You are on page 1of 6

Biotechnol Lett (2013) 35:279284

DOI 10.1007/s10529-012-1076-3

ORIGINAL RESEARCH PAPER

A genome walking strategy for the identification


of nucleotide sequences adjacent to known regions
Hailong Wang Ting Yao Mei Cai
Xiuqing Xiao Xuezhi Ding Liqiu Xia

Received: 15 September 2012 / Accepted: 12 October 2012 / Published online: 30 October 2012
Springer Science+Business Media Dordrecht 2012

Abstract To identify the transposon insertion sites


in a soil actinomycete, Saccharopolyspora spinosa, a
genome walking approach, termed SPTA-PCR, was
developed. In SPTA-PCR, a simple procedure consisting of TA cloning and a high stringency PCR,
following the single primer-mediated, randomlyprimed PCR, can eliminate non-target DNA fragments
and obtain target fragments specifically. Using SPTAPCR, the DNA sequence adjacent to the highly
conserved region of lectin coding gene in onion plant,
Allium chinense, was also cloned.

Electronic supplementary material The online version of


this article (doi:10.1007/s10529-012-1076-3) contains
supplementary material, which is available to authorized users.
H. Wang  T. Yao  M. Cai  X. Xiao 
X. Ding  L. Xia (&)
College of Life Science, Hunan Normal University; State
Key Laboratory Breeding Base of Microbial Molecular
Biology, Changsha 410081, Peoples Republic of China
e-mail: xialq@hunnu.edu.cn
H. Wang
e-mail: hlw1225@hotmail.com
T. Yao
e-mail: yaoting46@hotmail.com
M. Cai
e-mail: caimei1005@hotmail.com
X. Xiao
e-mail: 343206265@qq.com
X. Ding
e-mail: dingxuezhi@hunnu.edu.cn

Keywords Cloning  Genome walking  Single


primer PCR  Transposon

Introduction
Genome walking is a DNA cloning methodology
used to isolate unknown genomic regions adjacent to
known sequences. It can be used for identifying
integration sites of transposable elements or retroviruses, gene cloning for functional studies, identification of regulatory sequences outside coding
regions, and filling in the gaps in genome sequencing.
A number of PCR-based genome-walking methods
have been developed. These methods can be classified
into three main groups: inverse PCR (Tsaftaris et al.
2010), ligation-mediated PCR (Horn et al. 2007; Ji and
Braam 2010; Yuanxin et al. 2003) and randomly
primed PCR (Liu and Chen 2007; Tan et al. 2005;
Pilhofer et al. 2007; Hermann et al. 2000; Karlyshev
et al. 2000). The first two groups both require a
preliminary digestion of genomic DNA by suitable
restriction enzymes. The randomly primed PCR
methods require no enzymatic modification before
PCR and rely on either one specific targeted primer
together with nonspecific walking primers (Tan
et al. 2005; Liu and Chen 2007), or a single specific
primer only (Hermann et al. 2000; Karlyshev et al.
2000; Pilhofer et al. 2007). The unspecific binding of
primers is able to amplify target DNA fragments

123

280

containing known and adjacent unknown sequence,


which are accompanied by nontarget fragments
sometimes. Target fragments are commonly identified
by hybridization analysis.
For the identification of transposon insertion sites
in Saccharopolyspora spinosa, a variation of single
primer-mediated, randomly-primed PCR method
termed SPTA-PCR was developed. In SPTA-PCR,
a primary template-capture step can reduce the
template complexity and increase the specificity of
the following low stringency PCR (LSPCR). The
TA cloning and a high stringency PCR (HSPCR)
with a known-sequence specific primer and a
T-vector primer, following LSPCR, can eliminate
nontarget fragments and obtain target fragments
specifically. SPTA-PCR was also used for cloning
the DNA sequence adjacent to the highly conserved
region of lectin coding gene in Allium chinense.

Materials and methods


Materials
Saccharopolyspora spinosa is a Gram-positive bacterium that produces spinosad, the active ingredient
in a family of insect control agents (Waldron et al.
2001). Its genomic DNA was isolated with the
Bacterial Genomic DNA Isolation Kit (Sangon
Biotech, Shanghai, China) according to the manufactures protocol. Allium chinense genomic DNA
was extracted using the CTAB method. E. coli
GB2005 (Fu et al. 2010), which is a derivative of
DH10B with high plasmid electroporation efficiency, was cultured in LB medium supplemented
with appropriate antibiotics. The LA Taq DNA
polymerase, which is capable of adding a single 30 A overhang at both ends of PCR products, with GC
buffer I (Takara) was used for PCR. pMD18-T
vector (Takara) was used for TA cloning.
Detection of transposon insertion sites
in S. spinosa by SPTA-PCR
Transposon specific primers SPL1 (50 -GAAGC
CCTCCAAAGCTGGATAG-30 ) and SPL2 (50 -TATCGCTTCCCGAACCTCATTC-30 ), and T-vector
primers T1 (50 -GAGCGGATAACAATTTCACAC
AGG-30 ) and T2 (50 -CGCCAGGGTTTTCCCAG

123

Biotechnol Lett (2013) 35:279284


Fig. 1 Overall strategy of SPTA-PCR. a Binding sites of c
known-sequence specific primers (P1 and P2). b The procedures
of SPTA-PCR. Primer P1 extends from known sequences to the
adjacent unknown genomic region under high stringency
conditions, and ssDNA will be amplified. The ssDNA is
subsequently used as templates for a LSPCR. Under low
stringency conditions, primer P1 may bind to multiple partially
complementary sites within the ssDNA templates, and multiple
DNA fragments will be amplified. The PCR products of LSPCR
including target and nontarget fragments are ligated to
T-vectors. The ligation mixture is subsequently electroporated
into E. coli cells. Plasmid DNA was isolated and used as the
template for the following HSPCR. In the final HSPCR, Primer
P2 and a T-vector primer (T1 or T2) were used to identify tsarget
DNA fragments. The target fragments were analyzed by
sequencing. c When one PCR fragment acquires two T-vectors
at both ends, the vector-PCR-vector trimer will be formed

TCACGAC-30 ), were used to identify the left transposon insertion site in four S. spinosa mutants. The
overall strategy of SPTA-PCR for genome walking
is shown in the Results and Discussion section.
Briefly, primer SPL1 was used in the first HSPCR to
extend from the transposon. The HSPCR was
performed in 50 ll containing 19 GC buffer I
(2.5 mM Mg2? Plus), 200 ng genomic DNA,
0.4 mM each dNTP, 50 pmol primer SPL1, and
1.25 U LA Taq DNA polymerase. Following one
denaturation step (3 min at 94 C), 30 cycles of
amplification (45 s at 94 C, 45 s at 64 C, 5 min at
72 C) and a final elongation step of 10 min at 72 C
were carried out. The PCR products (single stranded
DNA, ssDNA) were purified with BioDev column
(BioDev, Beijing, China) to remove primers as well
as most large genomic DNA, and eluted into 30 ll
dH2O (less than 1 ng ssDNA/ll).
The LSPCR mixture was the same as above, except
that 5 ll (less than 5 ng) ssDNA was used. Following
one denaturation step (1 min at 94 C), 30 cycles of
amplification (45 s at 94 C, 45 s at 40 C, 5 min at
72 C) and a final elongation step of 10 min at 72 C
were carried out. PCR products were analyzed on a
1.5 % agarose gel, purified with BioDev column and
eluted into 30 ll H2O (about 290 ng PCR products/
ll).
The mixture containing 4 ll (about 1.2 lg) LSPCR
products, 50 ng pMD18-T vector and 5 ll Solution I
(ligation buffer containing T4 DNA ligase, Takara)
was incubated at 16 C overnight. After desalting, the
ligation mixture was electroporated into E. coli
GB2005 competent cells. After recovery at 37 C for
1 h, 1 ml recovery culture was divided into two parts

Biotechnol Lett (2013) 35:279284

and 500 ll LB medium containing 100 lg ampicillin/


ml was added. After incubating at 37 C for another
3 h, plasmid DNA was prepared and dissolved in 5 ll
H2O (The concentration was very low, as the plasmid

281

DNA was not visualized even though all 5 ll was


examined on the agarose gel).
The final HSPCR was performed in 50 ll containing 19 GC buffer I (2.5 mM Mg2? Plus), 1 ll

123

282

plasmid DNA, 0.4 mM each dNTP, 50 pmol primers


(SPL2/T1 or SPL2/T2), and 1.25 U LA Taq DNA
Polymerase. PCR programs were the same as the first
HSPCR. PCR products were analyzed on a 1.5 %
agarose gel. The DNA fragments were individually
purified and cloned into the pMD18-T vector for
sequence analysis.
Application of SPTA-PCR in cloning of 30 -region
of lectin coding gene from A. chinense
Conserved sequence specific primer ALR1 (ATGACTGCAACCTTGTACTGTACG) and ALR2 (CT
TGTACTGTACGAATACAGCAC) were used to
clone the 30 -region of lectin coding gene. ALR1 was
used in the first HSPCR and the following LSPCR.
ALR2 was used in the final HSPCR. PCR procedures
were the same as those used for S. spinosa transposon
insertion sites detection.

Results and discussion


Overall strategy of SPTA-PCR
The principles of genome walking with SPTA-PCR are
illustrated in Fig. 1. SPTA-PCR invovles four steps,
including three PCR reactions and a TA cloning step.
The first two PCR reactions use the same knownsequence specific single primer. The first HSPCR allows
the DNA template of interest to be amplified as single
stranded DNA (ssDNA). This template-capture step can
reduce the template complexity and increase the
specificity of the following LSPCR (Hermann et al.
2000; Mishra et al. 2002). Under low stringency
conditions, the single primer binds to multiple partially
complementary sites within captured ssDNA templates,
and the target DNA fragments containing known and
adjacent unknown sequences, along with other nontarget fragments will be amplified. As the LSPCR is
performed with DNA polymerase which is able to add a
single 30 -A overhang at both ends of PCR products, the
PCR products can be directly ligated to T-vectors to
generate another known priming site. The final HSPCR
with another known-sequence specific primer and a
T-vector primer is carried out to specifically identify the
target DNA fragments. Two insert orientations are
possible when PCR products are ligated to T-vectors, so
the primer binding at either end of T-vectors should be

123

Biotechnol Lett (2013) 35:279284

used together with the known-sequence specific primer.


For confident contig assembly, a minimal distance of
50 bp between the boundary of known sequences and
the priming site of the known-sequence specific primer
used in the final HSPCR is desired.
Identification of transposon insertion sites
in S. spinosa
We obtained some mutants of S. spinosa using transposon mutagenesis. In order to identify transposon
insertion sites, we initially tried inverse PCR with three
different restriction enzymes. Unfortunately, the PCR
products we obtained were not target DNA fragments
(data not shown). When we used the transposon specific
primer SPL1 mediated randomly primed PCR to
identify the left insertion site, very complex fragments
were amplified, ranging from 250 bp to 2000 bp
(Fig. 2a). Initially, we tried to clone these fragments
into the pMD18-T vector with a high fragment to vector
ratio. The ligation mixture, without transformation into
E. coli strains and plasmid isolation, was directly used as
templates for the final HSPCR.
DNA fragments amplified in the final HSPCR
(Fig. 2b) were purified. The sequencing results showed
that we successfully identified the transposon insertion
site of mutant 1, 2 and 3. Three DNA fragments from
mutant 3 were individually purified. The sequence
analysis revealed that these fragments contained same
transposon sequences, and their difference in size was
caused by different priming sites of primer SPL1 on the
unknown region of ssDNA templates in LSPCR (Fig. 2c).
For mutant 4, a fragment of about 3 kb was obtained
(data not shown). The sequence analysis revealed that it
was a nontarget product amplified by the vector primer
only, which means its template is a vector-PCR-vector
trimer (Fig. 1c). To overcome this non-specific amplification, the ligation mixture was transformed into E. coli
GB2005 by electroporation, and plasmid DNA was
isolated. The plasmid DNA was subsequently used as
templates for the final HSPCR. A fragment of 620 bp was
obtained (Fig. 2b). The sequence analysis revealed that it
was the target fragment (Supplementary Fig. 1). The
results suggested that this transformation and plasmid
isolation step can eliminate linear fragments from the
ligation mixture, including unligated PCR products and
vectors, as well as vector-PCR-vector trimers, which is the
main source of nonspecific amplification in the final
HSPCR.

Biotechnol Lett (2013) 35:279284

Fig. 2 Detection of transposon insertion sites in S. spinosa with


SPTA-PCR. a Agarose gel electrophoresis analysis of PCR
products amplified with primer SPL1 under low stringency
conditions. M, DNA ladder; Lane 14 are PCR products
amplified from mutant 14. b Agarose gel electrophoresis

283

analysis of PCR products amplified with primer SPL2 and


primer T1 under high stringency conditions. M, DNA ladder;
Lane 14 are PCR products amplified from mutant 14.
c Schematic presentation of three fragments identified from
mutant 3

region of lectin coding gene in A. chinense. The


results suggested that SPTA-PCR worked well for
plants with large and complex genome (Fig. 3).

Conclusion

Fig. 3 Agarose gel electrophoresis analysis of PCR products


generated in cloning of 30 -region of lectin coding gene from
Allium chinense. M, DNA ladder; Lane 1 is the PCR product
amplified with primer ALR1 under low stringency conditions;
Lane 2 is the PCR products amplified with primer ALR2 and
primer T1 under high stringency conditions

Cloning of 30 -region of lectin coding gene


from A. chinense
To test the feasibility of SPTA-PCR for organisms
with more complex genome, we tried to clone the
DNA sequence adjacent to the highly conserved

Single primer mediated randomly primed PCR is a


simple and sensitive method for genome walking.
However, the complexity of DNA fragments amplified
in LSPCR depends on the sequence of primers.
Sometimes one or several specific DNA fragments
will be obtained, while sometimes very complex
fragments will be amplified. For the identification of
target fragments, the simple procedure consisting of
TA cloning and a HSPCR is easier to manipulate,
compared with hybridization analysis. SPTA-PCR can
be considered as a valid alternative to already known
genome walking techniques. The simple and efficient
SPTA-PCR can also be used for high-throughput
genome walking applications.
Acknowledgments This work was supported by the National
Natural Science Foundation of China (31070006), the National
Basic Research Program (973) of China (2012CB722300),
973 special preliminary study program (2011CB311800), and
the National High Technology Research and Development
program (863) of China (2011AA10A203).

123

284

References
Fu J, Teucher M, Anastassiadis K, Skarnes W, Stewart AF
(2010) A recombineering pipeline to make conditional
targeting constructs. Methods Enzymol 477:125144
Hermann SR, Miller JA, ONeill S, Tsao TT, Harding RM,
Dale JL (2000) Single-primer amplification of flanking
sequences. Biotechniques 29(6):11761180
Horn C, Hansen J, Schnutgen F, Seisenberger C, Floss T, Irgang
M, De-Zolt S, Wurst W, von Melchner H, Noppinger PR
(2007) Splinkerette PCR for more efficient characterization of gene trap events. Nat Genet 39(8):933934
Ji J, Braam J (2010) Restriction site extension PCR: a novel
method for high-throughput characterization of tagged
DNA fragments and genome walking. Plos One 5(5):
e10577
Karlyshev AV, Pallen MJ, Wren BW (2000) Single-primer PCR
procedure for rapid identification of transposon insertion
sites. Biotechniques 28(6):10781082
Liu YG, Chen Y (2007) High-efficiency thermal asymmetric
interlaced PCR for amplification of unknown flanking
sequences. Biotechniques 43(5):649656
Mishra R, Singla-Pareek S, Nair S, Sopory S, Reddy M (2002)
Directional genome walking using PCR. Biotechniques
33(4):830834

123

Biotechnol Lett (2013) 35:279284


Pilhofer M, Bauer AP, Schrallhammer M, Richter L, Ludwig W,
Schleifer KH, Petroni G (2007) Characterization of bacterial operons consisting of two tubulins and a kinesin-like
gene by the novel Two-Step Gene Walking method.
Nucleic Acids Res 35(20):e135
Tan G, Gao Y, Shi M, Zhang X, He S, Chen Z, An C (2005)
SiteFinding-PCR: a simple and efficient PCR method for
chromosome walking. Nucleic Acids Res 33(13):e122
Tsaftaris A, Pasentzis K, Argiriou A (2010) Rolling circle
amplification of genomic templates for inverse PCR (RCAGIP): a method for 50 - and 30 -genome walking without
anchoring. Biotechnol Lett 32(1):157161
Waldron C, Matsushima P, Rosteck PR Jr, Broughton MC,
Turner J, Madduri K, Crawford KP, Merlo DJ, Baltz RH
(2001) Cloning and analysis of the spinosad biosynthetic
gene cluster of Saccharopolyspora spinosa. Chem Biol
8(5):487499
Yuanxin Y, Chengcai A, Li L, Jiayu G, Guihong T, Zhangliang
C (2003) T-linker-specific ligation PCR (T-linker PCR): an
advanced PCR technique for chromosome walking or for
isolation of tagged DNA ends. Nucleic Acids Res 31(12):
e68