You are on page 1of 11

Interbits – SuperPro ® Web

TEXTO PARA A PRÓXIMA QUESTÃO:

Desde que médicos começaram a solicitar regularmente exames de tomografia
computadorizada, cientistas se preocupam que o procedimento de imageamento médico possa
aumentar o risco de o paciente desenvolver câncer. O aparelho bombardeia o organismo com
feixes de raios X, que podem danificar o DNA e provocar mutações que estimulam as células a
formar tumores.
Médicos sempre declararam, no entanto, que os benefícios superam os riscos. Os
raios X, que giram em torno da cabeça, tórax ou outra região do corpo, ajudam a criar uma
imagem tridimensional muito mais detalhada que as produzidas por um aparelho padrão de
raios X, mas uma única tomografia submete o corpo humano à radiação de 150 a 1.100 vezes
mais intensa que os raios X convencionais, ou o equivalente a um ano de exposição à radiação
de origens naturais e artificiais no ambiente.
(STORRS. 2013. p.24-25).

1. (Uneb 2014) Considerando as possíveis alterações que os raios X podem provocar nas
moléculas de DNA, é correto afirmar:
a) A radiação induz replicações do DNA fora da etapa S, do ciclo celular, o que inviabiliza a
entrada da célula na divisão por mitose.
b) O câncer é uma anomalia na regulação do ciclo celular e à perda de controle da mitose a
partir de alteração de genes controladores desse ciclo.
c) A emissão de raios X pela tomografia identifica as regiões no corpo que apresentam o DNA
alterado e quais os tecidos que irão desenvolver um provável câncer no futuro.
d) As alterações nas posições das pentoses, a partir da exposição de um DNA aos raios X,
produzem mudanças irreversíveis na informação genética presente no organismo.
e) A exposição à radiação de raios X só é segura quando apresenta valores próximos ao de um
aparelho de raios X convencional, mesmo que seja com uma intensa repetição.
2. (Fgv 2015) As células numeradas de 1 a 4 da figura representam gametas masculinos
resultantes de uma divisão meiótica anômala em que não ocorreu disjunção dos cromossomos
homólogos vermelhos na anáfase I. As células numeradas de 5 a 8 da figura representam
gametas masculinos resultantes de outra divisão meiótica anômala em que não ocorreu a
disjunção das cromátides vermelhas na anáfase II. Os cromossomos azuis representam o
processo sem anomalias em todos os demais pares de cromossomos humanos.

Página 1 de 11

portadoras de uma monossomia. 2 e 6. c) 7 e 8. portadoras de uma trissomia. e) 3. ao fecundarem óvulos normais. ao fecundarem óvulos normais. formarão pessoas com 47 cromossomos.Interbits – SuperPro ® Web É correto afirmar que os gametas indicados pelos números a) 1. formarão pessoas com 46 cromossomos. 2 e 6. ao fecundarem óvulos normais. formarão pessoas com 48 cromossomos. Página 2 de 11 .4 e 5. formarão pessoas com 45 cromossomos. ao fecundarem óvulos normais.4 e 5. portadoras de uma tetrassomia. ao fecundarem óvulos normais. (Upe 2015) A figura a seguir mostra imagens de um experimento utilizando técnicas de DNA recombinante. 3. d) 1. não portadoras de síndromes cromossômicas. portadoras de uma nulissomia. formarão pessoas com 47 cromossomos. b) 3. Observe-a.

a) Clonagem é a produção de indivíduos geneticamente iguais.br/2014/02/12/teias-de-laboratorio. d) I e 4. e todo OGM é um transgênico. As bactérias transgênicas Escherichia coli passaram a produzir. em larga escala. Página 3 de 11 . Chamada pelos cientistas de Gluca. biofísicas e mecânicas. II. ela possui uma modificação genética que deverá fazer com que ela produza em seu leite uma proteína humana chamada glucocerebrosidase. IV. correlacione as etapas citadas no texto com as figuras enumeradas acima e assinale a alternativa que indica a CORRETA correspondência. 4. IV e 4. Todo transgênico é um organismo geneticamente modificado. Em 1996. e) I e 5. b) A clonagem pode ser obtida através da transferência do núcleo de uma célula somática da cabra que originou a Gluca. O passo seguinte consistiu na extração das proteínas. VI e 2. IV e 4. do processo de produção do biopolímero. Por meio de análises moleculares. a primeira cabra clonada e transgênica da América Latina. Disponível em: http://revistapesquisa. e) Transgênicos e Organismos Geneticamente Modificados (OGM) são sinônimos. III e 3. III e 3. para um óvulo anucleado. IV e 5. usada no tratamento da doença de Gaucher. marque a alternativa CORRETA. como transgênicos e clonagem.” Texto adaptado do Jornal O Estado de São Paulo. 14/04/2014. IV e 6. b) I e 2. É um processo de reprodução sexuada que resulta na obtenção de cópias geneticamente idênticas do ser vivo. na Universidade de Fortaleza . II e 2. d) Os transgênicos são organismos vivos modificados em laboratório. as proteínas recombinantes. VI e 2. A proposta da pesquisa brasileira é produzir a glucocerebrosidase no País. que formam os fios das aranhas. V e 5. III e 3.Interbits – SuperPro ® Web O texto a seguir descreve as seis etapas. VI e 1. V e 6. II e 1. Pesquisadores da Embrapa isolaram os genes das glândulas de seda de cinco espécies de aranhas da biodiversidade brasileira. que imita o órgão das aranhas responsável pela fabricação do fio. As drogas importadas são baseadas em proteínas produzidas in vitro. Trata-se de uma doença genética relativamente rara. imitando teias de aranha. VI. eles utilizaram as proteínas para produzir os fios sintéticos em laboratório. III e 3. III. estudaram esses genes e suas funções e construíram sequências sintéticas de DNA para a produção de fios. Adaptado Sobre isso. II e 6. Os genes modificados foram clonados e introduzidos no genoma de bactérias Escherichia coli. II e 2. porém extremamente custosa para o sistema público de saúde. V e 4. V. bioquímicas. a) I e 1. VI e 1. IV e 4. Baseando-se em alguns conceitos citados pelo texto.Unifor. programadas para atuar como biofábricas. onde se altera o código genético de uma espécie com introdução de uma ou mais sequências de DNA. identificadas com algarismos romanos. VI e 1. Segundo informações levantadas pelos pesquisadores. provenientes do mesmo organismo. no leite de cabras transgênicas. II e 6. V e 5. cultivadas em células transgênicas de hamster ou cenoura. c) I e 3.fapesp. Para isso. III e 5. Com o auxílio de uma seringa. o Ministério da Saúde gasta entre R$ 180 milhões e R$ 250 milhões por ano com a importação de tratamentos para pouco mais de 600 pacientes com Gaucher no Brasil. a massa de bactérias foi diluída em meio líquido e purificada para a separação das proteínas do restante do material. (Unifor 2014) Leia o texto abaixo: “Nasceu no dia 27 de março de 2014. a ovelha Dolly nasceu depois de apenas 2 tentativas que fracassaram. I. c) Sabe-se que a clonagem é um processo fácil de ser obtido. V e 6. a custos muito inferiores ao da produção em células em cultura.

c) fluxo de genes entre as espécies nativas e as transgênicas que causam impactos na biodiversidade. os pesquisadores procederam de acordo com a figura. (Enem 2014) Em um laboratório de genética experimental. 7. e) geração de problemas imediatos no fígado e nos rins humanos decorrentes do consumo de alimentos transgênicos. observou-se que determinada bactéria continha um gene que conferia resistência a pragas específicas de plantas. d) distribuição de grande número de sementes transgênicas de forma ilícita por produtores após o primeiro plantio.tv>. essas variações serão mais fáceis de diagnosticar. e) Transgênica. Analisando o texto. b) produção de toxinas nocivas ao homem em consequência da mutagênese gerada nos vegetais. c) Mutante. outubro/2013. Página 4 de 11 . Mesmo assim espera-se que a taxa de cultivo de organismos geneticamente modificados no Brasil cresça em média 54% até a safra 2020/21. conclui-se que a maioria das variações será do tipo maligna. enquanto os outros 50% serão normais. Revista Época. (Adaptado) Essas preocupações justificam-se pela possibilidade de a) ocorrência de mutações que proliferam células humanas após a absorção dos transgenes. 2012. Do ponto de vista biotecnológico. Em vista disso. pode-se inferir que: a) Uma vez que o mosaicismo pode surgir a partir de mutações espontâneas que determinadas células sofrem. (Unifor 2014) “Conhecer o padrão desses mosaicos genéticos pode ajudar no tratamento e diagnóstico de doenças e até em investigações policiais”. como a planta representada na figura é classificada? a) Clone. restringindo esse tipo de cultura. Acesso em: 26 jul. c) Uma vez que o mosaicismo pode ocorrer antes da separação das células germinativas. b) Híbrida.Interbits – SuperPro ® Web 5. b) Uma vez que o mosaicismo pode surgir a partir de mutações espontâneas que determinadas células sofrem. a mutação será diagnosticada em 50% da prole. d) Adaptada. (Cefet MG 2014) Com o desenvolvimento de técnicas de genética e aumento da área plantada com transgênicos surgiram preocupações com a biossegurança. 6. Disponível em: <http://agromais.

D. e) um pequeno número de sequências de reconhecimento para enzimas de restrição é conhecido. que não permitiria a identificação de outra maneira. pp. Briscoe. SP. avô materno. Frankham. cujos tamanhos representam alelos. filho e filha). Para identificar o corpo. para verificar se houve o corte. facilmente e sem ambiguidade. 8. Outro exemplo seria o de peixes brasileiros. pois a) a sequência que contém o sítio de restrição não variável é amplificada. Isso torna possível que órgãos de fiscalização ambiental identifiquem. Existem kits de identificação de diferentes espécies baseados na análise de polimorfismos de DNA de genes mitocondriais e nucleares. salgado e seco ao sol (como o do acarajé) e em lata. o produto é incubado com uma enzima de restrição qualquer e posteriormente testado em gel. (Upe 2014) Leia o texto a seguir referente às aplicações das técnicas moleculares da genética. R. Essa identificação de espécies é possível. e) avô materno. os peritos optaram por usar também DNA mitocondrial. por enzimas de restrição. A vantagem desses é que podem ser obtidos a partir de material processado e industrializado. D. d) polimorfismos de DNA se constituem em um conjunto de marcadores numerosos e distribuídos por todo o genoma. Como o teste com o DNA nuclear não foi conclusivo. Assim. Fonte: Adaptado de Galetti Jr. b) é possível caracterizar moléculas de DNA por meio do padrão eletroforético de fragmentos gerados pela digestão com enzimas de restrição. é possível identificar com sucesso camarão descascado e congelado. J. 2008. devido a sua semelhança. b) filho. as doenças desse padrão poderão ser estudadas através de sequências nucleotídicas do indivíduo afetado.119-229. Ballou. porém muitos polimorfismos de mutação de DNA serão caracterizados pelos alelos que possuem. como o mero (Epinephelus itajara). editora SBG. c) os polimorfismos de DNA podem ser analisados pela digestão de amostras de DNA genômico com a enzima de restrição relevante e pela identificação de fragmentos de restrição específicos. fragmentos de tecidos foram retirados e submetidos à extração de DNA nuclear. Et al. A. os peritos devem verificar se há homologia entre o DNA mitocondrial do rapaz e o DNA mitocondrial do(a) a) pai.. cuja carne é frequentemente vendida como se fosse garoupa (Epinephelus marginatus). Genética da conservação na biodiversidade brasileira. para dirimir dúvidas. o material apreendido. produzindo uma impressão molecular única para todos os indivíduos de uma espécie. e) Uma vez que o mosaicismo acarreta num indivíduo células com material genético diferente. d) avó materna. 10. 9. In: Fundamentos de Genética da Conservação. 280p. Marcadores moleculares podem ser utilizados com grande eficiência para identificar e inibir a comercialização ilegal de produtos. para comparação com o DNA disponível dos possíveis familiares (pai.Interbits – SuperPro ® Web d) Uma vez que o mosaicismo acarreta num indivíduo células com material genético diferente.. permitindo a construção de mapas físicos. embora sua localização genética não possa ser determinada. Página 5 de 11 . c) filha.. Ribeirão Preto. avó materna. (Enem 2013) Para a identificação de um rapaz vítima de acidente. (Unesp 2013) Leia a placa informativa presente em uma churrascaria. será possível que alguém vá preso porque uma mutação o torna parecido com o de um criminoso..

e) os animais puros. c) do cruzamento de uma leitoa com um javali devem resultar híbridos fêmeas com 38 cromossomos e híbridos machos com 36 cromossomos. que mostra a produção de insulina por uma bactéria. A referência ao número de cromossomos justifica-se pelo fato de que são considerados javalis puros apenas os indivíduos com 36 cromossomos. tendo herdado o material genético de ambas as subespécies. b) os genomas das bactérias e do homem são homólogos. b) um híbrido de porco e javali. conhecido como javaporco.Interbits – SuperPro ® Web Porcos e javalis são subespécies de uma mesma espécie. mas não o número cromossômico do javali. Sus scrofa. aos quais o restaurante se refere. d) os animais não puros terão o mesmo número de cromossomos do porco doméstico. (Uemg 2013) Analise as informações contidas na imagem a seguir. Página 6 de 11 . terá 74 cromossomos. Uma bactéria é capaz de executar a transcrição e a tradução de um gene humano porque a) as células bacterianas e humanas apresentam ribossomos. c) o genótipo da bactéria é igual ao do homem. são filhos de casais em que pelo menos um dos animais paternos tem 36 cromossomos. Desse modo. d) o código genético é universal para ambos. mas não de um casal de javalis. é correto afirmar que: a) os animais com 37 cromossomos serão filhos de um leitão ou de uma leitoa. Os porcos domésticos possuem 38 cromossomos e podem cruzar com javalis. 11.

Interbits – SuperPro ® Web 12. ela fica sabendo que seu filho terá uma mutação cromossômica. respectivamente. Após um exame. (Ufsm 2013) O problema da desnutrição é mundial. a) GGATTCCCTGGTCCAAAGTCTGTA b) CGATTCCCTGGTCCAAAGTCTGTA c) CGAUUCCCUGGUCCAAAGCUGUA d) GGAUUCCCUGGUCCAAAGUCUGUA e) ATGTCTGAAAACCTGGTCCCTTAGC 14. 13. estão representados. A seguir. c) necessitar de um grande número de óvulos do doador do DNA. apesar dos seus benefícios ecológicos.embrapa-buscaclonagem. complementar os esforços de conservação de matas. b) impedir a adaptação de animais nascidos em cativeiro. após a mutação obtida. é a) diminuir a variabilidade genética das populações. (Cefet MG 2013) A Empresa Brasileira de Pesquisa Agropecuária (Embrapa) planeja trabalhar na clonagem de espécies ameaçadas de extinção no Brasil. A principal limitação dessa técnica. CCUAAGGGACCAGGUUUCAGACAU GCUAAGGGACCAGGUUUCAGACAU Informe qual a fita de DNA deu origem à sequência mutante.0. de animais como loboguará. No entanto. (Ufsm 2013) Uma senhora está grávida e deseja adquirir conhecimento a respeito da saúde do seu futuro bebê.com. parte da sequência de códons e eles mesmos. respectivamente. ele precisou alterar o DNA responsável pela informação necessária à síntese da proteína faseolina. mas. Disponível em: <http://www.>. esse projeto não pretende se tornar a principal ferramenta de preservação dessas espécies. Um pesquisador conseguiu uma nova variedade de feijão muito mais nutritiva. d) tetrassomia — trissomia.inedita-deanimais-ameacados-de-extincao-no-brasil. a) trissomia — monossomia. Acesso em: 08 Abril 2013 (adaptado). d) requerer gametas masculinos compatíveis de diferentes espécies.htm.br/noticias/geral. Para isso. Página 7 de 11 . c) triploidia — haploidia. b) diploidia — haploidia.estadao. sim. As mutações cromossômicas que correspondem ao resultado da divisão celular em 1 e 2 são. e) trissomia — diploidia. rios e reservas.960681. onça pintada e veado catingueiro.

confirmando o potencial leucemogênico da mutação da IL7R. contrariando o processo normal de amadurecimento celular. mediadas por vetores de clonagem.inca. b) o uso dos animais transgênicos tenha contribuído para o conhecimento das diferentes vias de ativação celular envolvidas na proliferação e maturação das células mieloides. Os pesquisadores realizaram testes preliminares com algumas drogas que se mostraram capazes de inativar as células portadoras da proteína alterada. ao receberem o gene da proteína humana defeituosa. confirmando o potencial cancerígeno da mutação da IL7R. que exerce papel na formação e no amadurecimento dos linfócitos T. sem afetar as células saudáveis do paciente. os pesquisadores avaliaram as consequências da alteração molecular em células humanas cultivadas in vitro e em camundongos transgênicos. (Upe 2013) Leia o texto a seguir: Priscila Zenatti e Andrés Yunes. 15. trazendo a cura de leucemias. Para confirmar a relação entre a mutação e a ocorrência da LLA de células T. fiquem doentes e desenvolvam tumores e infiltração de células leucêmicas em diversos órgãos. Os próximos estudos concentrarão esforços no desenvolvimento de anticorpos e novos fármacos capazes de reconhecer especificamente a proteína e vias de ativação celular afetadas pela mutação. para confirmar a relação entre a mutação e a ocorrência da LLA de células T. com o objetivo de inativar a proteína alterada e interromper o ciclo da doença.Interbits – SuperPro ® Web e) precisar de uma mãe de aluguel da mesma raça para gerar o clone. ocorrendo também em adultos. interrompendo o ciclo da doença. trazendo novas perspectivas para o desenvolvimento futuro de terapias alvo-específicas. realizados via terapia gênica.br/wps/wcm/connect/revistaredecancer/site/home/n15/revista_15 (Adaptado) O uso de células humanas cultivadas in vitro e de camundongos transgênicos é de extrema importância no estudo de doenças. agravando-se rapidamente. Disponível em: http://www2. o que leva à proliferação exagerada de linfócitos imaturos e ao desenvolvimento da leucemia linfoide aguda (LLA) de células T”. pesquisadores do Centro Infantil Boldrini. de acordo com o texto. na qual 10% apresentaram a mutação na IL7R. Página 8 de 11 . c) o cultivo celular tenha auxiliado na identificação da função da proteína IL7R na patogênese da LLA de células B. sem afetar as células saudáveis do paciente. a LLA é o tipo mais comum em crianças pequenas.gov. é esperado que a) os camundongos. desenvolveram um estudo com a proteína interleucina7 (IL7R). tenham capacidade de inibir as vias de ativação celular afetadas pela mutação genética. o estudo promoveu a análise genômica de amostras clínicas de 201 pacientes. indicando o potencial cancerígeno da mutação da IL7R. descreve Priscila. d) algumas drogas analisadas em ensaios preliminares. “A mutação genética encontrada provoca ativação contínua da proteína. Assim. e) os anticorpos de camundongos produzidos pelos linfócitos T e os novos fármacos tenham a capacidade de reconhecer a mutação IL7R. permitindo a melhoria no diagnóstico e na prevenção de doenças hereditárias e/ou genéticas bem como na identificação de genótipos. Dos quatro tipos mais comuns de leucemia (tipo de câncer). Ao longo de cinco anos.

porque os organismos transgênicos podem transmitir seus genes modificados às espécies não transgênicas.Interbits – SuperPro ® Web Gabarito: Resposta da questão 1: [B] Os tumores malignos se desenvolvem quando as células sofrem mitoses anormais e desordenadas. Esses indivíduos apresentarão 47 cromossomos. tanto em técnicas convencionais quanto nas digitais. Resposta da questão 8: [C] A identificação genômica das espécies é possível porque estas possuem em seu material genético sequências denominadas polimorfismos que podem ser obtidos pela hidrólise do DNA por enzimas de restrição. Resposta da questão 3: [B] A correlação exata entre as figuras e os itens está na alternativa [B]. Doses relativamente altas em exames de TC (Tomografia Computadorizada) e procedimentos intervencionistas aumentam a chance de câncer relacionado à radiação. 4 e 5 são portadores de um cromossomo a mais. A preocupação é com a repetição de exames. em relação aos indivíduos normais e não portadores. Resposta da questão 2: [E] Os gametas 3. Resposta da questão 7: [D] Os mosaicismos genéticos podem ser detectados em indivíduos afetados por doenças genéticas através de suas sequencias nucleotídicas diferenciais. A dose de radiação envolvida na maioria dos exames de raios X. para um óvulo anucleado que gerou um embrião clonado. Ao fecundarem óvulos normais contendo n cromossomos darão origem a organismos portadores de trissomia. Página 9 de 11 . Resposta da questão 4: [B] A clonagem reprodutiva é realizada através da transferência do núcleo de uma célula adulta da cabra que originou a Gluca. Resposta da questão 5: [E] A planta é classificada como um organismo transgênico. pois recebe. incorpora e expressa o gene extraído de outra espécie. sendo n  1. Resposta da questão 6: [C] O fluxo gênico entre as espécies nativas e as geneticamente modificadas podem causar impactos na biodiversidade. é bem pequena. Mutações nos genes reguladores do ciclo podem produzir células cancerosas.

Resposta da questão 12: [A] Em [1] ocorre uma trissomia. Dessa forma. A variabilidade é um fator importante para a seleção de espécies adaptadas a um determinado ambiente. As mitocôndrias são organelas herdadas pela linhagem matrilinear. Resposta da questão 15: [A] Os camundongos geneticamente modificados que receberam o gene determinante da proteína humana defeituosa desenvolvem a LLA. do javali. confirmando o potencial cancerígeno do gene mutante. o gene humano introduzido na bactéria pode ser transcrito para a formação de moléculas de RNA e traduzido que acarreta na produção de insulina pelas bactérias. Resposta da questão 13: [B] RNAm: DNA: GCU CGA AAG TTC GGA CCT CCA GGT GGU CCA UUC AAG AGA TCT CAU GTA Resposta da questão 14: [A] A clonagem é um processo onde não há variabilidade por se tratar de um processo de cópia do material genético. por meio do citoplasma do óvulo. Resposta da questão 10: [A] O cruzamento do porco (2N=38) com o javali (2N=36) produz híbridos resultantes da união de gametas: N=19. Resposta da questão 11: [D] O código genético é universal.Interbits – SuperPro ® Web Resposta da questão 9: [D] Os peritos devem verificar se há homologia entre o DNA mitocondrial do rapaz e o DNA mitocondrial de sua avó materna. a monossomia é caracterizada pela presença de 1 cópia do maior cromossomo. ele terá 2N=37 cromossomos. o que significa que as trincas de bases nitrogenadas no DNA ou no RNA codificam o mesmo aminoácido. porque a célula apresenta 3 cópias do cromossomo maior. desta forma. Página 10 de 11 . Em [2]. do porco e N=18.

.........125575..........Biologia......135256.........Biologia...............Biologia.................Biologia..................Upe/2015.Unesp/2013.....135264.........Cefet MG/2013................Biologia.Múltipla escolha 4.......Biologia.....................................Uneb/2014.........Interbits – SuperPro ® Web Resumo das questões selecionadas nesta atividade Data de elaboração: Nome do arquivo: 14/06/2015 às 18:33 biotec Legenda: Q/Prova = número da questão na prova Q/DB = número da questão no banco de dados do SuperPro® Q/prova Q/DB Grau/Dif................Múltipla escolha 3.............Biologia........Múltipla escolha 12.....................135744...........................Múltipla escolha 8...................Múltipla escolha 10..........122200.........Média.......Média...137796.............Média.................................Média..............Média...................................Biologia..129535..........................124398..............Ufsm/2013....................................................Unifor/2014..............Ufsm/2013.Unifor/2014...............Múltipla escolha Página 11 de 11 ........................124396................Média.129991...................Múltipla escolha 13..Média...............Múltipla escolha 6....................128051.......................................Biologia................................Múltipla escolha 7....... Matéria Fonte Tipo 1.............125045........131794...................Múltipla escolha 14.......Média....................Múltipla escolha 15.........Média........Biologia..................Múltipla escolha 5.Média.........135525....Uemg/2013.......Biologia.......Média.........Enem/2013.........Cefet MG/2014...Enem/2014.....Biologia...Múltipla escolha 2............................Upe/2013.........Biologia.........Biologia.Múltipla escolha 9........Média.......Múltipla escolha 11..............................................Média...Fgv/2015..........Média............Upe/2014.Biologia..........130191........Média.....