You are on page 1of 33

PITX2 Insufficiency Leads to Atrial Electrical and

Structural Remodeling Linked to Arrhythmogenesis


Ana Chinchilla, PhD; Houria Daimi, PhD; Estefana Lozano-Velasco, BS; Jorge N. Dominguez, PhD;
Ricardo Caballero, PhD; Eva Delpon, PhD; Juan Tamargo, MD, PhD; Juan Cinca, MD, PhD;
Leif Hove-Madsen, PhD; Amelia E. Aranega, MD; Diego Franco, PhD
BackgroundPitx2 is a homeobox transcription factor that plays a pivotal role in early left/right determination during
embryonic development. Pitx2 loss-of-function mouse mutants display early embryonic lethality with severe cardiac
malformations, demonstrating the importance of Pitx2 during cardiogenesis. Recently, independent genome-wide
association studies have provided new evidence for a putative role of PITX2 in the adult heart. These studies have
independently reported several risk variants close to the PITX2 locus on chromosome 4q25 that are strongly associated
with atrial fibrillation in humans.
Methods and ResultsWe show for the first time that PITX2C expression is significantly decreased in human patients with
sustained atrial fibrillation, thus providing a molecular link between PITX2 loss of function and atrial fibrillation. In
addition, morphological, molecular, and electrophysiological characterization of chamber-specific Pitx2 conditional
mouse mutants reveals that atrial but not ventricular chamber-specific deletion of Pitx2 results in differences in the
action potential amplitude and resting membrane potential in the adult heart as well as ECG characteristics of
atrioventricular block. Lack of Pitx2 in atrial myocardium impairs sodium channel and potassium channel expression,
mediated in part by miRNA misexpression.
ConclusionsThis study thus identifies Pitx2 as an upstream transcriptional regulator of atrial electric function, the
insufficiency of which results in cellular and molecular changes leading to atrial electric and structural remodeling
linked to arrhythmogenesis. (Circ Cardiovasc Genet. 2011;4:269-279.)
Key Words: Pitx2 arrhythmia atrial fibrillation gene regulation polymorphism transcription factors

itx2 is a homeobox transcription factor that plays a


pivotal role in early left/right determination during embryonic development, downstream of the nodal/lefty signaling pathway.1 The expression of Pitx2 is confined to the left
side of the embryo within the lateral plate mesoderm. With
further development, it continues to be mainly confined to the
left side in different organs, such as the stomach and the
heart.2,3 Pitx2 loss-of-function mouse mutants displayed early
embryonic lethality with severe cardiac malformations,4 7
demonstrating the importance of Pitx2 during cardiogenesis.

Clinical Perspective on p 279


Recent genome-wide association studies have suggested
new roles for Pitx2 in the adult heart.8 10 These authors have
independently reported several risk variants on chromosome
4q25 that are strongly associated with atrial fibrillation (AF)
in distinct human populations. AF-associated risk variants are
adjacent to PITX2, and although these studies8 10 do not

provide any experimental evidence that links regulation of


PITX2 expression/activity to the risk variants, it is plausible
that modulation of the expression and/or activity of PITX2 in
the adult heart have the potential to play a role in AF.
In the present study, we have confirmed the high prevalence of these genetic variants in a small cohort of AF patients
and furthermore we demonstrate for the first time that
PITX2C expression is significantly decreased in human patients with sustained AF, thus providing a molecular link
between loss of function of PITX2 and AF. In addition, we
report herein morphological, molecular, and electrophysiological characterization of chamber-specific Pitx2 conditional
mouse mutants. Deletion of Pitx2 in the atrial chambers
results in viable offspring. Electrophysiological studies in
Pitx2 atrial chamberspecific adult hearts revealed differences in the resting membrane potential, action potential
amplitude, and conductive disturbances as demonstrated by
ECG measurements. Furthermore, lack of Pitx2 in the adult

Received June 10, 2010; accepted April 7, 2011.


From the Department of Experimental Biology, University of Jaen, Jaen, Spain (A.C., H.D., E.L.-V., J.N.D., A.E.A., D.F.); the Department of
Pharmacology, Complutense University of Madrid, Madrid, Spain (R.C., E.D., J.T.); the Cardiology Department, Hospital de Sant Pau, Institute of
Biomedical Research IBB, Autonomous University of Barcelona, Barcelona, Spain (J.C.); and the Cardiovascular Research Centre CSIC-ICCC, Hospital
de la Santa Creu i Sant Pau, Barcelona, Spain (L.H.-M.).
The online-only Data Supplement is available at http://circgenetics.ahajournals.org/cgi/content/full/CIRCGENETICS.110.958116/DC1.
Correspondence to Diego Franco, PhD, Department of Experimental Biology, University of Jaen, 23071 Jaen, Spain. E-mail dfranco@ujaen.es
2011 American Heart Association, Inc.
Circ Cardiovasc Genet is available at http://circgenetics.ahajournals.org

DOI: 10.1161/CIRCGENETICS.110.958116

Downloaded from http://circgenetics.ahajournals.org/


by guest on April 2, 2015
269

270

Circ Cardiovasc Genet

June 2011

atria alters sodium and potassium channel expression, corroborating the electrophysiological findings. Thus, we provide evidence that Pitx2 is an upstream transcriptional regulator of distinct signaling pathways that provide cellular,
molecular, and electrophysiological substrates linked to atrial
arrhythmogenesis.

Cell Culture and Transfection Assays


HL-1 mouse immortalized atrial myocardial cells were used to assay
microRNA-1 gain-of-function experiments as well as Pitx2c gainand loss-of-function assays. Transfection experiments were performed using standard condition as detailed in the online-only Data
Supplement.

Statistical Analyses

Methods
Human Tissue and DNA Samples
Atrial myocardial tissue samples were obtained from patients undergoing cardiac surgery. The atrial samples were classified as patients
with (AF) and without (no AF) a recorded history of AF. Detailed
information regarding tissue processing is provided in the onlineonly Data Supplement. The study conforms to the principles outlined
in the Declaration of Helsinki.
Genomic DNA samples from 47 patients diagnosed of having AF
and 100 healthy donors with no cardiac structural and/or functional
diseases were obtained from the Spanish National DNA Bank
(BNADN, Salamanca). Polymerase chain reaction (PCR) amplification of both single nucleotide polymorphisms (SNPs) (rs2200733
and rs13143308) was carried out using flanking oligonucleotides, as
detailed in online-only Data Supplement Table 1, followed by direct
sequencing. This study was approved by the Ethics Committees of
the Spanish National DNA Bank (BNADN, Salamanca) and of the
University of Jaen, and the investigation conforms to the principles
outlined in the Declaration of Helsinki.

Transgenic Mouse Lines, Breeding Strategy, and


Mouse Genotyping
The Pitx2floxed, NppaCre, and Mlc2vCre transgenic mouse lines
have been previously described.5,11,12 Generation of conditional
atrial (NppaCre) and ventricular (Mlc2vCre) mutant mice was
performed by intercrossing hemizygous Cre deletor mice with
homozygous Pitx2floxed mice, which resulted in atrial-specific
(NppaCrePitx2/) and ventricular (Mlc2vCrePitx2/) Pitx2
mutant mice, respectively. DNA for PCR screening was extracted
from adult ear and/or tail samples and from the yolk sac in embryos.
Screening of Cre and Pitx2floxed alleles was routinely done using
used specific primers, as detailed in online-only Data Supplement
Table 1. Further details are provided as in the online-only Data
Supplement. This investigation conforms to the Guide for the Care
and Use of Laboratory Animals published by the US National
Institutes of Health.

Quantitative Reverse TranscriptasePCR Analyses


Tissue sample isolation and processing for RNA isolation were
performed using standard procedures. Reverse transcriptase (RT)PCR was performed in the Mx3005Tm QPCR System with an
MxPro QPCR Software 3.00 (Stratagene) and SYBR Green detection system. Detailed information regarding mRNA and microRNA
quantitative (q)RT-PCR analyses are provided in the online-only
Data Supplement.

ECG Recordings and


Electrophysiological Measurements
Mice were anesthetized with 2 mg/kg Ketamine (Parker-Davis)
intraperitoneally. ECG recordings were registered and analyzed
using a digital acquisition and analysis system (Power Laboratory/
4SP; www.adinstrument.com). Transmembrane action potentials
were recorded in isolated left and right atria of male control mice and
atrial-specific Pitx2 conditional mice (n5 per group) and in thin
papillary muscles from male control mice and ventricular-specific
Pitx2 conditional mice (n5 per group) through glass microelectrodes filled with 3 mol/L KCl (tip resistance, 8 to 15 mol/L) using
procedures described previously.13,14 Further details are provided in
the online-only Data Supplement.

qRT-PCR data statistical analyses were performed using unpaired


Student t test. Probability values 0.05 were considered statistically
significant and are stated on each corresponding figure legend.
Deviation from the Hardy-Weinberg equilibrium was tested by
Fisher exact test. General linear models were carried out for testing
the genotype dependence on the independent age and group variables, as detailed in the online-only Data Supplement Methods.
Allele frequencies were estimated from genotype frequencies by
gene counting. Further detail information regarding the statistical
analyses is provided in the online-only Data Supplement.

Results
rs2200733 and rs13143308 Correlate With AF
We performed a direct resequencing approach to study the
frequency of 2 SNPs previously associated with AF8 in a small
cohort of Caucasian patients with AF. A total 47 patients (25
men and 22 women) with paroxysmal or permanent AF were
recruited for the study (online-only Data Supplement Table 2).
Thirty patients presented isolated AF; 17 patients were also
diagnosed with cardiomyopathy and/or valvulopathy. Ages
ranged from 38 to 90 years (6811 years); 100 patients (44 men
and 56 women) without any cardiac structural or electrophysiological diagnosis were recruited as the control population.
Control ages ranged from 43 to 69 years (526 years) (onlineonly Data Supplement Table 3). rs2200733 (C/T or T/T) was
observed in 20 of 47 (42%) AF patients and 22 of 100 (22%)
control patients (odds ratio [OR], 2.607; 95% confidence interval [CI, 1.158 to 5.908; Fisher exact test; P0.01; Table 1).
rs13143308 (T/T or T/G) was observed in 26 of 47 (55%) AF
patients and was present in 10 of 100 (10%) control patients
(OR, 10.900; 95% CI, 4.325 to 29.594; Fisher exact test;
P0.001; Table 1) (online-only Data Supplement Figure 1).
Thus, the data demonstrate a highly significant prevalence of
rs2200733 (C/T or T/T) and rs13143308 (T/T or T/G) in patients
with AF compared with control subjects. No significant differences were obtained related to age for rs2200733 (C/T or T/T) or
for rs13143308 (T/T or T/G), respectively, using general linear
models. Furthermore, an increased frequency of rs2200733 (C/C
or C/T) but not of rs13143308 is obtained if patients are
subdivided into isolated AF (rs2200733, 16/30; 53%) and AF
patients with valvulopathy and/or cardiomyopathy (rs2200733,
4/17; 23%), although none of them reached statistical significance.

PITX2c Expression Is Impaired in Patients


With AF
To test if AF is linked to changes in the expression levels of
PITX2, we analyzed the expression levels of PITX2C, the
major PITX2 isoform expressed in the adult heart, in right
and left atrial appendage biopsies of human patients diagnosed with AF compared with samples from patients without
a history of AF (no AF) (online-only Data Supplement Table
4). Importantly, PITX2C expression, as revealed by qRTPCR, is decreased in right atria of AF patients (n5) as

Downloaded from http://circgenetics.ahajournals.org/ by guest on April 2, 2015

Chinchilla et al
Table 1.

Pitx2 Insufficiency Leads to Atrial Arrhythmogenesis

271

SNP Genotypes in AF Patients


AF Type

Sex

Isolated

With CM/VM

Male

Female

Total

C/C

14/30 (47%)

13/17 (76%)

17/25 (68%)

10/22 (45%)

27/47 (57%)

C/T

14/30 (47%)

3/17 (18%)

9/25 (36%)

8/22 (17%)

17/47 (36%)

T/T

2/30 (6%)

1/17 (6%)

1/25 (4%)

2/22 (9%)

3/47 (5%)

C/C

NA

NA

35/44 (79%)

43/56 (77%)

88/100 (88%)

C/T

NA

NA

9/44 (21%)

13/56 (33%)

22/100 (22%)

T/T

NA

NA

0/44 (0%)

0/56 (0%)

0/100 (0%)

G/G

13/30 (42%)

8/17 (50%)

11/25 (44%)

10/22 (45%)

21/47 (45%)

G/T

13/30 (42%)

6/17 (37%)

10/25 (40%)

9/22 (41%)

19/47 (40%)

T/T

5/30 (16%)

2/17 (13%)

4/25 (16%)

3/22 (13%)

7/47 (15%)

G/G

NA

NA

42/44 (95%)

48/56 (86%)

90/100 (90%)

G/T

NA

NA

2/44 (5%)

8/56 (14%)

10/100 (10%)

T/T

NA

NA

0/44 (0%)

0/56 (0%)

0/100 (0%)

rs2200733
AF patients

Control subjects

rs13143308
AF patients

Control subjects

Isolated AF
Paroxysmal

Permanent

rs2200733 AF patients C/T or T/T

16/27 (59%)

1/3 (33%)

rs13143308 AF patients G/T or T/T

17/27 (62%)

1/3 (33%)

Age
5170 y

7190 y

rs2200733 AF patients C/T or T/T

11/16 (68%)

5/11 (45%)

rs13143308 AF patients G/T or T/T

13/16 (81%)

4/11 (36%)

CM indicates cardiomyopathy and VM, valvulopathy.

compared with control subjects (n5; Figure 1). Similarly,


PITX2C expression is also decreased in left atria of AF
patients (n4) compared with control subjects (n4; Figure
1) (online-only Data Supplement Table 5). Importantly,
ENPEP, gene coding for glutamyl aminopeptidase A, which
is located in the vicinity of PITX2 in chromosome 4q25,
display randomized expression levels in AF patients (onlineonly Data Supplement Figure 2). Thus, these data provide for
the first time evidence of an association between loss of
function of PITX2 and AF in human patients.

Atrial and Ventricular Chamber-Specific Pitx2


Deletion Leads to Chamber-Specific Defects
To obtain a suitable model of Pitx2 loss of function, we have
generated conditional tissue-specific Pitx2 mutant mice by
intercrossing a Pitx2 floxed mouse line5 with 2 distinct Cre
deletor mouse lines, which rendered atrial-specific (NppaCre)11
and ventricular-specific (Mlc2vCre)12 Pitx2 mutant models,
respectively. Deletion of Pitx2 within the atrial chambers using
NppaCre and deletion of Pitx2 in the ventricular chambers using
Mlc2vCre resulted in viable chamber-specific homozygous

Pitx2-deleted mice. qRT-PCR analyses of Pitx2 expression in


the atrial chambers and the ventricular chambers revealed that
Pitx2b and Pitx2c transcript levels were reduced approximately
60% (online-only Data Supplement Figure 3), respectively,
whereas Pitx2a expression was undetectable. Thus, these conditional Pitx2 mice represent Pitx2 loss-of-function deficiency
models within the atrial and ventricular chambers. Within the
present study, we have centered our attention on the atrialspecific Pitx2 mouse mutant.
Adult NppaCrePitx2/ mutant mice display moderate
enlargement of the atrial chambers with myocardial wall
thinning, whereas the ventricular chambers display an overt
increase in size and volume (Figure 2A through 2C), which is
also characterized by a mild increase in the interventricular
septum and left ventricular free wall thickness (Figure 2D
through 2G). Increased fibrous tissue deposition is detectable
within the ventricular but not the atrial chambers (Figure 2H
through 2M), in line with procollagen qRT-PCR analyses
(Figure 2N through 2O).
To investigate whether such morphological defects were
present in atrial-specific Pitx2 conditional mouse mutants during

Downloaded from http://circgenetics.ahajournals.org/ by guest on April 2, 2015

272

Circ Cardiovasc Genet

June 2011
Because Pitx2 expression in the developing atria is confined to the left atrial chamber, we explored the expression
profile of several cardiac markers in the left atrial appendages
of NppaCrePitx2/ mutant embryos as compared with
age-matched control mice. In line with previous reports,15
Bmp10 expression was highly upregulated in the left atrial
chambers. In addition, a significant increase on Nkx2.5
expression was observed. On the contrary, Gata6, Mef2c, and
Nppa transcript levels were downregulated, whereas islet-1
and Gata4 displayed no significant differences (Figure 3J).

Atrial-Specific Pitx2-Deficient Mice Display


Electrophysiological Defects

Figure 1. PITX2C qRT-PCR analysis in AF patients. A, PITX2C


expression in right atrial biopsies from AF patients and no-AF
patients. In 4 of 5 comparisons (80%), PITX2C expression is
decreased approximately 80% to 90% in AF patients as compared with no-AF patients. B, PITX2C expression in left atrial
biopsies from AF patients and no-AF patients. In 3 of 4 (75%)
comparisons, PITX2C expression is similarly decreased (approximately 80% to 90%) in AF patients as compared with no-AF
patients. C, GAPDH normalization against PPIA, which display
no differences between AF and no-AF patients in left atria (n4),
serving as internal control. Similar results were obtained for right
atrial (n5) samples. *P0.05, **P0.01.

embryonic development, control (NppaCrePitx2flox/flox) and


mutant (NppaCrePitx2/) mouse embryos were generated,
collected at distinct developmental stages, and morphologically analyzed. Lack of Pitx2 in the developing atrial myocardium partially impaired cardiac development because a
subset (7/22; 30%) of E13.5 NppaCrePitx2/ mouse
embryos displayed enlarged and thinner atrial chambers, as
illustrated in Figure 3A through 3H), but no other morphogenetic defects were observed. Atrial length but not width
was significantly larger in NppaCrePitx2/ as compared
with NppaCrePitx2flox/flox embryos at this stage, as reflected
in Figure 3I. Enlarged atrial chambers, in both the right and
left atria, become more patent at fetal (5/10 at E15.5; 50%
and 12/15 at E17.5; 80%) stages and was characterized by
a thinner myocardial wall as compared with wild-type agematched control mice (Figure 3E through 3H). No ventricular
defects are observed in NppaCrePitx2/ embryos during
development and thus ventricular defects are likely to be
secondary to atrial chamber dysfunction.

To address potential electrophysiological changes in the


mutant mice, we analyzed the ECG recordings and action
potentials of adult Pitx2 chamber-specific mutants. ECG
recordings were similar between nontransgenic control adult
mice (data not shown), NppaCre (Figure 4A), and
NppaCrePitx2flox/flox (Figure 4C) adult mice, displaying in
all cases rhythmic ECG recordings. However, 40% (4/10) of
NppaCrePitx2/ mutants display impaired ECG recordings characteristic of an atrioventricular (AV) node block
(Figure 4B). In addition, p waves are missing in most (5/6;
85%) of the remaining adult NppaCrePitx2/ mutant
mice (Figure 4D). Morphological examination of the ventricular conduction system in NppaCrePitx2/ mutants demonstrates that the sinoatrial node (data not shown) and the
ventricular conduction system is properly organized (Figure
4J through 4M), yet the AV node and bundle of His display
reduced fibrous tissue insulation (Figure 4J through 4K).
In addition, we studied the electrophysiological properties
of dissected right and left atrial samples corresponding to the
NppaCrePitx2 background (control and mutants) and left
ventricular samples of control and conditional mutants corresponding to the Mlc2vCrePitx2 background. The characteristics of action potentials were recorded on multicellular
preparations, and the results are summarized in Table 2. Left
atria from NppaCrePitx2-deficient mice displayed a significantly more depolarized resting membrane potential (RMP)
(83.84.2 versus 87.02.7 mV) and a smaller action
potential amplitude (109.80.6 versus 114.11.8 mV) than
those from control littermate control mice (P0.05). The
depolarization of the RMP would suggest that the absence of
Pitx2 correlates with a decrease in the expression and/or
function of the channels that generate the ionic currents
involved in the control of the resting membrane potential, for
instance, the inward rectifier current (IK1). Furthermore, this
depolarization may inactivate the Na channels responsible
of the AP upstroke explaining the reduced action potential
amplitude observed in Pitx2-deficient mice. It is interesting to
note that the effects observed are chamber-specific because
significant differences were apparent only in the left atria.

Molecular Determinants of the


Electrophysiological Measurements in
Atrial-Specific Pitx2-Deficient Mouse Mutants
To further investigate the molecular substrates underlying the
decreased action potential amplitude and the depolarized
RMP in the left atria of NppaCrePitx2/ adult hearts, we

Downloaded from http://circgenetics.ahajournals.org/ by guest on April 2, 2015

Chinchilla et al

Pitx2 Insufficiency Leads to Atrial Arrhythmogenesis

273

Figure 2. Morphological remodeling of adult atrial-specific Pitx2 conditional mutants. Whole-mount ventral views (A) and isolated left
atria (B and C) corresponding to adult NppaCrePitx2flox/flox (A and B) and NppaCrePitx2/ (A and C) hearts, respectively. Observe
the increased heart size in NppaCrePitx2/ compared with control NppaCrePitx2flox/flox hearts. Left atria (la) size is significantly
enlarged in NppaCrePitx2/ (B) compared with control NppaCrePitx2flox/flox (C) hearts. Dashed lines in C represent the overlay of
the left atria dimensions illustrated in B. Four-chambered views of adult NppaCrePitx2flox/flox (D) and NppaCrePitx2/ (E) hearts are
shown. Note that atrial-specific Pitx2 mutants (E) display enlarged atrial and ventricular chambers and thickening of the interventricular
septum (IVS) (double arrows) compared with control (D) and right ventricular (rv) lumen is significantly dilated (asterisk, E). Transversal
histological sections of adult ventricular NppaCrePitx2floxed/floxed (F) and NppaCrePitx2/ (G) chambers illustrate a significant IVS
thickness (double arrows). Red sirius staining of atrial (H through K) and ventricular (L and M) histological sections of
NppaCrePitx2flox/flox (H, J, and L) and NppaCrePitx2/ (I, K, and M) adult hearts demonstrate increased fibrosis in the ventricular
(arrows, M) but not the atrial chambers in atrial-specific Pitx2 conditional mutants. qRT-PCR analyses of Col1a1 (K) and Col3a1 (L) expression in NppaCrePitx2flox/flox (black bars) and NppaCrePitx2/ (white bars) adult hearts are shown. *P0.05, **P0.01.

compared the expression of the major determinants of sodium


current (INa) and the inward rectifier current (IK1) by qRTPCR. As shown in Figure 4C and 4D, Scn5a and Scn1b
expression was severely impaired in the both left and right
atrial chambers, with milder or no changes in the ventricular
chambers of NppaCrePitx2/ adult hearts. Similarly Kcnj2,

Kcnj12, and Kcnj4 expression was severely reduced in the left


atrial myocardium but not ventricular chambers (Figure 4E
through 4G). Consistent with these findings, Western blot
analysis showed that Kir2.1 (Kcnj2) and Nav1.5 (Scn5a)
channel expression is decreased in the atrial chambers of
NppaCrePitx2/ mice (Figure 4L).

Downloaded from http://circgenetics.ahajournals.org/ by guest on April 2, 2015

274

Circ Cardiovasc Genet

June 2011

Figure 3. Morphological remodeling of


embryonic atrial-specific Pitx2 conditional mutants. Transversal histological
sections of E13.5 (A and B) and E17.5
(C through H) embryonic hearts corresponding to NppaCrePitx2flox/flox (A, C,
E, and G) and NppaCrePitx2/ (B, D,
F, and H) embryos illustrate a significant
atrial chamber enlargement (A through
D) and myocardial thinning (E through
H). F, Mean dorso-ventral length (double
arrows in A through D) of the right atrial
(ra) and left atrial (la) appendages in multiple E13.5 transversal sections demonstrate a statistically significant increase
in length in atrial-specific Pitx2 conditional mutants (black bars) compared
with control (white bars). F, Expression
levels of Nkx2.5, Bmp10, Gata6, Mef2c,
Nppa, Islet-1, and Gata4 in E17.5 left
atrial appendages corresponding to
atrial-specific Pitx2 conditional mutants
(white bars) compared with control
(black bars). *P0.05, **P0.01,
***P0.001.

Pitx2 Modulates miR-1 Expression, Thereby


Controlling IK1 but Not INa Components
To further understand the regulatory role of Pitx2 on ion
channel expression, we tested whether lack of Pitx2 in the
adult left atrial chambers impairs microRNA expression.
miR-1 qRT-PCR analyses of adult NppaCrePitx2/ left
atrial myocardium demonstrate a significant increase of
miR-1 expression (Figure 5A). Thus, these results support a
role for Pitx2 in repressing miR-1 expression, which in turn,
can regulate Kcnj2 expression.16 However, it is unknown
whether Scn5a and Scn1b can also be modulated by miR-1.

We therefore overexpressed miR-1 in HL-1 atrial cardiomyocytes, which resulted in decreased Gja1 and Kcnj2 transcripts
levels (Figure 5B), in line with previous reports,16 but did not
modify Scn5a and/or Scn1b expression (Figure 5B). To
further investigate if Pitx2 directly regulates miR-1 expression and/or Scn5a expression, we transiently transfected
HL-1 atrial adult cardiomyocytes with Pitx2c. Overexpression of Pitx2c resulted in decreased miR-1 and increased
Scn5a and Scn1b expression (Figure 5C). Furthermore, Pitx2
silencing decreased Scn5a and Scn1b expression in HL-1
cells (Figure 5D).

Downloaded from http://circgenetics.ahajournals.org/ by guest on April 2, 2015

Chinchilla et al

Pitx2 Insufficiency Leads to Atrial Arrhythmogenesis

275

Figure 4. Electrophysiological and molecular remodeling of adult atrial-specific Pitx2 conditional mutants. Shown are representative
ECG recordings (A through D) of adult NppaCre (n5) (A), NppaCrePitx2flox/flox (n10) (C), and NppaCrePitx2/ (B and D) hearts,
respectively. Observe that in control mice (NppaCre and NppaCrePitx2flox/flox), conserved R-R intervals are recording, and in all
cases a p wave can be distinguished (arrows, A and C). In 40% (4/10) of the atrial-specific conditional mutant mice (NppaCrePitx2/), an
AV block ECG pattern can be observed, as delineated by arrowheads in B and B, whereas in the remaining atrial-specific conditional
mutant (6/10), in all but one, a p wave (arrow) was frequently missing (asterisks), as illustrated in D and D, and irregular R-R intervals
were also recorded (D, double arrows). E through I correspond to qRT-PCR expression analyses of Scn5a (E), Scn1b (F), Kcnj2 (J),

Downloaded from http://circgenetics.ahajournals.org/ by guest on April 2, 2015

276

Circ Cardiovasc Genet


Table 2.

June 2011

Electrophysiological Measurements in Atrial Chamber-Specific Pitx2 Insufficient Mice

Preparation
Left atria (n5)

Pitx2 Conditional

RMP, mV

APA, mV

Vmax, V/s

APD20, ms

APD50, ms

APD90, ms

NppaCrePitx2flox/flox

87.02.7

114.11.8

174.08.7

7.31.4

23.33.5

72.28.9

89.710.0

83.84.2*

109.80.6*

170.014.8

7.30.8

24.32.6

NppaCrePitx2flox/flox

86.42.9

111.71.1

160.08.6

6.81.0

25.62.7

93.07.5

NppaCrePitx2/

85.41.7

111.52.0

164.013.4

9.12.2

31.75.6

102.38.8

Mlc2vCrePitx2flox/flox

85.32.1

116.41.7

190.014.9

8.81.7

37.05.8

145.114.6

86.23.0

114.02.5

186.08.7

14.62.5

40.23.8

124.87.8

NppaCre Pitx2
Right atria (n5)
Ventricular papillary
muscle (n5)

Mlc2vCre Pitx2

APA indicates action potential amplitude; APD, action potential duration; and Vmax, maximum upstroke velocity.

Discussion
AF is the most common cause of arrhythmogenesis in the
human population, yet, the genetic cause of AF remains
elusive.1719 Point mutations in potassium or sodium channel
genes have been associated with familial AF but account for
only a small AF fraction.19 23 Recent genome-wide association studies8 10 have reported several risk variants on chromosome 4q25, adjacent to PITX2 gene, which are associated
with AF. Although these studies do not provide any experimental evidence that links regulation of PITX2 expression/
activity to the risk variants, it has been suggested that PITX2
might be the causative link. In the present study, we demonstrate that 2 SNPs, rs2200733 and rs13143308, are highly
prevalent in a cohort of Spanish patients with AF, supporting
previous findings from other populations. In addition,
rs2200733 is more prevalent in patients with isolated AF as
compared with patients with AF and other cardiac structural
defects, providing a potential role for SNP genotyping as a
stratification tool as recently suggested.24 The mechanisms by
which these SNPs regulate PITX2 function, however, remain
unknown.
At the transcriptional level, we demonstrate for the first
time in this study that PITX2C is significantly decreased in
human patients with sustained AF, thus providing a molecular
link between PITX2 loss of function and AF. We have also
generated chamber-specific conditional Pitx2 mouse mutants,
which display a 60% reduction of Pitx2 expression in the
chamber myocardium, thus providing an experimental model
of Pitx2 insufficiency. Such incomplete Pitx2 deletion might
be attributed to incomplete and/or patchy Cre recombination
in the atrial chamber myocardium.11 Importantly, Cre recombination (NppaCre) is mainly restricted to the atrial appendage myocardium, with some weak and patchy expression in
the AV node (V. Christoffels, personal communication) but
excluding the sinoatrial and pulmonary veins myocardium.11
Lack of Pitx2 expression in the atrial myocardium leads to a
progressive enlargement of the atrial chambers, which is
consistent with the increased proliferation rate in the left
compared with the right atrium already observed from early
developmental stages.25 Furthermore, Bmp10 is highly up-

regulated in the left atrial chambers,15 supporting a role of


Pitx2 controlling atrial chamber dimensions, because overexpression of Bmp10 plays a crucial role regulating physiological hypertrophy.26 Thus, these findings support the hypothesis that selective upregulation of Bmp10 in the atrial
myocardium, mediated by Pitx2, leads to increase cell proliferation and thus larger atrial chambers. Critically, atrial
dilatation has been widely reported as a putative mechanism
triggering the onset and maintenance of arrhythmogenic
processes, including AF, in the adult heart.27
At the functional level, atrial deletion of Pitx2 leads to ion
channel remodeling events, which have been previously
linked to familiar cases of AF,21,28 supporting the notion that
Pitx2 acts upstream of these AF-prone pathways. In context,
Wang et al29 have recently reported that Pitx2 plays important
role inhibiting sinoatrial pacemaker activity in the left atrium,
thus providing susceptibility to atrial arrhythmias. Importantly, our atrial-specific deletion of Pitx2 provides evidence
of ion channel remodeling within the atrial chamber myocardium independent of altering sinoatrial node function. Specifically, we show that Pitx2 loss of function leads to
downregulation of Scn5a and Scn1b. Genetic studies have
revealed that point mutations in SCN5A and SCN1B are
associated with familiar cases of AF,28 and Scn5a loss-offunction mouse mutants also display increased atrial susceptibility to atrial arrhythmogenesis.30 Surprisingly, lack of
Pitx2 expression in atrial myocardium leads to downregulation Kcnj2, Kcnj4, and Kcnj14 expression, in contrast to the
proarrhythmogenic pattern of expression observed in humans,31 although loss of the resting membrane potential has
been also associated with atrial electric remodeling and AF.32
Atrial chamber-specific Pitx2 conditional mutants also
display conductive disturbances, such as an AV block.
Importantly, P-wave recording is frequently missing in the
NppaCRe-Pitx2flox/flox (control) and NppaCrePitx2/
atrial chamber-specific Pitx2 conditional mutants, demonstrating too an atrial chamber dysfunction. Curiously, the
morphological characteristics and anatomic location of the
sinoatrial node and the ventricular conduction system of
atrial-chamber specific conditional mutants is unaltered, yet

Figure 4 (Continued). Kcnj12 (H), and Kcnj4 (I) in right atrium (RA), left atrium (LA), and ventricular (V) chambers corresponding to
atrial-specific adult Pitx2 conditional hearts (white bars) as compared with control mice (black bars). Histological sections of the
AV conduction system of adult NppaCrePitx2flox/flox (J and L) and NppaCrePitx2/ (K and N) hearts are stained with picrosirius (J and K) and Mallory trichrome (L and M). Western blot analyses (N) of Nav1.5 and Kir2.1 expression correspond to adult
NppaCrePitx2flox/flox (wt) and NppaCrePitx2/ (Pitx2/) hearts. -Tubulin served as internal loading control. O, Semiquantitative
illustration of Nav1.5 protein expression normalized to -tubulin expression corresponding to control mice as compared with atrialspecific Pitx2 mutants. *P0.05, **P0.01.

Downloaded from http://circgenetics.ahajournals.org/ by guest on April 2, 2015

Chinchilla et al

Pitx2 Insufficiency Leads to Atrial Arrhythmogenesis

277

Figure 5. Pitx2-mediated microRNA molecular pathway. A, qRT-PCR analyses of microRNA miR-1 expression in adult
NppaCrePitx2flox/flox (control) and NppaCrePitx2/ (Pitx2/) hearts. Observe that miR-1 expression is increased approximately
2-fold in atrial-specific mutant mice as compared with control mice. B, qRT-PCR analyses of Scn5a, Scn1b, Gja1, Kcnj2, Kcnj12, and
Kncj4 expression corresponds to miR-1 overexpression in HL-1 atrial cardiomyocytes. Overexpression of miR-1 leads to a significant
decrease in the expression of Gja1, Kcnj2, and Kcnj4, in line with previous reports,14 whereas Scn5a, Scn1b, and Kcnj12 display no
significant differences. C, qRT-PCR analyses of Pitx2c, miR-1, Scn5a, and Scn1b expression in Pitx2c-transfected HL-1 atrial cardiomyocytes. Overexpression of Pitx2c leads to downregulation of miR-1 and enhanced expression of Scn5a and Scn1b. D, qRT-PCR
analyses of Pitx2b, Pitx2c, Scn5a, and Scn1b expression in Pitx2 siRNA-transfected HL-1 atrial cardiomyocytes. Silencing of Pitx2c
leads to downregulation of Scn5a and Scn1b. *P0.05, **P0.01.

there is reduced insulation of the AV node and bundle of


His.33 Thus, it is plausible that such AV block might be
caused by Pitx2 deficiency in the AVN (Cre recombination),
leading to sodium channel impairment, which in turn can
underlie AV block, as previously proposed in mice and
humans.34 Importantly, AV block is an independent risk
factor for AF in humans,28,35 and the observation of AV block
in our mouse mutant model further implicates Pitx2 in the
development of atrial proarrhythmogenic substrates.
Atrial dilation and ion channel remodeling are highly
linked events. However, it is unclear whether Pitx2 directly
regulates these ion channels or whether this might be caused

by remodeling due to atrial chamber dilation. Our results


provide for the first time evidence that lack of Pitx2 results in
impaired expression of sodium (INa) and potassium (IK1)
channel expression in atrial but not the ventricular chambers,
consistent with the altered electrophysiological properties
recorded in the left but not right adult Pitx2-deficient atrial
myocardium. Moreover, our Pitx2 gain- and loss-of-function
experiments in vitro provide direct evidence that ion channel
remodeling triggered by Pitx2 is independent of atrial chamber dilation. In addition, we demonstrate that Pitx2 can also
modulate IK1 channel expression indirectly, through regulation of miR-1,36 whereas Scn5a regulation appears to be

Downloaded from http://circgenetics.ahajournals.org/ by guest on April 2, 2015

278

Circ Cardiovasc Genet

June 2011
the Complutense University of Madrid to Dr Caballero; a translational CNIC grant (CNIC-13) to Drs Tamargo and Caballero; and the
Ministry of Science and Education (SAF2008-04903) to Dr Delpon.
This work was partially supported by a grant from the University of
Jaen (UJA2009/12/11) to Dr Dominguez.

Disclosures
None.

References

Figure 6. Pitx2-mediated signaling pathways in the developing


and adult heart. Schematic representation of the Pitx2-mediated
signaling pathways is revealed by the morphological, electrophysiological, and molecular analysis of atrial chamber-specific
Pitx2 conditional mutants.

directly exerted by Pitx2. Thus, together these data support


the notion that impaired Pitx2 expression leads to reduced ion
channel expression and function, thereby providing cellular
and molecular substrates for the onset of arrhythmogenic
events. Unfortunately, the size limits of the murine heart
makes this model unsuitable to decipher if ion channel
remodeling caused by impaired Pitx2 expression is sufficient
to induce AF, and resolution of this issue will have to wait for
the generation of Pitx2 loss of function in larger animal
models.
In conclusion, we provide the first direct evidence for a
relationship between impaired Pitx2 function and distinct cellular, molecular, and electrophysiological pathways (Figure 6) can
provide increased susceptibility to induce and/or promote atrial
arrhythmogenesis, supporting the notion that Pitx2 acts hierarchically upstream of these AF-prone pathways.

Acknowledgments
We thank Phil Gage (University of Michigan Medical School, Ann
Harbor, MI), Vincent Christoffels (Heart Failure Research Center,
Academic Medical Centre, Amsterdam, The Netherlands), and Kenneth Chien (University of California, San Diego, CA) for reagents,
Antonio Caruz and Francisco J. Esteban for expert counseling and
support on statistical analyses of genotype data, and Robert Kelly for
critical reading of the manuscript. We also thank the Spanish
National Bank of DNA (BNADN, Salamanca) for their valuable
supply of AF and control DNA samples (grant AL-09-0026). We
thank the Department of Surgery, Hospital de Sant Pau, for providing
tissue samples. Technical assistance of Berta Ballester and collaboration of the Cardiac Surgery Team at Hospital Sant Pau in providing
and handling human atrial samples is greatly appreciated.

Sources of Funding
This work was partially supported by the VI European Union
Integrated Project Heart Failure and Cardiac Repair, LSHM-CT2005-018630 to Dr Franco; a grant from the Junta de Andaluca
Regional Council to Dr Franco (CTS-1614); a grant from the Junta
de Andaluca Regional Council to Dr Aranega (CTS-03878); and
grants from the Ministry of Science and Innovation of the Spanish
Government to Dr Franco (MICINN BFU2009-11566) and to Dr
Aranega (MICINN BFU-2008-01217). This work was partially
supported by the Spanish national network REDINSCOR (RD006/
0003/0000) on heart failure, coordinated by Dr Cinca, and translational CNIC grant 2009/08 to Drs Franco, Caballero, and HoveMadsen. This work was partially supported by grants from Ministry
of Health and Consume (PI08/665 and HERACLES RD06/009
network) of the Spanish Government to Dr Tamargo; a grant from

1. Burdine RD, Schier AF. Conserved and divergent mechanisms in


left-right axis formation. Genes Dev. 2000;14:763776.
2. Schweickert A, Campione M, Steinbeisser H, Blum M. Pitx2 isoforms:
involvement of Pitx2c but not Pitx2a or Pitx2b in vertebrate left-right
asymmetry. Mech Dev. 2000;90:4151.
3. Campione M, Steinbeisser H, Schweickert A, Deissler K, van Bebber F,
Lowe LA, Nowotschin S, Viebahn C, Haffter P, Kuehn MR, Blum M.
The homeobox gene Pitx2: mediator of asymmetric left-right signaling in
vertebrate heart and gut looping. Development. 1999;126:12251234.
4. Kitamura K, Miura H, Miyagawa-Tomita S, Yanazawa M, Katoh-Fukui
Y, Suzuki R, Ohuchi H, Suehiro A, Motegi Y, Nakahara Y, Kondo S,
Yokoyama M. Mouse Pitx2 deficiency leads to anomalies of the ventral
body wall, heart, extra- and periocular mesoderm and right pulmonary
isomerism. Development. 1999;126:5749 5758.
5. Gage PJ, Suh H, Camper SA. Dosage requirement of Pitx2 for development of multiple organs. Development. 1999;126:4643 4651.
6. Lu MF. Pressman C, Dyer R, Johnson RL, Martin JF. Function of Rieger
syndrome gene in left-right asymmetry and craniofacial development.
Nature. 1999;401:276 278.
7. Lui C, Liu W, Lu MF, Brown NA, Martin JF. Regulation of left-right
asymmetry by thresholds of Pitx2c activity. Development. 2001;128:
2039 2048.
8. Gudbjartsson DF, Arnar DO, Helgadottir A, Gretarsdottir S, Holm H,
Sigurdsson A, Jonasdottir A, Baker A, Thorleifsson G, Kristjansson K,
Palsson A, Blondal T, Sulem P, Backman VM, Hardarson GA, Palsdottir
E, Helgason A, Sigurjonsdottir R, Sverrisson JT, Kostulas K, Ng MC,
Baum L, So WY, Wong KS, Chan JC, Furie KL, Greenberg SM, Sale M,
Kelly P, MacRae CA, Smith EE, Rosand J, Hillert J, Ma RC, Ellinor
PT, Thorgeirsson G, Gulcher JR, Kong A, Thorsteinsdottir U, Stefansson
K. Variants conferring risk of atrial fibrillation on chromosome 4q25.
Nature. 2007;448:353357.
9. Kaab S, Darbar D, van Noord C, Dupuis J, Pfeufer A, Newton-Cheh C,
Schnabel R, Makino S, Sinner MF, Kannankeril PJ, Beckmann BM,
Choudry S, Donahue BS, Heeringa J, Perz S, Lunetta KL, Larson MG,
Levy D, MacRae CA, Ruskin JN, Wacker A, Schomig A, Wichmann
HE, Steinbeck G, Meitinger T, Uitterlinden AG, Witteman JC, Roden
DM, Benjamin EJ, Ellinor PT. Large scale replication and meta-analysis
of variants on chromosome 4q25 associated with atrial fibrillation. Eur
Heart J. 2009;30:813 819.
10. Ellinor PT, Lunetta KL, Glazer NL, Pfeufer A, Alonso A, Chung MK,
Sinner MF, de Bakker PI, Mueller M, Lubitz SA, Fox E, Darbar D, Smith
NL, Smith JD, Schnabel RB, Soliman EZ, Rice KM, Van Wagoner DR,
Beckmann BM, van Noord C, Wang K, Ehret GB, Rotter JI, Hazen SL,
Steinbeck G, Smith AV, Launer LJ, Harris TB, Makino S, Nelis M, Milan
DJ, Perz S, Esko T, Kottgen A, Moebus S, Newton-Cheh C, Li M,
Mohlenkamp S, Wang TJ, Kao WH, Vasan RS, Nothen MM, MacRae
CA, Stricker BH, Hofman A, Uitterlinden AG, Levy D, Boerwinkle E,
Metspalu A, Topol EJ, Chakravarti A, Gudnason V, Psaty BM, Roden
DM, Meitinger T, Wichmann HE, Witteman JC, Barnard J, Arking DE,
Benjamin EJ, Heckbert SR, Kaab S. Common variants in KCNN3 are
associated with lone atrial fibrillation. Nat Genet. 2010;42:240 244.
11. de Lange FJ, Moorman AF, Christoffels VM. Atrial cardiomyocytespecific expression of Cre recombinase driven by an Nppa gene fragment.
Genesis. 2003;37:1 4.
12. Chen J, Kubalak SW, Chien KR. Ventricular muscle-restricted targeting
of the RXRalpha gene reveals a non-cell-autonomous requirement in
cardiac chamber morphogenesis. Development. 1998;125:19431949.
13. Vaquero M, Caballero R, Gomez R, Nunez L, Tamargo J, Delpon E.
Effects of atorvastatin and simvastatin on atrial plateau currents. J Mol
Cell Cardiol. 2007;42:931945.
14. Barana A, Amoros I, Caballero R, Gomez R, Osuna L, Lillo MP,
Blazquez C, Guzman M, Delpon E, Tamargo J. Endocannabinoids and
cannabinoid analogues block cardiac hKv1.5 channels in a cannabinoid
receptor-independent manner. Cardiovasc Res. 2010;85:56 67.

Downloaded from http://circgenetics.ahajournals.org/ by guest on April 2, 2015

Chinchilla et al

Pitx2 Insufficiency Leads to Atrial Arrhythmogenesis

15. Tessari A, Pietrobon M, Notte A, Cifelli G, Gage PJ, Schneider MD,


Lembo G, Campione M. Myocardial Pitx2 differentially regulates the left
atrial identity and ventricular asymmetric remodeling programs. Circ Res.
2008;102:813 822.
16. Yang B, Lin H, Xiao J, Lu Y, Luo X, Li B, Zhang Y, Xu C, Bai Y, Wang
H, Chen G, Wang Z. The muscle-specific microRNA miR-1 regulates
cardiac arrhythmogenic potential by targeting GJA1 and KCNJ2. Nat
Med. 2007;13:486 491.
17. Postma AV, Dekker LR, Soufan AT, Moorman AF. Developmental and
genetic aspects of atrial fibrillation. Trends Cardiovasc Med. 2009;19:
123130.
18. Campuzano O, Brugada R. Genetics of familial atrial fibrillation.
Europace. 2009;11:12671271.
19. Damani SB, Topol EJ. Molecular genetics of atrial fibrillation. Genome
Med. 2009;1:54 56.
20. Chen YH, Xu SJ, Bendahhou S, Wang XL, Wang Y, Xu WY, Jin HW,
Sun H, Su XY, Zhuang QN, Yang YQ, Li YB, Liu Y, Xu HJ, Li XF, Ma
N, Mou CP, Chen Z, Barhanin J, Huang W. KCNQ1 gain-of-function
mutation in familial atrial fibrillation. Science. 2003;299:251254.
21. Xia M, Jin Q, Bendahhou S, He Y, Larroque MM, Chen Y, Zhou Q, Yang
Y, Liu Y, Liu B, Zhu Q, Zhou Y, Lin J, Liang B, Li L, Dong X, Pan Z,
Wang R, Wan H, Qiu W, Xu W, Eurlings P, Barhanin J, Chen Y. A
Kir2.1 gain-of-function mutation underlies familial atrial fibrillation.
Biochem Biophys Res Commun. 2005;332:10121019.
22. Olson TM, Alekseev AE, Liu XK, Park S, Zingman LV, Bienengraeber
M, Sattiraju S, Ballew JD, Jahangir A, Terzic A. Kv1.5 channelopathy
due to KCNA5 loss-of-function mutation causes human atrial fibrillation.
Hum Mol Genet. 2006;15:21852191.
23. Ellinor PT, Nam EG, Shea MA, Milan DJ, Ruskin JN, MacRae CA.
Cardiac sodium channel mutation in atrial fibrillation. Heart Rhythm.
2007;5:99 105.
24. Husser D, Adams V, Piorkowski C, Hindricks G, Bollmann A. Chromosome 4q25 variants and atrial fibrillation recurrence after catheter
ablation. J Am Coll Cardiol. 2010;55:747753.
25. Lozano-Velasco E, Chinchilla A, Martnez-Fernandez S, HernandezTorres F, Navarro F, Lyons GE, Franco D, Aranega AE. Pitx2c modulates
cardiac-specifictranscription factors networks in differentiating cardiomyocytes from murine embryonic stem cells. Cells Tissues Organs.
March 9, 2011. [Epub ahead of print].

279

26. Chen H, Yong W, Ren S, Shen W, He Y, Cox KA, Zhu W, Li W,


Soonpaa M, Payne RM, Franco D, Field LJ, Rosen V, Wang Y, Shou W.
Overexpression of bone morphogenetic protein 10 in myocardium
disrupts cardiac postnatal hypertrophic growth. J Biol Chem. 2006;281:
2748127491.
27. Camm AJ, Luscher TM, Serruys PW. ESC Textbook of Cardiovascular
Medicine. 2nd edition. Oxford University Press, Oxford; 2009.
28. Tfelt-Hansen J, Winkel BG, Grunnet M, Jespersen T. Inherited cardiac
diseases caused by mutations in the Nav1.5 sodium channel. J Cardiovasc
Electrophysiol. 2010;21:107115.
29. Wang J, Klysik E, Sood S, Johnson RL, Wehrens XHT, Martin JF. Pitx2
prevents susceptibility to atrial arrhythmias by inhibiting left-sided
pacemaker specification. PNAS. 2010;107:97539758.
30. Dautova Y, Zhang Y, Sabir I, Grace AA, Huang CL. Atrial arrhythmogenesis in wild-type and Scn5a/delta murine hearts modelling LQT3
syndrome. Pflugers Arch. 2009;458:443 457.
31. Kharche S, Garratt CJ, Boyett MR, Inada S, Holden AV, Hancox JC,
Zhang H. Atrial proarrhythmia due to increased inward rectifier current
(I(K1)) arising from KCNJ2 mutation-a simulation study. Prog Biophys
Mol Biol. 2008;98:186 197.
32. Mary-Rabine L, Albert A, Pham TD, Hordof A, Fenoglio JJ Jr, Malm JR,
Rosen MR. The relationship of human atrial cellular electrophysiology to
clinical function and ultrastructure. Circ Res. 1983;52:188 199.
33. Suarez-Penaranda JM, Munoz JL, Rodrguez-Calvo MS, Ortz-Rey JA,
Concheiro L. The pathology of the heart conduction system in congenital
heart block. J Clin Forensic Med. 2006;13:341343.
34. Ge J, Sun A, Paajanen V, Wang S, Su C, Yang Z, Li Y, Wang S, Jia J,
Wang K, Zou Y, Gao L, Wang K, Fan Z. Molecular and clinical characterization of a novel SCN5A mutation associated with atrioventricular
block and dilated cardiomyopathy. Circ Arrhythm Electrophysiol. 2008;
1:8392.
35. Miura M, Yamagishi H, Morikawa Y, Matsuoka R. Congenital long QT
syndrome and 2:1 atrioventricular block with a mutation of the SCN5A
gene. Pediatr Cardiol. 2003;24:70 72.
36. Girmatsion Z, Biliczki P, Bonauer A, Wimmer-Greinecker G, Scherer M,
Moritz A, Bukowska A, Goette A, Nattel S, Hohnloser SH, Ehrlich JR.
Changes in microRNA-1 expression and IK1 up-regulation in human
atrial fibrillation. Heart Rhythm. 2009;6:18021809.

CLINICAL PERSPECTIVE
Atrial fibrillation (AF) is the most frequent cardiac arrhythmia, leading to a high risk of mortality and morbidity. Though
its prevalence is high, genetics of AF has remained rather elusive, with sporadic reports on point mutations in a wide variety
of ion channel encoding genes. Recently, genome-wide association studies have unraveled genetic variants (associated
with AF risk) that are located close to the homeobox transcription factor PITX2 in a large proportion of AF patients. In
the present investigation, we corroborated these findings in a small cohort of AF patients. We also provided evidence that
PITX2 is downregulated in AF patients and experimentally demonstrated that Pitx2 insufficiency results in cellular and
molecular changes leading to atrial electrical and cellular remodeling linked to atrial arrythmogenesis. Thus, these findings
provide insights into signaling pathways that are implicated in the pathogenesis of AF.

Downloaded from http://circgenetics.ahajournals.org/ by guest on April 2, 2015

SUPPLEMENTALMATERIAL

Supplementary Materials & Methods

Human tissue and DNA samples


Atrial myocardial tissue samples were obtained from patients
undergoing cardiac surgery. Specimens were obtained from the right
or left atria just prior to atrial cannulation for cardiopulmonary bypass.
After excision, samples were rapidly frozen in liquid nitrogen and
stored at -80C until analyzed. The atrial samples were classified as
patients with atrial fibrillation (AF) and without (No AF) a recorded
history of AF. Although the atrial tissue samples consisted of tissue
that would normally be discarded during surgery, permission to be
used in this study was obtained from each patient. The study was
approved by the Ethical Committee of the Hospital de la Santa Creu i
Sant Pau (Barcelona) and the investigation conforms with the
principles outlined in the Declaration of Helsinki.
Genomic DNA samples from 47 patients diagnosed of having atrial
fibrillation and 100 healthy donors with no cardiac structural and/or
functional diseases were obtained from the Spanish National DNA
Bank (BNADN, Salamanca). This study was approved by the Ethical
Committees of the Spanish National DNA Bank (BNADN, Salamanca)
and of the University of Jan and the investigation conforms with the
principles outlined in the Declaration of Helsinki.

Transgenic mouse lines and breeding strategy


The Pitx2floxed, NppaCre and Mlc2vCre transgenic mouse line have
been previously described (5, 11, 12). Generation of conditional atrial
(NppaCre) and ventricular (Mlc2vCre) mutant mice was performed by
intercrossing hemizygous Cre deletor mice with homozygous
Pitx2floxed mice. Double heterozygous were selected by PCR and
subsequently

crossed

with

homozygous

mice,

Pitx2floxed

respectively, yielding to controls (Cre-) (i.e. Mlc2vCre-Pitx2flox/flox and


NppaCre-Pitx2flox/flox, respectively), heterozygous Cre+/floxed (i.e.
Mlc2vCre+Pitx2fl/-

and

NppaCre+Pitx2fl/-,
+

respectively)
-/-

homozygous Cre+/floxed (i.e. Mlc2vCre Pitx2

and

and NppaCre Pitx2-/-,

respectively). Since homozygous mice were viable to adulthood in


both conditional deletions, mice have been bred into a pure C57Bl/6J
genetic background, and offspring from mouse lines matting were
routinely screened for the presence of the Pitx2 floxed allele and the
Cre sequence as previously reported (15). This investigation conform
the Guide for the Care and Use of Laboratory Animals published by
the US National Institutes of Health.

Mouse genotyping
DNA for PCR screening was extracted from adult ear and/or tail
samples and from the yolk sac in embryos. Screening of Cre and
Pitx2 floxed alleles was routinely done using used specific primers as
detailed in Supplementary Table 1. Cycling conditions for Cre were as
follows; 5 min at 95C, 35 cycles of 30s at 95C, 30s at 60C and 90s
at 72C, and for Pitx2 as follows; 5 min at 95C. 40 cycles of 30s at
95C, 30s at 60C and 90s at 72C, followed by a final extension step
of 10 min at 72C, respectively. PCR products were separated in
standard agarose electrophoresis and classified according to the
expected band size.

Anatomical and histological analyses


Mice were sacrificed by cervical dislocation, after ECG recordings
(see below). Adult hearts were carefully dissected and briefly rinse in
Ringers

solution

and

photographed.

Samples

processed

for

histochemistry and immunohistochemistry were fixed overnight in


freshly made sterile 4% paraformaldehyde. Samples processed for
RNA isolation were immediately snap-frozen in liquid nitrogen and
stored at -80C until used. Staged wild-type control and chamberspecific Pitx2 conditional embryos (E13.5, E15.5 and E17.5) were
carefully dissected from uterus of time-controlled pregnant females,
briefly rinse in sterile PBS and processed accordingly, Adult and
embryonic

samples

processed

for

histochemistry

and

immunohistochemitry were dehydrated through graded ethanol steps


and embedded in paraplast. Sections were cut at 10 m and

processed for hematoxylin and eosin, Mallorys thrichrome and/or


picrosirius staining.

mRNA Isolation and Reverse Transcription


Embryonic hearts (E17.5) were dissected from pregnant tissuespecific

conditional

mutants.

Neonatal

(3

weeks)

and

adult

Mlc2vCrePitx2 and Nppa-CrePitx2 conditional mutants were also


obtained. For NppaCrePitx2 (NppaCre-Pitx2flox/flox and NppaCre+Pitx2/-,

respectively) mouse mutants we carefully separately dissected the

left atrial chambers, the right atrial chambers and the ventricular
chambers, and stored in liquid nitrogen. For MlcvCrePitx2 (Mlc2vCrePitx2flox/flox and Mlc2vCre+Pitx2-/-, respectively), only the ventricular
chambers were dissected and stored in liquid nitrogen.
RNA extraction was performed using six E17.5 pooled left, right
atrial or ventricular samples of embryonic NppaCrePitx2 conditional
mutants, respectively, corresponding on each case to either control
(NppaCre-Pitx2flox/flox) or homozygous (NppaCrePitx2-/-) mutants. For
Mlc2vCrePitx2 three pooled ventricular myocardium samples of
Mlc2vCre+Pitx2-/- and their corresponding controls (Mlc2vCre-Pitx2
flox/flox

) were used. RNA extraction of adult hearts was performed using

three pooled left atrial samples NppaCre Pitx2 conditional mutants


(NppaCre-Pitx2flox/flox and NppaCre+Pitx2-/-, respectively) and a single
ventricular myocardium sample of Mlc2vCrePitx2 conditional mutants
(Mlc2vCre-Pitx2flox/flox and Mlc2vCre+Pitx2-/-, respectively). Total RNA
was isolated using Trizol (Roche) according to manufactures
guidelines and DNase treated using RNase-Free DNase (Roche) for
1h at 30C. In all cases, at least three distinct pooled samples were
used to perform the corresponding qRT-PCR experiments.
First strand cDNA was synthesized at 50C for 1h using 1 g of
RNA, oligo-dT primers and Superscript III Reverse Transcriptase
(Invitrogen) according to manufactures guidelines Negative controls
to assess genomic contamination were performed for each sample,
without reverse transcriptase, which resulted in all cases in no
detectable amplification product.

qRT-PCR (mRNA)
RT-PCR was performed in Mx3005Tm QPCR System with a MxPro
QPCR Software 3.00 (Stratagene) and SYBR Green detection
system. Reactions were performed in 96-well plates with optical
sealing tape (Cultek) in 20 L total volume containing SYBR Green
Mix (Finnzymes) and the corresponding cDNA. Two internal controls,
mouse actin and GAPDH, were used in parallel for each run.
Amplification conditions were as follows: denaturisation step of 95C
for 10 min, followed by 40 cycles of 95C for 30s, 60C for 30s, 72C
for 30s; with final elongation step of 72C for 10 min. All primers were
designed to span exon-exon boundaries using online Primer3
software Primer3input (primer3 www. cgi v 0.2) as provided in Table
1. No amplifications were observed in PCR control reactions
containing only water as the template. Each PCR reaction was
performed at least three times to obtain representative averages. The
Livak method was used to analyze the relative quantification RT-PCR
data (37) and normalized in all cases taking as 100% the wild-type
(control) value, as previously described (38).

qRT-PCR (microRNA)
miR-1 microRNA qRT-PCR was performed using Exiqon LNA
microRNA qRT-PCR primers and detection kit according to
manufacturers guidelines. All reactions were always run in triplicates
using

5S

as

normalizing

control,

as

recommended

by

the

manufacturer. SyBR Green was used as quantification system on a


Stratagene

Q-Max

2005P

qRT-PCR

thermocycler.

Relative

measurements were calculated as described by Livak & Schmittgen


(37) and control measurements were normalized to represent 100%,
as previously described (38).

Electrophysiological measurements
Transmembrane action potentials were recorded in isolated left and
right atria of male NppaCre-Pitx2flox/flox and NppaCre+Pitx2-/- mice

(n=5, per group), and in thin papillary muscles from male Mlcv2CrePitx2flox/flox and Mlc2vCre+Pitx2-/- mice through glass microelectrodes
filled with 3 M KCl (tip resistance, 8-15 M) using procedures
described previously (13,14). Multicellular preparations were perfused
with a modified Tyrodes solution of the following composition: NaCl
125, KCl 5.4, CaCl2 1.8, MgCl2 1.05, NaHCO3 24, NaH2PO4 0.42 and
glucose 11. The solution was bubbled with 95% O2 and 5% CO2
(pH=7.4)

and

maintained

at

temperature

of

35C.

The

microelectrode was connected via Ag-AgCl wire to high-input


impedance, capacity-neutralizing amplifiers (model 701; WPI, New
Haven, CT, USA). Driving stimuli were rectangular pulses (1-2 ms in
duration) delivered from a multipurpose programmable stimulator (CS220; Cibertec SA, Madrid, Spain). Action potentials were stored in a
computer by use of Acknowledge software. The following parameters
of the transmembrane action potential were measured: resting
membrane potential (RMP), amplitude (APA) and action potential
duration (ADP) measured at the 20% (APD20), 50% (APD50), and 90%
(APD90) level of repolarization. The preparations were driven at 3 Hz
and a period of 1 h was allowed for equilibration, during which a
stable impalement was obtained.

ECG recordings
Mice were anesthetized with 2mg/Kg Ketamine (PARKE-DAVIS, S.L.)
intraperitoneally. Electrocardiogram (ECG) recordings were registered
and analyzed using a digital acquisition and analysis system (Power
Lab/4SP; www.adinstrument.com). Dual Bio Amplifier was connected
to the ECG Lead Switch Box to enable recording of standard lead
configurations. For routine screening, surface ECG (lead II) were
recorded from needle electrodes that were inserted subcutaneously in
the limbs and tape secured. The signal is acquired for about 10
minutes using Chart 4.2.3 software. When recordings were finished,
the limb electrodes are removed and mice were allowed to recover
and returned to their cage. The signal averaged ECG waveform and

the 1st derivate were analyzed using SAECG (signal-averaged


electrocardiogram) extension for Chart 4 software (AD Instruments).

Cell culture and microRNA-1 transfection assays


HL-1 mouse immortalized atrial myocardial (39) cells were used to
assay microRNA-1 gain-of-function experiments. HL-1 cells (6*105
cells per dish) were culture under appropriate cell culture condition
(39) and plated 30mm culture dishes. Pre-miR-1 were transfected
with lipofectamine 2000 (Invitrogen) into HL-1 cells at 5 mmol
according to manufacturers guidelines, respectively. Negative
controls included non transfected cells as well as FAM-labeled premiR negative control transfected cells, which also allow evaluation of
the transfection efficiency. In all cases, transfection efficiencies were
greater than 50%, as revealed by observation of FAM-labeled premiR transfection. After 4 hours transfection, HL-1 cells were culture in
appropriate cell culture media as reported by Claycomb et al. 1998.
Cells were collected 24h (pre-miR treatment) after transfection.
Negative control and transfected cells were collected and processed
for RNA isolation using Trizol-base standard protocols. RNA quality
and integrity was evaluated using a Nanodrop spectrophotometer and
cDNAs were retro-transcribed accordingly. qRT-PCR measurement of
several mRNA transcripts was evaluated as described above. Control
measurements levels were normalization represent 100%, as
previously described (38).

Cell culture, Pitx2c overexpression and siRNA transfection assays


HL-1 cells (6*105 cells per well) were transfected with CMV-Pitx2c
construct at two distinct plasmid concentrations (2 and 4 g/well)
using lipofectamine 2000 (Invitrogen), according to manufacturers
guidelines. Cells were harvested for 48 hours and processed for RNA
isolation as previously described. Transfection efficiency was
evaluated by assessment of CMV-EGFP transfected cells, which
resulted in all cases in more that 60% transfected cells. In addition, in

all cases, Pitx2c quantitation was evaluated by qRT-PCR, which


resulted in 5 to 8-fold increase.
HL-1 cells (6*105 cells per well) were transfected with siRNA-Pitx2
(Sigma), at different concentrations, 25nM and 50nM, using the
Lipofectamine RNAiMAX Transfection Reagent (Invitrogen) following
the suppliers protocol. 105 cells per well were seeded and transfected
in serum free conditions for 5 hr, after that cells were collected at 24h.
siRNA efficiency was measured as percentage of Pitx2 expression
levels as compared to non-transfected controls. In all cases, silencing
of Pitx2 was higher than 70-80%.

Immunofluorescence staining and confocal analysis


Embryonic hearts (E16.5) were extracted from chamber-specific
conditional and control pregnant females, respectively. Adult hearts
from chamber-specific Pitx2 conditional and controls were also
collected. For immunofluorescent experiments, embryos and isolated
adult hearts were fixed overnight in 4% paraformaldehyde in PBS,
dehydrated in increasing ethanol steps and embedded in paraplast.
Tissues samples were sectioned at 10 m and mounted in 3aminopropyl-triethoxy-silane (AAS) coated slides.
Tissue slides were deparaffinised at 65C during 30 min,
hydrated through decreasing graded ethanol steps, and briefly rinsed
in bidest water. Unspecific bindings were blocked for 30 min in
TBSA_BSAT (10 mM Tris, 0,9% NaCl, 2% bovine serum albumin,
0,1% Triton X-100, 0,02% sodium azide) at room temperature.
Subsequently tissue sections were incubated overnight with the
corresponding primary antibody (1:100) diluted in TBSA-BSAT. The
antibodies used were: rabbit anti desmin (D8281; Sigma), anti-hcn4
(APC-052, Alomone) and anti-Nav1.5 (ASC-005, Alomone). The
excess of primary antibody was removed by a brief rinse in TBSABSAT. Thereafter, the sections were incubated in darkness with the
corresponding anti-rabbit Cy2-conjugated (Jackson Lab, USA) or antimouse TRITC-conjugated (DAKO) secondary antibodies (1:100)
respectively, during 5 hours. Sections were washed in TBSA-BSAT,

rinsed in PBS and incubated in DRAQ-5TM (Red Fluorescent CellPermeable DNA probe, from Biostatus Limited, UK) diluted (1:1000)
in PBS for 10 min. The excess of DRAQ-5TM was removed by a wash
in PBS, briefly rinsed in water, dehydrated and mounted in DPX. The
specificity of the primary antibody was assessed by lack of primary
antibody incubation which resulted in all cases in no detectable signal.
The samples were conserved in total darkness until analysed. Images
were obtained using a Leica Laser Scanning Confocal Microscope
and further edited using Adobe Photoshop software (version 7.0).

Western blotting
Adult hearts from either wild type (NppaCre-Pitx2flox/flox) or homozygous
(NppaCre+Pitx2-/-) mutants, were collected, processed accordingly and
stored in liquid nitrogen. Total protein extraction of was done using single
hearts. These samples were lysated in a small volume of 1 ml RIPA buffer
(50mM Tris pH 8,2, 1mM EDTA, 0,1% p/v Triton X-100, 1mM PMSF,
cocktail protease) using sonication. Protein quantitation was performed
using standard Commassie Protein Assay (Pierce). 10mg of total protein
was loaded in homogeneous 12,5% SDS-PAGE gels. Gels were blotted
onto nitrocellulose and probed against Kir2.1 (ab-80969-500, Abcam) or
Nav1.5 (ASC-005, Alomone) while -tubuline was used as internal loading
control (T-5168, Sigma). Primary antibody incubation was performed at
1:200, 1:100 and 1:14000, respectively. Corresponding secondary antirabbit or anti-mouse antibodies (1:10000 dilution) were used to reveal
Kir2.1, Nav1.5 and -tubuline, respectively. Signal detection was performed
using ECL Plus (GE).
Statistical analyses
qRT-PCR data statistical analyses were performed using unpaired Student
t- test. p values <0.05 were considered statistically significant and are
stated on each corresponding figure legend. Deviation from the Hardy
Weinberg equilibrium was tested by a Fisher's exact test for testing the null
of independence of the group and genotype in a (2 by 2) contingency table
with fixed marginals (alternative hypothesis: true odds ratio is not equal to

1; p-values were obtained directly using the hypergeometric distribution.


Allele frequencies were estimated from genotype frequencies by gene
counting. The study was analyzed as a case/ control study comparing the
allele frequency of both SNPs in the atrial fibrillation (47) and control (100)
groups. The odds ratio (OR) [95% CI] for both SNPs associated with
genotype was estimated from logistic regression analysis adjusted for AF
type (isolated vs associated) and atrial fibrillation/control. A p-value <0.05
was considered statistically significant. All computations of p-value, OR and
confidence interval were carried out with the two ways contingency table
analysis software (www.statpages.org/ctab2x2.html). General linear models
(GLMs) were carried out for testing the genotype dependence on the
independent age and group variables. The outcome was generated using a
binomial distribution (for testing the presence or absence of mutation)
under a logistic model as the link function.To analyze simultaneously both
polymorphisms, haplotype analyses were performed by use of Haploview
software. In these analyses, the haplotype combining the risk alleles at
each locus was used as the reference.

References
37. Livak KJ. Schmittgen T. Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T))
Method. Methods. 2001;25(4):402-408.
38. Domnguez JN. Navarro F, Franco D, Thompson RP, Arnega
AE.Temporal and spatial expression pattern of beta1 sodium
channel subunit during heart development. Cardiovasc Res. 2005;
65:842-850.
39. Claycomb WC. Lanson NA Jr, Stallworth BS, Egeland DB,
Delcarpio JB, Bahinski A, Izzo NJ Jr. HL-1 cells: a cardiac muscle
cell line that contracts and retains phenotypic characteristics of the
adult cardiomyocyte. Proc Natl Acad Sci U S A. 1998; 95:29792984.

ENEP (right atrium)

A
250

200

150

100

50

**

**

**

NoAF
AF
1
2

NoAF
AF
3
4

NoAF
AF
5
6

NoAF
AF
7
8

NoAF
AF
9
10

NoAF
AF
11
12

ENEP (left atrium)

B
**

250

200

150

100

50

**
1
2
NoAF
AF

**
3
4
NoAF
AF

5
6
NoAF
AF

**
7
8
NoAF
AF

9
10
NoAF
AF

11
12
NoAF
AF

Chinchilla et al., Supplementary Figure 2

rs2200733 (CT)

C/C

C/T

T/T

rs13143308 (GT)

G/G

G/T

T/T

Chinchilla et al., Supplementary Figure 1

B
NppaCrePitx2

Mlc2vCrePitx2

120

normalized
d units

100

80

60

40

20

0
1
Pitx2b

2
Pitx2c

4
Pitx2b

5
Pitx2c

Chinchilla et al., Supplementary Figure 3

Supplementary Table 1
Mouse qRT-PCR

Oligonucleotide sequence

Cre Forward
Cre Reverse
Pitx2 Forward
Pitx2 Reverse
Gapdh Forward
Gapdh Reverse
Gusb Forward
Gusb Reverse
Nkx2.5 Forward
Nkx2.5 Reverse
Pitx2b Forward
Pitx2b Reverse
Pitx2c Forward
Pitx2c Reverse
Nppa Forward
Nppa Reverse
Bmp10 Forward
Bmp10 Reverse
Kcnj2 Forward
Kcnj2 Reverse
Kcnj12 Forward
Kcnj12 Reverse
Kcnj4 Forward
Kcnj4 Reverse
Gja1 Forward
Gja1 Reverse
Scn1b Forward
Scn1b Reverse
Scn5a Forward
Scn5a Reverse
Mhl7 Forward
Mhl7 Reverse
Mef2c Forward
Mef2c Reverse
Mlc2a Forward
Mlc2a Reverse
Mlc2v Forward
Mlc2v Reverse
Col1a1 Forward
Col1a1 Reverse
Col3a1 Forward
Col3a1 Reverse

ATCTTCCAGGCGCACCATTGCCCCTGT
TGACGGTGGGAGAATGTTAATCCATATTGG
TCGTGTCTTAAAAGGATGTGTTTCTTC
TTCTGGAGGGTTTTCTTGTTCTAG
TCCTGGTATGACAATGAATACGGC
TCTTGCTCAGTGTCCTTGCTGG
ACGCATCAGAAGCCGATTAT
ACTCTCAGCGGTGACTGGTT
AGGTACCGCTGTTGCTTGAA
CAAGTGCTCTCCTGCTTTCC
GATAACCGGGAATGGAGACC
GTCTTTCTGGGGCAGAGTTG
GCCCACATCCTCATTCTTTC
CCTCACCCTTCTGTCACCAT
TCT CAG AGG TGG GTT GAC CT
CCT GTG TAC AGT GCG GTG TC
TCAAGACGCTGAACTTGTCG
GTTCAGCCATGACGACCTCT
GGTGTCAGCGCAAACAGTTGC
AGAGATGGATGCTTCCGAGA
GACAGAAACAGCATCCACCA
GTGTATGCACCTTGCCATTG
AGACCCTCCTCGGACCTTAC
AGACGTTACACTGGCCGTTC
ACAGCGAAAGACTGTT
TTTGACTTCACCAAGG
TGC TCA TTG TGG TGT TGA CC
CCT GGA CGC CTG TAC AGT TT
GGA GTA CGC CGA CAA GAT GT
ATC TCG GCA AAG CCT AAG GT
TGCTTTATTCCCACCT
AGTCCCAGGTAAGCTG
GGGGTGAGTGCATAAGAGGAG
AGAAGAAACACGGGGACTATGGG
AAGCCATCCTGAGTGCCTTCCG
GGTGTCAGCGCAAACAGTTGC
CCT CTC TGC TTG TGT GGT CA
AAA GAG GCT CCA GGT CCA AT
CACCTGGTCCACAAGGTTTC
ACCATCCAAACCACTGAAGC
AATGGCTCACACAAAG
CACCTGAAGGCGTGTT

Gata4 Forward
Gata4 Reverse
Gata6 Forward
Gata6 Reverse
islet-1 Forward
islet-1 Reverse
siRNA Pitx2 sense
siRNA Pitx2 antisense

GCAGCAGCAGTGAAGAGATG
GCGATGTCTGAGTGACAGGA
CTACACAAGCGACCACCTCA
CCAGAGCACACCAAGAATCC
TCCCATCCCTAAGCAC
ACCAATTGTCCACCAT
GUC CAU ACA AUC UCC GAU AdTdT
UAU CGG AGA UUG UAU GCA CdTdT

Human SNP genotyping

Oligonucleotide sequence

rs2200733 Forward
rs2200733 Reverse
rs13143308 Forward
rs13143308 Reverse

ACTAGCAAGCCCTCCAGGTT
GCAAACCACTGCCCTAAGAG
TGGGGGATGGACCAGTATAA
TTGCCAGAAGAGCTTCAGTATG

Human qRT-PCR

Oligonucleotide sequence

PITX2A Forward
PITX2A Reverse
PITX2B Forward
PITX2B Reverse
PITX2C Forward
PITX2C Reverse
GAPDH Forward
GAPDH Reverse
PPIA Forward
PPIA Reverse
ENEP Forward
ENEP Reverse

GGCGTGTGTGCAATTAGAGA
GGTCCACACAGCGATTTCTT
TCGAGTTCACGGACTCTCCT
GAGCTGCTGGCTGGTAAAGT
CTTTCCGTCTCCGGACTTTT
CGCGACGCTCTACTAGTCCT
AGCCACATCGCTCAGACAC
AACCATGTAGTTGAGGTCAATGAA
TCGAGTTGTCCACAGTCAGC
TTCATCTGCACTGCCAAGAC
TTTCTCCTGCTCCAGCTTGT
AGAAACCTTGGCCGAATTG

Supplementary Table 2
Sex

Age

1 Male
2 Male
3 Female
4 Female
5 Female
6 Male
7 Male
8 Female
9 Female
10 Female
11 Female
12 Male
13 Male
14 Male
15 Male
16 Female
17 Male
18 Female
19 Male
20 Female
21 Female
22 Male
23 Male
24 Male
25 Male
26 Male
27 Female
28 Female
29 Male
30 Male
31 Male
32 Male
33 Male
34 Male
35 Female
36 Female
37 Female
38 Female
39 Male
40 Female
41 Male
42 Male
43 Female
44 Female
45 Female
46 Male
47 Male

72
64
58
75
64
81
75
73
70
60
72
46
58
68
74
65
73
78
52
58
81
59
65
78
60
65
78
74
85
77
75
57
76
57
86
59
86
77
38
90
63
43
83
77
78
77
81

Diabetes
NO
NO
NO
NO
NO
NO
NO
YES
NO
YES
NO
NO
NO
YES
NO
YES
NO
YES
NO
NO
NO
YES
NO
NO
NO
NO
YES
NO
NO
NO
YES
NO
NO
NO
NO
YES
NO
NO
NO
NO
NO
NO
YES
NO
NO
NO
NO

Systole Dyastole
BP
BP
100
65
160
100
146
80
128
78
147
74
128
95
155
65
162
95
90
58
160
88
130
80
138
96
130
84
135
66
129
80
110
77
136
102
125
72
132
75
123
80
144
93
131
79
130
80
134
74
98
62
152
89
167
97
140
70
131
79
110
85
127
68
98
71
118
69
136
81
181
86
136
78
120
70
123
100
119
82
153
81
137
89
119
88
115
62
118
97
147
86
116
61
139
67

HTA

FA type

Isolated/CM

NO
NO
YES
NO
YES
YES
YES
YES
YES
YES
YES
NO
NO
YES
YES
NO
YES
YES
YES
NO
YES
YES
NO
YES
NO
YES
YES
YES
NO
YES
YES
YES
YES
YES
YES
YES
YES
YES
YES
NO
YES
YES
YES
NO
YES
NO
NO

Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Permanent
Permanent
Permanent
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Permanent
Permanent
Permanent
Paroxysmal
Permanent
Paroxysmal
Permanent
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Paroxysmal
Permanent
Paroxysmal
Paroxysmal
Permanent
Permanent

CM
Isolated
Isolated
Isolated
Isolated
CM
Isolated
Isolated
Isolated
Isolated
Isolated
Isolated
Isolated
CM
Valvulopathy
Isolated
CM
Isolated
Isolated
Isolated
Isolated
Isolated
Isolated
CM
Isolated
Isolated
CM
CM
CM
CM
Isolated
CM
CM
Isolated
CM
Isolated
Isolated
CM
Isolated
Isolated
Isolated
Isolated
CM
Isolated
Isolated
CM
CM

rs2200733 rs13143308
T/T
C/T
C/C
C/T
C/T
C/C
C/C
T/T
C/C
C/T
C/C
C/C
C/T
C/C
C/T
C/C
C/C
C/C
C/C
C/T
C/T
C/T
C/T
C/C
C/C
C/T
C/C
C/T
C/C
C/C
C/T
C/C
C/C
C/T
C/C
C/T
C/C
C/C
C/C
T/T
C/T
C/C
C/T
C/C
C/C
C/C
C/C

G/G
T/G
T/T
T/G
T/G
T/G
T/T
G/G
G/T
G/T
G/G
G/G
G/T
G/G
G/T
T/T
G/T
G/G
G/T
G/G
G/T
G/T
G/T
G/G
G/G
G/T
G/G
G/T
G/G
G/G
G/G
T/T
G/G
T/T
G/T
G/G
G/G
T/T
T/T
G/G
G/T
G/G
G/G
G/T
G/G
G/T
G/G

Supplementary Table 3
Sex
1 Male
2 Male
3 Male
4 Female
5 Male
6 Female
7 Male
8 Female
9 Male
10 Male
11 Male
12 Female
13 Female
14 Female
15 Male
16 Female
17 Male
18 Female
19 Female
20 Female
21 Female
22 Female
23 Male
24 Female
25 Female
26 Male
27 Female
28 Female
29 Female
30 Female
31 Female
32 Female
33 Female
34 Female
35 Male
36 Male
37 Female
38 Male
39 Male
40 Female
41 Female
42 Female
43 Female
44 Male
45 Female
46 Male
47 Female
48 Male
49 Female
50 Female
51 Female
52 Female
53 Female
54 Male
55 Male
56 Female
57 Female
58 Male
59 Female
60 Female

Age
61
53
59
49
53
55
59
69
57
53
45
61
49
47
63
55
64
56
43
43
56
46
50
51
49
65
50
57
43
45
45
56
52
47
65
45
57
45
56
57
62
57
44
60
52
66
45
52
56
50
44
59
51
57
51
45
49
53
54
44

rs2200733 rs13143308
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/T
C/C
G/G
C/C
G/G
C/T
G/G
C/T
G/T
C/C
G/T
C/C
G/G
C/T
G/T
C/C
G/T
C/C
G/T
C/C
G/T
C/C
G/T
C/T
G/T
C/T
G/G
C/T
G/G
C/C
G/G
C/C
G/G
C/T
G/T
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/T
G/G
C/T
G/G
C/C
G/G
C/C
G/G
C/T
G/G
C/T
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/T
G/G
C/T
G/G
C/T
G/G
C/C
G/G
C/C
G/G
C/T
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/T
G/G

Sex
61 Male
62 Female
63 Male
64 Male
65 Male
66 Female
67 Male
68 Female
69 Male
70 Male
71 Female
72 Male
73 Male
74 Female
75 Male
76 Female
77 Female
78 Male
79 Male
80 Female
81 Female
82 Female
83 Male
84 Male
85 Male
86 Female
87 Female
88 Male
89 Female
90 Female
91 Male
92 Male
93 Male
94 Female
95 Male
96 Female
97 Male
98 Male
99 Male
100 Female

Age
52
53
51
54
52
56
54
44
58
53
52
48
58
44
51
54
55
53
63
51
48
43
56
52
52
45
54
58
62
45
58
51
64
58
49
44
53
64
55
53

rs2200733 rs13143308
C/T
G/G
C/C
G/G
C/C
G/G
C/T
G/G
C/T
G/G
C/T
G/G
C/C
G/G
C/T
G/G
C/C
G/G
C/T
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G
C/C
G/G

Supplementary Table 4

1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18

Sex
Male
Male
Female
Female
Female
Male
Female
Male
Male
Male
Male
Male
Female
Female
Male
Male
Female
Female

Age
51
58
79
78
61
75
74
75
15
67
18
54
74
67
71
58
58
65

Diabetes
NO
NO
YES
NO
NO
NO
YES
YES
NO
NO
NO
NO
NO
NO
NO
YES
NO
NO

Hypertension
YES
YES
YES
NO
NO
YES
YES
NO
NO
NO
NO
NO
NO
YES
YES
NO
NO
NO

FA/ No AF
sinus rythmn
sinus rythmn
sinus rythmn
sinus rythmn
permanent AF
permanent AF
permanent AF
permanent AF
sinus rythmn
sinus rythmn
sinus rythmn
sinus rythmn
sinus rythmn
permanent AF
permanent AF
paroxysmal AF
permanent AF
permanent AF

Surgery
Biopsies
Valve replacement
LA
Heart transplatation
LA
Valve replacement
LA
Valve replacement
LA
Valve replacement
LA
Valve replacement
LA
Bypass
LA
Valve replacement
LA
Valve replacement
RA
Valve replacement
RA
Valve replacement
RA
Valve replacement
RA
Valve replacement
RA
Valve replacement
RA
Valve replacement
RA
Valve replacement
RA
Valve replacement
RA
Valve replacement
RA

Supplementary
Table 5

NoAF #1 RA
AF #1 RA

delta CT (PITX2C/PPIA)
right atrium
mean
SD
10,84
1,27
14,72
2,43

NoAF #2 RA
AF #2 RA

8,74
14,26

0,54
0,89

NoAF #3 RA
AF #3 RA

6,4
13,35

1,61
1,48

NoAF #4 RA
AF #4 RA

10,83
15,52

1,49
1,49

NoAF #5 RA
AF #45 RA

20,45
12,75

1,12
0,65

NoAF #1 LA
AF #1 LA

left atrium
mean
6,73
9,25

SD
0,81
0,44

NoAF #2 LA
AF #2 LA

8,51
16,35

1,13
0,49

NoAF #3 LA
AF #3 LA

7,28
20,83

0,27
0,01

NoAF #4 LA
AF #4 LA

17,58
7,92

0,92
0,86

Supplementary Figure 1 Chromatograms of SNPs (rs2200733 and


rs13143308) sequencing.

Supplementary Figure 2 qRT-PCR analyses of ENPEP in right


(panel A) and left (panel B) atrial samples of NoAF and AF patients.
Observe that expression of ENPEP displays in approximately 50% of
cases a significant decrease of expression in AF patients as
compared to NoAF, whereas in the remaining 50% displays no
significant changes or increased expression in AF patients as
compared to AF. Thus, ENPEP expression in right and left atrial
samples seems to be independent of AF.

Supplementary Figure 3 qRT-PCR analyses of Pitx2b and Pitx2c


expression in atria (NppaCrePitx2) and ventricular (Mlc2vCrePitx2)
chamber-specific conditional Pitx2 mouse mutants corresponding to
E16.5 atrial and ventricular chambers, respectively. Relative
expression of Pitx2b and Pitx2c, in age-matched control negative
littermates (black bars), as compared to conditional mutants (white
bars). Control levels are normalized to 100%. Observe that Pitx2b and
Pitx2c are decreased between 60 to 80% in both atrial and ventricular
chamber-specific Pitx2 conditional mutants.

Supplementary Table 1. Oligonucleotide sequences used for qRTPCR expression analyses, SNPs (rs2200733 and rs13143308)
genotyping and Pitx2 siRNA silencing.

Supplementary Table 2. Clinical data and rs2200733 and


rs13143308 genotype corresponding to the AF cohort of patients

Supplementary Table 3. Clinical data and rs2200733 and


rs13143308 genotype corresponding to the control cohort of patients.

Supplementary Table 4. Clinical data corresponding to the AF and


No AF cohorts used for PITX qRT-PCR analyses in the atrial biopsies.

Supplementary Table 5. Mean values of the delta Ct value between


PITX2C levels and PPIA levels in NoAF and AF right and left atrial
qRT-PCR analyses. SD, standard deviation.

PITX2 Insufficiency Leads to Atrial Electrical and Structural Remodeling Linked to


Arrhythmogenesis
Ana Chinchilla, Houria Daimi, Estefana Lozano-Velasco, Jorge N. Dominguez, Ricardo
Caballero, Eva Delpn, Juan Tamargo, Juan Cinca, Leif Hove-Madsen, Amelia E. Aranega and
Diego Franco
Circ Cardiovasc Genet. 2011;4:269-279; originally published online April 21, 2011;
doi: 10.1161/CIRCGENETICS.110.958116
Circulation: Cardiovascular Genetics is published by the American Heart Association, 7272 Greenville Avenue,
Dallas, TX 75231
Copyright 2011 American Heart Association, Inc. All rights reserved.
Print ISSN: 1942-325X. Online ISSN: 1942-3268

The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circgenetics.ahajournals.org/content/4/3/269

Data Supplement (unedited) at:


http://circgenetics.ahajournals.org/content/suppl/2011/04/21/CIRCGENETICS.110.958116.DC1.html

Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation: Cardiovascular Genetics can be obtained via RightsLink, a service of the Copyright Clearance
Center, not the Editorial Office. Once the online version of the published article for which permission is being
requested is located, click Request Permissions in the middle column of the Web page under Services. Further
information about this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation: Cardiovascular Genetics is online at:
http://circgenetics.ahajournals.org//subscriptions/

Downloaded from http://circgenetics.ahajournals.org/ by guest on April 2, 2015