected after 7 and 14 days respectively from the same plants. annua was deduced from the obtained sequences and consequently amplified by proofreading RT-PCR amplification with primers AaERF3full5 and AaERF3full3. 24 h) for the gene expression analysis. Comparative and bioinformatic analyses Comparative and bioinformatic analyses of AaERF3 were carried out online at the websites.gov and http://cn. Hormonal and stress treatments Artemisia annua plants grown in MS medium for 2 weeks were treated with solutions of 100 lM ABA. 12].org. 6. http://www. nih. and used to amplify the partial sequence of a putative ERF gene from A. Beijing) following the manufacturer’s instructions. Sequence analysis was performed using DNAMAN software (Lynnon Biosoft. The search returned an A. Southwest University in Chongqing.8). The phylogenetic analysis of AaERF3 protein and ERF from other species was carried out by alignment with CLUSTAL X (1. ethephon and cold treatments were collected before treatment (0 h) and at different time point after treatment (1. Fluorescence was detected at 530–600 nm for YFP. For wound induction. the seeds were placed on Murashige and Skoog (MS) medium (Sigma-Aldrich. We observed and recorded the results 48 h after transformation. including its subcellular localization. Seeds were surfaced sterilized in 70 % ethanol for 1 min and then a 0. and (3) to investigate the expression pattern of AaERF3 in A. The PCR product was diluted 50-fold for a second round of amplification with primer AaERF3-3-2 and Nested Universal Primer A (provided in the kit). annua were obtained from the School of Life Sciences. MO.9522 characterize in detail the properties of the predicted AaERF3 protein. annua plants were collected for RNA extraction using plant RNA isolation reagent (Tiangen Biotech. leaves (Leaf) and green young alabastrums (Bud0) samples. 3. . Data was processed using Photoshop software (Adobe).5 h.

Results and discussion Characterization of AaERF3 full-length cDNA sequences Using the primers AaERF3-F and AaERF3-R.5 ll of EASY dilution. Two primers were then designed for the 30 -RACE based on the obtained sequence. The results of the BLAST-Protein (BLASTP) online (http://www. the full-length cDNA of AaERF3 (GenBank accession no. Characterization of the deduced AaERF3 protein By using the software pI/Mw tool at http://www.ncbi. stress treatments and in various tissues of A. It was 850 bp long and contained a 582 bp ORF encoding 193 amino acid proteins. 0.8 ng of total RNA).4 lg total RNA were employed in the reverse transcriptase reaction using random hexamer primers for the synthesis of first strand cDNA. a band of 721 bp was specifically amplified. and the SYBR ExScript RT-PCR kit (Takara. Japan) protocol to confirm changes in gene expression. The coding region was followed by 30 -untranslated region that was 194 bp long downstream from the stop codon including the poly (A). and a full length ORF was found in the sequence.nlm. Melt curve analysis and agarose gel electrophoresis following each qRT-PCR were performed to assess product specificity.19 kD. the isoelectric point (pI) and molecular weight of the deduced AaERF3 protein were predicted to be 6. Watford.14 and 22. and nuclease-free water were added to a final volume of 25 ll. which was subsequently confirmed by sequencing. All RNA samples were digested with DNase I (RNase-free) prior to use.Mol Biol Rep (2012) 39:9521–9527 Table 1 Primers used for PCR amplication in this study 9523 Primers Purpose Primer sequence (50 –30 ) AaERF3-F Clone CAAATTAATCAAATATACAAAACAT AaERF3-R Clone CAAGTTAAACCAATAAATTGGCGTT AaERF3-3-1 30 RACE GGGGTTCTGGGACGGTTCTTAACTTTTCGG AaERF3-3-2 30 RACE ACGAGGAAGGGAGTTCGCCTGTTTTGG RACE AAGCAGTGGTATCAACGCAGAGTAC(T)30 V N RACE Long (0. Shiga.expasy.25 lM of forward primer. and 30 s at 72 °C). respectively. JN695782) was obtained.4 lM): CTAATACGACTCACTATAGGG 30 -RACE CDS primer A SMART IITM A Oligo UPM AAGCAGTGGTATCAA CGCAGAGTACGCGGG CAAGCA GTGGTATCAACGCAGAGT Short (2 lM): CTAATACGACTCACTATAGGGC NUP RACE AAGCAGTGGTATCAACGCAGAGT AaERF3-gatewayF Clone CACCATGAATCGATTCTTTTATCCGGAAA AaERF3-gatewayR Clone TCACCAACTAGAACTACTACTGTTA AaERF3-RT-F Q-PCR AGGAAGGGAGTTCGCCTGTTTT AaERF3-RT-R Actin-F Q-PCR Q-PCR AAATTGGCGTTATAAAATTACCAGGG CCAGGCTGTTCAGTCTCTGTAT Actin-R Q-PCR CGCTCGGTAAGGATCTTCATCA Expression pattern analysis of AaERF3 by Quantitative RT-PCR Expression patterns of AaERF3 in response to hormones. The relative expression of AaERF3 indicated the increasing fold of the gene expression over the control (0 h before treatment). For each reaction. By using the method described in ‘‘Materials and methods’’. 12.org. 0. 30 s at 56 °C.gov/blast) showed 123 . Quantification of the target gene expression was carried out with comparative CT method [16]. Aliquots of 0. There was a 50 -untranslated region of 74 bp upstream from the start codon with an ATG as the transcript start. The amplification reactions of qRT-PCR were performed on an iCycler iQTM Real-Time PCR Machines (Bio-Rad.5 ll of 29 SYBR Premix ExTaqTM. Average CT values for the target gene from at least three PCRs were normalized to average CT values for actin from the same cDNA preparations and analysed using Microsoft Excel. The thermal cycle conditions used were 1 min at 95 °C followed by 40 cycles of amplification (15 s at 95 °C.25 lM of reverse primer. annua were analysed using the Real-time quantitative RT-PCR (Q-RT-PCR) method. 2 ll of diluted cDNA (corresponding to 0. UK) with gene-specific primers AaERF3-RT-F and AaERF3-RT-R. 2. Actin primers Actin-F and Actin-R.

AaERF3 should have some similar functions with AtERF1. The ERF/AP2 domain of AaERF3 is predicted to have such structures (Supplement Fig. tobacco NtERF1 and NsERF2 (Supplement Fig. ERF1 and ORA59. marked with u) [19]. including Arabidopsis AtERF1. the fused expression vector pEarlyGateway104-AaERF3 was constructed and used to perform a transient expression assay in Nicotiana benthamiana epidermal cells. The overexpression and RNAi of AaERF3 may affect the transduction of the JA and ethylene signals and the content of artemisinin in A. The treatment of JAs could significantly increase the content of artemisinin in A. From the phylogenetic tree which was constructed by NJ method. 1 Subcellular localization of AaERF3 in tobacco (Nicotiana benthamiana) epidermal cells. Tobacco epidermal cells were transiently transformed with constructs containing either control YFP or AaERF3: YFP under the control of the CaMV35S promoter. Previous studies also indicated that B3 subcluster genes of the AP2/ERFs might share similar functions [5]. Comparing with other ERFs’ nuclear localization signal (NLS). 2). annua. Ten cells of Nicotiana benthamiana epidermal segments bombarded with pEarlyGateway104AaERF3 and pEarlyGateway104 vectors were analysed. and the corresponding overlay images (right) of representative cells expressing YFP or AaERF3: YFP fusion protein are shown 123 Targeting of AaERF3 protein to both of the nuclei and the cytoplasm To examine the subcellular localization of the AaERF3 protein in vivo. While AaERF3 does not include a putative nuclear localization signal (PKRRKR) in the corresponding region. Since Arabidopsis ERF family proteins are classified into six subclusters based on their AP2/ERF conserved domains [20]. all of which are important for DNA binding [17. TaERF3. in which three b-sheets and one a-helix are predicted. LeERF1. 1. so we inferred that AaERF3 may have different localization. The transient expression experiment showed that AaERF3 protein was targeted to both of the nuclei and the cytoplasm. which were targeted to the nucleus (PKRRKR. ERF1 and ORA59 (Supplement Fig. 1). The YFP fluorescence was imaged using a Leica TCS SP5 laser scanning confocal microscope after 48 h of transiently transformation. . ERF1 and ORA59 are essential integrators of the JA and ethylene signal transduction pathways [21. too. AtERF1 and ERF1 were belonged to the B3 subcluster. annua [8–10]. Fluorescence images (left). 1). bright-field images (middle). 18].9524 Mol Biol Rep (2012) 39:9521–9527 that the AaERF3 protein shared a highly conserved ERF/ AP2 domain with other ERF proteins. AaERF3 had closest evolutionary relationships to AtERF1. Fig. And this is why Arabidopsis ORA59 was used as a query sequence for a BLAST search on GenBank. Supplement Fig. we also found that some ERFs contain an NLS. This domain is divided into two conserved segments of YRG and RAYG. 22]. ORA59.

1). Total RNA was isolated. 2 Expression profiling analysis of AaERF3 in different organs of A. some of them acts as nucleocytoplasmic shuttling proteins. 3. The data represent the mean ± SD (standard deviation) of three repeated samples respectively. the results indicated that the AaERF3 protein was not only targeted to the nuclei. from A. we find that the fluorescence brightnesses of AaERF3-YFP are stronger than those of the vector control (YFP) (Fig. old leaves (leaf). Total RNAs extracted from roots (root). 0. 12 and 24 h) followed by qRT-PCR analysis with the gene-specific primers AaERF3-RT-F and AaERF3-RT-R. We know that most of the transcription factors are targeted to the nuclei. Total RNA was isolated respectively from different organs of A. From the above analysis. which is about more than 100 fold higher than the expression in other tissues. annua [24. just like BZR1. annua were previously proven to be the highest in green young alabastrums (bud0). The glandular secretory trichomes (GSTs) are thought to be the site of biosynthesis and storage of artemisinin in A. Fig. annua followed by qRT-PCR analysis with Actin as an internal control. annua in the 5-months-old plants. stems (stem). The artemisinin content and GSTs of A. however.5. 25]. In the subcellular localization of the AaERF3 protein in vivo. The measurement was repeated three times. annua leaves under different treatments for different periods of time (0. Expression profiling analysis of AaERF3 after hormones and stress treatments In this study. respectively. Actin was used as internal control. while AaERF3 was also found to have the highest expression level in green young alabastrums [26]. we inferred that AaERF3 may have some important relevance with the synthesis of artimisnin. The results showed that AaERF3 expressed in a constitutive manner in organs. but with different levels (Fig. white alabastrums (bud1) and flowers (flower) were also subjected to the investigation of AaERF3 expression pattern in the 5-months-old plants in field. Comparing with the vector control (YFP). 6. ABA (100 lM). 2). qRT-PCR analysis was used to obtain the expression pattern of AaERF3 after hormones and stress treatments including MeJA (100 lM). 1. such as BZR1 [23]. Green young alabastrums (bud0) had the highest expression level of AaERF3. Vertical bars represent standard deviation 123 . 3 Expression profiles analysis of AaERF3 under different treatments.Mol Biol Rep (2012) 39:9521–9527 9525 Expression profiles of AaERF3 in different organs Fig. green young alabastrums (bud0). The protein of AaERF3 should be a nucleocytoplasmic shuttling protein. no matter in nuclei and cytoplasm. but also to the cytoplasm.

Wang LF. Pi Y. Yao WL. Shanghai Science and Technology Committee (Grant no. abiotic stress and development. Allen MD. Liang HX. Wang YY. B209). too (Fig. Dai LJ. Shen Q. Takahashi F. Baulcombe D (2003) An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Kamachi S. 3B). Tian WM (2011) Characterization of HbEREBP1. stereochemistry and medicinal chemistry requirements. Fujita M.1007/s11033-011-1146-y 7. Mazarel M. while in this study the expression of AaERF3 was induced by Wound. Plant J 33:949–956 16. Wang T. Shinshi H (2006) Genomewide analysis of the ERF gene family in Arabidopsis and rice. Wu SY. Rodermel SR. Ohme-Takagi M. Zhang FY.. Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. annua. characterization and expression of a jasmonate biosynthetic pathway gene encoding allene oxide cyclase from Camptotheca acuminate. Guo XX. Sakai S (2001) Isolation of a MADS-box gene (ERAF17) and correlation of its expression with the induction of formation of female flowers by ethylene in cucumber plants (Cucumis sativus L. Puthoff DP. Reddy MK. Narusaka Y. 3A). Jakobsen IB. The qRT-PCR analysis also revealed that ABA. 3D) [27]. Freya NFD. Curr Opin Plant Biol 8:397–403 123 Mol Biol Rep (2012) 39:9521–9527 3. Yamasaki K. Rivas S.). Plant Physiol 140:411–432 6. Mol Biol Rep. Tang KX (2011) Characterization of the Jasmonate Biosynthetic Gene Allene Oxide Cyclase in Artemisia annua L. annua. Curr Top Med Chem 6:509–537 8. As indicated in Fig. Shen Q. while the transcript was gradually decreased after the time point. Acknowledgments This work was funded by China ‘‘863’’ Program (grant no. Chen YF. Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the --44CT method. Biosci Rep 28:349–355 12. Livak KJ. The qRT-PCR analyses showed that AaERF3 mRNA accumulated most abundantly in green young alabastrums. Baum T (2002) Identification and characterization of a soybean ethylene responsive element-binding protein gene whose mRNA expression changes during soybean cyst nematode infection. Ando S. Chen YY. Saitou N. It was reported that Wound treatment can induce the expression of AtERF1 in Arabidopsis.9526 Ethylene (500 lM). The cloning and characterization of AaERF3 will be helpful for further transgenic studying in regulating artemisinin biosynthesis in A. Tang KX (2008) Molecular cloning. doi:10. Jiang KJ. Voinnet O. Mol Plant Microbe Interact 15:577–586 19. Source of the Antimalarial Drug Artemisinin. Noutoshi Y. a wound-responsivetranscription factor gene in laticifers of Hevea brasiliensis Muell. Lin XY. Plant Sci 178:390–397 9. Jammesc F. References 1. The phylogenetic tree analyses implied that the AaERF3 protein may have similar functions with AtERF1. Zeng QP (2010) Salicylic acid and methyl jasmonate but not Rose Bengal enhance artemisinin production through invoking burst of endogenous singlet oxygen. Methods 25:402–408 17. Jiang WM. MeJA and Ethylene treatment could also slightly induce an accumulation of AaERF3 transcription. Yang RY.5 h). The AaERF3 mRNA was induced slightly with the duration of time after the treatment of Ethylene (Fig. Sato Y. 08391911800) and Shanghai Leading Academic Discipline Project (Grant no. 2011AA100605). Yang XQ. Agarwal PK. Tang KX (2011) Characterization of the first specific jasmonate biosynthetic pathway gene allene oxide synthase from Artemisia annua. Haynes RK (2006) From artemisinin to new artemisinin antimalarials: biosynthesis. Shinozaki K (2006) Crosstalk between abiotic and biotic stress responses: a current view from the points of convergence in the stress signaling networks. Curr Opin Plant Biol 9:436–442 2. Zhang FY. Yamaguchi-Shinozaki K. Vlada F. ERF1 and ORA59. Sirichandraa C. our results indicated that Cold treatment could also induce a significant accumulation of AaERF3 transcript in 1 h (Fig. AaERF3 mRNA was substantially increased in the leaves of A. Plant Mol Bio Rep 29:489–497 10. Tateno M. while the transcript was gradually decreased after the time point (Fig. Torres MA. some of the transcriptional regulation of AaERF3 appears to be different. China Transgenic Research Program (grant no. Nei M (2001) MEGA2: molecular evolutionary genetics analysis software. doi:10. Dangl JL (2005) Functions of the respiratory burst oxidase in biotic interact ions. Mestre P. Arg Mol Biol Rep. Dong N. Chen YF. Ministry of Education. Yang SG. the expression of AaERF3 increased vigorously in Wound treated samples. Wu SY. Hart JK. up to about 6–7 fold. In a short time period (0. annua was induced in 1 h. Lu X. Surprisingly. Huang BB. extraction old and new derivatives. Fujita Y. In conclusion. Redkob YL. 3E). Plant Cell Rep 25:1263–1274 5. Deng ZX. Kumar S. Tamura K. In responding to the MeJA treatment. Liao ZH. Huang RF (2007) A novel ERF transcription activator in wheat and its induction kinetics after pathogen and hormones treatments. Leung J (2008) An update on abscisic acid signaling in plants and more. the transcript of AaERF3 in A. Nakano T. The result of subcellular localization showed that AaERF3 targeted to both of the nuclei and the cytoplasm. Lu X. Mol Plant 1:198–217 4. 3C. Suzuki K. Wang T. Valona C. Zhang ZY. J Exp Bot 58:2993–3003 . Wound and Cold treatments significantly enhanced the transcript expression of AaERF3. Sun XF. thaliana [27]. Sun XF. Liu HX. EMBO J 17:5484–5496 18. Zeng HN. Zhao DL. Fujimura T. The results showed that although AaERF3 and AtERF1 have close evolutionary relationship. Bioinformatics 17:1244–1245 15. annua maintained at the treatment of ABA for 1 h. Agarwal P. Lin XY. Cold and Wound treatments. Wasilewskaa A. Mol Bio Evol 4:406–425 14. the full-length cDNA sequence of AaERF3 was cloned and characterized from A. Sopory SK (2006) Role of DREB transcription factors in abiotic and biotic stress tolerance in plants. 2011ZX08002001). Suzuki M (1998) A novel model of DNA recognition by a beta-sheet revealed by the solution structure of the GCC-box binding domain in complex with DNA. Cold treatment did not up-regulate AtERF1 transcript levels in A.1007/s 11033-011-0976-y 11. Planta 213:943–952 13.

Pre0 M. 27.Mol Biol Rep (2012) 39:9521–9527 20. Dombrecht B. Plant Cell 12:393–404 123 . Pieterse CMJ. McGrath KC. Lundgren A. is essential in arabidopsis brassinosteroid signaling. Lindahl AL. Lorenzo O. Kazan K (2005) Repressor. Brodelius M. Reed DW. Park JH. Phytochemistry 70:1123–1128 Abad Farooqia AH. Ryu HJ. 25. Phytochemistry 68:1864–1871 Olsson ME. Udvardi MK. Cho HW. 26.and activator-type ethylene response factors functioning in jasmonate signaling and disease resistance identified via a genome-wide screen of arabidopsis transcription factor gene expression. Polichuk DR. Choe SH. Schenk PM. Sa´nchez-Serrano JJ. Nowak G (2007) Functional genomics and the biosynthesis of artemisinin. J Herbs Spices Med Plants 4:73–80 Fujimoto SY. Brodelius PE (2009) Localization of enzymes of artemisinin biosynthesis to the apical cells of glandular secretory trichomes of Artemisia annua L. Kim KM. Ohta M. Plant Cell 15:165–178 22. Manners JM. Usui A. Olofsson LM. Shinshi H. Solano R (2003) ETHYLENE RESPONSE FACTOR1 integrates signals from ethylene and jasmonate pathways in plant defense. Champion A. Ohme-Takagi M (2000) Arabidopsis ethylene-responsive element binding factors act as transcriptional activators or repressors of GCC box–mediated gene expression. Scheible WR. Memelink J (2008) The AP2/ERF domain transcription factor ORA59 integrates jasmonic acid and ethylene signals in plant defense. Sharmaa S. Khana A (1996) Effect of plant age and GA3 on artemisinin and essential oil yield in Artemisia annua L. Plant Physiol 139:949–959 21. Shuklaa A. Plant Cell 19:2749–2762 Covello PS. Teoh KH. Vos MD. Piqueras R. Edgar CI. Hwang I (2007) Nucleocytoplasmic shuttling of BZR1 mediated by phosphorylation 9527 24. Atallah M. Maclean DJ. Plant Physiol 147:1347–1357 23.