You are on page 1of 7

archives of oral biology 58 (2013) 583589

Available online at www.sciencedirect.com

journal homepage: http://www.elsevier.com/locate/aob

XRCC1 gene polymorphisms and risk of ameloblastoma


Pattamawadee Yanatatsaneejit a, Titiporn Boonsuwan a, Apiwat Mutirangura b,
Nakarin Kitkumthorn c,*
a

Department of Botany, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand


Center of Excellence in Molecular Genetics of Cancer and Human Diseases, Department of Anatomy, Faculty of Medicine,
Chulalongkorn University, Bangkok 10330, Thailand
c
Department of Oral and Maxillofacial Pathology, Faculty of Dentistry, Mahidol University, Bangkok 10400, Thailand
b

article info

abstract

Article history:

Objective: Ameloblastoma is a common benign odontogenic tumour with inherently ag-

Accepted 21 October 2012

gressive behaviour. Genetic susceptibility of single nucleotide polymorphism (SNP) can


likely predict ameloblastoma at risk patients but this data remains limited. Here, we studied

Keywords:

XRCC1 polymorphism as a risk factor for ameloblastoma.

Ameloblastoma

Design: Eighty-two ameloblastoma samples and blood from 140 healthy controls were used

XRCC-1

to perform polymerase chain reactionrestriction fragment length polymorphism (PCR

Polymorphism

RFLP) for XRCC1 at codons 194, 280 and 399, and confirmed by sequence analysis.
Results: Compare to healthy control, a significant increase was noted in the occurrence of
polymorphism at codon 194 and 399 in ameloblastoma patients. At codon 194, tryptophan
encoded by T, was the susceptibility allele showed an ODD ratio of (95% CI) = 1.62 (1.052.48),
p = 0.027. At codon 399, glycine encoded by A was the susceptibility allele showing ODD ratio
of (95% CI) = 1.83 (1.192.84), p = 0.005. Moreover at codon 399, we found AG as the susceptibility genotype (2.06 (1.143.72), p = 0.015). However, we did not find any significant increase
in polymorphic occurrence in ameloblastoma patients at codon 280. For haplotype analysis
of 3 codons, we found GGC as protective haplotype, and AGT as the risk haplotype.
Conclusion: Our data suggest that polymorphism at codons 194 and 399, likely contributes to
the risk of developing ameloblastoma.
# 2012 Elsevier Ltd. All rights reserved.

1.

Introduction

Ameloblastoma is a common benign odontogenic tumour


which frequently occurs in maxillary and mandibular bone.
This tumour is found in young adult male and female in the
median age of 35 years old.16 Although ameloblastoma is a
benign tumour and rarely metastasis, it is locally aggressive by
infiltrating and destroying surrounding bone tissue resulting
in symptoms that includes swelling, facial deformity, loose
teeth, and these can be associated without pain that can
progress to pain.79 Ameloblastoma has a high recurrent rate,

thus after treatment by wild excision, long term follow up


should be arranged.6,9,10 Ameloblastoma is mainly classified
into multicystic, peripheral, desmoplastic and unicystic
type.68 Multicystic and unicystic type are the most common
of intrabony. Notably, the multicystic type is the most
aggressive form, in comparison to the unicystic.8 It is also
believed that ameloblastoma can transform to ameloblastic
carcinoma.11
Various genetic alterations can lead to tumour formation.
Normally, cells have an inherent ability to correct these
changes unless their repair function is decreased or defective.
Polymorphism of repair genes is one of the leading causes

* Corresponding author. Tel.: +66 2203 6470; fax: +66 2203 6470.
E-mail addresses: Nakarinkit@hotmail.com, Nakarinkit@gmail.com (N. Kitkumthorn).
00039969/$ see front matter # 2012 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.archoralbio.2012.10.016

584

archives of oral biology 58 (2013) 583589

impacting repair function. In this context, the X-ray Repair


Cross-Complementing gene (XRCC1) encodes for one of DNA
repair proteins (XRCC1), playing a crucial role in base excision
repair (BER) pathway. There are many steps and proteins
involved in this pathway to remove small, non-helix-distorting base lesions from the genome. XRCC1 which is one of BER
proteins essentially acts as a scaffold protein interacting with
several repair proteins, for example DNA polymerase b, ligase
III, APEI and PARP.12,13
Single nucleotide polymorphisms (SNP) of XRCC1 have
been widely studied, especially Arg194Trp, Arg280His and
Arg399Gln which have been reported to be involved in
susceptibility to several cancers, such as colon,14 lung,15
cervix,16 bladder,17 gastric,18 and prostate.19
Ameloblastoma has a high recurrent rate and surgery is the
most common treatment strategy, leading to facial malfunction and discomfort impacting quality of life. Therefore, a
genetic test to screen patients at risk for ameloblastoma
susceptibility may be important for understanding the
biological basis of disease progression, leading to the
development of effective drug therapy for treatment and
prevention. With no evidence of an association between
XRCC1 and ameloblastoma, we sought to investigate polymorphisms of XRCC1 in ameloblastoma prevalent in a Thai
population. In this regard, we hypothesized that, Tryp at
codon 194, His at codon 280 and Gln at codon 399 may
represent allelic risk, essentially as these are minor alleles,
and numerous studies have revealed that they are associated
with several cancers.20 Thus the investigation of the association between allele frequency of the three polymorphisms as
susceptibility allele and ameloblastoma can hold potential for
disease diagnosis and prevention in Thai population in the
future.

2.

Materials and methods

2.1.

Patient samples and DNA extraction

140 healthy Thai populations, who matched to the ameloblastoma group with respect to age, sex and nationality.
Each ameloblastoma case underwent H&E histopathological evaluation prior to analysis, and those sections consisting
at least of 80% tumour cells were included in the study. For
analysis, 35 sections of 5 mM thick were collected in the
microtube underwent DNA isolation using the DNA QIAamp
DNA FFPE tissue (Qiagen, CA, USA). DNA from the peripheral
blood of each subject was extracted by proteinase K and
incubated overnight at 50 8C followed by phenol/chloroform
extraction and ethanol precipitation. Finally, the purified
genomic DNA was eluted and stored at 20 8C until needed for
use as a template in genotyping analysis.

2.2.

DNA extracted from both ameloblastomas and healthy


controls underwent genotyping of XRCC1 at codons 194, 280
and 399 by PCRRFLP (polymerase chain reactionrestriction
fragment length polymorphism). The sequence of primers,
and restriction enzymes used for genotyping are shown in
Table 1. SNP at codon 194 can be CGG, encoding a major allele
arginine, or TGG, encoding the minor allele tryptophan.
Whereas SNP at codon 280 can be CGT, encoding a major
allele arginine, or CAT, encoding the minor allele histidine.
Finally, SNP at codon 399 can be CGG, encoding major allele
arginine, or CAG encoding minor allele glycine. The PCRRFLP
gel electrophoresis was demonstrated in Figs. S1S3. All
experiments were performed in duplicate, and double blind.
Ten percent of genotyping results were randomly confirmed
by sequence analysis.
Supplementary data associated with this article can be
found, in the online version, at doi:10.1016/j.archoralbio.2012.10.016.

2.3.

Eighty-two paraffin embedded tissues, pathologically diagnosed with ameloblastoma were collected between 2002 and
2011, and obtained from the Faculty of Dentistry, Mahidol
University. Clinical and radiological data were obtained from
patients file. For the control group, subjects undergoing
routine health examination and those assessed to be free of
cancer were enrolled for the study. After obtaining written
informed consent, 6 mL of peripheral blood was collected from

XRCC1 genotyping

Statistical analysis

HardyWeinberg equilibrium calculator was used for assessing the consistency of genotype frequencies among normal
control. Allele and genotype frequency were compared
between patient and control groups. ODDS ratio (OR) and
95% confidence interval (CI) were used as parameters to
compare the frequency of SNP as risk factors in ameloblastoma. OR > 1 and 95% CI excluding 1 together with p value
<0.05 indicates a positive association or increase risk between
the SNP allele and ameloblastoma. Three SNPs were analysed

Table 1 Primer sequences, restriction enzymes and product sizes of PCRRFLP at XRCC1 codons 194, 280 and 399.
Codon (rs no.)

Primer sequence

Enzyme for RFLP

Product size (b.p.)

194 (1799782)

Forward: AGAAGGTGACAGTGACCAAG
Reverse: ACGTTGTCCGAGCTCACCT

PvuII

Uncut: 131
Cut: 40 and 91

280 (25489)

Forward: TTGACCCCCAGTGGTGCT
Reverse: TGCCTTCTCCTCGGGGTTT

RsaI

Uncut: 133
Cut: 63 and 70

399 (25487)

Forward: CCCCAAGTACAGCCAGGTC
Reverse: CCCAGCACAGGATAAGGAGC

MspI

Uncut: 142
Cut: 48 and 94

585

archives of oral biology 58 (2013) 583589

for haplotype blocks. The PLINK v1.07 program21 was used for
performing the statistical analysis. Percentage of coefficient of
variance (% CV) was used to analyse the distribution of density
of the PCR band of each heterozygous sample to demonstrate
that there was no mosaisicm from the oral epithelium and
connective tissue (% CV  10, indicated that there was no
distribution of data).

3.

Results

3.1.
399

Genotyping of SNP of XRCC1 at codons 194, 280 and

The genotypic data is summarized in Tables 24. Essentially, this study demonstrated that the frequency of Arg/Arg,
Trp/Trp and Arg/Trp genotype at codon 194, were 40.24%,
17.07% and 42.68%, respectively, in ameloblastomas.
Whereas in healthy controls, these were 52.86%, 8.57%
and 38.57%, respectively. At codon 280, the genotype Arg/
Arg, His/His and Arg/His were at a frequency of 70.73%,
3.66% and 25.61%, respectively, in ameloblastomas, and
73.57%, 4.29% and 22.14%, respectively, in healthy controls.
Finally at codon 399, the genotype Arg/Arg, Gln/Gln and
Arg/Gln were 32.93%, 12.20% and 54.88% in ameloblastomas, and 55.00%, 7.86% and 34.17%, respectively, in healthy
controls. The distribution of the genotype of codons 194, 280
and 399 among the controls was in the HardyWeinberg
equilibrium ( p > 0.05).

3.2.

SNP analysis of XRCC1 at codons 194, 280 and 399

The raw data and allele frequency between ameloblastomas


and healthy controls are shown in Tables 24, and genotyping
data are concluded in Table 5. The data indicated that there
was a significant risk association of SNP at codons 194 and 399.
At codon 194, OR (95% CI) was 1.62 (1.052.48), p = 0.027 among
ameloblastomas with T as the susceptibility allele. The OR
(95% CI) of unicystic and conventional type of ameloblastoma
with T susceptibility allele, was 1.82 (0.913.63) and 1.54 (0.95
2.49), respectively. The OR (95% CI) of genotypic frequency,
with TT as the susceptibility genotype was 2.20 (0.95.41) while
CT as the susceptibility genotype was 1.19 (0.662.14).
At codon 399, OR (95% CI) was 1.83 (1.192.84), p = 0.005
among ameloblastomas with A as the susceptibility allele. The
OR (95% CI) of unicystic and conventional type of ameloblastoma with A susceptibility allele was 1.35 (0.652.76) and 2.05
(1.273.30), respectively. The OR (95% CI) of genotypic
frequency, AA as the susceptibility genotype was 1.63
(0.614.37) while AG as the susceptibility genotype was 2.06
(1.143.72).
However, there was insignificance at codon 280, OR (95% CI)
was 1.09 (0.621.89), p = 0.862 among ameloblastoma with A
susceptibility allele. The OR (95% CI) of unicystic and
conventional type of ameloblastoma with A susceptibility
allele was 1.34 (0.563.15) and 0.99 (0.521.87), respectively.
The OR (95% CI) of genotypic frequency, AA as the susceptibility genotype was 0.85 (0.163.96) while GA as the susceptibility genotype was 1.21 (0.612.40).

Table 2 XRCC1 codon 194 polymorphisms in ameloblastoma patients and control subjects.
Groups

Controls
Sex
Male
Female
Ameloblastomas
Sex
Male
Female
Adjust OR
Clinical types
Unicystic type
Sex
Male
Female
Adjust OR
Conventional type
Sex
Male
Female
Adjust OR

No. of
samples

Ave.
age

XRCC1 genotypes [n (%)]

Arg

Hetero

Trp

C/C

C/T

T/T

30.8

74 (52.86%)

54 (38.57%)

71 (50.71%)
69 (49.29%)

29.9
31.43

38 (53.52%)
36 (52.17%)

82

35.96

41 (50%)
41 (50%)

Allele frequency [n (%)]

Allelic test
OR
(95% CI)

p value

12 (8.57%)

202 (72.14%)

78 (27.86%)

Ref.

27 (38.03%)
27 (39.13%)

6 (8.45%)
6 (8.70%)

103 (72.54%)
99 (71.74%)

39 (27.46%)
39 (28.26%)

Ref.
Ref.

33 (40.24%)

35 (42.68%)

14 (17.07%)

101 (61.59%)

63 (38.41%)

1.62 (1.052.48)

0.027

41.54
31.39

20 (48.78%)
13 (31.71%)

14 (34.15%)
21 (51.22%)

7 (17.07%)
7 (17.07%)

54 (65.85%)
47 (57.32%)

28 (34.15%)
35 (42.68%)

1.37 (0.732.57)
1.89 (1.023.49)
1.61 (1.052.48)

0.367
0.041
0.028

23

35.96

7 (30.44%)

13 (56.52%)

3 (13.04%)

27 (58.70%)

19 (41.30%)

1.82 (0.913.63)

0.093

12 (52.17%)
11 (47.83%)

41.54
31.39

4 (33.33%)
3 (27.27%)

7 (58.34%)
6 (54.55%)

1 (8.33%)
2 (18.18%)

15 (62.50%)
12 (54.55%)

9 (37.50%)
10 (45.45%)

1.58 (0.584.25)
2.12 (0.775.79)
1.83 (0.913.63)

0.447
0.168
0.094

26 (44.07%)

22 (37.29%)

11 (18.64%)

74 (62.71%)

44 (37.29%)

1.54 (0.952.49)

0.081

15 (51.72%)
11 (36.67%)

8 (27.59%)
14 (46.67%)

6 (20.69%)
5 (16.66%)

38 (65.52%)
36 (60.00%)

20 (34.48%)
24 (40.00%)

1.39 (0.692.81)
1.69 (0.853.35)
1.54 (0.952.49)

0.414
0.143
0.082

140

59
29 (49.15%)
30 (50.85%)

41.54
31.39

OR: odd ratio; CI: confidence interval.

586

archives of oral biology 58 (2013) 583589

Table 3 XRCC1 codon 280 polymorphisms in ameloblastoma patients and control subjects.
Groups

No. of
samples

Ave.
age

XRCC1 genotypes [n (%)]

Arg
Controls
Sex
Male
Female
Ameloblastomas
Sex
Male
Female
Adjust OR
Clinical types
Unicystic type
Sex
Male
Female
Adjust OR
Conventional type
Sex
Male
Female
Adjust OR

Hetero

Allele frequency [n (%)]

His

Allelic test
OR
(95% CI)

p value

G/G

G/A

A/A

30.8

103 (73.57%)

31 (22.14%)

6 (4.29%)

237 (84.64%)

43 (15.36%)

Ref.

71 (50.71%)
69 (49.29%)

29.9
31.43

56 (78.87%)
47 (68.12%)

11 (15.49%)
20 (28.99%)

4 (5.63%)
2 (2.90%)

123 (86.62%)
114 (82.61%)

19 (13.38%)
24 (17.39%)

Ref.
Ref.

82

35.96

58 (70.73%)

21 (25.61%)

3 (3.66%)

137 (83.54%)

27 (16.46%)

1.09 (0.621.89)

0.862

41 (50%)
41 (50%)

41.54
31.39

29 (70.73%)
29 (70.73%)

9 (21.95%)
12 (29.27%)

3 (7.32%)
0 (0.00%)

67 (81.71%)
70 (85.37%)

15 (18.29%)
12 (14.63%)

1.45 (0.653.22)
0.81 (0.361.83)
1.09 (0.621.89)

0.427
0.729
0.864

23

35.96

15 (65.22%)

7 (30.43%)

1 (4.35%)

37 (80.43%)

9 (19.57%)

1.34 (0.563.15)

0.613

12 (52.17%)
11 (47.83%)

41.54
31.39

9 (75.00%)
6 (54.55%)

2 (16.67%)
5 (45.45%)

1 (8.33%)
0 (0.00%)

20 (83.33%)
17 (77.27%)

4 (16.67%)
5 (22.73%)

1.29 (0.334.63)
1.40 (0.404.57)
1.35 (0.563.17)

0.911
0.76
0.606

43 (72.88%)

14 (23.73%)

2 (3.39%)

100 (84.75%)

18 (15.25%)

0.99 (0.521.87)

0.899

19 (65.52%)
24 (80.00%)

8 (27.59%)
6 (20.00%)

2 (6.89%)
0 (0.00%)

46 (79.31%)
54 (90.00%)

12 (20.69%)
6 (10.00%)

1.69 (0.714.01)
0.53 (0.181.46)
0.99 (0.521.87)

0.279
0.263
0.898

140

59
29 (49.15%)
30 (50.85%)

41.54
31.39

OR: odd ratio; CI: confidence interval.

Table 4 XRCC1 codon 399 polymorphisms in ameloblastoma patients and control subjects.
Groups

Controls
Sex
Male
Female
Ameloblastomas
Sex
Male
Female
Adjust OR
Clinical types
Unicystic type
Sex
Male
Female
Adjust OR
Conventional type
Sex
Male
Female
Adjust OR

No. of
samples

140

Ave.
age

30.8

XRCC1 genotypes [n (%)]


Arg

Hetero

Gln

G/G

G/A

A/A

77 (55.00%) 52 (37.14%) 11 (7.86%)

71 (50.71%) 29.9 47 (66.20%) 20 (28.17%)


69 (49.29%) 31.43 30 (43.48%) 32 (46.38%)

Allele frequency [n (%)] Allelic test OR (95% CI) p value


G

206 (73.57%) 74 (26.43%) Ref.

4 (5.63%) 114 (80.28%) 28 (19.72%) Ref.


7 (10.14%) 92 (66.67%) 46 (33.33%) Ref.

82

35.96 27 (32.93%) 45 (54.88%) 10 (12.20%)

99 (60.37%) 65 (39.63%) 1.83 (1.192.81)

0.005

41 (50%)
41 (50%)

41.54 16 (39.02%) 21 (51.22%)


31.39 11 (26.83%) 24 (58.54%)

4 (9.76%)
6 (14.63%)

53 (64.63%) 29 (35.37%) 2.23 (1.154.31)


46 (56.10%) 36 (43.90%) 1.57 (0.862.85)
1.84 (1.192.84)

0.015
0.154
0.005

23

35.96

8 (34.78%) 15 (65.22%)

0 (0.00%)

31 (67.39%) 15 (32.61%) 1.35 (0.652.76)

0.488

5 (41.67%)
4 (36.36%)

0 (0.00%)
0 (0.00%)

17 (70.83%)
15 (68.18%)

0.435
0.917
0.677

12 (52.17%) 41.54
11 (47.83%) 31.39

59
29 (49.15%) 41.54
30 (50.85%) 31.39

OR: odd ratio; CI: confidence interval.

7 (58.33%)
7 (63.64%)

19 (32.20%) 30 (50.85%) 10 (16.95%)


9 (31.04%) 16 (55.17%)
8 (26.67%) 16 (53.33%)

4 (13.79%)
6 (20.00%)

7 (29.17%) 1.68 (0.574.84)


7 (31.82%) 0.93 (0.322.66)
1.23 (0.582.58)

68 (57.63%) 50 (42.37%) 2.05 (1.273.30

0.002

34 (58.62%) 24 (41.38%) 2.87 (1.405.91)


32 (53.33%) 28 (46.67%) 1.75 (0.903.40)
2.19 (1.363.56)

0.002
0.104
0.001

587

archives of oral biology 58 (2013) 583589

Table 5 OR (95% CI) of genotypic frequency at codon 194,


280 and 399 of XRCC1 in ameloblastoma patients and
control subjects.
Codon

Genotype

OR (95% CI)

p value

194

TT
CT

2.20 (0.95.41)
1.19 (0.662.14)

0.092
0.645

280

AA
GA

0.85 (0.163.96)
1.21 (0.612.40)

0.901
0.671

399

AA
AG

1.63 (0.614.37)
2.06 (1.143.72)

0.407
0.015

3.3.

Haplotype analysis

Haplotype analysis of SNP at codons 194, 280 and 399 was


performed. Haplotype GGT, AGC and GGC were found as major
haplotypes as shown in Table 6. GGC was found as protective
haplotype, and this frequency haplotype in ameloblastoma
was 21.62% whereas in controls, this was 37.61%, p = 0.0005.
Furthermore, the minor allele haplotype (AGT) was found as
risk haplotype, with a frequency in ameloblastoma of 10.37%,
and 2.87% ( p = 0.0009) in controls (Table 6).

3.4.

Model of inheritance

Model of inheritance in each of the three codons of XRCC1


were analysed as following.
At codon 194, when the mode of inheritance was dominant,
the OR (95% CI) of CC or CT was 1.66 (0.923.00), sex adjusted 1.66
(0.923.01). When the mode of inheritance was recessive, the OR
(95% CI) of TT was 2.61 (0.885.33), sex adjusted 2.20 (0.905.41).
For codon 280, when the mode of inheritance was
dominant, the OR (95% CI) of AA or AG was 1.15 (0.602.20),
sex adjusted 1.15 (0.602.21). When the mode of inheritance
was recessive, the OR (95% CI) of AA was 0.85 (0.163.96), sex
adjusted 0.85 (0.164.04).
For codon 399, when the mode of inheritance was
dominant, the OR (95% CI) of AA or AG was 2.49 (1.364.58),
sex adjusted 2.55 (1.384.79). When the mode of inheritance
was recessive, the OR (95% CI) of AA was 1.63 (0.614.37).

3.5.
Distribution of PCR density band of heterozygous
samples
To confirm that there was no mosaisicm from the oral
epithelium and adjacent connective tissue, we randomly

Table 6 Haplotype analysis showing the protective and


risk haplotypes for ameloblastoma.
Haplotype

AAT
GAT
AGT
GGT
AAC
GAC
AGC
GGC

Haplotype frequency
Ameloblastomas

Healthy controls

NA
0.0302
0.1037
0.2502
0.0274
0.1071
0.2653
0.2162

NA
0.0273
0.0287
0.2226
0.0166
0.1097
0.219
0.3761

p value

0.0022
0.8581
0.0009
0.5063
0.4401
0.9315
0.2681
0.0005

Table 7 Density average, standard deviation and


coefficient variation of heterozygous samples at codon
194, 280 and 399.
Density
average (%)

Standard
deviation

Coefficient of
variance (%)

66.7
19.58
13.71

1.7
1.64
1.35

2.55
8.36
9.85

34.09
33.2
32.7

1.38
2.13
2.49

4.04
6.4
7.61

37.81
32.19
30

1.29
1.3
1.95

3.4
4.05
6.51

Codon 194
C band
T band at 91 b.p.
T band at 40 b.p.
Codon 280
A band
G band at 70 b.p.
G band at 63 b.p.
Codon 399
A band
G band at 94 b.p.
G band at 48 b.p.

measured the percentage of density of 3 PCR band from 35


heterozygous samples at codon 194 (C, T at 40 b.p. and T at 91
b.p.), 21 heterozygous samples at codon 280 (A, G at 63 b.p. and
G at 70 b.p.) and 15 heterozygous samples at codon 399 (A, G at
48 b.p. and G at 94 b.p.). At codon 194, the % coefficient of
variance (CV) of C band, T band at 40 b.p. and T band at 91 b.p.
were 2.55, 8.36 and 9.85, respectively. At codon 280, the % CV of
A band, G band at 63 b.p. and G band at 70 b.p. were 4.04, 6.40
and 7.61, respectively. Finally, at codon 399, the % CV of A
band, G band at 48 b.p. and G band at 94 b.p. were 3.40, 4.05 and
6.51, respectively. The density average, standard deviation
(SD) and % CV of each band were shown in Table 7.

4.

Discussion

Early-stage ameloblastoma is difficult to diagnose because it


displays mild or nonspecific clinical symptoms. Hence, the
analysis of potential genetic risk factors for the prediction of
ameloblastoma in patients without clinical symptoms is likely
to be a valuable diagnostic strategy. In our previous study, we
revealed a significant association between ameloblastoma
and polymorphism of p53 at codon 72.22 Not only Arg allele of
P53 at codon 72, CGG8 repeat allele of PTCH1 can also be the
risk for ameloblastoma.22,23 In this study, we found a
significant association between ameloblastoma and XRCC1
polymorphism. XRCC1 gene encodes XRCC1 protein, playing
an important role in BER pathway.
BER pathway is important for keeping stability of cells,
essentially by removing small damaged bases from the
genome and replace with normal bases. Several proteins
are responsible for BER including XRCC1 playing a crucial
role in this process. XRCC1 essentially acts as a scaffold
protein which can bind to many other proteins in the
repair process, and these include DNA polymerase b, APE1,
ligase III, PARP1 and PARP2.12 Many studies have focused
on 3 polymorphisms in XRCC1, codon 194, 280 and 399.
Codon 194 lies at the N-terminal, and readily binding with
DNA polymerase b,24,25 while codon 399 lies within the
BRCT1 domain and binding with APE1, PARP1 and
PARP2.26,27 Hence, polymorphism at these codons might
be expected to impact the function and the ability to

588

archives of oral biology 58 (2013) 583589

interact with these proteins. In contrast, codon 280 lies


between the N-terminal and BRCT1 domain, and with
function that remains unknown. Here, we studied polymorphism of XRCC1 at codons 194, 280 and 399. Interestingly, we found significant association between allele risk
at codon 194 (T) and 399 (A), and ameloblastoma. Moreover,
the 399 allele A was prominent associated with the
conventional type of ameloblastoma rather than the
unicystic type. We also found that genotype AG (Arg/Gln)
at codon 399 was the risk genotype in ameloblastoma,
whereas genotype TT (Trp/Trp) and CT (Arg/Trp) at codon
194 were trend to be genotypic risks in ameloblastoma. In
this context, many studies have shown the association of
codon 399 polymorphism, and cancer risk in Asian
populations such as lung cancer in Korean,28 oesophageal
squamous cell carcinoma (ESCC) in Chinese,29 and gastric
cancer in Chinese.30 Importantly, some studies have found
that codon 399 of XRCC1 was related to the risk to cancer in
Asian and Western population.31,32
Association studies of codon 194 have been controversial,
with some indicating that T allele was a risk factor in cancer
while others revealed that T was the protective allele.17,33 In
our study, we found that T was the risk allele of ameloblastoma. Moreover, we found the genotype TT and CT with an
increased risk, although this was not statistically significant.
At codon 280, frequency of allele T is low (0.13 in Asians and
0.07 in Caucasians).20 This may be due to limitation of the
sample size of our study, and hence we cannot find significant
association between allele T as susceptibility allele and
ameloblastoma. In our study, we suggest that allele T at
codon 194 and allele A at codon 390 might be the risk allele of
ameloblastoma. In addition, from our data suggest that
genotype AG at codon 399 could be genotypic risk, but we
cannot conclude that CT or TT at codon 194 as the genotypic
risks. We conclude that XRCC1 SNP at codon 399 is more
influential than at codon 194 in ameloblastoma in Thai
population.
Finally, the data from haplotype analysis of the three
codons, we found both protective and risk haplotype. GGC was
found as protective haplotype whereas AGT was found as risk
haplotype. We noted that both protective and risk haplotype
consisted of allele G at codon 280, and therefore likely
confirming that codon 280 was not involved in ameloblastoma
in Thai population. Taken together, we conclude that XRCC1
could be one of the useful molecular markers for ameloblastoma diagnosis in Thai population.

Funding
This study was financially supported by Research Chair Grant
2011 from the National Science and Technology Development
Agency (NSTDA), Thailand, TRF-MRG young scientific researcher grant No. MRG 5380010, and research fund from the
Faculty of Science, Chulalongkorn University.

Competing interests
The authors declare that they have no conflict of interest.

Ethical approval
The research protocol was approved by the Institutional
Review Board of the Faculty of Medicine, Chulalongkorn
University (IRB 093/54).

Acknowledgements
The authors thank Mr. Dusit Bumalee for help in preparing the
tissue samples and Dr. Viomesh Patel (NIDCR/NIH) for
critically reviewing the manuscript.

references

1. Fernandes AM, Duarte EC, Pimenta FJ, Souza LN, Santos VR,
Mesquita RA, et al. Odontogenic tumors: a study of 340 cases
in a Brazilian population. Journal of Oral Pathology and
Medicine 2005;34(10):5837.
2. Ladeinde AL, Ajayi OF, Ogunlewe MO, Adeyemo WL, Arotiba
GT, Bamgbose BO, et al. Odontogenic tumors: a review of 319
cases in a Nigerian teaching hospital. Oral Surgery Oral
Medicine Oral Pathology Oral Radiology and Endodontics
2005;99(2):1915.
3. Luo HY, Li TJ. Odontogenic tumors: a study of 1309 cases
in a Chinese population. Oral Oncology 2009;45(8):
70611.
4. Ebenezer V, Ramalingam B. A cross-sectional survey of
prevalence of odontogenic tumours. Journal of Maxillofacial
and Oral Surgery 2010;9(4):36974.
5. Osterne RL, Brito RG, Alves AP, Cavalcante RB, Sousa FB.
Odontogenic tumors: a 5-year retrospective study
in a Brazilian population and analysis of 3406 cases
reported in the literature. Oral Surgery Oral Medicine Oral
Pathology Oral Radiology and Endodontics 2011;111(4):
47481.
6. Barnes L, Reichart EJ, Sidransky PD. World Health Organization
classification of tumours. Pathology and genetics of head and neck
tumours. Lyon: IARC Press; 2005.
7. Mendenhall WM, Werning JW, Fernandes R, Malyapa RS,
Mendenhall NP. Ameloblastoma. American Journal of Clinical
Oncology 2007;30(6):6458.
8. Reichart PA, Philipsen HP, Sciubba JJ. The new classification
of head and neck tumours (WHO)any changes? Oral
Oncology 2006;42(8):7578.
9. Carlson ER, Marx RE. The ameloblastoma: primary, curative
surgical management. Journal of Oral and Maxillofacial Surgery
2006;64(3):48494.
10. Eckardt AM, Kokemuller H, Flemming P, Schultze A.
Recurrent ameloblastoma following osseous
reconstructiona review of twenty years. Journal of CranioMaxillo-Facial Surgery 2009;37(1):3641.
11. Abiko Y, Nagayasu H, Takeshima M, Yamazaki M,
Nishimura M, Kusano K, et al. Ameloblastic carcinoma
ex ameloblastoma: report of a case-possible involvement
of CpG island hypermethylation of the p16 gene in
malignant transformation. Oral Surgery Oral Medicine Oral
Pathology Oral Radiology and Endodontics 2007;103(1):
726.
12. Hoeijmakers JH. Genome maintenance mechanisms for
preventing cancer. Nature 2001;411(6835):36674.
13. Li Y, Marion MJ, Zipprich J, Freyer G, Santella RM, Kanki C,
et al. The role of XRCC1 polymorphisms in base excision
repair of etheno-DNA adducts in French vinyl chloride

archives of oral biology 58 (2013) 583589

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

workers. International Journal of Occupational Medicine and


Environmental Health 2006;19(1):4552.
Yin G, Morita M, Ohnaka K, Toyomura K, Hamajima N,
Mizoue T, et al. Genetic polymorphisms of XRCC1, alcohol
consumption, and the risk of colorectal cancer in Japan.
Journal of Epidemiology 2012;22(1):6471.
Schneider J, Classen V, Helmig S. XRCC1 polymorphism and
lung cancer risk. Expert Review of Molecular Diagnostics
2008;8(6):76180.
Roszak A, Lianeri M, Jagodzinski PP. Involvement of the
XRCC1 Arg399Gln gene polymorphism in the development
of cervical carcinoma. International Journal of Biological
Markers 2011;26(4):21620.
Wang C, Sun Y, Han R. XRCC1 genetic polymorphisms and
bladder cancer susceptibility: a meta-analysis. Urology
2008;72(4):86972.
Xue H, Ni P, Lin B, Xu H, Huang G. X-ray repair crosscomplementing group 1 (XRCC1) genetic polymorphisms
and gastric cancer risk: a HuGE review and meta-analysis.
American Journal of Epidemiology 2011;173(4):36375.
Wei B, Zhou Y, Xu Z, Ruan J, Zhu M, Jin K, et al. XRCC1
Arg399Gln and Arg194Trp polymorphisms in prostate
cancer risk: a meta-analysis. Prostate Cancer and Prostatic
Diseases 2011;14(3):22531.
Qu T, Morimoto K. X-ray repair cross-complementing group
1 polymorphisms and cancer risks in Asian populations: a
mini review. Cancer Detection and Prevention 2005;29(3):
21520.
Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MA,
Bender D, et al. PLINK: a tool set for whole-genome
association and population-based linkage analyses.
American Journal of Human Genetics 2007;81(3):55975.
Kitkumthorn N, Yanatatsaneejit P, Rabalert J,
Dhammawipark C, Mutirangura A. Association of P53 codon
72 polymorphism and ameloblastoma. Oral Diseases
2010;16(7):6315.
Kawabata T, Takahashi K, Sugai M, Murashima-Suginami A,
Ando S, Shimizu A, et al. Polymorphisms in PTCH1 affect
the risk of ameloblastoma. Journal of Dental Research
2005;84(9):8126.

589

24. Marintchev A, Robertson A, Dimitriadis EK, Prasad R, Wilson


SH, Mullen GP. Domain specific interaction in the XRCC1
DNA polymerase beta complex. Nucleic Acids Research
2000;28(10):204959.
25. Bhattacharyya N, Banerjee S. A novel role of XRCC1 in the
functions of a DNA polymerase beta variant. Biochemistry
2001;40(30):900513.
26. Schreiber V, Ame JC, Dolle P, Schultz I, Rinaldi B, Fraulob V,
et al. Poly(ADP-ribose) polymerase-2 (PARP-2) is required for
efficient base excision DNA repair in association with PARP1 and XRCC1. Journal of Biological Chemistry
2002;277(25):2302836.
27. Vidal AE, Boiteux S, Hickson ID, Radicella JP. XRCC1
coordinates the initial and late stages of DNA abasic site
repair through proteinprotein interactions. EMBO Journal
2001;20(22):65309.
28. Park JY, Lee SY, Jeon HS, Bae NC, Chae SC, Joo S, et al.
Polymorphism of the DNA repair gene XRCC1 and risk of
primary lung cancer. Cancer Epidemiology Biomarkers and
Prevention 2002;11(1):237.
29. Yu HP, Zhang XY, Wang XL, Shi LY, Li YY, Li F, et al. DNA
repair gene XRCC1 polymorphisms, smoking, and
esophageal cancer risk. Cancer Detection and Prevention
2004;28(3):1949.
30. Shen H, Xu Y, Qian Y, Yu R, Qin Y, Zhou L, et al.
Polymorphisms of the DNA repair gene XRCC1 and risk of
gastric cancer in a Chinese population. International Journal
of Cancer 2000;88(4):6016.
31. Zhou W, Liu G, Miller DP, Thurston SW, Xu LL, Wain JC, et al.
Polymorphisms in the DNA repair genes XRCC1 and ERCC2,
smoking, and lung cancer risk. Cancer Epidemiology
Biomarkers and Prevention 2003;12(4):35965.
32. Divine KK, Gilliland FD, Crowell RE, Stidley CA, Bocklage TJ,
Cook DL, et al. The XRCC1 399 glutamine allele is a risk
factor for adenocarcinoma of the lung. Mutation Research
2001;461(4):2738.
33. Chen S, Tang D, Xue K, Xu L, Ma G, Hsu Y, et al. DNA repair
gene XRCC1 and XPD polymorphisms and risk of lung
cancer in a Chinese population. Carcinogenesis
2002;23(8):13215.