You are on page 1of 14

Gentica Forense

ea
Tcnica do PCR

Universidade de Braslia
Alunas: Amanda Soares 09/0002776
Carolina Fumico - 09/0004434
Ina Aquino 09/0018516
Luana Lima 09/0028210
Paula Margotto 09/0011872
Disciplina: Gentica Bsica
Professora: Zulmira Guerrero Marques Lacava

Introduo
A Biologia uma cincia composta por inmeras reas, uma delas a
gentica forense. Do ingls, forensic science um termo utilizado,
predominantemente, no uso da cincia e da tecnologia para a reconstituio
e obteno de provas de crimes. Esse ramo foi consolidado com o trabalho
desenvolvido por Jeffreys, em 1985, que possibilitou a individualizao do
DNA.
O presente trabalho tem como finalidade de abordar tcnicas de
anlise de DNA e suas aplicaes. Dentre as tcnicas destacam-se: reao
em cadeia da polimerase (PCR), polimorfismo de comprimento de
fragmento de restrio (RFLP), VNTR e STR e por fim a eletroforese em
gel. A grande aplicao desse importante ramo da gentica a identificao
de indivduos a servio da justia como no teste de paternidade e
identificao de suspeitos.

Gentica Forense
Histrico
Os testes de DNA so para a justia o que o telescpio para as
estrelas: no uma lio de bioqumica, no uma exibio das maravilhas da
lente de aumento, mas uma maneira de ver as coisas como realmente so.
Esta frase encontra-se no livro Actual Innocence de Scheck e Nefeuld e
demostra como a Gentica Forense que tem como base tcnicas de anlise
da estrutura do DNA pode ser til e esclarecedora. Para este ramo da
Gentica chegar onde est hoje com todas as suas tcnicas um longo
caminho para desenvolv-las foi percorrido.
At a dcada de 1980 quando desejava-se amplificar um trecho da
molcula de DNA os cientistas lanavam mo de uma tecnologia
desenvolvida por Cohen e Boyer que nada mais era do que um recurso de
clonagem molecular. Neste mtodo primeiro isolava-se o trecho de DNA
em foco a ser amplificado utilizando enzimas de restrio. Estas enzimas
tambm chamadas de endonuclease de restrio tm origem de procariotos
e atuam como "tesouras moleculares", reconhecendo seqncias de pares
de bases especficas em molculas de DNA e cortando-as nesses pontos.
Depois de isolar o trecho desejado este inserido no plasmdeo de
alguma bactria que teve de ser cortado e aberto em algum ponto para que
a insero pudesse ser realizada. Este plasmdeo modificado ou DNA
recombinante colocado dentro de uma clula bacteriana e esta ao se
duplicar replicar o prprio material gentico e conseqentemente o
segmento de DNA inserido. Assim, esperava-se que essas bactrias se
multiplicassem suficiente para obter uma quantidade razovel do trecho
desejado. Purificava-se tal segmento separando-o da massa total de DNA
da populao de bactrias formada.
Este procedimento era muito trabalhoso e demorado, pois alm do
inconveniente de ter de lidar com bactrias levavam-se dias para conseguir
bastante DNA amplificado. Quando o PCR (Reao da Polimerase em
Cadeia) foi inventado causou uma revoluo no mundo cientfico e um
grande avano, porque em poucas horas alcanava-se o mesmo fim
(amplificao seletiva de um trecho de DNA). Tal inveno valeu o prmio
Nobel, em 1993, a Kary Mullis.

Nesta poca a tecnologia forense passou a ser aplicada cada vez mais
freqentemente e erros se tornaram comuns em identificao genmica.
Com isto, rgos de segurana pblica contestaram o mtodo empregado
nas identificaes. Na poca o mais utilizado era a anlise por meio dos
Polimorfismos de Comprimento dos Fragmentos de Restrio (RFLP).
uma tcnica na qual organismos podem ser diferenciados por padres de
DNAs clivados. Se dois organismos diferirem na distncia entre os stios de
clivagem de uma endonuclease de restrio, o comprimento dos fragmentos
produzidos vai diferir quando o DNA for digerido com uma enzima de
restrio. Acontece que a avaliao das faixas de DNA eram muito
subjetivas e difceis de interpretar. Assim, um novo tipo de marcador
passou a ser utilizado: o STR (repeties curtas enfileiradas)e o mais
empregado atualmente. Neste o tamanho medido do trecho mais preciso.
Alguns casos de identificao humana ficaram famosos na histria
pela repercusso pblica que tiveram. Citar-se- dois deles. O primeiro se
deu na Rssia com a tentativa de provar que resqucios esqueletais achados
eram de indivduos da famlia Romanov. Os ossos foram enviados ao
Servio de Cincia Forense que foi o primeiro laboratrio do Reino Unido
especializado em identificao genmica. L o cientista Gill desenvolveu
um mtodo de identificao com DNA mitocondrial (DNAm ) que mais
abundante que o cromossmico do ncleo celular. Conseguiu-se provar por

meio de comparaes de impresses genmicas simtricas que os ossos


pertenceram a trs irms, dois parentes e ao prprio czar Romanov.
O caso envolvendo o ex-presidente norte-americano Thomas
Jefferson tambm tornou-se conhecido. Havia uma forte suspeita devido a
semelhanas fsicas de que Thomas era o pai de um ou dois filhos de uma
escrava dele: Sally Hemings. Afim de esclarecer tudo o DNA foi fadado a
resolver a questo. Amostras de DNA de descendentes masculinos do tio
paterno de Thomas foram comparadas com amostras de descendentes
masculinos de Tom e Eston (os filhos de Sally). Um trao jeffersoniano foi
encontrado em ambas as amostras, mas isto confirma que o ex-presidente
tenha tido um caso com a escrava, pois nada prova que um outro membro
da famla Jefferson pudesse estar envolvido.
A identificao genmica deu um grande salto com a inveno da
tcnica do DNA fingerprinting cujo autor foi Jeffreys. Ele trabalhava
estudando genes da mioglobina quando percebeu que um pequeno trecho
de DNA se repetia continuamente. Ampliando seus estudos Jeffreys
percebeu que aquele tipo de trecho encontrava-se espalhado por todo o
genoma . Ele descobriu acidentalmente como distinguir indivduos. Uma
amostra purificada da sequencia repetitiva foi marcada com molcula
radioativa funcionando assim como uma sonda. Quando o genoma
colocado junto a sonda ocorre emparelhamento de base em certas regies.
Isto pode ser revelado com raios x e comparado com a seqncia de DNA
pertencente a outro indivduo possibilitando assim a identificao de
indivduos distintos.
A Gentica Forense trata da utilizao do conhecimento e das tcnicas
de gentica e de biologia molecular no auxlio justia. Tambm
conhecido como DNA forense. Apesar do ramo mais desenvolvido da
gentica forense ser a identificao humana pelo DNA e sua aplicao mais
popular o teste de paternidade, esta tambm pode ser aplicada na
identificao ou individualizao de animais, plantas e microorganismos
presentes em resduos, provas ou at mesmo no corpo de um cadver.
Algumas etapas so importantes na coleta dos vestgios na cena do
crime para uma conservao do material evitando a contaminao deste e
um resultado incorreto da anlise. Primeiro isola-se o local e toma os
cuidados necessrios para a preservao deste que varia de lugar para lugar.
Antes de se fazer a coleta do material importante fazer o reconhecimento
e a identificao do material, seguido de um registro fotogrfico,
topogrfico e descritivo. Esses registros so importantes para comprovao

dos vestgios encontrados no local. E por fim faz-se a coleta com um


transporte adequado at um laboratrio aonde ir se fazer a anlise
laboratorial.
O material biolgico pode variar entre sangue e um fio de cabelo.
apartir desse material que faz a extrao do DNA e sua anlise. Outros
exemplos de amostra so dente, osso, tecido, smen, saliva e urina.
As tcnicas que podem ser feitas as anlises do material so o
polimorfismo de comprimento de fragmentos de restrio (PCFR) ou do
ingls, restriction fragment lenght polymorphisms (RFLP). A tcnica
consiste em detectar diferentes polimorfismos. Existem variaes nas
seqncias dos seus nucleotdeos que correspondem a mudanas neutras ou
silenciosas, chamados polimorfismos de DNA. Esses polimorfismos podem
ser detectados com base em diferenas no comprimento de fragmentos de
DNA, produzidos pela clivagem com enzimas de restrio, que cortam o
DNA em seqncias reconhecidas por essas enzimas. Tais seqncias so
chamadas stios de restrio que leva a formao de polimorfismos de
comprimento de restrio.
Um exemplo a enzima EcoR1 que reconhece a seqncia de DNA
GAATTC. Se esta enzima estiver atuando em um filamento de DNA, toda
vez, que a enzima encontrar essa seqncia ela corta o DNA entre G e A,
produzindo fragmentos de restrio de DNA.

Na figura acima, observa-se a deteco do DNA e a clivagem do DNA


pela enzima de restrio EcoR1. Em B, a enzima cliva trs seqncias,
produzindo dois fragmentos menores. Em A a seqncia GAATTT no
pode ser clivada pela enzima, produzindo um filamento nico mais longo.
Conclui-se que variaes nas seqncias de DNA em stios de
restrio especficos produzem variaes nos comprimentos dos
fragmentos de DNA, que so separados por eletroforese em gel e

visualizados com o uso de sondas conhecidas e marcadas, geralmente


radioativamente.
O PCFR foi uma das primeiras aplicaes de anlise de DNA para
investigao forense. Com o desenvolvimento de tcnicas de anlise de
DNA mais eficientes, o PCFR no usado tanto como antes, pois requer
quantidades relativamente grandes de DNA. Alm disso, amostras
degradadas por fatores ambientais como sujeira ou mofo, no funcionam
bem com o PCFR.
A tcnica que utiliza o DNA mitocondrial pode ser usado para
examinar o DNA de amostras que no podem ser analisadas pelo PCFR,
PCR, STR. Nessa anlise utiliza-se o DNA extrado da mitocndria.
usado em casos em que a amostra biolgica anucleada como cabelo,
dente, etc.
A Anlise do cromossomo Y baseada no principio que o
cromossomo Y transmitido diretamente de pai para filho, assim a anlise
de marcadores genticos do cromossomo Y especialmente til para
rastrear as relaes entre homens ou para anlise de evidncias biolgicas
que envolvem vrios participantes do sexo masculino.
A Anlise STR uma tecnologia utilizada para avaliar determinadas
regies do DNA nuclear. Variabilidade nas regies STR pode ser usada para
distinguir um perfil de DNA apartir de outro.
O PCR uma das tecnologias mais usadas ultimamente.
PCR uma tcnica da biologia molecular que permite a replicao em
vitro do DNA. Essa rpida amplificao de material gentico permitiu uma
melhor analise do DNA em investigaes criminais (onde vestgios podem
ser mnimos) e em diagnsticos mdicos mais precisos de doenas.
O DNA previamente cortado por enzimas de restrio, que limita a
rea a ser replicada. A replicao ser mais limitada ainda pelos primers na
segunda fase do PCR.
O PCR consiste em trs fases,que acontecem em um termociclador
,que controla automaticamente a temperatura do processo
Primeiro passo: desnaturao, consiste na separao das fitas duplas.
Com o aumento da temperatura as ligaes de hidrognio que une as duas

fitas so quebradas. As ligaes de hidrognio so mais fracas que as


ligaes covalentes entre a pentose e o fosfato, que permanecem intactas.

Segundo passo: hibridizao, objetivo do PCR no replicar todo


DNA, mas uma pequena seqncia de interesse. Os primers so seqncias
sintticas de nucleotdeos que se ligam a seqncia complementar na fita
molde. So adicionados dois primers, um para cada fita simples. A
temperatura aumentada para que os primers possam se encaixar com a
fita simples.

Terceiro passo extenso: pela ao da enzima Taq polimerase os


nucleotdeos complementares a fita molde so adicionados da 5 para 3.A
vantagem da taq polimerase que ela trabalha a temperaturas altas sem ser
desnaturada.
E assim acontece sucessivamente nas fitas que crescem de forma
exponencial

Eletroforese
A tcnica de separao dos fragmentos de DNA mais utilizada a
eletroforese atravs de gel.A Eletroforese que forma padro de bandas
caractersticas para cada indivduo ,isso permite a identificao de pessoas
como em cenas de crimes e em testes de paternidade, como tambm

diagnsticos de doenas especficas. Eletroforese uma ferramenta


amplamente utilizada no meio cientfico, uma tcnica baseada na
separao de partculas em um determinado gel de acordo com os
diferentes tamanhos cargas ou conformaes. O princpio da eletroforese
utilizada para separao de DNA se baseia na carga negativa global de uma
fita de DNA. Ao final do processo as cadeias de DNA estaro prximas ao
catodo (positivo), que atrai, devido polaridade, molculas de carga
negativa. O DNA colocado no gel ,que separa as partes mais pesadas das
mais leves.
O gel composto geralmente de agarose (um polissacardeo extrado
de uma alga marinha, fcil de preparar e no txico). Aps a
eletroforese , os fragmentos de DNA normalmente so corados com
brometo de etdeo, que possui afinidade pelo DNA e fluorece (torna-se
visvel) vivamente em contato com a luz ultravioleta. Dessa forma pode-se
localizar as bandas que correspondem ao DNA. Os fragmentos de DNA
podem, ento, ser isolados, purificados e analisados.
DNA satlite
DNAs satlites so seqncias repetitivas (em tandem) e no
codificadoras de DNA, que se localizam principalmente no centrmero e
telmero dos cromossomos, exercendo funes estruturais nos mesmos.
Exemplo: GACGATGCGAATGCGAGCTCTCTCTCTTCTCTCTCTC
Em 1960 foi descoberto o DNA satlite e atribuiu-se essa
denominao por causa ao padro de banda originado pela centrifugao
em gradientes de densidade de CsCl (com o objetivo de separar o DNA por
sua densidade), assemelhando-se a satlites orbitando ao redor de um
corpo.
Cerca de 3 a 10% do genoma humano composto por essas
sequncias e embora ainda no se saiba ao certo a origem dos DNAs
satlites, a teoria mais provvel a de que eles so formados pelas
derrapagens (slippage) da DNA polimerase durante a replicao do DNA.
Nesse processo, o nmero de repeties pode ser aumentado ou diminudo,
caracterizando assim, uma diversidade de sequncias.
Dentre os tipos de Satlites podemos destacar o DNA satlite (170-175
pares de base), o minissatlite ou VNTR- variable number of tandem
repeats (10 a 15 pb) e o microssatlite ou STR-short tandem repeats (1 a 4

pb), sendo esse dois ltimos de fundamental importncia para a gentica


forense.
Uma grave doena neuromuscular causada pela expanso de
microssatlites a distrofia miotnica, tambm conhecida como doena de
Steinert. Seu principal sintoma a miotonia, ou seja, demora ao relaxar o
msculo depois de contra-lo. Ela caracterizada por causar fraqueza
muscular e problemas cardacos, neurolgicos e gastrointestinais. Seus
sintomas podem ser amenizados por uma intensa fisioterapia.
No ano de 1985, Alec. J. Jeffreys, observou que o nmero de
repeties de um dado minissatlite diferente entre os indivduos, o que
d origem a diversos alelos e conseqentemente ao polimorfismo. Desse
modo, improvvel que duas pessoas tenham o mesmo gentipo, com
exceo de gmeos monozigticos. Pela tcnica do PCR, uma determinada
quantidade de DNA pode ser amplificada e analisada pela eletroforese em
gel para a identificao de indivduos e suspeitos e para testes de
paternidade.

Aplicaes:
1- Identificao de suspeitos
As investigaes policiais fazem o uso de comparaes entre
impresses digitais genticas (DNA fingerprint) no reconhecimento de um
criminoso. Como explicado anteriormente, cada indivduo possui um
nmero de repeties especficas de minissatlite, da mesma forma que
cada um possui uma impresso digital distinta, por isso faz-se a analogia
com o termo fingerprint. Aps a coleta do material envolvido no crime e
posterior movimentao desse ao longo do gel de agarose, compara-se os
padres de banda formados, como por exemplo na figura abaixo:

Percebe-se que o padro de bandas da amostra de DNA encontrada na


vtima compatvel com as bandas do suspeito 1. Dessa forma conclui-se
que ele o culpado pelo crime.
2- Teste de paternidade
O teste de paternidade comumente utilizado para identificao e,
portanto confirmaes de suspeitas de paternidade. Muito usado como
provas nos tribunais, apoiando a justia de todo o mundo, e ainda como
uma prova com uma probabilidade de erro extremamente mnima.
Consiste em comparar a impresso digital gentica ou DNA
fingerprint da me, do (a) filho (a) e do suposto pai, nos casos mais
comuns. Com todas essas informaes, tem-se os alelos doados pela me
no DNA do(a) filho(a) e obrigatoriamente os outros foram doados pelo pai,
assim, se o DNA do suposto pai tiver esses alelos, confirma-se a
paternidade, do contrrio, o teste de paternidade d negativo.
Nesse processo de comparao, analisam-se vrios genes, a quantidade
e quais genes sero analisados no DNA da pessoa, varia de laboratrio para
laboratrio. O Brasil pioneiro nas anlises utilizando-se a marcao por
sondas radioativas dos Shorts Tandem Repeats ou STRs (pequenas
repeties hipervariveis de indivduo para indivduo).
O teste de paternidade pode ser feito ainda antes do nascimento da
criana, nesse caso, colhe-se com uma seringa especial o lquido amnitico
que contm clulas com o DNA do feto. Essa especialidade do teste de
paternidade denominada paternidade pr-natal.
H casos em que o suposto pai j faleceu, podendo-se com
determinao judicial fazer a exumao do cadver para obteno do
material gentico ou utilizao de material recolhido para biopsia num
procedimento mdico feito no corpo do suposto pai.

Tambm pode-se ter casos em que no se tem disponvel o material


gentico do suposto pai e utiliza-se o do parentes deste para fazer uma
prvia do que seria o DNA desse indivduo. Ou no tem o material gentico
da me, fazendo a probabilidade matemtica diferenciada no teste de
paternidade.
A foto abaixo mostra como feita essa comparao com as impresses
digitais:

3- Teste de maternidade
Assim como no teste de paternidade sem o DNA da me, o teste de
maternidade feito com os mesmos princpios, porm a probabilidade
matemtica muda, j que na grande maioria dos casos tambm no se tem o
DNA do pai.

Concluso
A Gentica forense se apoia nas tcnicas desenvolvidas na gentica e
biologia molecular para auxiliar a justia. Essas tecnologias foram sendo
aprimoradas e hoje com uma quantidade bem menor de material gentico
que extrado de uma amostra biolgica pode ser feita uma anlise bem
precisa. Outro fator importante que contribui para a preciso da anlise a
conservao da amostra, que envolve desde o processo de coleta dessa
amostra at sua locomoo ao laboratrio. Existem uma quantidade relativa
de tcnicas que podem ser aplicadas e o que vai direcionar qual a melhor
tecnologia a ser adotada a natureza da amostra.
O PCR uma tcnica da biologia molecular amplamente utilizada
devido a sua eficcia na replicao em vitro do DNA, permitindo que de
pequenas amostras se obtenha quantidade suficiente de DNA para analise.
Essa tcnica consiste em trs etapas que ocorrem dentro de um
termociclador (controla a temperatura durante o processo). Desnaturao,
Hibridizao e Extenso. Dobra-se a quantidade de DNA a cada ciclo.
Para a anlise a tcnica mais usada a eletroforese, que utiliza
diferena de potencial para separar o DNA de acordo com o tamanho e a
densidade, formando fitas caractersticas.
Uma das tcnicas mais usuais da gentica forense a do STR
(microssatlite), que so curtas e repetitivas sequncias de DNA,
localizadas cromossomo, onde exercem funes estruturais. H cerca de 25
anos descobriu-se que o nmero de repeties de um microssatlite ou
minissatlite varia de indivduo para indivduo. Isso permitiu certas
aplicaes na justia como a identificao de indivduos e
conseqentemente de suspeitos. Desse modo, percebe-se a importncia do
desenvolvimento de estudos que aprimorem essa tcnica.
Uma das aplicaes mais usadas da gentica forense o teste de
paternidade comparando-se impresses digitais utilizadas para
identificao de indivduos, e assim, confirmando-se ou no a paternidade
do suposto pai. Esse teste auxilia muito decises judiciais em tribunais de
todo o mundo. O teste de maternidade, no to comum, possui o mesmo
princpio do teste de paternidade, exceto na probabilidade matemtica.

Bibliografia
Bio Volume nico, Snia Lopes, Editora Saraiva
http://www.scribd.com/doc/23337106/Aula-8-DNA-mitocondrial
http://www.roche.pt/portugal/index.cfm/produtos/equipamentos-dediagnostico/products/molecular-diag/intro-pcr
http://www.abcdasaude.com.br/artigo.php?670
http://translate.google.com.br/translate?hl=pt-BR&sl=en&tl=pt&u=http
%3A%2F%2Fwww.ornl.gov%2Fhgmis%2Felsi%2Fforensics.shtml
http://www.e-escola.pt/topico.asp?id=279
http://www.cremerj.com.br/palestras/624.PDF
http://www.cpafro.embrapa.br/media/arquivos/publicacoes/doc103_mar
cadoresmoleculares_.pdf
http://www.crbm1.gov.br/bio65/artigocien_65.asp
http://www.bombeiros.go.gov.br/trabalhos_cientificos/docs/DissertacaoMonitoramento%20Genetico.pdf
http://bmg.fc.ul.pt/Disciplinas/FundBiolMolec/5Genoma%20II
%20DNArepetitivo.pdf
http://br.answers.yahoo.com/question/index?
qid=20070420160309AAab00B
http://webcache.googleusercontent.com/search?
q=cache:0ICX2LNIRvcJ:www.portaldafisioterapia.com/%3Fpg
%3Dfisioterapia_neurofuncional%26id%3D1126+distrofia+miot
%C3%B4nica+caracteristicas&cd=9&hl=pt-BR&ct=clnk&gl=br
http://www.bombeiros.go.gov.br/trabalhos_cientificos/docs/DissertacaoMonitoramento%20Genetico.pdf
http://webcache.googleusercontent.com/search?
q=cache:rf3rFN94aVoJ:www.drashirleydecampos.com.br/noticias/1259
+dna+satelite&cd=4&hl=pt-BR&ct=clnk&gl=br
http://forum.med.up.pt/viewtopic.php?
t=92&sid=8385447c7243fca6a4929b411d721b84