You are on page 1of 4

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD

Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente


203022 Organismos Transgnicos

EVALUACIN INICIAL CURSO ORGANISMOS TRANSGNICOS


Estimado estudiante, en el presente documento encontrar una serie de
preguntas que pretenden evaluar el nivel de comprensin y conocimiento que
usted tiene sobre temas relacionados con la biologa molecular. Los temas
especficos son fundamentales para la comprensin de conceptos que usted
manejar en la unidad correspondiente al ADN recombinante y que son base
para la construccin de un Organismos Genticamente Modificado (OGM).
Individualmente deben responder a este cuestionario, pueden consultar libros
y documentos cientficos de Internet, las respuestas deben ser discutidas en el
foro.
Cada estudiante debe subir en este foro su documento con las respuestas a las
preguntas, cuando todos los documentos este completos ustedes iniciarn la
discusin para consolidar un solo documento que se anexar en el Entorno de
Evaluacin y Seguimiento (Momento uno) por la persona que ustedes han
seleccionado. Deben tener en cuenta la agenda pues no podemos dar inicio a
la segunda actividad sin que esta sea cumplida en las fechas dispuestas.

CUESTIONARIO

1. Cul es la diferencia de composicin y estructura entre el ARN y el ADN,


entre la ribosa y la desoxirribosa
2. El ARN es fcilmente hidrolizado por lcalis, en cuanto que el ADN no lo
es, por qu?
3. Explique por qu los cidos nucleicos son denaturados cuando son
sometidos a altas temperaturas o pH extremos. Una molcula de ADN
denaturada por calor puede ser nuevamente renaturada? Cmo?
4. Considere la siguiente secuencia de un fragmento de ADN aislado de una
bacteria:
5'CTGATAAGGGATTTAAATTATGTGTCAATCACGAATGCTAATCGCTTAACACTT
C 3'
Asumiendo que esta secuencia corresponde a la secuencia de la hebra
codificadora, cul sera la secuencia de aminocidos del polipeptido
producido cuando un ARN mensajero (ARNm) transcrito de este gen sea
traducido?
5. Considere el fragmento de ADN:

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD


Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
203022 Organismos Transgnicos

5AAGAATTGCGAATTCGACTTAAGGGCCGCGCCGAAGCTTTAAAGGTTATATTTCC-3
Cuantos fragmentos resultaran del corte con las siguientes enzimas de
restriccin, indique el nmero de pares (pb) de base de cada fragmento

EcoRI: (G AATTC):

HaeIII: (GG CC):

NotI: (GC CCGG):

Con las tres enzimas juntas

6. Considere la secuencia 5- 3 de ADN

1 ACGTAGCTAG TAAAGTCTGT CCTTGATAGA AGCTTCGACT


GACTAGTACT
Este
5 GGACTATCAC CTTGAAGGAC CTGTGGACTT AGTCTGATCG
1 TGACCGTAAG
fragmento de ADN fue colocado en una solucin con la endonucleasa de
restriccin HindIII que reconoce la secuencia 5-AAGCTT-3 e hidroliza el
ADN entre los dos residuos de cido adenlico. Con relacin a este
enunciado, responda: Cuantos pb presenta el fragmento de ADN y
cuantos fragmentos de ADN resultaran de la digestin con HindIII?
7. Un cientfico analiz la secuencia de bases nitrogenadas del ADN de una
bacteria y verific que era formada por los codones AGA-CAA-AAA-CCGAAT. Verific tambin que la secuencia de aminocidos en el polipeptido
correspondiente era serina-valina-fenilalanina-glicina-leucina. Al analizar
el mismo segmento de ADN de otra bacteria de la misma colonia,
verific que la secuencia de bases era AGA-CAA-AAG-CCG-AAT, sin
embargo no verific cualquier alteracin en la composicin de
aminocidos de la cadena polipeptdica. Cmo usted explica el hecho de
bacterias de una misma colonia presenten, para el mismo segmento de
ADN, diferentes secuencias de bases y que esas bacterias presenten la
misma composicin de aminocidos en la cadena polipeptdica
correspondiente?

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD


Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
203022 Organismos Transgnicos

8. La profesora del curso Organismos Transgnicos inform a sus


estudiantes que un cientfico espaol afirm haber encontrado protenas
en el huevo fsil de un dinosaurio que podran ayudarlo a reconstituir el
ADN de esos animales.

a) Haga un esquema demostrando cmo, a partir de una secuencia de


ADN se obtiene una protena.

b) A partir de una protena, es posible recorrer el camino inverso y llegar


a la secuencia de ADN que a gener, justifique.

9. Imagine que un determinado individuo, reciba un gen de otra especie,


este gen es responsable por la produccin de una protena compuesta
por los siguientes aminocidos: cistena - serina - arginina - alanina leucina - glutamina - valina - glutamina - treonina - lisina.
Como es de su conocimiento, el cdigo gentico universal y la sntesis
de esa protena depende da accin conjunta del ARN mensajero (ARNm),
del ARN de transferencia (ARNt) y del ARN ribosomal (ARNr). Indique si
las siguientes afirmaciones son verdaderas o falsas, sustente cada una
de las respuestas.
a) Esta protena no podra ser producida porque el receptor del gen no
posee los ARNr necesarios para la fase final de traduccin, encontrados
solamente en el donador del gen.
b) La molcula de RNA, transcrita por ese gen tendra mnimo una serie
de 10 codones con un total de 30 nucletidos, presentando bases
pricas de adenina e guanina e bases pirimdicas de citosina y uracilo.
c) Esa molcula proteica no podra ser producida por el receptor del gen
porque los aminocidos necesarios para la traduccin slo son
encontradas en el organismo donante del gen.

d) La molcula proteica podra ser perfectamente montada en el


organismo del receptor del gen desde que fueran tambin transfundidos
los anti-codones del ARNt del donante.

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD


Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
203022 Organismos Transgnicos