You are on page 1of 13

BIOLOGA 08 CTEDRA JERUSALINSKY

CUR Villa Gesell - 2do cuatrimestre de 2015

GUA DE ACTIVIDADES Y TAREAS


SEGUNDA PARTE

Reproduccin.
Ciclo celular.
Duplicacin del ADN.
Divisin celular (mitosis, meiosis).
Gentica. Leyes de Mendel.
Transcripcin y traduccin. Cdigo gentico. Mutaciones.
Genotipo, fenotipo, ambiente.
Evolucin.
Problemtica ambiental en Argentina

1)

a. Cules son las fases del ciclo celular eucarionte y qu eventos importantes ocurren en cada una de
ellas?
b. Ubic las fases y perodos del ciclo celular eucarionte en el siguiente grfico:
cantidad
cantidad
de ADN

perodos del ciclo celular


perodos del ciclo celular

2)

Indic si las siguientes afirmaciones son verdaderas o falsas, justificando brevemente todas tus respuestas:

1. Los organismos unicelulares se reproducen asexualmente, mientras que los pluricelulares se reproducen
2.
3.
4.
5.
6.
7.
8.
9.

3)

sexualmente.
La fase G1 se caracteriza por una intensa actividad metablica, mientras que durante la fase G2 la clula se
encuentra en reposo.
Cuando una clula eucariota pasa por el perodo S del ciclo celular, su contenido de ADN aumenta al doble.
Las clulas procariontes no duplican su ADN.
La duplicacin de ADN debe ocurrir antes de la divisin celular.
La duplicacin del ADN requiere como sustratos nucletidos monofosfatados.
La duplicacin del ADN es un proceso catablico.
La enzima ADN polimerasa es un sustrato del proceso de duplicacin del ADN.
La duplicacin del ADN es semiconservativa.

Complet el siguiente cuadro comparativo:


MITOSIS

MEIOSIS

Clulas en las que se produce


(procariontes o eucariontes)
Genera variabilidad gentica?
Presencia de cromosomas
homlogos
Apareamiento de cromosomas
homlogos
Cantidad de ADN en cada
clula hija respecto a la original
Nmero de divisiones
(una o dos)
Tipo de divisin
(ecuacional o reduccional)
Requiere de la duplicacin
previa del ADN?

4)

En la pgina siguiente se representan una mitosis y una meiosis. En los dos esquemas, seal para cada
fase :
- Nombre.
- Grado de ploida y nmero de cromosomas.
- Un par de cromosomas homlogos y un par de cromtides hermanas o recombinantes.

5)

Indic si las siguientes oraciones son verdaderas o falsas, justificando brevemente todas tus respuestas:

1. Una cromtide contiene una secuencia de ADN idntica a la de su cromtide hermana.


2. Una poblacin de papas reproducidas sexualmente presenta mayor variabilidad gentica que una poblacin
3.
4.
5.
6.
7.
8.
9.

6)

de la misma especie reproducida asexualmente.


En la primera divisin meitica se generan dos clulas diploides.
La segregacin de cromosomas homlogos que ocurre en anafase I genera variabilidad gentica.
En la metafase mittica los cromosomas homlogos se aparean.
Una clula resultante de la divisin mittica tiene la misma cantidad de ADN que la clula madre en G2.
Una clula 2n=6 tiene 6 cromosomas, con una cromtide cada uno.
Los cromosomas homlogos son idnticos en cuanto a la forma y a la informacin que contienen.
La presencia o ausencia de cromtides hermanas determina si una clula es diploide o haploide.
En una especie cuya ploida es 2n=10, las clulas presentan en G1 una cantidad de ADN de 60 unidades.
En base a estos datos complet los cuadros:
Etapa del ciclo (clula
somtica)

N de
cromosomas

Cantidad
de ADN

N de cromtides
por cromosoma

N de molculas
de ADN

Cantidad
de ADN

N de cromtides
por cromosoma

N de molculas
de ADN

G1
G2
Metafase
En cada polo
de telofase

Etapa del ciclo (clula


germinal)

N de
cromosomas

G1
G2

Metafase I
En cada polo
de telofase I
Metafase II
En cada polo
de telofase II

En las ratas de laboratorio el color de pelo negro domina sobre el blanco. En un laboratorio se tienen una rata
macho de pelo negro y una rata hembra de pelo blanco. Se realiza el cariotipo de una clula somtica de
cada uno de ellos y se localizan los lugares donde se encuentra la informacin para dicho carcter. Como
convencin usaremos N para representar la variante pelo negro y n para representar la variante pelo
blanco. Se obtiene lo siguiente:
CARIOTIPO DEL MACHO:

CARIOTIPO DE LA HEMBRA:

a. Cul es la ploida de esta especie?


b. Dibuj el cariotipo de una gameta del macho y el cariotipo de una gameta de la hembra.
c. Supongamos que una gameta cualquiera del macho fecunda a una gameta cualquiera de la hembra.
Dibuj el cariotipo de la cigota resultante.
d. Cmo ser el cariotipo de cualquiera de las clulas somticas de los descendientes de esta pareja?
Por qu?
e. Qu color de pelo tendrn los descendientes? Por qu?

PROBLEMAS DE GENTICA. PRIMERA LEY DE MENDEL.


Resolv los siguientes problemas de gentica.
No olvides justificar todas las respuestas con las explicaciones y/o los cruzamientos necesarios.

1.

En los ogros el color de piel verde domina sobre el color de piel azul.
a. Indic todos los genotipos posibles para un ogro azul y para un ogro verde.
b. Puede una pareja de ogros azules tener un ogrito de piel verde?
c. Cmo deben ser genotpicamente Shrek y Fiona (que son verdes) para poder tener un ogrito de piel
azul?

2.

El factor Rh presenta dos alelos: Rh+ domina sobre Rh .


a. Paula es heterocigota para el factor Rh, y Martn es homocigota dominante para este mismo gen.
Cul es la probabilidad de que esta pareja tenga un hijo de factor Rh ?
b. Ana tiene sangre factor Rh+ y Juan tiene sangre factor Rh Cul es la probabilidad de que esta
pareja tenga un hijo de factor Rh+? Si corresponde, plante todos los casos posibles.

3.

El albinismo es una enfermedad gentica recesiva. Dos personas fenotpicamente normales (A_) tienen un
hijo albino (aa). En base a esta informacin:
a. Cul es la probabilidad de que su segundo hijo manifieste ese rasgo?
b. Dibuj una clula somtica de uno de los padres, indicando cromosomas homlogos y alelos (suponer
2n=4)

4.

Un matrimonio tiene tres hijos: uno con el lbulo de la oreja separado, heterocigota; otro con el lbulo de la
oreja separado, homocigota, y otro con el lbulo de la oreja unido.
a. Cul es el alelo dominante?
4

b. Cul es el genotipo y el fenotipo de los padres?


5.

Un ratn A de pelo blanco se cruza con una ratona de pelo negro y toda la descendencia es de pelo
blanco. Otro ratn B de pelo blanco se cruza con la misma ratona y en la descendencia se observan
ratoncitos de pelo blanco y de pelo negro. Sabiendo que uno solo de los dos ratones es heterocigota
a. Cul es el alelo dominante?
b. Cul de los dos ratones es el heterocigota?
c. Dibuj el cariotipo de una clula somtica del ratn heterocigota, indicando cromosomas homlogos,
cromtidas hermanas y alelos (suponer 2n=4).

6.

La ptosis es una enfermedad que consiste en la imposibilidad de abrir los prpados totalmente, y se debe a
la presencia de un alelo dominante. Un vulo de una mujer enferma es fecundado por un espermatozoide
de un hombre fenotpicamente normal, originando un beb normal.
a. Indic el genotipo y el fenotipo de los tres integrantes de la familia.
b. Cul es la probabilidad de esta pareja de tener hijos enfermos de ptosis?

7.

En las ratas de laboratorio el carcter cola larga domina sobre el carcter cola corta. Suponga que Ud.
tiene una rata de cola larga Cmo hara para averiguar su genotipo?

8.

En las langostas, el color de ojos rojo domina sobre el color de ojos blanco. Se cruza una langosta macho
de ojos blancos con una hembra de ojos rojos y se obtienen 303 langostas de ojos blancos y 298 de ojos
rojos.
a. Indic el genotipo y el fenotipo de los padres y de la descendencia.
b. Dibuj las posibles gametas de la hembra indicando cromosomas homlogos y alelos (suponiendo
2n=8)

9.

Indic la respuesta correcta: Si un individuo es heterocigota para un determinado carcter, solamente se


puede garantizar que el 100% de su descendencia tendr fenotipo dominante si se aparea con un
individuo:
a) heterocigota
c) homocigota dominante
b) homocigota recesivo
d) homocigota, dominante o recesivo

10. Una mujer de grupo sanguneo A tiene un hijo de grupo B. Indic todos los genotipos posibles de la mam,

el beb y el pap.
11. Un hombre de grupo sanguneo A y una mujer de grupo AB tienen un hijo de grupo B Cul es la

probabilidad de que su prximo hijo sea de grupo A?


12. Indic la respuesta correcta: Qu grupos sanguneos pueden heredar los hijos de un hombre de grupo B y

una mujer de grupo A, ambos homocigotas?


a) A o B solamente
b) A, B, AB o 0

c) A, B o 0

d) AB solamente

PROBLEMAS DE GENTICA. SEGUNDA LEY DE MENDEL.


Resolv los siguientes problemas de gentica. En todos los casos suponemos que los dos genes
estudiados no estn ligados (es decir, no se encuentran en el mismo par de homlogos).
No olvides justificar todas las respuestas con las explicaciones y/o los cruzamientos necesarios.
1. En la especie humana los colores oscuros dominan sobre los colores claros. Una mujer morocha y de ojos

a.
b.
c.
d.

negros y un hombre rubio y de ojos celestes tienen dos hijos: uno morocho y de ojos celestes y otro rubio y
de ojos negros. Con estos datos:
Indic los genotipos de los cuatro integrantes de la familia
Cul es la probabilidad de que un tercer hijo sea morocho y de ojos negros?
Dibuj una clula del hombre en anafase I, indicando cromosomas homlogos, cromtidas hermanas o
recombinantes y alelos (suponer 2n=6).
Dibuj una clula de la mujer en anafase II, indicando cromosomas homlogos, cromtidas hermanas o
recombinantes y alelos (suponer 2n=6).

2. Cuntas gametas diferentes puede formar...

a. ...una persona que presenta un genotipo heterocigota para dos genes (AaBb).

b. ...una persona que presenta un genotipo heterocigota para el color de pelo y homocigota recesivo para el
factor Rh?
c. ...una persona que presenta un genotipo homocigota para dos caracteres?
3. En una especie de aves, el pico recto domina sobre el pico curvo, y el color gris de las plumas domina sobre

el marrn. Un ave macho heterocigota para ambos genes se cruza con una hembra de pico recto y plumas
marrones. Algunos de sus pichones tienen pico curvo.
a. De acuerdo a estos datos cul es la probabilidad de que tengan pichones de pico recto y plumas grises?
b. Suponiendo 2n=4, dibuj: i) una clula somtica del macho en metafase y ii) una clula sexual de la hembra
en anafase I. En ambos dibujos seal un par de cromosomas homlogos, un par de cromtidas hermanas
o recombinantes y los alelos para cada gen.
4. La fibrosis qustica es una enfermedad gentica recesiva, que afecta principalmente a los pulmones. Pablo y

Daniela, que son sanos, tienen un hijo, Martn, que padece fibrosis qustica. Adems Pablo es morocho,
mientras que Daniela y Martn son rubios. En base a estos datos:
a. Indic el genotipo de los tres integrantes de la familia.
b. Cul es la probabilidad de que Pablo y Daniela tengan un hijo heterocigota para ambas caractersticas?
c. Dibuj una clula germinal de Daniela en metafase II, indicando claramente un par de cromosomas
homlogos, un par de cromtidas hermanas o recombinantes y los alelos para el gen estudiado. Consider
2n=6.
5. Marcos es de ojos oscuros y padece fenilcetonuria (enfermedad recesiva). Marcela, de ojos claros, es

sanita. Pepe, el hijo de ambos, es de ojos claros y fenilcetonrico.


a. Indic el genotipo y el fenotipo de los tres integrantes de la familia
b. Cul es la probabilidad de que un hermanito de Pepe sea fenilcetonrico y de ojos claros?
c. Dibuj una clula de Marcos en metafase, otra en metafase I y otra en metafase II, indicando cromosomas
homlogos, cromtidas hermanas o recombinantes y alelos (supon 2n=4).
6. Una mujer de grupo 0 y factor Rh tuvo un hijo de sangre B Rh+.

a. Cules son sus genotipos?


b. Indic todos los genotipos posibles del pap.
7. Una mujer cuyo fenotipo es B, Rh+ da a luz un beb de fenotipo A, Rh .

a. Indic todos los genotipos posibles de la mam y del hijo.


b. Qu genotipos podra tener un hombre que seguro no es el pap de ese beb? Indic por lo menos tres de
esos genotipos.
c. Si un hombre dice ser el padre de la criatura, qu genotipos podra tener? Alcanza con que tenga alguno
de estos genotipos para estar seguros de que es el pap?
8. En una especie de zorros el color marrn domina sobre el gris. Por otro lado, algunos tienen orejas

redondeadas y otros tienen orejas punteagudas. Una zorra gris y de orejas redondeadas tiene dos zorritos
tambin grises, uno de orejas redondeadas y uno de orejas punteagudas. Adems se sabe que el pap
zorro es marrn y tiene orejas redondeadas.
a. Indic los genotipos de todos los integrantes de la familia.
b. Considerando que la especie estudiada presenta una ploida de 2n=8, complet el siguiente cuadro:
Etapa del
ciclo celular

N de
cromosomas

G1 (interfase)

n de cromtides
por cromosoma

Cantidad
de ADN
100

Metafase I
En cada polo de telofase I

9. Al cruzar dos ratones sanos y de color blanco (homocigotas recesivos para el color) se obtienen 9 cras

a.
b.
c.
d.

sanas y 3 enfermas, todas blancas.


La enfermedad es una caracterstica dominante o recesiva?
Indic las proporciones genotpicas de la descendencia.
Las proporciones genotpicas y fenotpicas son iguales?
Suponiendo un complemento cromosmico 2n=4, dibuj una clula germinal de la hembra en anafase I y
una clula del pulmn del macho en metafase. En ambos esquemas seal un par de cromosomas
homlogos, un par de cromtides (aclarando si son hermanas o recombinantes) y los alelos estudiados.

Le el siguiente extracto de un artculo de Clarn del 02-04-2004 y respond el cuestionario que est a
continuacin.

DECODIFICAN LA SECUENCIA DE DOS CROMOSOMAS CLAVE PARA LA SALUD


Un paso adelante para saber ms de los humanos y de las razones hereditarias de sus enfermedades.
Ayer cientficos estadounidenses y britnicos publicaron la decodificacin de dos cromosomas el 13
y el 19- que contienen genes involucrados en diabetes, cncer, y otras enfermedades.
Los cromosomas 13 y 19 son estructuras que se encuentran dentro del ncleo de las clulas. Estn
constituidos por cido desoxirribonucleico (ADN) empacado junto a protenas. En el organismo
humano, hay 23 pares de cromosomas. Es decir, 46 en total (dos de ellos son los cromosomas
sexuales). Hasta el momento ya se haban mapeado nueve de esos cromosomas: 6, 7, 14, 20, 21, 22 y
el Y. Este ltimo cromosoma contiene los genes que hacen que un individuo sea varn.
Al nmero 19 los decodificaron mas de 30 investigadores de la Universidad de Stanford, la
Universidad de Washington, la Universidad de California y del Departamento de Energa de los
Estados Unidos, entre otras instituciones. Ellos se dieron el gusto de escarbar en el cromosoma
humano ms rico en genes.
El cromosoma 19 incluye 55.8 millones de "letras", lo cual representa tan solo el 2% del genoma
humano. Pero es el que mas genes posee: 1500. Dentro de ese montn, hay genes que estn
involucrados en la diabetes insulina-dependiente, la distrofia miotnica (una enfermedad muscular
de progresin lenta), las migraas y la hipercolesterolemia familiar (una forma de colesterol elevado
que se hereda).
La participacin de cientficos del Departamento de Energa se debi a que estn tratando de conocer
mas los genes que tienen como funcin la reparacin del ADN daado por radiacin o por la
exposicin a contaminantes ambientales. De acuerdo con Richard Myers, director del Centro del
Genoma Humano de Stanford, la versin del cromosoma 19 que se publico ayer es 500 veces mejor a
los borradores que se haban hecho en cuanto a contigidad y exactitud.
El cromosoma 13, que fue estudiado por investigadores del Instituto Sanger de Inglaterra, es uno de
los de menor "densidad": contiene 633 genes. Pero no por eso es menos importante; incluye genes
involucrados en el desarrollo de cncer, como el de mama y el retinoblastoma.
Es cierto que estos estudios acercan mas pistas para entender las razones hereditarias de ciertas
enfermedades. Pero estas no son las nicas: el ambiente puede dejar sus huellas en el organismo.
Cuestionario
1. Escrib con tus propias palabras de qu trata el artculo, en no ms de 3 renglones.
2. Subray todas las palabras de significado biolgico que encuentres (no las enfermedades). Trat de definir
todos los trminos que puedas con la ayuda de tus conocimientos o de la bibliografa que poseas.
3. De acuerdo a lo que dice el texto y a tus conocimientos, respond las siguientes preguntas, justificando si
es necesario:
a. Cuntos cromosomas hay en el ncleo de una clula humana?
b. Son todos los cromosomas iguales entre s?
c. Cmo se determina el sexo en la especie humana?
d. El nmero de cromosomas es el mismo en todas las especies?
4. Qu significa la expresin "...hay genes involucrados en la diabetes insulina-dependiente"? Qu quiere
decir involucrados en este contexto?
5. Discut con tus compaeros la validez del ltimo prrafo del texto. A qu se refiere la frase el ambiente
puede dejar sus huellas en el organismo? Cmo se relaciona esta frase con el resto del artculo?
7

6. Para cada par de trminos, redact una oracin en la que queden relacionados funcionalmente:
a. gen ADN
d. cromosoma ADN
b. gen ARN
e. herencia ADN
c. gen protena
f. ADN mutaciones
7. Repas lo que vimos sobre biomolculas antes del primer parcial y respond:
a. Cul es el nombre de los monmeros que forman las protenas? Cuntos diferentes puede haber
formando parte de una protena?
b. Cul es el nombre de los monmeros que forman la estructura del ADN Cuntos diferentes puede
haber formando parte de una molcula de ADN? Y formando parte del ARN?
8. a. El texto menciona 55, 8 millones de letras; a qu se refiere? A qu molcula biolgica alude?
b. Como veremos, el cdigo gentico establece la relacin entre dos lenguajes diferentes. A qu
lenguajes nos referimos?

a. A partir del siguiente fragmento de ADN cul ser la secuencia de nucletidos del ARN que se obtiene por
transcripcin?
Cadena molde:
CAGGTACGCATTTTACG ACCG ACG AACTTA
Cadena codificante:
GTCCATGCGTAAAATGCTGGCTGCTTG AAT
ARN:

b. Dado el siguiente fragmento de ARN, cul es la secuencia de nucletidos del ADN del cual se transcribi?
ARN:

AUGGUUCG ACCCAGUUUU AGCCCGC

Cadena molde:

.....

Cadena codificante:

..

Luego de leer un texto sobre la transcripcin y la traduccin, realiz un cuadro comparativo entre los dos
procesos en cuanto a los siguientes tems:
- Sustratos
- Productos
- Tipo de proceso segn la materia
- Tipo de proceso segn la energa
- Molcula con funcin de molde
- Enzima principal
- Localizacin en procariontes

- Localizacin en eucariontes

CDIGO GENTICO:
1.
2.
3.
4.
5.

A qu se llama cdigo gentico?


Qu significa que es universal?
Qu significa que es degenerado?
Diferenci claramente los conceptos de cdigo gentico e informacin gentica.
Indic si las siguientes afirmaciones son verdaderas o falsas, justificando brevemente:
a. El cdigo gentico contiene la informacin para la sntesis de las protenas.
b. El Proyecto Genoma Humano consiste en descifrar el cdigo gentico de la especie humana.
c. Dada una secuencia de nucletidos, el cdigo gentico nos permite saber a qu secuencia de
aminocidos corresponde.
d. Dada una secuencia de aminocidos, el cdigo gentico nos permite saber a qu secuencia de
nucletidos corresponde.

6. Suponiendo que las dos molculas de ARN del ejercicio 11) corresponden a ARN mensajero cules sern

las secuencias de aminocidos que se obtendrn al traducirlas?


1era
posicin

2da
posicin

U
C
A
G

UUU
UUC
UUA
UUG
CUU
CUC
CUA
CUG
AUU
AUC
AUA
AUG
GUU
GUC
GUA
GUG

fen
fen
leu
leu
leu
leu
leu
leu
ile
ile
ile
met
val
val
val
val

UCU
UCC
UCA
UCG
CCU
CCC
CCA
CCG
ACU
ACC
ACA
ACG
GCU
GCC
GCA
GCG

ser
ser
ser
ser
pro
pro
pro
pro
tre
tre
tre
tre
ala
ala
ala
ala

3ra
posicin

A
UAU
UAC
UAA
UAG
CAU
CAC
CAA
CAG
AAU
AAC
AAA
AAG
GAU
GAC
GAA
GAG

tir
tir
stop
stop
his
his
gln
gln
asn
asn
lis
lis
asp
asp
glu
glu

G
UGU
UGC
UGA
UGG
CGU
CGC
CGA
CGG
AGU
AGC
AGA
AGG
GGU
GGC
GGA
GGG

cis
cis
stop
trp
arg
arg
arg
arg
ser
ser
arg
arg
gli
gli
gli
gli

U
C
A
G
U
C
A
G
U
C
A
G
U
C
A
G

RELACIN ENTRE LOS GENES Y EL FENOTIPO


En cierta especie de plantas, las flores son rojas o blancas. El color rojo se debe a un pigmento rojo que se
encuentra en las clulas de las flores. Se observa que el alelo para el color rojo (R) domina sobre el alelo para
el color blanco (r).
Mediante estudios bioqumicos se determin que el pigmento rojo es el producto de una reaccin catalizada por
la enzima pigmentosintetasa, que pude representarse de la siguiente manera:
pigmentosintetasa
molcula precursora

pigmento rojo

A su vez, se logr identificar y secuenciar el gen que codifica para la enzima pigmentosintetasa, ubicado en el
par de homlogos n3.
En los individuos homocigota dominantes (RR) esta secuencia se encuentra en ambos miembros del par.

TTATGCGACTTGAGGCAGCACCCTTGTGAGGTA

Atencin: para representar un gen se escribe la secuencia de bases de una sola de las cadenas del ADN, ya
que no es necesario, conocida la complementariedad entre bases, escribir la secuencia de ambas. En este
caso transcribimos la cadena codificante.
1.
2.
3.

Cul es la caracterstica estudiada? Cules son sus variantes?


Suponiendo que la especie es 2n=6, represent un cariotipo de una clula somtica de un individuo
heterocigota para esta caracterstica (record que el gen se encuentra en el par de homlogos n3).
Explic brevemente cul es la relacin entre el fenotipo color rojo de las flores y la secuencia de ADN
presentada.

Por otro lado, en los individuos homocigota recesivos (rr) no se encuentra la enzima pigmentosintetasa. En los
cromosomas del par n3 de estas plantas, la secuencia hallada en el mismo locus es la siguiente:

TTATGCGACTTTAGGCAGTACCCATGTGAGGTA

Compar esta secuencia con la anterior En qu se diferencian?


Cmo explicaras la relacin entre el fenotipo color blanco de las flores y esta nueva secuencia?
Reformulando la pregunta 1.: Cul es el gen que se corresponde con la caracterstica estudiada? Cules
son los alelos de dicho gen?
7. Cmo explicaras el hecho de que los individuos heterocigotas (Rr) presentan flores rojas?
8. Para cada una de las dos secuencias presentadas, escrib la secuencia correspondiente a la cadena
molde.
9. Para cada una, hac la transcripcin, es decir, escrib la secuencia de nucletidos del ARN mensajero
correspondiente.
10. Para cada una, hac la traduccin, es decir, escrib la secuencia de aminocidos de la protena
correspondiente.
11. Analiz los resultados obtenidos y volv a responder la pregunta 5.
4.
5.
6.

MUTACIONES
La siguiente secuencia de nucletidos corresponde a la cadena molde de un fragmento de ADN. Supon que
se trata de un gen que codifica para una protena.

TAGCCTACGTATCATCTCCCGGGTACAAAATCAC
1. a. Cul es la secuencia de la cadena codificante? Escribila.
b. Cul es el resultado de la transcripcin? Escrib la secuencia correspondiente e indic qu tipo de
molcula es.
b. Cul es el resultado de la traduccin? Escrib la secuencia correspondiente e indic qu tipo de
molcula es.
2. Si se produce una sustitucin (cambio) del nucletido de la posicin 19 (cuya base nitrogenada es citosina)
por un nucletido de timina,
a. cul ser la consecuencia en la traduccin?
b. la protena obtenida tendr la misma estructura espacial y funcin? Por qu?
3. Puede ocurrir que una sustitucin de un nucletido por otro no altere la secuencia de aminocidos de la
protena? Por qu? Explic con un ejemplo.
4. Dadas las siguientes mutaciones puntuales cul ser la consecuencia en la traduccin para cada una de
ellas?
a. Sustitucin del nucletido de la posicin 15 (timina) por adenina.
b. Sustitucin del nucletido de la posicin 8 (citosina) por guanina.
c. Insercin (agregado) de un nucletido de adenina entre las posiciones 22 y 23.
d. Delecin (prdida) del nucletido de guanina de la posicin 9.
5. Considerando los ejemplos de los puntos 2, 3 y 4, explic:
a. Cules son las mutaciones llamadas silenciosas? Con qu caracterstica del cdigo gentico se
relacionan dichas mutaciones?
b. Qu tipo de mutaciones producen un corrimiento del marco de lectura?

Indic si las siguientes oraciones son verdaderas o falsas. Justific tu eleccin en no ms de cinco renglones.
1.
2.
3.

Durante el proceso de traduccin se forman enlaces fuertes.


El proceso de transcripcin es anablico.
El resultado de la transcripcin es la secuencia de aminocidos que forma una protena.
1
0

Los ARN de transferencia son sustratos en el proceso de traduccin.


Los sustratos de la transcripcin son los ribonucletidos trifosfatados.
6. Si se coloca una molcula de ARNm de sapo dentro de una clula de levadura, esta clula podr traducirlo,
obtenindose una protena de sapo.
7. Una mutacin puntual siempre provoca el corrimiento del marco de lectura durante la traduccin.
8. Un error en la actividad de la ADN polimerasa puede llevar al surgimiento de un nuevo alelo.
9. Una mutacin en una clula de la piel podr heredarse a la descendencia.
10. No todas las mutaciones pueden heredarse.
4.
5.

a. Cul es la relacin entre el genotipo, el fenotipo y el ambiente?


b. Mencion:
- dos ejemplos en los que el fenotipo es simplemente la expresin del genotipo.
- dos ejemplos en los que el ambiente tambin interviene.
- un ejemplo de una caracterstica del fenotipo que se deba nicamente al ambiente.
- un ejemplo de una caracterstica del fenotipo de la cual no se sepa con certeza cul es la participacin
del genotipo.

EVOLUCIN
Reunidos en grupos lean detenidamente los casos presentados y resuelvan los cuestionarios.
1. El caso de la Old Order Amish
Entre las personas pertenecientes a la Old Order Amish (Antigua Orden de los Amish), que viven en
Lancaster, Pensylvannia, hay una frecuencia sin precedentes de un alelo recesivo. Este alelo en estado
homocigtico causa una combinacin de enanismo y polidactilia (dedos supernumerarios). La colonia de
Amish se ha mantenido virtualmente aislada del resto del mundo desde que fue fundada en 1770. Desde
entonces se registraron ms de 60 casos de esta malformacin congnita rara; casi tantos como en todo el
resto de la poblacin mundial. Se calcula que aproximadamente el 13% de los miembros de este grupo
formado por unas 17.000 personas- son portadores de este alelo. Todos los integrantes de la colonia,
descienden de unos pocos individuos. Por azar, uno de ellos debi haber sido portador de este raro alelo.
Cuestionario
a. El texto trata de un ejemplo referido a una especie o a una poblacin? De acuerdo a esto, decidan si se
trata de un ejemplo de micro o de macroevolucin.
b. Cules son las condiciones que se presentan en este caso que permiten explicar la altsima frecuencia de
este alelo raro entre los Amish?
c. Qu agente de cambio evolutivo consideran que est actuando? Justifiquen su respuesta.
2. Alteraciones numricas y poliploida
Las alteraciones numricas son mutaciones que, como su nombre indica, alteran el nmero total de
cromosomas tpico de la especie. Se originan frecuentemente por fallas durante la meiosis: la no-disyuncin
(no segregacin de homlogos) produce gametas con uno o varios cromosomas de ms (por ejemplo, la
trisoma del par 21 -que causa el sndrome de Down- se produce cuando una gameta n=23 se fusiona con
una gameta con 24 cromosomas).
La poliploida puede ser resultado de la no-disyuncin durante la meiosis. Cuando ocurre este fenmeno,
todo el complemento cromosmico queda, por ejemplo, duplicado (clulas 4n, o tetraploides), de modo que
de cada cromosoma habr cuatro homlogos en la misma clula. Tambin puede repetirse el genoma ms
de dos veces.
Los individuos poliploides no pueden reproducirse y dejar descendencia frtil con organismos diploides:
pueden reproducirse entre s, pero no con sus ancestros inmediatos.
Aqu se presentan algunos ejemplos:
- Papa (Solanum tuberosum)
4n=48
- Caf (Coffea arabica)
2n=22, 4n=44, 6n=66
- Banana (Musa sapientum)
2n=22, 3n=33
- Alfalfa (Medicago sativa)
4n=32
1
1

Man (Arachis hypogaea)


Batata (Ipomoea batata)

4n=40
6n=90

Cuestionario
a. En una especie 2n=4, un individuo sufre no-disyuncin en un solo par de homlogos; dibujen las gametas
que puede originar, sealando claramente los cromosomas homlogos.
b. Si en una poblacin de frutillas (Fragaria grandiflora, 2n=14), un pequeo grupo de plantas pasaran a tener
56 cromosomas, qu grado de ploida tendran? Expliquen brevemente qu pudo haber ocurrido (pueden
hacer esquemas o explicarlo con palabras).
c. Cules son las fuentes de variabilidad gentica que actan en dicha poblacin?
d. Qu agente de cambio evolutivo podra ponerse en marcha ante esta situacin? Por qu?
e. Este caso ilustra un mecanismo microevolutivo o macroevolutivo? Por qu?

3. Los pinzones de Darwin


En el archipilago de las Galpagos, visitado por Charles Darwin durante su viaje a bordo del Beagle, habitan
numerosas especies de animales y plantas que no han sido encontradas en otros lugares del planeta. Un
ejemplo es el de unos pequeos pjaros llamados genricamente pinzones. Constituyen unas 13 especies
que se parecen mucho entre s, aunque presentan notables diferencias en la forma de sus picos. En cada isla
habitan determinados grupos de pinzones, es decir, no todas las variedades de pinzones habitan en todas las
islas. Por otra parte, en el continente, frente al archipilago, se encuentra una nica especie de pinzn,
parecida tambin a las que habitan en las islas. De entre lo muchsimos casos que Darwin estudi y que le
permitieron postular su famosa teora, el de los pinzones es uno de los ms bellos y claros.
Cuestionario

a. Las distintas poblaciones de pinzones pertenecen a la misma o a distintas especies? De acuerdo a esto,
decidan si se trata de un ejemplo de micro o de macroevolucin.

b. Con qu caracterstica del hbitat de los pinzones se relaciona la forma del pico? De acuerdo a su
respuesta, por qu en cada isla habitan diferentes grupos de pinzones?

c. Cmo explican la presencia de otra especie de pinzn en el continente?


d. Qu agente de cambio evolutivo acta en este ejemplo? Justifiquen la respuesta explicando cmo pudo
haber sido la evolucin de los pinzones.

e. Qu se podra hacer para comprobar que las 13 variedades de pinzones corresponden a 13 especies
diferentes?

Ms ejercicios
1) Indic si las siguientes oraciones son verdaderas o falsas. Justific tu eleccin en no ms de cinco
renglones.
a.
b.
c.
d.
e.
f.
g.
h.
i.
j.
k.

La enzima ADN polimerasa forma uniones covalentes.


La cantidad de ADN que hay en una clula en G2 es el doble de la que hay en cada polo de telofase.
La divisin mittica puede ser un mecanismo de reproduccin asexual en organismos eucariontes.
La meiosis I es redaccional porque las dos clulas resultantes tienen la mitad de ADN que tena la clula
madre.
Tanto las clulas procariontes como las eucariontes duplican su ADN en el perodo S, que es previo a la
divisin celular.
Observando el cariotipo de una clula es posible determinar qu genes constituyen su genoma.
Una gameta que tiene 5 cromosomas y una cantidad de ADN de 30 unidades, provino de una clula madre
que en G2 tena 10 cromosomas y 60 unidades de ADN.
La fecundacin es una fuente de variabilidad gentica.
El cdigo gentico establece una relacin entre dos lenguajes diferentes.
Conociendo la secuencia de aminocidos de una protena es posible saber la secuencia de nucletidos del
ARN mensajero a partir del cual se obtuvo dicha protena.
Todas las caractersticas del fenotipo de un individuo son el resultado de la interaccin de su genotipo con
el ambiente.
1
2

2) Los lemures de cola anillada son una especie de primates. Se sabe que el color de sus ojos est codificado
en un gen con dos variantes: el color miel domina sobre el color negro. Por otro lado, los mechones que
recubren sus orejas pueden ser largos (dominante) o cortos (recesivo). Una hembra, homocigota recesiva para
ambas caractersticas, tiene, tras sucesivos apareamientos con un mismo macho, cuatro descendientes todos
fenotpicamente diferentes entre s.
a. Indic los genotipos y fenotipos de los padres y de las cras.
b. Cul es la probabilidad de que nazca otro hijo de ojos color negro y mechones largos?
c. Suponiendo que los lemures tienen en sus clulas somticas 4 cromosomas, y que en G 1 contienen 40
unidades arbitrarias de ADN, complet la tabla:
o

Etapa del ciclo celular

N de
cromosomas

N de cromtides
en la clula

Cantidad
de ADN

G2 (interfase)
Metafase mittica
En cada polo de telofase II
3) Daniel es de grupo sanguneo AB y Carla es de grupo 0. Ambos son alrgicos a la penicilina (un antibitico).
Daniel y Carla tienen su primer hijo. Sabiendo que los cuatro abuelos del beb toleran bien el antibitico:
a. Determin cul de los dos alelos relacionados con la penicilina es el dominante. Explic tu deduccin.
b. Indic las proporciones fenotpicas y genotpicas esperadas para este nio.
c. Considerando un complemento cromosmico 2n=6, dibuj una clula de la madre en metafase II y una clula
del padre en anafase. Seal en cada esquema un par de cromtidas (aclarando si son hermanas o
recombinantes), los alelos estudiados y, si es posible, un par de cromosomas homlgos.
4) Dada la siguiente lista de elementos, indic para cada uno y segn corresponda, cul es su rol en la
transcripcin y/o cul es su rol en la traduccin: ARN polimerasa aminocidos ARN de transferencia
ribonucletidos trifosfatados ribosomas ADN.
5) En una especie de ratones se descubri una enfermedad hereditaria, debida a una alteracin en un gen. Las
secuencias correspondientes a las cadenas molde son:
Alelo ratn sano:

AGGTACAAAGGCCTTGCACAGCTTTTACT

Alelo ratn enfermo:

AGGTACAAAGGCCTTGCACTGCTTTTACT

a. Indic cules son los productos de la transcripcin y de la traduccin de cada alelo (mencion el nombre de
la molcula resultante y la secuencia de bases correspondiente).
b. Explic brevemente cmo pudo haberse originado el alelo que codifica para la enfermedad (no olvides
mencionar la fuente de variabilidad involucrada).
6) Con cada conjunto de trminos, redact un prrafo de no ms de 8 renglones:
a.
b.
c.
d.
e.
f.

clula diploide duplicacin del ADN cromtides hermanas


cigota meiosis gameta duplicacin del ADN
reproduccin asexual cromtides hermanas variabilidad gentica
reproduccin sexual entrecruzamiento (crossing over) variabilidad gentica.
mutacin alelo reproduccin asexual poblacin de levaduras.
poblacin de gorriones de Buenos Aires variabilidad gentica reservorio gnico seleccin natural.

1
3