You are on page 1of 15

Origen del trmino GENETICA

El nombre gentica fue inventado en 1905 por Wiliam Bateson, un bilogo


ingls interesado en la herencia y variacin. Las circunstancias se describen en
la biografa: William Bateson, F.R.S., Naturalist por Beatrice Bateson.
Pareciera que haba enters en establecer un departamento y una ctedra
para estudiar la herencia y variacin, y Bateson era un candidato. El siguiente
texto es extrado de la biografa antes mencionada.

I- Bases Fsicas de la Herencia



1. Una cadena de ADN tiene polaridad debido a los grupos amino hidroflicos de
las bases. Correcto?
2. Hershey y Chase marcaron bacterifagos con 35S y con 32P. Explicar cmo
gracias a este marcaje pudieron demostrar que el ADN es el portador del mensaje
gentico.
3. Tienen carga las molculas de ADN? Y las de ARN? Si la tienen, a qu
(grupos) se debe?
4. Los pares G-C son estructuralmente ms estables que los A-T. Correcto?
5. a) En muestras de ADN aisladas de dos especies bacterianas desconocidas, la
adenina representa el 32 y el 17 por ciento, respectivamente, de las bases totales.
Qu proporciones relativas de adenina, de guanina, de uracilo y de citosina
cabra esperar que existiesen en las dos muestras de ADN?
b) Una de las dos especies es una bacteria termfila, aislada de un manantial de
agua caliente (64C) Podra decir cul de las dos muestras le corresponde?
6. Qu significa que las secuencias de dos cadenas de ADN sean
complementarias?
7. El ADN del bacterifago M13 tiene la siguiente composicin de bases: 23% A,
36% T, 21% G, 20% C. Qu puede deducir del ADN de este fago?
8. Definir "palndromo" en un cido nucleico. Cul es su importancia biolgica?
9. El ARN se diferencia del ADN en que, al poseer el grupo 2'-OH de la ribosa, los
enlaces fosfodister entre nucletidos se establecen de 5' a 2', en lugar de 5'-3'
como en el ADN. Es correcto? Comentar.
10. Un mARN puede contener la secuencia ATTGACCCCGGTCAA ?
11.Es posible la existencia en un tARN cualquiera de regiones con estructura
secundaria en doble hlice basada en apareamientos de bases intracatenarios?
Contestar afirmativa o negativamente. Explicar luego la respuesta, con el mayor
detalle posible.
12. La horquilla de replicacin es asimtrica porque contiene dos molculas de
ADN polimerasa, que son estructuralmente distintas. Es esto correcto?
13. Los fragmentos de Okazaki son eliminados por una ribonucleasa. Es esto
correcto?
14. El experimento de Meselson y Stahl demostr que la replicacin del ADN en E.
coli era semiconservadora. En el modelo de replicacin "dispersora" del ADN, las
hebras de ADN progenitor se escinden en fragmentos de tamao variable, y
despus se unen con fragmentos de ADN recin replicado, dando lugar a dplex
hijos cuyas hebras contienen segmentos al azar de ADN nuevo y ADN antiguo.
Explicar de qu modo el experimento de Meselson y Stahl descarta un modelo de
estas caractersticas.
15. Escriba la secuencia del segmento de ADN que ser sintetizado por la ADNpolimerasa al utilizar el siguiente ADN molde:

(5') AGCTTGCAACGTTGCATTAG (3')


16. La sntesis del ADN durante la replicacin, a partir de un determinado origen
de replicacin, se produce de forma continua en la hebra conductora y de forma
discontinua en la hebra retardada, tanto en procariotas como eucariotas. Sin
embargo, en su conjunto, el proceso transcurre aparentemente de forma
simultnea en ambas hebras a partir del origen. Cmo puede explicarlo?

Conoce el experimento que demostr inicialmente este hecho?


17. Sealar la analoga y diferencia existente entre ADN-polimerasa y ARNpolimerasa en cuanto a la formacin concreta del primer enlace fosfodister de la
nueva cadena sintetizada (ADN y ARN, respectivamente)
18. La regin estructural de un gen eucaritico contiene:
a) secuencias internas no codificantes (llamadas ...............................).
(b) secuencias internas codificantes (llamadas ...............................).
(c) secuencias terminales no codificantes (sin un nombre especfico).
Indicar a continuacin cul de las siguientes afirmaciones es correcta.
Las secuencias (a) desaparecen en la transcripcin del gen.
Las secuencias (b) desaparecen en la maduracin postranscripcional del transcrito
primario.
Las secuencias (c) desaparecen en la traduccin del mARN.
Las secuencias (c) desaparecen durante la maduracin postraduccional de las
protenas.
19. Dentro de la secuencia de transmisin de la informacin gnica (ADN -> ARN > protena), en qu punto tiene lugar con mayor frecuencia la regulacin de la
expresin gnica? Qu protenas son responsables? Cmo actan?
20. Se est estudiando una protena de levadura, cuyo extremo C-terminal tiene la
secuencia
-Asn-Met-Asn-Gly-Lys-COOH
Al someter las levaduras a radiacin ultravioleta se obtuvieron dos cepas
particulares que sintetizan variantes de esta protena, cuyas secuencias Cterminales son:
cepa A: -Asn-Met-Lys-Gly-Lys-COOH
cepa B: -Asn-Met-Asn-Gly-Lys-Trp-COOH
Deducir razonadamente qu mutaciones presenta el ADN de dichas cepas A y B,
que sean responsables de la sntesis de estas protenas variantes.
21. Comentar a qu se llama "sonda" y cul es su utilidad.
22. Qu son, de dnde se obtienen y para qu sirven las enzimas (mejor llamadas
endonucleasas) de restriccin? Cmo hacen las bacterias que producen ER para
evitar que su genoma se vea afectado por las mismas? Qu tipos de
especificidad presentan? Qu tipos de extremos pueden generar en el ADN
sustrato?
23. En qu consiste la PCR? Es una tcnica cualitativa o cuantitativa? Qu
diferencias existen entre PCR y PCR de tiempo real? Es posible hacer una PCR
a partir de ARN?Cmo? Puede utilizarse para diagnstico (la deteccin de HIV, por ejemplo)? Qu ventajas o desventajas tendra respecto a otras
tcnicas diagnsticas como el ELISA?

II- Herencia Mendeliana


1. Seale la importancia del concepto de segregacin, por un lado, e
independencia, por el otro, de la herencia de caracteres derivada de las leyes de
Mendel y qu papel juega el azar en ambos. Cul es la importancia de la
diploida en todo esto? Sera lo mismo si las arvejas fueran monoploides en vez
de diploides?
2. Cmo recombinan los genes en la meiosis?
3. a) Qu es un monohbrido? Qu es un hbrido en sentido agronmico o
comercial (por ej. un hbrido superrendidor para Clarn Rural)? b) Qu significa
hacer un cruzamiento dihbrido o trihbrido?
4. Qu es retrocruza? Y cruzamiento prueba?
5. En qu consiste la prueba de complementacin?

Problemas
1)
A una planta de arvejas que es heterocigota para el color de semilla
(el color amarillo es dominante sobre el color verde) se le permite autofertilizarse
Cules son las probabilidades de los genotipos y fenotipos predichos para la
descendencia?
2)
Cul es el patrn de herencia que cres correcto para los siguientes
pedigres? Explic tu razonamiento. Los individuos rellenos en color negro son los
afectados.

3) El albinismo, una condicin caracterizada por la falta total de pigmentos en la


piel, es en humanos un carcter recesivo. Si una pareja no afectada tiene un hijo
albino cul es la probabilidad de que su siguiente hijo sea albino?
4) El sndrome de Marfan es un raro desorden hereditario humano,
caracterizado por brazos, pierna

5) s y dedos inusualmente largos, defectos en el corazn (especialmente en la


aorta) y en ojos, entre otros sntomas. A continuacin se detalla un pedigree para
una familia donde es frecuente este desorden Cul es el patrn de herencia que
crees ms probable?

6) En moscas de la fruta, las alas curvas (curly) son recesivas respecto de las
alas rectas, y el color de cuerpo negro (ebony) es recesivo respecto al cuerpo
salvaje. Se hizo una cruza entre lneas puras con alas curvas y cuerpo color
salvaje y moscas con alas rectas y cuerpo negro. La F1 fue cruzada despus con
moscas de alas curvas y cuerpos negros para producir una generacin F2.
A. Diagramar los genotipos de este cruzamiento, empezando con la generacin
parental P y terminando en la F2.
B. Cules son las proporciones fenotpicas predichas para esta F2?
C. Suponiendo que los siguientes individuos fueron obtenidos en la F2:
114 alas curvas, cuerpo negro
105 alas curvas, cuerpo salvaje
111 alas rectas, cuerpo salvaje
114 alas rectas, cuerpo negro
Hacer un test de Chi cuadrado para evaluar si estos resultados son consistentes
con las frecuencias predichas por las leyes de Mendel.
6) Se cruzan una planta con flores azules y semillas prpuras con otra de flores
blancas y semillas verdes. Se obtuvo la siguiente informacin:
F1: Todas las plantas tienen flores azules y semillas prpuras.
F2: 103 flores azules, semillas prpura
49 flores azules, semillas verde
44 flores blancas, semillas prpura
104 flores blancas, semillas verde

Total: 300
Hacer uso de la hiptesis de que las flores azules y las semillas prpura son
caracteres dominantes y que los dos genes segregan independientemente.
Calcular el valor de Chi cuadrado Qu significa este valor en funcin de esta
hiptesis? Si decids rechazar la hiptesis porpuesta cul crees que sea la razn
por la que esto pasa?

Informacin complementaria

III- Interacciones Gnicas y Allicas


1. Explique desde el punto de vista gentico las siguientes interacciones allicas:
dominancia, codominancia, sobredominancia y dominancia incompleta
2. Qu ventajas tiene el uso de caracteres, genes o marcadores codominantes
(respecto a los dominantes) en un anlisis gentico mendeliano?
3. Normalmente, de un carcter autosmico dominante relacionado con alguna
enfermedad se espera que cada individuo afectado tenga al menos un progenitor
tambin afectado. Pero, puede suceder que ambos padres no manifiesten la
enfermedad?
4. A qu se denomina interacciones gnicas?
PROBLEMAS
1) Los perros pelados mexicanos (pertenecientes a la
raza Xoloitzcuintle, Fig. 1) tienen poco pelo y pocos
dientes. Cuando un Xoloitzcuintle se aparea con un
ejemplar de otra raza, alrededor de la mitad de las cras
son peladas. Siempre que dos perros Xoloitzcuintle se
apareen entre ellos, cerca de 1/3 de las cras tendrn pelo,
y cerca del 2/3 sern peladas. Sin embargo, dos de cada
ocho cachorros de esta cruza nacern con notables
deformaciones y no sobrevivirn. Explicar este tipo de
herencia.
2)

Figura 1: Un Xoloitzcuintle

En
tienen
otras

pollos, algunas variedades


patas plumosas, mientras que
b
no. En una cruza
entre un
Langshan
Negro
(patas
plumosas, Fig. 2a) y un Buff
Rocks
(patas no plumosas, Fig. 2b),
las
patas de la generacin F1
fueron
todas plumosas. Cuando se
hace una cruza entre dos
individuos de la F1, la
generacin
F2
est
Figura 2: a) Ejemplares de Langshan Negro.
compuesta por individuos con
b) Ejemplares de Buff Rocks.
patas
plumosas y no plumosas en
una proporcin de 15:1. Sugerir una explicacin para este fenmeno.
3) Con ganas de obtener cras de su lechuza Hedwig, Harry Potter cruza su
mascota (de plumaje blanco) con una lechuza de plumas negras. Todos los hijos
de este cruzamiento fueron de color negro. Dado que en las ltimas pocas la
magia no le dejaba el dinero suficiente para criar a sus nios, pens en abrir un

proyecto comercial de venta de bhos de criadero, por lo que Potter cruz


individuos hermanos de esta F1, obteniendo una F2 donde aparecan lechuzas de
plumajes negro, marrn y blanco en proporcin 92:31:39.
a. A qu tipo de herencia ajusta el carcter color de plumas en las lechuzas?
Viendo que en Hogwarts se estaban imponiendo las lechuzas marrones como
objeto de moda, Harry quiere tener la mxima cantidad posible de lechuzas con
este color. Si se cruzasen al azar dos lechuzas de la F2, ambos marrones
b. Qu fenotipos posibles podran aparecer en la descendencia? Determinar la
probabilidad de obtener descendientes de cada uno de los fenotipos posibles.
4) En Drosophila, los ojos rojos son el fenotipo salvaje o wild-type. Varios genes
diferentes (cada gen con dos o ms alelos) se conocen como determinantes del
color de ojos. Un alelo determina ojos prpura, y un alelo diferente determina ojos
color sepia. Ambos alelos son recesivos comparados con el rojo. Cuando moscas
con ojos color prpura son cruzadas con moscas de ojos sepia, toda la F1
resultante tiene ojos rojos. Cuando a individuos de la F1 se les permite aparearse
entre ellos, se obtiene el siguiente resultado:
146 ojos prpura
151 ojos sepia
50 ojos sepia-purpreos
444 ojos rojos
Explicar este patrn de herencia. Llevar a cabo un anlisis de chi-cuadrado para
poner a pruba tu hiptesis.

Extras
Problema 1. Las cabras de orejas largas que se aparean con cabras de orejas
cortas producen cras con un tamao mediano de orejas en la generacin F1; en
la F2 tendrn 1/4 orejas largas, 1/2 medianas y 1/4 cortas, tanto en machos como
en hembras. Las cabras machos imberbes apareadas con cabras hembras
barbadas producen progenie masculina barbada y hembras imberbes. Los machos
F2 tienen una proporcin 3/4 barbados y 1/4 imberbes, en tanto que las hembras
F2 tienen una proporcin 3/4 imberbes y 1/4 barbadas.
Cul es el modo de herencia de estos dos caracteres?
Problema 2. Indicar si dos personas de fenotipo AB, Rh+ podran tener los
siguientes descendientes, consignando los posibles genotipos, en su caso: a) A
Rh+ b) A Rhc)
0 Rh+ d) 0 RhProblema 3. En las cobayas se pueden encontrar distintos tipos de coloracin del
pelaje, como son el negro, albino, crema y sepia. Determinar los genotipos ms

d) 0 Rh-

Problema 3. En las cobayas se pueden encontrar distintos tipos de coloracin del


pelaje, como son el negro, albino, crema y sepia. Determinar los genotipos ms
probablesde
delos
los padres
padres en
cruzamientos.
probables
enlos
lossiguientes
siguientes
cruzamientos.

1
2
3
4
5
6
7
8
9

cruce
negro x negro
negro x albino
crema x crema
sepia x crema
negro x albino
negro x crema
negro x sepia
sepia x sepia
crema x albino

negro
227
10

sepia

albino

34
11
12

11
12

9
24

13
19
18

Crema

20
20
26

9
15

Problema 4. El apareamiento entre ratas de genotipo idntico produjo la siguiente


descendencia:
color crema:
47 ratas
colorde
negro:
19 albinas.
a) A qu
proporcin se
Problema 4. El14
apareamiento
entre
genotipo
idntico produjo
la siguiente
aproxima
la descendencia?
b)47
Acolor
qunegro:
tipo de
descendencia:
14 color crema:
19epistasis
albinas. se debe?
a) A qu proporcin se aproxima la descendencia?

c) b)
Cules
sonde
losepistasis
genotipos
de los progenitores y de los descendientes?
A qu tipo
se debe?
c) Cules son los genotipos de los progenitores y de los descendientes?

Problema 5. Dos plantas de guisantes con flores blancas se cruzaron entre s


dando una F1 de flores prpura. Un cruzamiento al azar entre dos plantas de la F1
produjo una descendencia de 96 plantas, de las cuales 53 eran prpura y 43
blancas. a) Qu razn fenotpica se espera aproximadamente en la F2?
b) Cules fueron los genotipos probables de los padres?

IV-Ligamiento y Mapeo
1. Cmo y cuando se encontr el fenmeno de ligamiento? Por qu contradice
las leyes de Mendel?
2. Cundo se dice que 2 genes estn en acoplamiento o en repulsin?
3. Qu relacin existe entre ligamiento y mapeo?
4. Cul es la base fsica del mapeo gentico? Qu relacin tienen los estudios
de mapeo gentico con los entrecruzamientos y quiasmas que se observan en las
meiosis? Qu similitudes, relaciones y diferencias existen entre el mapeo
gentico y el fsico o genmico?
5. Qu es y cmo se hace una prueba de 2 puntos? Qu significa la palabra
punto en prueba de 2 puntos? Implica ligamiento?
6. Qu es una unidad de mapa? Es sinnimo de centiMorgan, frecuencia de
recombinacin o de unidad de recombinacin? A cuntos nucletidos equivale
una unidad de mapa?
7. Qu es una prueba de 3 puntos?
8. Es sencillo aplicar los sistemas arriba mencionados para mapeo en humanos?
Por qu? Es posible utilizar informacin de pedigr para hacer estudios de
ligamiento?
Problemas
1) En la arveja de jardn Pisum sativum, las chauchas naranja (ch) son recesivas
a las chauchas verdes (Ch), y la sensibilidad al virus del mosaico (mo) es recesiva
con respecto a la resistencia al virus (Mo). Una planta con chauchas naranja y
sensibilidad al virus fue cruzada con una planta (de una lnea pura) con chauchas
verdes y resistente al virus. En la F1 se hizo un cruzamiento prueba, obteniendo la
siguiente F2:
160 chauchas naranjas, sensibilidad al virus
165 chauchas verdes, resistencia al virus
36 chauchas naranjas, resistencia al virus
39 chauchas verdes, sensibilidad al virus

a) Se calcul el estadstico 2 comparando estas frecuencias con las esperadas


bajo herencia mendeliana simple, obteniendo un valor de 156,5 Cul es la
hiptesis nula de este test y cul el resultado del anlisis? Justificar.
b) Calcular la distancia de mapa entre ambos genes.
2) En la descendencia de un cruzamiento prueba de un triheterocigota se
obtuvieron los siguientes resultados:
Fenotipos
ABD

Frecuencias
50

Fenotipos
aBd

Frecuencias
600

ABd
AbD

32
538

abD
abd

28
62

Se desea conocer:
a) la fase del genotipo parental
b) el locus central
c) las distancias genticas
Problema 3
En Drosophila, los caracteres alas curvadas y la falta de antenas se deben a la
accin de los correspondientes alelos recesivos de dos loci diferentes.
En la F1 del cruzamiento de una hembra de alas curvadas con un macho sin
antenas, todas las hembras eran normales y todos los machos de alas curvadas. La
segregacin obtenida en la F2 fue la siguiente:
Fenotipos
Hembras Machos
Normales
390
129
Alas curvadas
378
243
Sin antenas
240
Alas curvadas y sin antenas
132
Total
768
744


A partir de estos datos, qu podemos decir en cuanto a la localizacin de estos
genes?

3) En 1958, Luke Combs llev a su mujer al hospital. El motivo de la visita deba


ser por algo relacionado con la salud de ella, pero hoy es difcil saberlo. En cuanto
el tal Combs puso un pie en el hospital de la Universidad de Kentucky (EE. UU.),
los mdicos se fijaron ms en l que en ella. La razn: algo que a l le daba
bastante vergenza, pero que era comn en toda su familia: la piel de Luke era
azul. Un equipo mdico del hospital se encarg de seguir el caso de Combs,
labrando una historia clnica donde Combs (un hombre muy memorioso) detall el
color de piel de cada uno de sus familiares cercanos.

Pedigree de la familia de Luke Combs. En negro se muestran los afectados por la condicin piel azul.

a)
Suponiendo que se trata de un carcter monognico Qu tipo de
herencia podra postularse para el color azul de la piel de Combs? Argumente su/s
hiptesis basndose en el grfico.

b)
Cuntas de las seis hijas de Luke Combs (sombreadas en el
pedigree) podra esperarse que manifestaran el fenotipo piel azul?
En su relato, Combs coment que haba nacido a orillas del arroyo Troublesome
Creek, en un pueblo aislado y de escasa poblacin de las Montaas Apalaches,
donde eran frecuentes los casamientos entre personas medianamente
emparentadas.
c)
qu?

Este dato certifica o refuta su hiptesis planteada en el punto a? Por

El equipo mdico que estudi el caso de los Combs determin que la condicin de
Combs se deba a un trastorno sanguneo denominado metahemoglobinemia, en
el cual la hemoglobina presenta una baja efectividad para liberar el oxgeno a los
tejidos. Actualmente (luego de muchos anlisis de pedigree y estudios de
ligamiento), se sabe que esta patologa se debe a una mutacin en el gen que
codifica para la enzima citocromo b5 reductasa.
El empleo de un marcador microsatlite permite brindar diagnstico prenatal en
familias afectadas. Suponga que un marcador microsatlite (que est ubicado a 2
cM del gen que produce la enfermedad) brinda los siguientes patrones en una
electroforesis en gel de agarosa y que el alelo de 100 pb de este microsatlite
cosegrega con la variante de la citocromo b5 reductasa que produce la
enfermedad.

Electroforesis del microsatlite realizada a la familia de la consulta.

d) Qu le contestaras a una pareja sana (cuyos patrones electroforticos


muestra la figura) que ya ha tenido un hijo afectado por esta enfermedad y lo
consulta respecto a la probabilidad de concebir un nuevo embarazo cuyo beb
resulte afectado?
e) Cul (y en qu proporcin) es el patrn de microsatlites ms probable que
mostraran los hijos enfermos de esta pareja en particular?
f) Puede suceder que existan individuos que muestren el patrn de individuo
enfermo, pero que sean sanos? Por qu?
g) Qu probabilidad hay de que un hijo enfermo de esta pareja muestre el patrn
del padre?

4) El gen de resistencia al virus del mosaico del tabaco se ha tratado de mapear


en tomate respecto a marcadores moleculares que detectan RFLP. Se supone que
existe un alelo que confiere resistencia, dando un fenotipo totalmente resistente en
homocigosis, y un fenotipo parcialmente resistente en heterocigosis. Existe una
variedad de Lycopersicum peruvianum (especie emparentada al tomate)
totalmente resistente al virus pero con otras caractersticas agronmicas
indeseables. Al cruzar individuos de ambas especies se obtuvieron plantas
hbridas F1, parcialmente resistentes. Se presentan los resultados de RFLP, para
tres arcadores moleculares diferentes, de los individuos parentales y de 20
individuos originados por autofecundacin de la F1 (F2), acompaados de los
resultados fenotpicos observados en los ensayos biolgicos con el virus: R
(totalmente resistente), P (parcialmente resistente) y S.

a) Calcular el porcentaje de cosegregacin del gen de resistencia junto a cada gen


marcador e indicar cul de estas 3 sondas (pTG9, pCD3, pXY) utilizara Ud. como
marcador de RFLP para seguir la herencia del gen de resistencia al virus en un
proceso de mejoramiento a travs de cruzamientos controlados.
b) Qu ventajas tendra usar el marcador elegido para testar resistencia al virus,
en lugar de hacer el ensayo biolgico correspondiente?
c) Cuntas generaciones de retrocruza (contra la variedad susceptible) llevara,
en promedio, tener una variedad resistente al virus pero con un 99% del genoma
de la variedad agronmicamente interesante?
d) Qu individuos F2 elegira para la primera retrocruza, para tratar de acortar el
n de generaciones calculado en c)?
5) Una pareja afligida llega a vos para que le des asesoramiento gentico. Su
segundo hijo falleci poco despus de nacer debido a una enfermedad gentica y
la madre est nuevamente embarazada. El hijo fallecido ha sido el segundo en la
familia afectado por la enfermedad (el primer afectado ha sido un hermano de su

abuela paterna). Dispons, a travs de estrategias de clonado, de una sonda de la


regin cromosmica autosmica recesiva. Usando esa sonda, pudiste construir un
mapa de restriccin de dicha regin y, adems, obtuviste datos que muestran que,
en la poblacin, existe polimorfismo para sitios reconocidos por una enzima de
restriccin E (indicado +/- en la figura).

Mapa de restriccion del gen que hibrida con la sonda

Aislaste ADN de linfocitos de los abuelos y de los miembros vivos de la familia


obteniendo los correspondientes fragmentos de restriccin visualizados en el
esquema del Southern.

Ests ahora en condiciones de hacer un diagnstico prenatal a partir de clulas


fetales. Qu patrn de restriccin indicara que el feto hered la enfermedad
(dibujarlo)?