You are on page 1of 14

Name  _______________________________________________  

Biochemistry  
Biol  100  
Summer  2014  
 

Jeremy  Lee  
Eryn  Wicklow  
 
Midterm  Exam  
July  10,  2014  

 
BE  SURE  TO  PUT  YOUR  NAME  ON  ALL  PAGES.  (14  PAGES  TOTAL)  
 
The  following  exam  is  composed  of  four  parts  (112  points  total:)  
Part  1.   Multiple-­‐choice  (28  points  total);  
Part  2.   Fill-­‐in  (24  points  total);  
Part  3.  Calculation  Problem  (12  points);  
Part  4.   Written  Answer  (48  points  total.)  
 
Part  1.  Multiple-­‐choice.    Choose  the  one  best  answer  and  fill-­‐in  the  corresponding  bubble  
on  the  Scantron  form.  (1  point  each)  
 
1.  Proteins  that  are  to  be  utilized  in  the  plasma  membrane  are  most  commonly  
A.  synthesized  on  free  ribosomes  in  the  cytosol.  
B.  synthesized  on  ribosomes  in  the  rough  ER.  
C.  transported  to  the  plasma  membrane  in  secretory  vesicles  that  bud  off  from  the  rough  ER.  
D.  A  and  C  
E.  B  and  C  
ANSWER:  B  
 
2.  Hydrophobic  molecules  tend  to  aggregate  in  aqueous  solutions  because  
A.  the  hydrophobic  molecules  are  negatively  charged  so  are  repelled  by  the  positively  charged  
water  molecules.  
B.  the  hydrophobic  molecules  are  positively  charged,  so  are  repelled  by  the  negatively  charged  
water  molecules.  
C.  this  decreases  the  entropy  of  water  molecules  surrounding  the  hydrophobic  molecules.  
D.  the  hydrophobic  molecules  bind  only  to  the  positive  charges  of  polar  water  molecules.  
E.  this  increases  the  entropy  of  water  molecules  surrounding  the  hydrophobic  molecules.  
ANSWER:  E  
 
3.  Acetic  acid  has  a  pKa  of  4.76,  whereas  pyruvic  acid  has  a  pKa  of  2.50.    Which  of  the  following  
is/are  true?  
A.  Pyruvic  acid  is  a  stronger  acid  than  acetic  acid.  
B.  The  pH  at  which  acetic  acid  is  fully  dissociated  is  4.76.  
C.  The  pH  at  which  acetic  acid  is  half  dissociated  is  4.76.  
D.  A  and  B  
E.  A  and  C  
ANSWER:  E  
 
 

 In  a  polypeptide.  it  can  form  a  covalent  bond  with  another  cysteine.  all  of  the  above   ANSWER:  C     9.  is  a  weak  acid.  In  an  alpha  helix.  toward  the  inside  of  the  helix.  histidine  can  be   A.  At  neutral  pH  (pH=7).  A  and  C   E.   D.  both  its  amino  group  and  its  carboxyl  group  protonated.  just  its  amino  group  protonated.  α-­‐carbon  to  amino  nitrogen  bond.  its  side  chain  has  a  sulfhydryl  group.   D.  uncharged.  A  and  C   E.   D.   C.   B.  A  characteristic  of  a  buffer  is  that  it     A.   C.   ANSWER:  A   6.Name  _______________________________________________   4.  parallel  to  the  long  axis  of  the  helix.  peptide  bond   D.  all  of  the  above   ANSWER:  D   7.   B.  At  physiological  pH.  even  with  a  significant  input  of  protons.  its  side  chain  is  hydrophobic.  prevents  large  changes  in  pH.   B.   E.  the  amino  acid  side  chains  are  oriented   A.   D.  all  of  the  above   ANSWER:  B     2   .  is  a  strong  acid.  rotation  does  not  occur  around  which  bond?   A.  B  and  C   ANSWER:  E     5.   B.  just  its  carboxyl  group  protonated.   B.  A  and  B   E.  An  important  characteristic  of  the  amino  acid  cysteine  is   A.  α-­‐carbon  to  carbonyl  carbon  bond   C.   D.   C.  both  its  amino  group  and  its  carboxyl  group  deprotonated.  toward  the  outside  of  the  helix.  B  and  C   ANSWER:  E     8.  randomly  with  respect  to  the  helix.   C.  positively  charged.   B.   C.  an  amino  acid  typically  has   A.  negatively  charged.  A  and  B   E.

  C.   C.Name  _______________________________________________   3   10.  the  α-­‐phosphate  of  a  deoxyribonucleotide  phosphate.   D.  In  DNA  replication.  The  function  of  the  sliding  clamp  in  DNA  replication  is  to   A.   B.  all  of  the  above.  A  and  C   ANSWER:  C     11.  the  angles  of  the  bonds  between  the  deoxyribose  sugars  and  the  bases.  each  amino  acid  on  a  strand  forms  two  hydrogen  bonds  with  only  one  amino  acid  on  the   other  strand.  hydrogen  bonding  between  nucleotides  on  the  same  strand  of  DNA.  the  DNA  polymerase  catalyzes  the  reaction  between  the  3’  OH  of  one   nucleotide  and   A.   ANSWER:  C     .   ANSWER:  B     12.   E.  a  difference  between  a  beta  sheet  composed  of  two  antiparallel  β-­‐strands  and  a   beta  sheet  composed  of  two  parallel  strands  is  that  in  a  beta  sheet  composed  of   antiparallel  strands   A.   B.   D.  repellency  between  phosphate  groups  on  the  two  strands  of  DNA.  the  α-­‐phosphate  of  a  deoxyribonucleotide  diphosphate.   D.   E.   C.   B.   B.  maintain  DNA  polymerase’s  attachment  to  the  template  strand.  A  and  B   E.  A  and  B   E.  A  and  B   E.  the  α-­‐phosphate  of  a  deoxyribonucleotide  triphosphate.  unwind  the  DNA.   ANSWER:  B     13.   B.  Major  and  minor  grooves  are  found  in  a  DNA  double  helix  because  of   A.   D.  increase  and  maintain  DNA  polymerase’s  processivity.   C.  prevent  single-­‐stranded  DNA  from  base-­‐pairing  to  itself.  the  β-­‐phosphate  of  a  deoxyribonucleotide  triphosphate.   D.  The  function  of  DNA  helicase  in  DNA  replication  is  to   A.   ANSWER:  A     14.  each  amino  acid  on  a  strand  forms  one  hydrogen  bond  with  each  of  two  amino  acids  on  the   other  strand.  the  angles  between  phosphodiester  bonds  on  adjacent  nucleotides  on  a  chain.  In  proteins.   C.  the  difference  in  the  number  of  hydrogen  bonds  between  G-­‐C  pairs  and  A-­‐T  pairs.  all  of  the  above.  there  are  fewer  hydrogen  bonds  between  amino  acids  on  the  two  strands.  unwind  DNA.  the  β-­‐phosphate  of  a  deoxyribonucleotide  diphosphate.  rewind  the  DNA.

  C.   B.  oxidized  bases.   E.  binding  of  the  RNA  polymerase  to  the  Shine-­‐Dalgarno  sequence  of  the  promoter.  addition  of  a  5’  cap.  deaminated  bases.  binding  of  the  RNA  polymerase  to  the  operator  sequence.  does  not  need  a  primer  to  initiate  formation  of  a  new  strand.   B.   C.  the  sigma  subunit  of  RNA  polymerase  is  critical  for   A.  unwinding  of  the  DNA  to  allow  reading  of  the  DNA  template.  addition  of  the  nucleotides  C-­‐C-­‐A  to  the  3’  end   D.   E.  base  excision  repair   B.  dimers  of  pyrimidines.  A  characteristic  of  RNA  polymerase  that  is  not  a  characteristic  of  DNA  polymerase  is  that  RNA   polymerase   A.   C.  addition  of  a  poly  A  tail.   ANSWER:  C     17.   B.  all  of  the  above   ANSWER:  E     16.  all  of  the  above   ANSWER:  B     19.  In  E.  A  and  B   E.   ANSWER:  E     18.  A  and  B   E.  all  of  the  above   ANSWER:  C               .  Post-­‐transcriptional  modification  of  a  newly  transcribed  prokaryotic  tRNA  includes   A.  nucleotide  excision  repair   C.  A  and  B   E.  alkylated  bases.  coli.  Ultraviolet  light  damages  DNA  by  creating   A.   C.  binding  of  the  RNA  polymerase  to  the  transcription  initiation  site.  is  not  a  processive  enzyme.  reduced  bases.  lagging  strand  synthesis  in  DNA  replication   D.   D.  reads  along  the  template  strand  from  3'  to  5'.  binding  of  the  RNA  polymerase  to  the  -­‐10  and  -­‐35  sequences.   D.Name  _______________________________________________   4   15.   D.  DNA  ligase  functions  in   A.   B.

 coli   A.  bind  to  basal  transcription  factors  to  allow  formation  of  the  pre-­‐initiation  complex.  increasing  the  CAP  protein's  binding  to  the  lac   operon.   ANSWER:  C     21.   B.  bind  to  the  spliceosome  to  facilitate  intron  removal.   ANSWER:  A     23.  there  is  more  cAMP  bound  to  CAP  protein.   B.  formation  of  a  bond  between  the  guanosine  at  the  5’  end  of  the  intron  and  the  branch  site   adenosine.  enhancers   A.   C.   C.  there  is  less  cAMP  bound  to  CAP  protein.  In  eukaryotic  transcription.  allowing  it  to  escape  the   promoter.  phosphorylate  the  C-­‐terminal  domain  of  TFIID.   D.   C.  decreasing  the  CAP  protein's  binding  to  the  lac   operon.  bind  proteins  that  interact  with  the  mediator  complex  to  affect  the  levels  of  transcription.  causing  it  to  release  RNA  polymerase  from   the  promoter.  A  major  function  of  the  TFIIH  basal  transcription  factor  in  eukaryotes  is  to   A.   D.  In  spliceosome-­‐mediated  removal  of  an  intron.   D.  the  second  transesterification  reaction   involves   A.  bind  to  the  GC  box  of  the  promoter.  A  and  B   E.  all  of  the  above   ANSWER:  C         .  decreasing  the  CAP  protein's  binding  to  the  lac   operon.  When  glucose  levels  are  high  in  E.   E.  phosphorylate  the  C-­‐terminal  domain  of  the  RNA  polymerase.  interact  with  the  mediator  complex  to  allow  RNA  polymerase  to  bind  to  the  promoter.  formation  of  a  phosphodiester  bond  between  the  3'  OH  of  the  nucleotide  at  the  3’  end  of  the   upstream  exon  and  the  5'  phosphate  of  the  nucleotide  at  the  5’  end  of  the  downstream   exon.  bind  to  the  mediator  complex  to  affect  levels  of  transcription.  cleavage  of  the  phosphodiester  linkage  between  the  nucleotide  at  the  3’  end  of  the   upstream  exon  and  the  nucleotide  at  the  5’  end  of  the  intron.   E.  there  is  more  cAMP  bound  to  CAP  protein.  there  is  less  cAMP  bound  to  CAP  protein.   ANSWER:  C     22.   C.  modify  histone  tails  to  affect  the  levels  of  transcription.   B.   D.Name  _______________________________________________   5   20.  phosphorylate  the  C-­‐terminal  domain  of  histone  proteins.   B.  increasing  the  CAP  protein's  binding  to  the  lac   operon.  making  the  promoter  more   available  for  binding  by  RNA  polymerase.

 ATP.  ΔG  may  be  >0  or  <0  depending  on  temperature.   E.  the  mRNA  is  associated  with  the  small  unit  of  the  ribosome  prior  to  the  large  subunit  of  the   ribosome  joining  the  complex.   C.  AMP.  the  initiator  methionine  is  not  formylated.    This  means  that  at  25oC  and  pH=7.   D.  A  and  C   ANSWER:  B   e       .  the  small  unit  of  the  ribosome.   A.  the  reaction  will  occur  spontaneously.  In  a  reaction  at  equilibrium.  at  equilibrium  the  reactants  will  be  at  a  lower  concentration  than  the  products.  ΔG  >0   D.  increases  the  reaction  rate   C.   B.  has  no  effect  on  the  equilibrium  of  the  reaction   E.  A  and  B   E.  none  of  the  above  (i.   E.  the  complete  ribosome  is  composed  of  two  subunits.   E.     A.  the  initiator-­‐aminoacyl-­‐tRNA  initially  associates  with  the  mRNA  at  the  start  codon.   C.   B.  The  first  step  in  "charging"  a  tRNA  with  an  amino  acid  (forming  a  bond  between  the  tRNA  and   an  amino  acid)  involves  a  reaction  between  the  amino  acid  and   A.  Which  of  the  following  is  NOT  true  regarding  enzyme  activity  in  a  chemical  reaction?   A.   C.   D.  EF-­‐Tu.   ANSWER:  B     27.   B.   ANSWER:  C     25.  For  a  reaction  the  K'eq  >1.  A  characteristic  of  prokaryotic  translation  that  is  not  a  characteristic  of  eukaryotic  translation   is  that  in  prokaryotic  translation   A.  lowers  the  activation  energy  of  a  reaction   B.e.Name  _______________________________________________   6   24.   ANSWER:  B     26.  all  of  the  above  are  true  statements  about  enzyme  activity)   ANSWER:  E     28.  facilitates  formation  of  the  transition  state   D.   D.  ΔG  =  0   C.  the  3'  end  of  the  tRNA.  at  equilibrium  the  reactants  will  be  at  a  higher  concentration  than  the  products.  peptide  bond  formation  is  a  catalyzed  by  an  rRNA  in  the  large  subunit  of  the  ribosome.  ΔG<0   B.  Can't  tell  without  knowing  concentrations  of  reactants  and  products.

 word  or  phrase.)       6.  the  basic  structure  of  DNA  packaging  is  called  a(n)   ___nucleosome________________.  The  two  major  kinds  of  interactions  that  occur  between  bases  in  double-­‐stranded  DNA  are   ___hydrogen_______________________________  bonds  and     ____Van  der  Waals  interactions  (or  forces)_.  which  is  composed  of  DNA  wrapped  around  a  core  of  eight   ___histone___________________  proteins.  are  said  to  show  “inside-­‐out”  conformation  because   ___hydrophobic_______________________  amino  acids  tend  to  be  found  on  the  exterior  of  the   functional  protein.       2.  A  bond  that  forms  between  atoms.  The  bond  in  a  nucleotide  that  links  the  base  to  the  sugar  is  called  a(n)    ___N-­‐glycosidic  (or  β -­‐glycosidic)  bond  (or  linkage.  except  where  noted.       (1  point  per  blank.)   ___________________________________________________________     4.  In  eukaryotic  cells.)     1.       7.  write  in  the  appropriate.  Fill-­‐in.         5.  Many  membrane  proteins.       .  In  eukaryotic  DNA.  secretory  vesicles  are  produced  from  an  organelle  called  the     ___Golgi  complex  (or  apparatus.  Draw  the  basic  structure  of  an  amino  acid  (2  points)       (Note:  this  is  worth  2  points.Name  _______________________________________________   7     Part  2.  they  don't  need  to  put  text  labels.  In  each  blank.  like  porins.)       3.  which  involves  sharing  of  an  electron  between  the  two   atoms.    Also.  is  called  a(n)  ___covalent____________________  bond.  and  best.

 The  group  of  enzymes  that  catalyze  the  reactions  that  form  bonds  between  tRNAs  and  amino   acids  is  called  ____amino-­‐acyl-­‐tRNA-­‐synthetases__________________________.       14.       16.  a(n)  _poly(A)  tail_______________  is  added  to  the   3’  end  by  the  enzyme  ___poly  (A)  polymerase___________________.       12.  In  a  spliceosome.  DNA  strand  #1  is  the  _sense  (or  coding)___________  strand  and   DNA  strand  #2  is  the  _anti-­‐sense  (or  template)_  strand.  Hydrolysis  of  _____GTP____________  provides  the  energy  by  which  the  translation  factor  called   ___EF-­‐G  (or  elongation  factor-­‐G)____  translocates  the  mRNA  and  the  tRNAs  along  the   .  In  base  excision  repair.       10.  the   incorrect  nucleotide  is  usually  detected  by  the  ____proofreading__________________  activity  of   the  DNA  polymerase.     11.  If  an  incorrect  nucleotide  is  added  to  a  growing  strand  of  DNA  by  DNA  polymerase.  A  nucleotide  that  is  frequently  found  at  the  5'  end  of  tRNA  anticodons  and  which  can  base  pair   with  three  different  bases  on  mRNA  is  __inosine______________________________.    This  phosphorylation  is  catalyzed  by  the  basal   transcription  factor  __TFIIH_________________.       15.       13.  the  catalytic  activity  for  intron  removal  and  splicing  is  a  function  of  the   ___snRNA_______________________  molecules  within  the  snRNPs.   9.  In  eukaryotes.  The  following  is  a  portion  of  the  transcribed  region  of  a  gene:     5’ ACCTGTCGATGCCCAGTCGTGT 3’ (strand #1) 3’ TGGACAGCTACGGGTCAGCACA 5’ (strand #2) Here  is  a  corresponding  portion  of  the  mRNA  that  is  produced  by  transcription  of  this  gene:     5’ ACCUGUCGAUGCCCAGUCGUGU 3’   With  respect  to  transcription.Name  _______________________________________________   8   8.  after  cleavage  of  the  pre-­‐mRNA.  The  factor  that  "escorts"  an  aminoacyl-­‐tRNA  to  the  ribosome  is  called     ____EF-­‐Tu________________________________.  the  first  step  is  removal  of  the  damaged  base  by  an  enzyme  called  a(n)   ____DNA  glycosylase______________________________.  phosphorylation  of  the  _C-­‐terminal  domain  of  RNA  polymerase_______________   is  required  for  transcription  to  be  initiated.  In  eukaryotes.       17.

    K'eq = e.41   ΔG  =  -­‐3.Name  _______________________________________________   9   ribosome  so  that  the  next  codon  moves  into  the  position  to  associate  with  a  new  aminoacyl-­‐ tRNA.98____________________________________         B.98  +  2.2  =  ln  e-­‐ Go'/RT -­‐1.    Complete  parts  A.    Equations  you  might  need  are  listed  at  the  bottom  of  the  page.     K'eq  =  e-­‐ Go'/RT 0.47   Δ .61  =  -­‐ΔGo'/RT   -­‐1.  Determine  ΔG  for  the  reaction  when  the  initial  concentrations  of  the  two  compounds   are:                            [A]  =  6  x  10-­‐2  M                          [B]  =  3  x  10-­‐3  M      Δ G  =  Δ Go'  +  RT  ln  ([C][D]  /  [A][B])   ΔG  =  Δ Go'  +  RT  ln  ([products]  /  [reactants])   ΔG  =  3.  Calculate  ΔGo'  for  the  reaction  (3  points).  and  under  standard  conditions  (25oC.)  will   the  reaction  occur  spontaneously?    Explain.  B  and  C.47  =  -­‐ΔGo' Δ Δ Δ ΔGo'  =  __3.2            For  this  reaction:   A.43______________________________________  (5  points)     C.    In   other  words.  pH=7.43   ΔG  =  _-­‐3.47  x  (-­‐3.  Δ G  <0.  At  the  concentrations  given  in  part  B.    You  must  show  your  work  to  get   credit.  at  those  concentrations.61  x  2.  the  reaction  will  occur  spontaneously  since.   Part  3.     For  the  following  reaction:                                  A                                                     B                                  K'eq  =  0.  Calculation  problem.  (4  points)     Yes.47  ln  (0.05)   ΔG  =  3.Go'/RT ΔG  =  Δ Go'  +  RT  ln  ([C][D]  /  [A][B])   RT  =  2.47  ln  (0.  the  free  energy  of  the  product  at  its  initial  concentration  is  less  than   the  free  energy  of  the  reactant  at  its  initial  concentration.2 =  e-­‐ Go'/RT   ln  0.003  /  0.0)   ΔG  =  3.98  –  7.98  +  2.98  +  2.06)   ΔG  =  3.

   Written  Answer.  This  generally  "loosens"  the   association  between  the  core  histones  and  DNA.  creating  ester   bonds  between  them.g.    Also.     Histone  acetyltransferases:  add  acetyl  groups  to  amino  acids  (especially  lysines)  in  the  N-­‐ terminal  tails  of  core  histone  proteins  of  nucleosomes.Name  _______________________________________________   10   ΔGo’  =  -­‐  RT  ln  [C][D]  /  [A][B]  (at  equilibrium)   Part  4.    Activity  generally  associated  with  decreased   transcription.    Only  the  first  3  questions  you  answer  will  be  graded   (unless  you  completely  cross  out  your  answer.     Activator  proteins:  bind  enhancer  sequences  and  increase  level  of  transcription  by  1)   interacting  with  mediator  complex  to  facilitate  formation  of  the  RNA  pol  II  pre-­‐initiation   complex.  activator  proteins.  TBP  subunit  of  TFIID  binds  to  the  TATA  box  sequence  of  the   promoter.  reads  anti-­‐sense   (template)  strand  of  DNA  and  adds  complementary  RNA  nucleotides  5'  to  3'.  TFIIH.  histone  acetyltransferases.     Chromatin  remodeling  engines:  modify  the  interactions  between  DNA  and  associated  proteins   (e.  inhibiting  binding  of  basal  transcription  factors/  RNA  pol  II  and   the  activity  of  chromatin  remodelers.  catalyzes  phosphorylation  of  C-­‐terminal  domain  (CTD)  of  RNA   polymerase  II.  Describe  all  the  important  functions  of  each  of  the  following  in  eukaryotic  transcription:  RNA   polymerase  II.)     TFIIH:  Basal  transcription  factor  that  induces  RNA  polymerase  to  "melt"  (initial  unwinding  of)   DNA  at  the  promoter.     RNA  polymerase  II:  Binds  promoter  sequence.     Enhancers:  DNA  sequences  frequently  upstream  of  promoter  (also  may  be  in  introns)  to  which   activator  proteins  (or  repressor  proteins)  bind  to  influence  the  level  of  transcription.    This  generally  "tightens"  the  association  between  the   core  histones  and  DNA.     Histone  deacetylases.  allowing  it  to  escape  the  promoter  and  initiate  transcription.    The  following  section  contains  5  questions.    remove  acetyl  groups  from  amino  acids  in  the  N-­‐terminal  tails  of  core   histone  proteins  of  nucleosomes.    Activity  generally  associated   with  increased  transcription.g.  chromatin  remodeling  engines.     TFIID:  Basal  transcription  factor  that  initiates  formation  of  the  pre-­‐initiation  complex  by   binding  to  the  promoter  (e.  histones.)    For  example  may  "spin  off"  a  segment  of  DNA  from  histone  core  of   nucleosome  to  make  DNA  more  available  for  binding  of  basal  transcription  factors  and   .    In  addition.  unwinds  and  rewinds  DNA.  TFIID.  describe  how  the  process   of  transcription  in  terminated  in  eukaryotes.  to  synthesize  pre-­‐mRNA.  facilitating  binding  of  basal  transcription   factors/  RNA  pol  II  and  activity  of  chromatin  remodelers.   histone  deacetylases.  and/or  2)  recruitment  of  chromatin  remodelers  and/or  histone  modifiers  that   facilitate  binding  of  basal  transcription  factors/RNA  pol  II  to  promoter.    CHOOSE  3  of  the  5   and  write  thorough  answers.  (16  points  each)     1.  enhancers.)    Use  the  bottom  and  back  of  the  last   page  if  you  need  more  room.

 Describe  how  enzymes  catalyze  reactions  with  respect  to  activation  energy.  and   since ΔG  is  the  difference  in  free  energy  of  products  and  reactants.  explain.  and  draw  and   explain  a  graph  depicting  this  effect.  Activation  energy  is  NOT  included  in  calculation  of  Δ G  because  all  the  energy  added  to   reach  transition  state  is  released/recovered  when  transition  state  is  transformed   into  the  product(s.  is  reduced  by  the  enzyme     Graph  should  look  something  like  this:              D.     .  Enzymes  do  NOT  affect  the  levels  of  free  energy  in  the  reactants  or  in  the  products.   C.  Address  each  of  the  following  with  respect  to  a  chemical  reaction:   A.  enzymes  have  no   effect  on  Δ G.  Activation  energy  is  the  difference  in  free  energy  between  reactant(s)  (substrate(s))   and  the  transition  state.  the  effect  of  an  enzyme  is  to  lower   the  free  energy  of  transition  state.  Describe  the  effect  that  an  enzyme  has  on  the  ΔG  of  a  reaction.)   2.       In  other  words.     B.       D.  Enzymes  catalyze  reactions  by  lowering  the  activation  energy  required  to  reach  the   transition  state.         B.     A.  the  conformation  between  the  reactant(s)  and  product(s).  activation  energy.  activation  energy  is  the  amount  of  energy  that  must  be  added  to   allow  the  reactant(s)  to  reach  the  transition  state.  thus  facilitating  formation  of  the  transition  state  and  increasing  the   rate  of  the  reaction.  Indicate  whether  the  "activation  energy"  of  a  chemical  reaction  is  included  in  the   calculation  of  ΔG  for  a  reaction.)     C.Name  _______________________________________________   11   RNA  pol  II.)    (ΔG  is  simply  the  difference  in  free  energy  of  products  and   reactants.    As  shown  in  the  graph  below.  meaning  that  the  input  of  energy  to  reach  transition   state.  depending  on   the  type  of  remodeling.    (May  be  associated  with  increased  or  decreased  transcription.  Explain  what  “activation  energy”  is  with  respect  to  a  chemical  reaction.

    1.   A.  Spliceosome  subunits  associate  with  each  intron.  indicate  how  this  processing  affects  the   number  of  proteins  that  can  be  encoded  by  a  single  gene.  The  enzyme  guanylyltransferase.Name  _______________________________________________   12     3.  Describe.  creates  an  ester  bond  between  the  beta  phosphate   (now  the  terminal  phosphate)  of  the  5'  nucleotide  of  the  pre-­‐mRNA  and  the  alpha   phosphate  of  an  additional  guanosine  nucleotide.    Be  sure  to  include  then  name  and  functions  of  the  important  molecules   involved  in  the  various  types  of  processing.  Removal  of  introns  and  splicing  of  exons.   C.  The  enzyme  RNA  triphosphatase  cleaves  off  one  phosphate  group  (gamma   phosphate)  from  the  5'  end  of  the  5'  (first)  nucleotide  of  the  pre-­‐mRNA   B.  producing  a  variety  of  different   mRNAs  from  the  same  pre-­‐mRNA.     C.    Also.   B.  Addition  of  5'  cap  (7-­‐methyl  guanosine)  to  5'  end  of  pre-­‐mRNA:   A.  Second  transesterifcation  reaction.   A.     2.  this  means  that  a  single  gene  can  encode  several  different   polypeptides/proteins.  catalyzed  by  U2  and  U6  snRNAs:    Oxygen  of  branch   site  adenosine's  2'OH  reacts  with  phosphate  group  of  nucleotide  at  5'  end  of  intron   (usually  a  "G")  to  form  an  ester  linkage  between  them.  Intron  is  released  and  exons  are  now  spliced  together.  the  processing  of  a  eukaryotic  pre-­‐mRNA  to  produce  an  mRNA  that  is  ready   for  translation.     3.  First  transesterification  reaction.  in  detail.  with  each  mRNA  encoding  a  somewhat  different   polypeptide.  The  enzyme  methyltransferase  adds  a  methyl  (CH3)  group  to  the  N-­‐7  of  the   guanosine.  Several  (about  20)  nucleotides  downstream  (3')  of  the  signal  sequence   (polyadenylation  signal)  an  endonuclease  cleaves  the  pre-­‐mRNA.  poly  (A)  polymerase  adds  a  large  number  (tens  to  hundreds)  of  adenosines  to  the  3'   cut  end  of  the  pre-­‐mRNA.   B.                         .  Cleavage  of  pre-­‐mRNA  and  addition  of  poly  (A)  tail.     Since  a  given  pre-­‐mRNA  can  be  spliced  in  alternative  ways.  also  catalyzed  by  U2  and  U6  snRNAs:  Oxygen  of   the  now  "free"  3'OH  of  the  nucleotide  at  the  3'  end  of  the  upstream  exon  reacts  with   the  5'  phosphate  of  the  nucleotide  of  the  5'  end  of  the  downstream  exon  forming   another  ester  linkage.

RNaseH digests most of RNA primer.             .  Single-­‐strand  binding  proteins  (SSBs)  bind  to  single-­‐stranded  DNA  template  strand   to  prevent  formation  of  stem  loops  in  that  DNA  strand  (intra-­‐strand  base  pairing.  Be  sure  to  name  all  the  molecules  involved  in  the  process  and  their  functions. Starting at 3' end of an RNA primer made by (DNA) primase. Catalyzes reaction between 3’ OH of last nucleotide and α-phosphate of incoming (next) nucleotide to create an ester linkage (phosphodiester bond.  the  process  of  replication  of  DNA  for  creating  a  lagging  strand  in   prokaryotes. 4. Detachment of DNA polymerase from previous Okazaki fragment changes conformation of (Tau protein) clamp loader subunit of DNA polymerase holoenzyme. DNA polymerase re-localizes from previous Okazaki fragment to 3' end of new primer and new clamp is attached to/loaded on DNA polymerase. 9. adding complementary nucleotides one-by-one to new strand.     1.     2.) Creates Okazaki fragment that lengthens in a direction opposite the movement of the replication fork. DNA polymerase detaches from template and moves to next primer (back to step 4.)   re-­‐annealing  of  the  two  strands.   3.Name  _______________________________________________   13     4.  DNA  helicase  unwinds  DNA  at  the  replication  fork. Enzyme is ready for synthesizing next Okazaki fragment 6. 7.) 8. exonuclease activity of DNA polymerase (DNA pol I) digests remainder of primer. 10.  in  detail. inducing (gamma subunit of) clamp loader to load a sliding clamp around DNA at 3' end of new RNA primer. 5. DNA ligase seals "nick" by creating phosphodiester bond between 3' end of DNA that replaced primer and 5' end of the previous Okazaki fragment. (DNA) primase creates an RNA primer complementary to a short stretch of single-stranded template being produced by DNA helicase. DNA polymerase fills in "gap" created by digestion of RNA primer. DNA polymerase reads template strand 3’ to 5’.  Describe.  or  binding  of  other  nucleic  acids. As above occurs. When DNA polymerase reaches 5' end of the RNA primer at the 5' end of previously synthesized Okazaki fragment.

)   7.  it  has  already  synthesized  part  of   the  encoded  polypeptide.     4.  tRNA  in  E-­‐site  leaves  the  ribosome.   2.    Describe  one  full  cycle  of  translation.    Binding  here  brings  EF-­‐G-­‐GTP  into  factor  binding  center.  EF-­‐G-­‐GDP  leaves  ribosome.   enters  the  A-­‐site  of  the  ribosome.       .  associated  with  EF-­‐Tu-­‐GTP.     3.  i.   6.  hydrolyzing  its  GTP  to  GDP.     9.  Assume  a  eukaryotic  ribosome  is  in  the  middle  of  translation.e.  as  it  is  within  the  peptidyl  transferase  center.   5.  it's  converted  to  EF-­‐G-­‐GDP  causing  a  change  in  the  conformation   of  EF-­‐G.    The  elongation  factor  EF-­‐G-­‐GTP  enters  the  large  subunit  portion  of  the  A  site  of  the   ribosome.    Movement    also   "pushes"  tRNA  that  had  been  in  the  P-­‐site  to  the  E-­‐site.  The  anticodon  of  this  aminoacyl-­‐tRNA  base  pairs  with  the  mRNA  codon  in  small   subunit  portion  of  the  A-­‐site.     1.  A  new  aminoacyl-­‐tRNA.  which    activates   the  GTPase  of  EF-­‐G.  and  with  an  anticodon   complementary  to  mRNA  codon  now  in  small  subunit  of  the  A  (aminoacyl)  site.  EF-­‐G's  change  of  conformation  "pushes"  tRNA  in  the  A-­‐site  completely  from  A-­‐site  into   the  P-­‐site  of  ribosome.  EF-­‐Tu  binding  to  A-­‐site  activates  GTPase  of  EF-­‐Tu.  freeing  A  site  for  entry  of  next  aminoacyl-­‐tRNA-­‐EF-­‐Tu   complex.     8.  The  "new"  polypeptide  (one  amino  acid  longer)  is  transferred  to  the  "newest"  tRNA   residing  in  the  A-­‐site  (though  partially  displaced  from  the  A  site  in  the  large   ribosomal  subunit.  the  events  that  occur  to  add   the  next  amino  acid  to  the  growing  chain  and  to  prepare  the  ribosome  for  adding  the  next  amino   acid  to  the  polypeptide.  EF-­‐Tu-­‐GDP  leaves  ribosome  and  the  new  aminoacyl-­‐tRNA's  3'end  with  attached  amino   acid  is  moved  into  peptidyl  transferase  center  of  the  large  ribosomal  subunit.  mRNA  with  codon  base-­‐paired  to  this  tRNA  is  "pulled"   through  ribosome  one  codon  to  bring  the  next  codon  into  A-­‐site.  Peptidyl  transferase  (an  activity  of  an  rRNA  in  the  large  subunit)  catalyzes  formation   of  peptide  bond  between  the  amino  group  nitrogen  of  the  amino  acid  on  the  tRNA  in   the  A-­‐site  and  the  terminal  carbonyl  group  carbon  of  the  polypeptide  attached  to  the   tRNA  in  the  P-­‐site.e.  i.Name  _______________________________________________   14     5.     10.