You are on page 1of 13

LAS CLULAS EPITELIALES ALVEOLARES DE

TIPO II EN CULTIVO PRIMARIO.


1.
2.
3.
4.
5.
6.

Laboratorio Estatal Clave de Enfermedades Respiratorias y Guangzhou Instituto de Enfermedades


Respiratorias , Guangzhou, Guangdong , China
El Primer Hospital Afiliado de la Universidad Mdica de Guangzhou , Guangzhou, Guangdong , Centro de
Investigacin China
Keenan de Ciencias Biomdicas del Hospital St. Michael , Toronto , Ontario , Canad
Departamento de Medicina de la Universidad de Toronto , Toronto , Ontario , Departamento de Anestesia
Canad
Universidad de Toronto , Toronto , Ontario , Departamento de Fisiologa Canad
Universidad de Toronto , Toronto , Ontario , Canad

EXTRACTO:
Las clulas epiteliales alveolares del tipo II (AEII), son una estructura clave de defenza, pero tambin son
objetivo en muchas enfermedades pulmonares, como el sndrome agudo respiratorio, como en una
lesin pulmonar inducida por el ventilador, y fibrosis pulmonar. Wesought a establecido un mtodo
ptimo para el alto mantenimiento, rendimiento y una lista larga de caractersticas de las clulas AEII, y
as facilitar la investigacin de los mecanismos de las enfermedades pulmonares a diferentes niveles.
Los tejidos normales perifricos humanos de pulmn, de pacientes con cncer, se recogieron mediante
reseccin. Se aislaron las clulas AEII e identificaron la expresin de la protena pro-surfactante (SP) C,
canal de sodio epitelial (aENaC) y citoqueratina (CK) -8, los cuerpos lamelares especficos para las
clulas AEII, y fueron confirmados por estudios histolgicos mediante microscopa electrnica. Las
clulas de fenotipo AEII se caracterizan por la expresin de protenas pro-surfactantes (SP-A, SP-B, SPC, SP-D), CK-8, KL-6, aENaC, y acuaporina (AQP) -3.Se ha optimizado un mtodo para el aislamiento,
de alta pureza y largo mantenimiento, del fenotipo humano de clulas AEII en cultivo primario. Este
mtodo proporciona una herramienta importante para estudios destinados a los mecanismos
moleculares de las enfermedades pulmonares exclusivamente en clulas AEII.

INTRODUCCIN:
El epitelio alveolar de pulmn, est compuesto de clulas de tipo I y tipo II ( Mason 2006 ). Las
clulas epiteliales alveolares tipo II ( AEII ) son cbicas, y constituyen el 60 % de todo el tejido.
Estas, desempean un papel importante en el mantenimiento de la funcin integral del alveolo
pulmo nar ( Driscoll et al., 1995 ) , y sirven como progenitoras de las clulas AEI que
contribuyen a la reparacin del epitelio alveolar ( UHAL 1997 ; Fehrenbach 2001 ) . Las clulas
AEII son consideradas defensoras de los alvolos, dadas sus funciones fisiolgicas y
biolgicas, como sintetizar, segregar y reciclar los componentes del surfactante que controla la
tensin superficial alveolar. Las clulas AEII regulan el transporte de iones de sodio del epitelio
al despacho de fluidos alveolares; modulan el equilibrio de la fibrinolisis y la coagulacin; por lo
tanto, contribuyen a la defensa del sistema husped. Las clulas AEII no slo guan los
neutrfilos en el espacio alveolar durante su emigracin; sino, actuan como clulas efectoras
mediante la interaccin con clulas mviles, ya sea directamente por el contacto clula-clula o
indirctamente por contacto ligando-receptor a travs de la liberacin de citoquinas y factores
de crecimiento. Las AEII son particularmente vulnerables a la tensin mecnica, como se
evidencia en el sndrome de distrs respiratorio agudo (SDRA) y en la lesin pulmonar inducida
por el ventilador.
Para comprender los mecanismos de SDRA y la lesin pulmonar inducida por el ventilador a
nivel celular y molecular, nuestros investigadores se centraron en la mecano-transduccin, la
reparacin y el fenotipo de transicin; esto se realiz utilizando clulas epiteliales bronquiales

humanas (es decir, BEAS-2B), clulas AEII (es decir, A549), o clulas AEII primarias, de
roedores. En varios, han surgido preocupaciones acerca de las diferencias de activacin de las
vas de seal observadas entre las clulas bronquiales y las clulas del epitelio alveolarl, la
prdida de fenotipo de clulas AEII humana en als lneas celulares transformadas y clulas de
las diferentes funciones de AEII, entre humanos y animales. Distintos grupos han desarrollado
mtodos para aislar clulas AEII en cultivos primarios. En diferentes condiciones de cultivo, las
clulas AEII primarios tendieron a diferenciarse en clulas AEI demostrando, hasta la fecha,
dificultad en mantener las clulas AEII humanas en cultivos surfactantes. Para superar los
problemas mencionados anteriormente, se combin tcnicas anteriores modificandolas
(Ehrhardtet al., 2005; . Yu et al 2007;. Bove et al 2010) para para clulas humanas AEII de la
periferia del tejido pulmonar libre de tumores, de los pacientes sometidos a la reseccin
pulmonar. Nuestro enfoque se centra en la mejora y el mantenimiento del fenotipo de las
clulas AEII y su funcin.

MTODOS:
El estudio fue aprobado por el Consejo tico de Investigacin del Primer Hospital Afiliado de la
Universidad Mdica de Guangzhou (201.232) para el uso del aislamiento material humano de
clulas AEII primarios. Las muestras y mtodo de aislamiento fueron establecidos por la
adaptacin y modificacin de varios protocolos anteriores. En condiciones estriles, la muestra
de las porciones distales de tejido pulmonar normal (6-10 g) se obtuvo de los pacientes
sometidos a reseccin pulmonar. La muestra se cort en 1 cm3 de tamao y se lava con buffer
HEPES solucin salina balanceada (BSS) hasta que se aclare. Las piezas de pulmn se picada
(0,5 mm3) con unas tijeras ojo y luego se transfirieron a un vaso de precipitados esterilizado
que contiene 50 ml de BSS. Despus de mezcla suave, la solucin de tejido se filtr pasando
througha malla (150 lm) filtro de clulas. El tejido restante se lav al menos tres veces, y se
incub en una solucin que contiene 3 ml de tripsina (10.000 U / ml; Sigma, Saint Louis, MO) y
300 LL de la elastasa (5,1 U / ml; Worthington, Lakerwood, NJ) durante 45 minutos en un bao
de agua con agitacin a 37 C. DNasa I en 2 mL (10000 U / ml, Sigma, Saint Louis, MO)
durante 15 min. La actividad enzimtica se detuvo utilizando 40 ml solucin de inhibicin (30 ml
DMEM / F-12, 1: 1, Invitrogen; GrandIsland, NY 10 ml de FBS y 1 ml de DNasa I 10000 U / ml)
.La suspensin digerida despus se diluy mediante la adicin de 400 ml BSS y whiffled a
fondo durante 10 min con una pipeta Pasteur. La suspensin se filtr a travs de clulas
formadores en el tamao de 150, 75, y 40 lm en tndem para recaudar los de la suspensin
celular en bruto. Despus de la centrifugacin AT400 g durante 10 min a aire de la habitacin,
el sedimento celular se resuspendi en medio de adhesin para macrfagos y fibroblastos
(22,5 ml DMEM / F-12, 1: 1; 22,5 ml manera de aire pequeo medio de crecimiento de clulas
epiteliales, SAGM, Lonza, Walkersville, MD; 5 ml de FBS y 1 ml de DNasa I 10000 U / ml) y se
transfiri a 100 mm placas de Petri (10 ml de cada uno) .Despus de la incubacin a 37 C
durante 150 min, un tiempo optimizado de nuestros estudios piloto, los macrfagos y las
fibroblastos adjuntos en los platos de cultivo celular fueron separados de las clulas epiteliales
que tuvieron ms tiempo para ser adjunta enel medium.This procedimiento de adhesin
diferencial se repiti tres veces, y luego las clulas se recogieron AEII suavemente y se
centrifug a 300 g durante 10 min a aire de la habitacin . Los sedimentos celulares se
resuspendieron en 3 ml de DME / F12 y la suspensin celular en bruto se estratific en un
1,040 a 1,089 g / ml gradientes discontinuos de Percoll. Una solucin de 40 ml de un gradiente
de luz (1,040 g / ml) contena 4 ml de PBS 109,12.55 ml de solucin de Percoll, y 23,45 ml de
agua destilada. Una solucin de 40 ml gradiente pesado (1,089 g / ml) contena 4 ml de PBS
solucin 109,25.96 ml de Percoll (MP Biomedical), 10,04 ml. agua destilada, y una gota de rojo
de fenol. Cada solucin en 3 ml de volumen se carg suavemente en FBS del 15-mLcentrifuge
tubos, seguido por centrifugacin a 300 g durante 20 min a 4 C utilizando un batiente rotor

para generar una capa enriquecida de clulas AEII en la interfaz entre los dos capas de
gradientes de Percoll. La desaceleracin se logr mediante la desconexin de la alimentacin
cuando se alcanz el tiempo de centrifugacin deseado. Los sedimentos celulares enriquecidas
se transfirieron a un tubo de centrfuga de 15 ml que contena 13 ml de BSS y se centrifugaron
dos veces a 300 g durante 10 min a aire de la habitacin. Los grnulos de clulas se
resuspendieron en 2 ml de BSS y un enfoque de separacin de perlas magnticas se aplic
para eliminar cualquier posible contaminacin de los macrfagos (anti-CD14 microbolas;
Miltenyi Biotec, Bergisch Glad-Bach, Alemania). Las clulas AEII aisladas se centrifugaron a
300 g durante 10 min a aire de la habitacin, se resuspendieron en 2 ml. SAGM que contiene
1% de SFB, y se incubaron en
Tabla 1. Comparacin de los diferentes protocolos utilizados para el aislamiento de clulas AEII
humanos.
Protocolo

Tejido

Perfusin
Tampn de
digestin

Filtracin
Eliminacin de
fibroblastos

Eliminacin de
macrfagos

Estudio actual

Referencia Yu et al
(2007)

Porciones distales
de tejido pulmonar
normal, de cncer de
pulmn sometidos a
reseccin pulmonar
No aplicado

Pulmn Cadaveric
disminuido en red de
donantes

El uso de tripsina (
10.000 U / ml) para
picar el tejido
pulmonar, y elastasa
( 5 U / ml) para la
digestin
150 , 75 y 40 lm en
tndem
Medianas
adherencia, 150 min
3 veces

El medio de cultivo

Perlas magnticas
medio Adhesin anti
- CD14
SAGM+1%FBS

Morfologa

Quistes alveolares

Marcadores de
clulas

Cuerpos lamelares ,
SP -A, SP- B , SP -C
, SP -D; Cytokaretin 8, KL -6, AQP - 3
12 , 21, 28 das

Los puntos del


tiempo de
evaluacin fenotipo
AEII

Perfusin de la
arteria pulmonar
El uso de 13 U / ml
de elastasa para la
digestin

150 , 30 lm en
tndem
NO

Perlas magnticas
anti - CD14
MEM + 10 % FBS +
2 % de alto factor de
crecimiento matrigel
Quistes alveolares
Cuerpos lamelares
de Papanicolaou ,
Prosp -C
4 das

Referencia
Ehrhardt et al.
(2005)
Porciones distales
de tejido pulmonar
normal de cncer de
pulmn sometidos a
reseccin pulmonar
No aplicado
El uso de tripsina (
10.000 U / ml) para
picar el tejido
pulmonar, y elastasa
( 60 U / ml) para la
digestin
40 lm
Medianas
adherencia, 90 min
perlas magnticas,
una vez, y antifibroblastos
Adhesin medio anti
- CD14
SAGM

Referencia Bove et
al. (2010)
Pulmonares
normales rechazada
para el trasplante

Lavado del bronquio


principal
El uso de 13 U / ml
de elastasa para la
digestin

150 , 40 lm en
tndem
NO

IgG platos
recubiertos con
anticuerpos
DMEM+10%FBS

Epiteliales alveolares
tipo I
Papanicolaous

guijarro

6-10 das

5 das

Cuerpos lamelares ,
Prosp -C

en placas de cultivo de 60 mm a 37 C durante 60 h, mientras que medio se cambi cada dos


das. Las clulas fueron subcultivadas en cualquiera SAGM o DMEM que contena 1% o 10%
de FBS durante un mximo de 21 das.

ENSAYOS DE VIABILIDAD CELULAR Y LA PROLIFERACIN:


Las clulas AEII ( 1 9 104 / ml) se sembraron en placas de 24 pocillos en un 5% incubadora de
CO2 a 37 C . Las clulas AEII adicionales ( 3 x 104 ) se sembraron en insertos de cultivo de
clulas de sistema de seis as transwell (poro 0,4 lm , Lowell , MA) con medio de cultivo , tanto
en los compartimentos apical y basal . Tras la confluencia , las clulas en la superficie apical se
expone al aire por la eliminacin del medio de cultivo del compartimiento apical para formar una
cultura interfase aire-lquido (Chen et al. 2009 ) . La viabilidad celular y el recuento se llevaron a
cabo en los das 2 , 21 y 28 mediante el ensayo de exclusin de azul tripn . El nivel de
duplicacin de la poblacin se define como el nmero total de veces que el crecimiento celular
se ha duplicado desde la siembra inicial despus del aislamiento , y se calcula con una frmula
( Hayflick 1973 ) .
MICROSCOPA ELECTRNICA DE TRANSMISIN:
La microscopa electrnica de transmisin es el estndar de oro para identificar clulas AEII (
Fraslon et al ., 1993) , como la tcnica puede mostrar las caractersticas ultraestructurales
claramente especficos como cuerpos lamelares y microvellosidades . AEII clulas se rasparon
suavemente y despus se fijaron deshidratado, y se incluyeron como previamente publicado (
Driscoll et al. 1995 ) . Se cortaron secciones finas , se tieron con acetatee de uranilo y citrato
de plomo , y se examinaron en un microscopio electrnico de transmisin (Philips CM- 10 )
operado a 80 KV.

EVALUACIN DE LA UNIN ESTRECHA:


Para examinar la unin estrecha , las clulas AEII ( 1 9 105 / pocillo ) se cultivaron en
electrodos estndar matriz de 8 pocillos ( 8W10E + Aplicadas Biofsica , Troy , NY) . La clula sustrato de deteccin de impedancia elctrica (IEM ) tcnica (Applied Biofsica , Troy , NY) se
utiliz para examinar las actividades de las clulas cultivadas en cultivo de tejidos. La
permeabilidad de las clulas AEII monocapa se evalu con un registro de la resistencia
transepitelial (TER ) a travs de los electrodos.
TINCIN NOM -26 DE CUERPOS LAMELARES:
LysoTracker verde DND - 26 es un colorante fluorescente que se acumula preferentemente en
los cuerpos lamelares en las clulas AEII primarios humanos ( Haller et al. 1998 ) . Las clulas
se cultivaron durante 21 das y se sembraron en cubreobjetos durante la noche, despus se
incubaron durante 30 min con LysoTracker verde DND - 26 ( 150 nmol / L; Molecular Probes,
Eugene , OR) a 37 C en SAGM que contiene 1 % de FBS. Los cubreobjetos fueron se lav
con BSS ( precalentado a 25 C) y montado para el anlisis de barrido confocal.

CARACTERIZACIN DEL FENOTIPO DE CLULAS AEII POR LA EXPRESIN DEL ARNM:


Expresin de genes incluyendo la protena surfactante A ( SPA) , SPB , SPC , SPD, CK- 8 ,
queratina - 6 ( KL- 6 ) , AQP - 3 , pero AQP - 5 , se detect como se ha descrito previamente (
Zhang , Zhang et al . 2013) . Las secuencias de cebadores se enumeran en la Tabla 2 .
LA EXPRESIN DE MARCADORES DE CLULAS EPITELIALES MEDIANTE
MICROSCOPIO CONFOCAL:
Las clulas AEII aislados se cultivaron durante 21 das y se sembraron en cubreobjetos de
vidrio a 5 9 104 clulas / ml en placas de 24 pocillos , se incubaron a 37 C durante 12 h , se
fijaron en paraformaldehdo al 4% durante 10 min, y luego se permeabilizaron usando 0,1 % de
Triton X- 100 seguido por el bloqueo usando 2 % de BSA durante 1 h . Las clulas se probaron
con conejo antihumano pro- SP- C anticuerpo policlonal (Millipore, 1 : 1000 Temecula, CA), de
cabra anti- humano anti- cuerpo policlonal aENaC (Santa Cruz Biotechnology, 1 : 500 , Santa
Cruz, CA) , el ratn anticuerpo monoclonal citoqueratina 8 - anti- humano ( Abcam , 1 : 100 ,
Cambridge , MA) , anticuerpo de cabra anti- humano AQP - 5 policlonal (Santa Cruz
Biotechnology, 1 : 500 ) , durante la noche a 4 C . Se realiz un control positivo utilizando
clulas Hela basados en la instruccin de la utilizacin de AQP - 5 anticuerpo) . Las clulas se
lavaron tres veces con PBS a intervalos de 10 min y despus se incubaron con el anticuerpo
secundario Cy3 mixta AffiniPure de cabra anti- conejo ( 1 : 200 ; EarthOx , San Francisco , CA)
, Cy3 AffiniPure burro anti- cabra ( 1 : 200 , EarthOx ) , FITC AffiniPure burro anti- cabra ( 1 :
200, EarthOx ) y FITC AffiniPure cabra IgG anti- ratn ( 1 : 200, EarthOx ) durante 1 hora a 37
C en la oscuridad. Despus de lavar tres veces , los cubreobjetos fueron montados , y se
analizaron utilizando confocal Scanning Microscopy ( LCSM , Nikon C1si , Tokio , Japn).
Gene
s

Primer secuencias ( 50-30 )

Longitud del
producto

SP-C

Sentido

CTCATCGTCGTGGTGATTGTTG

Antisentido

TGGAGAAGGTGGCAGTGGT

154 bp

SP-A

Sentido

CGACTTTAGACATCAAATCCTGC

Antisentido

CTCGGTACCAGTTGGTGTAGTTT

305 bp

SP-A

Sentido

CAGGTAGTGTTCCAGCAGGGTG

Antisentido

ATCTGAAGGCGGCTCTAGGTCA

149 bp

SP-B

Sentido

AGAGCAGGAGCCAGGGATGT

Antisentido

AGCAGGATGACGGAGTAGCG

324 bp

SP-B

Sentido

CCAAGCCATGATTCCCAAGGGTG

Antisentido

CGAGCAGGATGACGGAGTAGCG

122 bp

SP-D

Sentido

AGGAGCAAAGGGAGAAAGTGG

Antisentido

GCTGTGCCTCCGTAAATGGT

197 bp

KL-6

Sentido

GTGCCGCCGAAAGAACTAC

Antisentido

CTGCTGCCACCATTACCTG

165 bp

CK-8

Sentido

GAGGCATCACCGCAGTTAC

Antisentido

TTGCTTCGAGCCGTCTTCT

223 bp

AQP-3

Sentido

TGACCAGTTCATAGGCACAGC

Antisentido

ACACGAAGACACCCGCAAT

296 bp

AQP-3

Sentido

CTCGTGAGCCCTGGATCAAGCT

Antisentido

GTTGTCGGCGAAGTGCCAGATTT

119 bp

AQP-5

Sentido

GCCACCTTGTCGGAATCTAC

Antisentido

CCAGTCCTCGTCAGGCTCATA

233 bp

AQP-5

Sentido

CACCCCCCACCTTCCCCAACCCT

Antisentido

CTAAACACCAGCAGCCCCACGCA

169 bp

IL-6

Sentido

GGAGACTTGCCTGGTGAAA

Antisentido

CTGAGGTGCCCATGCTAC

330 bp

IL-6

Sentido

Antisentido

Sentido

Antisentido

CAGCAGGCAACACCAGGAGCAG
C
CCCTACAACAGACCCACA

125 bp

IL-8

GAGCCCACCGGGAACGAAAGAG
A
GCCAAGGAGTGCTAAAGA

IL-8

Sentido

TACTCCAAACCTTTCCACCC

Antisentido

AACTTCTCCACAACCCTCTG

158 bp

MCP-1

Sentido

CAGCCAGATGCAATCAATGC

Antisentido

GTGGTCCATGGAATCCTGAA

198 bp

ICAM-1

Sentido

GGAGCCAATTTCTCGTGC

Antisentido

GGAGTCGTTGCCATAGGTG

267 bp

ICAM-1

Sentido

GATTGTCATCATCACTGTGGTAG

Antisentido

GCCTGTTGTAGTCTGTATTTCTT

111 bp

GAPDH

Sentido

TCCTCCACCTTTGACGCT

Antisentido

TCTTCCTCTTGTGCTCTTGC

177 bp

329 bp

EXPRESIN DE LAS CLULAS EPITELIALES Y MESENQUIMALES MARCADORES POR


WESTERN BLOTS:
La extraccin de protenas de AEII a los 21 das , y Western Blot se llev a cabo como se
describi previamente (Cabrera Benitez et al. 2012 ) . Se utilizaron los siguientes anticuerpos :
anticuerpo de ratn E -cadherina anti- humano (BD Bioscience, 1 : 2000 , San Jose, CA), de
cabra anti- humana pro- SP- B anticuerpo policlonal (Santa Cruz Biotechnology, 1 : 500 ) , el
ratn vimentina anti- humana ( 1 : 1000 , BD ) , conejo antihumano GAPDH ( 1 : 10.000 , BD ) ,
anti-ratn de cabra , antigoat burro , cabra anti- conejo conjugado a peroxidasa de rbano
picante ( 1 : 5000 , EarthOx ).

PRUEBA FUNCIONAL DE LAS CLULAS AEII:


Las clulas AEII fueron sembradas en placas de seis pocillos a 2 9 105 clulas por pocillo .
Despus de la incubacin durante la noche, la SAGM completa se reemplaz con SAGM libre
de suero y en ayunas durante 24 h . Las clulas fueron entonces estimulados for24 h con TNF a en 0 , 0,1 , 1 , y 10 ng / mL. El ARN total se extrajo para la deteccin de la expresin gnica
de la citoquina inflamatoria IL- 6 (utilizado para los ensayos clnicos de sepsis ) y quimiocinas
(IL- 8 y MCP- 1 , los quimioatrayentes ms comunes ) y ICAM- 1 (molcula coestimuladora de
diafona con sus ligandos en leucocitos) . La expresin del gen de mantenimiento de GAPDH
wa sused de control de carga. Las secuencias de cebadores se enumeran en la Tabla 2. Las
concentraciones de protena de IL- 6 y IL- 8 se midieron en sobrenadantes de cultivo por ELISA
especficos de los humanos (R & amp; D Systems, Minneapolis, MN) .

CULTIVO DE CLULAS EPITELIALES DE PULMN HUMANO Y FIBROBLASTOS:


Vas respiratorias pequeas clulas epiteliales humanas primarias ( SAEC , Lonza y
Walkersville , MD) se cultivaron en un medio SAGM . Las clulas humanas bronquiales
epiteliales ( BEAS- 2B) y adenocarcinoma de pulmn lnea de clulas epiteliales ( clulas A549
, ATCC , Manassas , VA) se cultivaron en medio RPMI 1640 suplementado con 10 % FBS .
Fibroblastos pulmonares humanos primarios ( regalo del profesor Xu , Guangzhou Instituto de
Enfermedades Respiratorias , China ) se cultivaron en DMEM suplementado con 10 % de SFB .
ANLISIS ESTADSTICO:
El anlisis estadstico se realiz con el programa SPSS 12.0. Los resultados se expresan como
media SE. Las comparaciones entre los dos grupos se realizaron mediante ANOVA . P & lt;
0,05 fue considerado estadsticamente significativo .

RESULTADOS:
RENDIMIENTO, PUREZA , VIABILIDAD Y MORFOLOGA:
Nuestro proceso de aislamiento dando como resultado aproximadamente 2 a 7 septiembre 105
clulas AEII humanos por gramo de tejido pulmonar perifrico en 60 h de cultivo celular. La
viabilidad fue del 95 % en promedio 2 a partir de 28 pulmones durante 60 h . No hubo
diferencias en el crecimiento celular entre el uso de medio de cultivo diferente, pero la
morfologa de las clulas AEII pareca ser ptima bajo la condicin de SAGM que contiene 1 %

de FBS , pero no bajo la de DMEM que contena 1 % o 10 % de FBS que contiene 10 o SAGM
% de FBS (datos no mostrados). El nivel de duplicacin de la poblacin era de
aproximadamente 6 veces al da 28 (fig . 1A ) . Las clulas formaron unin estrecha despus
de alcanzar la confluencia como se refleja por una lectura constante de ECIS (Fig. 1B ) . Los
cuerpos y microvellosidades lamelares tpicos se observaron en las clulas AEII bajo la
microscopa electrnica de transmisin (Fig. 1Cand D).
MOLECULARES DE LAS CLULAS AEII:
Las clulas AEII se caracterizaron por la expresin de protenas especfico para clulas AEII
incluyendo pro- SP- C (Fig. 2B ) y citoqueratina - 8 (Fig. 2C) . Cuerpos lamelares como
caracterstica especfica de las clulas AEII (Williams 1977; . Witherden et al 2004) se
identificaron positivamente por NOM -26 manchas en el citoplasma (Fig 2E y F . ) . Los cuerpos
lamelares no se encontraron en el epitelio bronquial humano de pulmn de clulas BEAS -2B
(Fig. 2G y H) y los fibroblastos de pulmn humano examinados ( Fig . 2I y J).
Para supervisar el fenotipo de las clulas AEII despus del aislamiento , las clulas se
cultivaron en SAGM que contiene 1 % de FBS durante un mximo de 28 das . La expresin de
aENaC (Fig. 3A) , la protena de unin estrecha E -cadherina, y la protena AEII SPB (Fig. 3B )
y la SPC (Fig. 4 ) , pero no la protena vimentina mesenquimales (Fig. 3B ) y la protena theAEI
AQP - 5 (Fig. 4 ) , era detectable. No hubo diferencia en la expresin de E- cadherina y SPB en
el da 21 entre las condiciones de cultivo lquidos y aire -lquido ( Fig . 3B ) . El tejido pulmonar
total a partir del cual se aislaron las clulas AEII mostr fuerte expresin de vimentina (Fig. 3B )
.Por otra parte , la expresin de genes de protenas de agentes tensioactivos , CK- 8 , KL- 6 , y
AQP - 3 como marcadores AEII ( Driscoll et al . 1995 ; Armstrong et al. 2004 ; Bove et al. 2010 )
se observ en 12 ( paso 1 ) , mantenida en el da 21 , y la disminucin en el da 28 (Fig . 3C ) .
Hubo poca expresin de AQP - 5 en el da 12 y que desapareci despus ( Fig . 3C ) . El perfil
gen AEII se confirm usando los mtodos QPCT en tiempo real (Fig. 3D) . En contraste , las
clulas A549 epiteliales adenocarcinomic humanos no mostraron ninguna expresin de las
protenas de agentes tensioactivos y AQP - 3 (Fig. 3C) .

Figura. 3

Figura. 4
LA RESPUESTA FUNCIONAL DE LAS CLULAS AEII A LA ESTIMULACIN:
Para examinar la funcionalidad de las clulas AEII primarios , las clulas fueron estimuladas
con diferentes dosis de TNF -a durante 24 h. Hubo un aumento dependiente de la dosis en la
expresin gnica de IL- 6 , IL- 8 , MCP - 1 , e ICAM - 1 , as como las concentraciones de
protena de IL- 6 y IL- 8 en los sobrenadantes de cultivo en respuesta a las la estimulacin con
TNF -a ( Fig. 5 ) ) .

DISCUSIN:
Hay un par de toques de luz en el presente estudio mtodo con respecto al aislamiento y
mantenimiento de las clulas AEII humana principales: (1) El alto rendimiento se logr
mediante la aplicacin combinada de tripsina en la digestin elastasa que preserva el tejido
pulmonar durante la cosecha; (2) La alta pureza se obtuvo por la separacin de los macrfagos
y fibroblastos a partir de clulas epiteliales en un momento optimizado utilizando anticuerpos
medianas adherencia para la seleccin negativa; y (3) el mantenimiento prolongado de AEII
fenotipo se llev a cabo mediante la optimizacin de los componentes del medio de cultivo que
contienen una concentracin de FBS apropiado. AEII clulas, como las clulas madre de tejido,
tienen funciones muy importantes. Es necesario establecer cultivo primario de clulas AEII

humanos para nuestra comprensin de los mecanismos celulares y moleculares en condiciones


patolgicas de las enfermedades pulmonares tales como los SDRA letales y lesin pulmonar

inducida por la ventilacin. (. Dobbs et al 1986) Desde Dobbs public por primera vez un
mtodo de aislamiento y cultivo de clulas ATII de rata adulta, un nmero de estudios se han
llevado a cabo para aislar clulas AEII en los seres humanos (Fuchs et al 2003;. Bove et al.
2010) y en roedores (Bates et al 2002;. Witherden et al 2004;. Lazrak et al 2012).. Los estudios
han demostrado que las clulas AEII humanos aislados funcin in vitro ejercen (Wang et al
2007, 2011;. Ballard et al.2010; Qian et al.2013; Bove et al 2014).. Sin embargo, varias
preocupaciones principales han surgi incluyendo la prdida rpida de la funcin celular,
especialmente la prdida de expresin de la protena surfactante (Dobbs 1990;. Bates et al
2002;. Witherden et al 2004) y de clulas diferenciadas en ATI fenotipo dentro de unos pocos
das (Bates et al . 2002;. Bove et al 2010). Mantenimiento de caractersticas de las clulas
depende no slo la fuente de tejido, sino tambin los mtodos de aislamiento y los
componentes del medio de cultivo. En este estudio, hemos modificado los protocolos de varios
estudios previos para el aislamiento de clulas AEII, caracterizacin, y la cultura. En primer
lugar, se utiliz el tejido pulmonar perifrica normal de pacientes sometidos a reseccin
pulmonar como nuestra fuente de tejido. En segundo lugar, la aplicacin combinada de la
tripsina con elastasa fue capaz de disminuir la dosis de tripsina y por lo tanto puede haber
contribuido a reducir la lesin del tejido y la mejora de la cosecha (Waymouth 1974). En tercer
lugar, creemos que la eliminacin de los fibroblastos es un paso crucial durante el
procedimiento de aislamiento y purificacin (Komiyama et al 2003;. Kaushik et al. 2008).
Finalmente, el SAGM que contiene 1% de FBS era una receta importante en el mantenimiento
de las caractersticas biolgicas de las clulas AEII humanos y la prevencin de su
diferenciacin en clulas AEI. Hay varios tipos de medios, incluyendo los medios de

comunicacin bajo hibridoma protena, SAGM y DMEM siendo utilizado (Pechkovsky et al


2000;. Bur et al 2006;. Thorley et al 2007;.. Kosmider et al 2010) para el cultivo celular AEII
humano. SAGM contiene epinefrina, hidrocortisona, y cido retinoico, que parece ser
importante para la inhibicin de la diferenciacin (Rippon et al. 2004). El factor de crecimiento
epidrmico en SAGM puede promover la proliferacin celular en clulas de mamfero (Worster
et al. 2012). Se demuestra que SAGM suplementado con 1% FBS, pero no FBS al 10% fue
capaz de mantener los fenotipos AEII, pero los otros tipos de medio que contena diferentes
concentraciones de FBS no pudo mantener el fenotipo de clulas AEII. Aunque el AEII
duplicacin de la poblacin celular fue algo lento, thephenotype de las clulas AEII apareci a
durar ms tiempo (es decir, ms de 20 das) en comparacin con estudios previos (Bates et al
2002;.. Witherden et al 2004; Bove et al., 2010). Este perodo de tiempo es por lo general el
tiempo suficiente para estudios mecnicos comunes en vitro despus de insultos tales como
estiramiento mecnico, la exposicin hipxica y el desafo de cido (Ishizuka et al 2001;.
Bouvry et al 2006;. Cabrera-Bentez et al.2012).
Las clulas AEII humanos primarios se caracterizan por la expresin de pro-SP-C (Bove et al.
2010), cytokera-estao-8 (Driscoll et al. 1995), aENaC (Lazrak et al. 2012), y cuerpos lamelares
( Haller et al 1998;. Colmillo et al 2006;.. Wemhoner et al 2011). Un reto tcnico de cultivo
celular AEII primaria fue la rpida prdida de expresin de protenas de agentes tensioactivos
(Dobbs 1990;. Witherden et al 2004). Nuestra fenotipo AEII fue evidenciado por la expresin
sostenida de protenas de surfactante (Ballard et al 2010;. Wang et al 2011;. Qian et al 2013).,
Marcadores epiteliales (KL-6, CK-8) (Driscoll et al., 1995; Hermans y Bernard 1999), y AEII
diferenciacin celular marcador de AQP-3 whiile que carecen de AQP-5 de un marcador de
clulas AEI (Armstrong et al. 2004). Finalmente, las clulas primarias AEII tambin mostraron
funcin biolgica excelente por la regulacin positiva de citoquinas, quimioquinas, y la molcula
de adhesin en los niveles de genes y protenas en respuesta a la estimulacin con TNF-a.
Esto proporciona una herramienta importante para estudiar las respuestas inflamatorias
involucradas en clulas AEII. En las conclusiones, hemos establecido tcnicas para la cosecha
de tejidos de pulmn humano y el aislamiento de clulas AEII que permiten el cultivo primario
de estas clulas durante un perodo prolongado de tiempo. La tcnica proporciona una
herramienta fiable para examinar los mecanismos celulares y moleculares de las clulas AEII
humanos en el contexto de enfermedades pulmonares agudas y crnicas asociadas con
alvolos.

REFERENCIAS:

Armstrong, L., A. R. Medford, K. M. Uppington, J. Robertson,I. R. Witherden, and T. D. Tetley, et al. 2004.
Expression offunctional toll-like receptor-2 and -4 on alveolar epithelialcells. Am. J. Respir. Cell Mol. Biol.
31:241245.
Ballard, P. L., J. W. Lee, X. Fang, C. Chapin, L. Allen, andM. R. Segal, et al. 2010. Regulated gene
expression incultured type II cells of adult human lung.Am. J. Physiol. Lung Cell. Mol. Physiol. 299:L36L50.
Bates, S. R., L. W. Gonzales, J. Q. Tao, P. Rueckert, P. L.Ballard, and A. B. Fisher. 2002. Recovery of rat
type II cellsurfactant components during primary cell culture. Am. J.Physiol. Lung Cell. Mol. Physiol.
282:L267L276.
Bouvry, D., C. Planes, L. Malbert-Colas, V. Escabasse, andC. Clerici. 2006. Hypoxia-induced cytoskeleton
disruption inalveolar epithelial cells. Am. J. Respir. Cell Mol. Biol.35:519527.
Bove, P. F., B. R. Grubb, S. F. Okada, C. M. Ribeiro, T. D.Rogers, and S. H. Randell, et al. 2010. Human
alveolar typeII cells secrete and absorb liquid in response to localnucleotide signaling. J. Biol. Chem.
285:3493934949.

Bove, P. F., H. Dang, C. Cheluvaraju, L. C. Jones, X. Liu, andW. K. ONeal, et al. 2014. Breaking the in vitro
alveolar typeII cell proliferation barrier while retaining ion transportproperties. Am. J. Respir. Cell Mol. Biol.
50:767776.
Bur, M., H. Huwer, C. M. Lehr, N. Hagen, M. Guldbrandt,and K. J. Kim, et al. 2006. Assessment of transport
rates ofproteins and peptides across primary human alveolarepithelial cell monolayers. Eur. J. Pharm. Sci.
28:196203.
Burns, A. R., C. W. Smith, and D. C. Walker. 2003. Uniquestructural features that influence neutrophil
emigration intothe lung. Physiol. Rev. 83:309336.
Cabrera-Benitez, N. E., M. Parotto, M. Post, B. Han, P. M.Spieth, and W. E. Cheng, et al. 2012. Mechanical
stressinduces lung fibrosis by epithelial-mesenchymal transition.Crit. Care Med. 40:510517.
Chen, L., W. Song, I. C. Davis, K. Shrestha, E. Schwiebert, andW. M. Sullender, et al. 2009. Inhibition of
Na+ transport inlung epithelial cells by respiratory syncytial virus infection.Am. J. Respir. Cell Mol. Biol.
40:588600.
Corti, M., A. R. Brody, and J. H. Harrison. 1996. Isolation andprimary culture of murine alveolar type II cells.
Am. J.Respir. Cell Mol. Biol. 14:309315.
Crapo, J. D., B. E. Barry, P. Gehr, M. Bachofen, and E. R.Weibel. 1982. Cell number and cell characteristics
of thenormal human lung. Am. Rev. Respir. Dis. 126:332337.
Cunningham, A. C., D. S. Milne, J. Wilkes, J. H. Dark, T. D.Tetley, and J. A. Kirby. 1994. Constitutive
expression of MHC and adhesion molecules by alveolar epithelial cells(type II pneumocytes) isolated from
human lung andcomparison with immunocytochemical findings.J. Cell Sci. 107(Pt 2):443449.
Desai, L. P., K. E. Chapman, and C. M. Waters. 2008.Mechanical stretch decreases migration of alveolar
epithelialcells through mechanisms involving Rac1 and Tiam1. Am. J.Physiol. Lung Cell. Mol. Physiol.
295:L958L965.
Dobbs, L. G. 1990. Isolation and culture of alveolar type IIcells. Am. J. Physiol. 258(4 Pt 1):L134
L147.Dobbs, L. G., R. Gonzalez, and M. C. Williams. 1986. Animproved method for isolating type II cells in
high yieldand purity. Am. Rev. Respir. Dis. 134:141145.
Dreyfuss, D., P. Soler, G. Basset, and G. Saumon. 1988. Highinflation pressure pulmonary edema.
Respective effects ofhigh airway pressure, high tidal volume, and positive end-expiratory pressure. Am. Rev.
Respir. Dis. 137:11591164.
Driscoll, K. E., J. M. Carter, P. T. Iype, H. L. Kumari, L. L.Crosby, and M. J. Aardema, et al. 1995.
Establishment ofimmortalized alveolar type II epithelial cell lines from adultrats. In Vitro Cell. Dev. Biol. Anim.
31:516527.Ehrhardt, C., K. J. Kim, and C. M. Lehr. 2005. Isolation andculture of human alveolar epithelial
cells. Methods Mol.Med. 107:207216.
Fang, X., Y. Song, J. Hirsch, L. J. Galietta, N. Pedemonte, andR. L. Zemans, et al. 2006. Contribution of
CFTR to apical-basolateral fluid transport in cultured human alveolarepithelial type II cells. Am. J. Physiol.
Lung Cell. Mol.Physiol. 290:L242L249.
Fehrenbach, H. 2001. Alveolar epithelial type II cell: defenderof the alveolus revisited. Respir. Res. 2:33
46.Fraslon, C., T. Lacaze-Masmonteil, V. Zupan, B. Chailley-Heu,and J. R. Bourbon. 1993. Fetal rat lung
type II celldifferentiation in serum-free isolated cell culture:modulation and inhibition. Am. J. Physiol. 264(5
Pt 1):L504L516.
Fuchs, S., A. J. Hollins, M. Laue, U. F. Schaefer, K. Roemer,and M. Gumbleton, et al. 2003. Differentiation
of humanalveolar epithelial cells in primary culture: morphologicalcharacterization and synthesis of caveolin1 and surfactantprotein-C. Cell Tissue Res. 311:3145.
Haller, T., J. Ortmayr, F. Friedrich, H. Volkl, and P. Dietl.1998. Dynamics of surfactant release in alveolar
type II cells.Proc. Natl. Acad. Sci. USA 95:15791584.
Hayflick, L. 1973. Subculturing human diploid fibroblastcultures. Pp. 220 in P. F. Kruse Jr., M. K. Patterson
Jr., eds.Tissue culture methods and applications. Academic Press,New York.Hermans, C., and A. Bernard.
1999. Lung epithelium-specificproteins: characteristics and potential applications asmarkers. Am. J. Respir.
Crit. Care Med. 159:646678.
Hotchkiss, J. R., D. A. Simonson, D. J. Marek, J. J. Marini,and D. J. Dries. 2002. Pulmonary microvascular
fracture in a patient with acute respiratory distress syndrome. Crit.Care Med. 30:23682370.
Huang, Z., Y. Wang, P. S. Nayak, C. E. Dammann, andJ. Sanchez-Esteban. 2012. Stretch-induced fetal
type II celldifferentiation is mediated via ErbB1-ErbB4 interactions.J. Biol. Chem. 287:1809118102.

Ishizuka, S., M. Yamaya, T. Suzuki, K. Nakayama, M.Kamanaka, and S. Ida, et al. 2001. Acid exposure
stimulatesthe adherence of Streptococcus pneumoniae to culturedhuman airway epithelial cells: effects on
platelet-activatingfactor receptor expression. Am. J. Respir. Cell Mol. Biol.24:459468.
Kaushik, R. S., A. A. Begg, H. L. Wilson, P. Aich, M. S.Abrahamsen, and A. Potter, et al. 2008.
Establishment offetal bovine intestinal epithelial cell cultures susceptible tobovine rotavirus infection. J. Virol.
Methods 148:182196.
Komiyama, T., Y. Nakao, Y. Toyama, H. Asou, C. A. Vacanti,and M. P. Vacanti. 2003. A novel technique to
isolate adultSchwann cells for an artificial nerve conduit. J. Neurosci.Methods 122:195200.
Kosmider, B., J. E. Loader, R. C. Murphy, and R. J. Mason2010. Apoptosis induced by ozone and oxysterols
in humanalveolar epithelial cells. Free Radic. Biol. Med. 48:15131524.
Kreda, S. M., M. C. Gynn, D. A. Fenstermacher, R. C.Boucher, and S. E. Gabriel. 2001. Expression
andlocalization of epithelial aquaporins in the adult humanlung. Am. J. Respir. Cell Mol. Biol. 24:224234.
Lazrak, A., L. Chen, A. Jurkuvenaite, S. F. Doran, G. Liu, andQ. Li, et al. 2012. Regulation of alveolar
epithelial Na+channels by ERK1/2 in chlorine-breathing mice. Am. J.Respir. Cell Mol. Biol. 46:342354.
Mason, R. J. 2006. Biology of alveolar type II cells. Respirology11(Suppl):S12S15.Mason, R. J., and M. C.
Williams. 1977. Type II alveolar cell.Defender of the alveolus. Am. Rev. Respir. Dis. 115(6 Pt 2):8191.
Oudin, S., and J. Pugin. 2002. Role of MAP kinase activationin interleukin-8 production by human BEAS-2B
bronchialepithelial cells submitted to cyclic stretch. Am. J. Respir.Cell Mol. Biol. 27:107114.
Pechkovsky, D. V., G. Zissel, M. W. Ziegenhagen, M. Einhaus,C. Taube, and K. F. Rabe, et al. 2000. Effect
ofproinflammatory cytokines on interleukin-8 mRNAexpression and protein production by isolated
humanalveolar epithelial cells type II in primary culture. Eur.Cytokine Netw. 11:618625.
Qian, Z., E. A. Travanty, L. Oko, K. Edeen, A. Berglund, andJ. Wang, et al. 2013. Innate immune response
of humanalveolar type II cells infected with severe acute respiratorysyndrome-coronavirus. Am. J. Respir.
Cell Mol. Biol.48:742748.
Rippon, H. J., N. N. Ali, J. M. Polak, and A. E. Bishop. 2004.Initial observations on the effect of medium
composition onthe differentiation of murine embryonic stem cells toalveolar type II cells. Cloning Stem Cells
6:4956.