You are on page 1of 10

Food Microbiology 33 (2013) 252e261

Contents lists available at SciVerse ScienceDirect

Food Microbiology
journal homepage: www.elsevier.com/locate/fm

Analysis of bacterial diversity during the fermentation of inyu, a high-temperature
fermented soy sauce, using nested PCR-denaturing gradient gel electrophoresis
and the plate count method
Chia-Li Wei a, Shiou-Huei Chao b, Wen-Bin Tsai a, Pei-Shan Lee a, Nai-Hung Tsau a, Jhih-Shan Chen a,
Wen-Lin Lai c, James Ching-Yueh Tu d, Ying-Chieh Tsai b, *
a

Department of Biochemical Science and Technology, National Chiayi University, Chiayi City 60004, Taiwan
Institute of Biochemistry and Molecular Biology, National Yang-Ming University, Taipei City 11221, Taiwan
School of Medical Laboratory and Biotechnology, Chung Shan Medical University, Taichung City 40201, Taiwan
d
San Ying Foods Co., Ltd., Chiayi County 62151, Taiwan
b
c

a r t i c l e i n f o

a b s t r a c t

Article history:
Received 20 September 2011
Received in revised form
14 July 2012
Accepted 2 October 2012
Available online 9 October 2012

The diversity of bacteria associated with the fermentation of inyu, also known as black soy sauce, was
studied through the nested PCR-denaturing gradient gel electrophoresis (DGGE) of samples collected
from the fermentation stages of the inyu production process. The DGGE profiles targeted the bacterial 16S
rDNA and revealed the presence of Citrobacter farmeri, Enterobacter cloacae, Enterobacter hormaechei,
Enterococcus faecium, Klebsiella pneumoniae, Pantoea agglomerans, Salmonella enterica, Serratia marcescens, Staphylococcus sciuri and Weissella confusa. The bacterial compositions of 4 fermented samples were
further elucidated using the plate count method. The bacteria isolated from the koji-making stage
exhibited the highest diversity; Brachybacterium rhamnosum, E. hormaechei, K. pneumoniae, Kurthia
gibsonii, Pantoea dispersa, Staphylococcus gallinarum, Staphylococcus kloosii and S. sciuri were identified.
Koji collected during the preincubation stage presented the largest cell counts, and E. hormaechei,
K. pneumoniae, E. cloacae and Enterobacter pulveris were identified. In brine samples aged for 7 and 31
days, the majority of the bacteria isolated belonged to 4 Bacillus species, but 4 Staphylococcus species and
Delftia tsuruhatensis were also detected. This study demonstrates the benefits of using a combined
approach to obtain a more complete picture of microbial populations and provides useful information for
the control or development of bacterial flora during inyu fermentation.
Ó 2012 Elsevier Ltd. All rights reserved.

Keywords:
inyu
Soy sauce
Bacterial diversity
Nested PCR-DGGE
16S rDNA

1. Introduction
Soy sauce is a traditional fermented seasoning in Asia. The
common method used to produce soy sauce is soaking soybeans in
water, steaming them, and then mixing them with baked wheat
flour. The mixture is then inoculated with Aspergillus oryzae or
Aspergillus sojae and incubated at 25e30  C for 2e3 days, in
a process known as koji making. Subsequently, the koji is mixed
with a high concentration of salty water to obtain brine with a final
concentration of 22e23% salt. The mixture is then aged at room
temperature for 6e12 months (Huang and Teng, 2004; Su et al.,
2005; Ko et al., 2009). Generally, soy sauces are divided into

* Corresponding author. Tel.: þ886 2 2826 7125; fax: þ886 2 2826 4843.
E-mail address: tsaiyc@ym.edu.tw (Y.-C. Tsai).
0740-0020/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.fm.2012.10.001

Chinese and Japanese types. The main difference between these
two types is that the former uses soybeans as the only ingredient,
whereas the latter uses soybeans and wheat (Lioe et al., 2010). Inyu,
black soy sauce, is another traditional type of soy sauce from
Taiwan that has special properties due to enhanced flavors during
cooking (Chen, 1975). The traditional means of producing inyu also
consists of koji and brine fermentation steps, as used for soy sauce,
but the production process has several differences and additional
steps compared with soy sauce (Chen, 1975). Inyu uses black
soybeans as the only ingredient or as the main ingredient accompanied by 1e4% of baked flour. The koji for making inyu is incubated
at 32e33  C for 5e7 days. The koji is then washed to remove spores
from the surfaces of the soybeans in a process known as koji
washing, which is carried out to avoid flavor impairment. Subsequently, the koji is incubated at 43  C for 3e8 h to promote the
enzymatic digestion of the ingredients. The resultant koji is then

Ltd. 1 month (1M). 2010). The temperature of the fermented brine just under the top layer of NaCl. culture-independent approaches that apply molecular techniques based on the direct detection of DNA or RNA in microbial ecosystems are particularly attractive for studying microbial population dynamics both reliably and rapidly. this is the first report to reveal the bacterial diversity associated with inyu production.85% NaCl) using a mortar and pestle. 25. 2 month (2M). denaturing gradient gel electrophoresis (DGGE) analysis is one of the most widely applied molecular techniques (Muyzer et al. However. Because there are increasing demands from the consumers and producers of fermented foods for high-quality products that are free from bacterial contaminants. Forty-milliliter aliquots of either the resulting filtrates or the outdoor-aged brines were centrifuged individually at 10. the resultant mixture is aged outdoors without stirring for 2e4 months with exposure to sunlight.. 1 week (1W). The samples were then passed through 4 layers of sterilized cheesecloth. Salt-resistant yeasts. 28.. 40 g of the koji samples were homogenized in 40 mL of sterile saline (0. September. produces extracellular enzymes that hydrolyze the proteins and carbohydrates of the ingredients that are involved in the brine fermentation (Lioe et al. However. Recently. during which the average monthly temperatures were 29. 2004). there are various types of microorganisms living in the fermentation medium that are responsible for the unique flavors and tastes of the soy sauce. which appeared to contain all bands of all brine samples in DGGE profiles. 1. 2010). 2004). 1993). / Food Microbiology 33 (2013) 252e261 mixed with salt. The isolates were grouped and identified on the basis of their genotypic characteristics. Wei et al.6  C in July. are associated with decreases in the brine pH. To the best of our knowledge. such as Zygosaccharomyces rouxii. sojae. 3 month (3M) and 4 month (4M) were collected (Fig.000  g for 10 min. grow during the early stage of brine fermentation and produce lactic acid that acidify the brine (Huang and Teng.-L. However. such as Torulopsis versatilis. Lee et al.9  C. One milliliter of the concentrated cells was aliquoted for DNA Black soybean Soaking 4 hours Steaming Aspergillus oryzae (108-9 spore/1 kg soybean) Mixing Room temperature 6 days 7 days Baked rice bran (10 g/1 kg soybean) Sample KM Koji Washing Incubating 45–50 °C 95% humidity 8 hours 6 hours Sample PI Koji (750 kg) Water (380 kg) Mixing NaCl (180 kg) Covering Covering Aging 1 day 1 week Outdoor Sunlight 4 months 2 weeks Sample 1D Sample 1W Sample 2W 1 month Sample 1M 2 months Sample 2M 3 months Sample 3M Inyu brine Sample 4M Fig. The aim of this study was to investigate bacterial communities that were either contributively or undesirably associated with the process of inyu fermentation by using a combination of culturedependent and culture-independent methods. respectively. Among these methods. The cell pellets were suspended in 2 mL of sterile saline. were subjected to further evaluation of their bacterial diversities using the plate count method. Both koji samples and 2 brine samples. as determined by randomly amplified polymorphic DNA (RAPD) and 16S rDNA sequencing. the molds that the koji is inoculated with during koji fermentation. loaded in a vat with salty water and covered with a layer of salt. Solid koji samples from the koji making (KM) and preincubation (PI) stages and brine samples from the outdoor aging stages at 1 day (1D). Halophilic lactic acid bacteria (LAB). The manufacturing process is shown in Fig. 1.. the competition of the Bacillus species with the molds decreases the production of amylases and proteases. As a result. Finally. On the same day. The traditional approach for studying the diversity of a microbial community consists of isolating and enumerating microbial groups by growing them on various selective culture media and identifying the predominant populations using phenotypic and molecular techniques.C. the GC-clamped primers used in such analyses present sensitivity limitations when targeting lowabundance samples in natural environments (Vanbroekhoven et al.3  C. October and November. was approximately 41  C. resulting in a 20-fold concentration of the cells. and are capable of alcoholic fermentation and the hydrolysis of various amino acids into their respective alcohols during the middle stage of brine fermentation (Huang and Teng. Salt-tolerant yeasts. which was measured at 16:00 on a sunny day in July 2009.0  C and 21. 2004). produce odor compounds during the maturation stage of brine fermentation (Huang and Teng.1. Chiayi County. The samples were fermented from July to November 2009. 1998). such as Tetragenococcus halophilus. 253 2. Because of the nonsterile nature of koji making. The production diagram of inyu used in this study with the sampling points indicated. 28. 2004). in addition to being laborious and time intensive. 2 week (2W). . 2004). Taiwan. Bacillus subtilis and Bacillus mesentericus also contribute to the production of odor compounds and create a more complex flavor during brine aging (Huang and Teng.. grow rapidly.. it is necessary to understand and control the changes in bacterial flora that occur during the fermentation process. 2009.7  C. Sampling procedures Fermented samples were collected from the San Ying Foods Co. rendering the bacteria as undesirable contaminants of koji (Takazane et al. this drawback has been addressed to assess the microbial diversity of fermented soybean foods by using nested PCR combined with DGGE (Kim et al.. A. Nested PCR-DGGE of the V6eV8 regions of the bacterial 16S rDNA was used to monitor the diversity of the bacterial populations that are associated with the 9 stages of inyu fermentation... oryzae or A. August. Materials and methods 2. 1) in sterile bottles and transported to the laboratory at room temperature within 1 h. these culture-dependent approaches will not identify strains or species that cannot grow on regular nutrient media.

1996 Primer name Primer sequence Target A 8 OPL-05 8F 520F 930F 15R 520R 800R F-968 Bac-1492R-II CCGCAGCCAA ACGCGCCCT ACGCAGGCAC AGAGTTTGATCMTGGCTCAG CAGGAGTGCCAGCAGCCGCGG GCACAAGCGGTGGAGCATGTGG AAGGAGGTGATCCAACCGCA ACCGCGGCTGCTGGC CAGGACTACCAGGGTATCTAAT AACGCGAAGAACCTTAC ACGGYTACCTTGTTACGCGACTT CGCCCGGGGCGCGCCCCGGGCG GGGCGGGGGCACGGGGGGAACG CGAAGAACCTTAC CGGTGTGTACAAGACCC F-968-GC R-1401 a Escherichia coli numbering system. The other 1 mL of concentrated cells was mixed with 1 mL of sterile saline and centrifuged again. The DNA was re-amplified using the GC-clamp primers as described above and run on another DGGE gel for further separation with a narrower gradient range. 2008). 2008 Chao et al.5 mM EDTA. and OPL-05 (Table 1). The samples were applied to 10% (w/v) polyacrylamide gels in TAE buffer (20 mM Tris. 5 cycles of 94  C for 30 s. 2. 29 cycles of 94  C for 20 s. The plates were incubated at 30  C for 2e3 days. The pellets were resuspended in 2 mL of Nutrient Broth (NB.l. The bands were excised. Positiona Reference Genomic DNA Genomic DNA Genomic DNA Bacterial 16S rDNA Bacterial 16S rDNA Bacterial 16S rDNA Bacterial 16S rDNA Bacterial 16S rDNA Bacterial 16S rDNA Bacterial 16S rDNA Bacterial 16S rDNA 8e27 515e530 933e954 1541e1522 531e517 804e787 968e985 1514e1492 Chao et al.. The refractometer measures the concentration of salts such as sodium chloride.. DNA extraction Genomic DNA was extracted as previously described (Chao et al. 36  C for 1 min and 72  C for 90 s. Subsequently. Japan) after a 5-fold dilution. v/v).4) and 1 volume of isopropanol. air-dried and finally dissolved in 30 mL of sterile TE buffer (TriseEDTA. except that 20 ng of DNA template and 2 U of Taq polymerase (Takara Bio Inc.. pH 8.. Following another centrifugation step. 36  C for 30 s and 72  C for 90 s. Taipei.254 C. Ai-On Industrial Corp. MD. The products of the nested PCR amplification were analyzed by DGGE using a Dcode apparatus (Bio-Rad Laboratories s. with the following modifications.-L. these stocks were then stored at 80  C. USA) containing 10% dimethyl sulfoxide (DMSO). Japan) were used. w/v). 2. The salt concentrations (g/100 g) of the brine samples were measured with a digital salinity refractometer (model PAL-03S. 2009 Chao et al. Shiga.. the DNA was washed with 70% ethanol.6. Briefly.. 10% or 15%. and 100 mL of the appropriate dilution was plated on NB agar supplemented with cycloheximide (100 mg/mL) alone or with cycloheximide plus NaCl (5%. The PCR products were then sequenced by using the primer F-968 (Table 1 and Fig. DNA was visualized by UV illumination after the gels were stained in TAE buffer containing ethidium bromide and destained in TAE buffer. Italy). 6 2. cells from 200 mL of overnight cultures of pure isolates (for RAPD fingerprinting).2. resulting in a 10-fold concentration of the cells.. magnesium and calcium sulfates in liquids. Selected bands from the PCR-DGGE gel were excised using a clean scalpel blade. / Food Microbiology 33 (2013) 252e261 extraction... Parallel electrophoresis experiments were performed at 60  C using gels containing a 30e65% urea-formamide denaturing gradient (100% corresponded to 7 M urea and 40% [w/v] formamide). The samples were incubated at 65  C for 20 min with occasional inversions... the pellets were suspended in NB containing 10% DMSO and stored at 80  C.. . pH 5. Microbial enumeration and isolation The 10-fold-concentrated cells were serially diluted (100 to 10 ) in saline. positions 968 to 1514 in the Escherichia coli numbering system) were generated by PCR amplification of genomic DNA extracted from fermented samples using the primers F-968 and Bac-1492R-II (Table 1 and Fig. An equal amount of phenol was added and inverted before centrifugation for 5 min at 12.. pH 9.. and the DNA was re-amplified using the same primer set without the GC-clamp under the same PCR conditions. PCR-DGGE analysis Fragments of the bacterial 16S rDNA (547 bp. Ltd. and Table 1 Primers used in this study. Taiwan).. the supernatant was mixed with 0. and DNA was eluted in 30 mL of sterile TE buffer by incubation at 4  C overnight.. Wei et al.000  g. The cycling program consisted of 1 cycle of 94  C for 2 min. 2008 Chao et al. 80 mM EDTA. Nested PCR was performed as previously described (Manninen et al. 1991 Bacterial 16S rDNA 968e985 Nubel et al.5.r. 8.0) and stored at 20  C. pH 8. 10 mM acetate and 0.4. 2008 Johansson et al. Atago Co.. BD Difco. followed by cooling at room temperature for 10 min.. The isolates were cultured in NB at 30  C for 1e2 days and were then washed with saline.. 1996 Weisburg et al. 2008 Nubel et al. 2) to create a DNA fragment suitable for DGGE analysis. Milan. 1995 Holzapfel et al. with some modifications. 2. 2008 Chao et al. Each slice was sectioned and placed in an Eppendorf tube. 2) under the PCR conditions described previously (Chao et al. The random primers used in this analysis were primers A. RAPD fingerprints RAPD-PCR analysis was performed as previously described (Chao et al. After centrifugation.. 2. 1997 Chao et al.0) and 50 mL of 10% sodium dodecyl sulfate. After centrifugation. 2). the PCR product was used as a template for a nested PCR amplification that targeted the segment of the bacterial 16S rDNA from nucleotide positions 968 to 1401 using the DGGE primers F-968-GC and R-1401 (Table 1 and Fig. for each reaction. The supernatant was collected and mixed with 1 volume of phenole chloroformeisoamyl alcohol (25:24:1. 1996 Bacterial 16S rDNA 1401e1385 Nubel et al.. 2006).3. 2008). 2008 Chao et al.0).1 volume of sodium acetate (3 M. 2008).. Analyses of pH and salt concentration The pH values of the brine samples were measured with a DO Microelectronic pH-Vision pH meter (model PHB-9901. from a piece of agar containing a pure isolate (for RAPD fingerprinting) or from 200 mL of the 20-fold-concentrated cells from the collected samples (for PCR-DGGE analysis) were added to 250 mL of lysis buffer (200 mM TriseHCl.

for which corresponding bands were found in all of the brine samples shown in Fig.57 5. coli numbering system. with sequences homologous to sequences of Serratia Table 2 The bacterial counts.98 5. 3b.4 38 5. H.79 e e 8. H1e2. In the subsequent DGGE analysis (Fig. and the V6eV8 regions of the bacterial 16S rDNA were amplified to yield nested PCR products for the characterization of bacterial diversity using DGGE on a 30e65% denaturing gradient gel (Fig. / Food Microbiology 33 (2013) 252e261 8F 3. The secondary DGGE fingerprint. they cannot be separated by this DGGE condition. In addition to analysis on the 50e70% gel. 12e13.7  107 and 1. Re-amplified products of these bands were thus applied to further separation by a second round of DGGE analysis with 3 narrow ranges of denaturing gradient gels.25 5. to confirm the origin of these reamplified products.34 e e 7.C. The initial brine samples of 1W and 2M were included on the 30e50% and 50e70% gels (Fig. the other bands were present in both the koji and brine samples (Fig. Sample Koji preparationa Maturation under sunlightb KM PI 1D 1W 2W 1M 2M 3M 4M Cell counts pH value Salt concentration (%) 7. K.. 2) (Brosius et al.4 after aging for 1 month (Table 2). 3a only exhibited corresponding bands in koji samples from the KM and PI stages. 19e21 and 23e26). Enterobacter cloacae (bands 11. 520F.2  107 cfu/g in the KM stage. 3a). Band C in Fig. In the subsequent DGGE analysis (Fig. Klebsiella pneumoniae (bands 2. The sequencing results suggested that all of the bands were mixtures of amplicons. 2004).4 37 5.1 39 5. the salt concentration had reached 42%. respectively. 3bed were excised and re-amplified prior to sequencing.-L. its sequence corresponded to Pantoea agglomerans and was the same as that of band 37 developed from Q2. pH and salt concentration measurements The counts for viable bacterial colonies observed on NB medium during the fermentation of inyu are shown in Table 2. 2. Bands E. 22 and 31). Citrobacter farmeri (band 16). Fig. After washing and preincubation. At the end of the aging period. pneumoniae was also identified from band 36 but was present only in brine aged for 2 months and not in brine aged for 1 week or 1 month (Fig. Table 1 and Fig. 3c).. Fig.7 30 7. 4e10. Enterobacter hormaechei (bands 17e18 and 32e33). Bacteria were quantified at a concentration of 6. 3c). including 30e50% (bands AeG. the 16S rDNA fragments might have identical melting properties even though they had different sequences (Ercolini.1. I1e3 and O1e3 yielded sequences with close homologies to Staphylococcus sciuri (band 1). re-amplified and subjected to sequencing. Determination of bacterial diversity using PCR-DGGE analysis F-968 520F 930F 16S rDNA 520R 255 800R R-1401 100 bp Bac-1492R-II 15R Fig. 2. the koji exhibited the largest bacterial population (2. bands 27 and 28e30. except that the primers used for full-length sequencing of the 16S rDNA were 8F.7 after aging in sunlight for 1 day. Total DNA was directly extracted from the koji and brine samples. The position of primers used in this study with regard to the bacterial 16S rDNA. 3d) to exclude the possibility that the re-amplified products were artifacts. 2). Enterococcus faecium (band 35) and Weissella confusa (band 34). 1978). Based on the premise that bands that migrated to the same position were identical. 800R and 15R (Table 1 and Fig. the pH gradually decreased to 5. The 8F and 15R primers were used to amplify full-length 16S rDNA (positions 8 to 1541 in the E. Bacterial enumeration. Fig.. 2008). The RAPD profiles obtained were used to discriminate the chromosomal compositions among isolates. G1e2. The bacterial concentrations of the brines continued to decrease. 3d). and therefore. Only one representative strain from each group was chosen for subsequent rRNA gene analysis.9 39 5.6 4.6 35 6. .8  107 cfu/mL in brines that had been exposed to sunlight for 1 day and 1 week. 3D). a final cycle of 72  C for 3 min. The pH of brine was determined to be 5. excised. the re-amplified products of bands P1 and Q1 were also included in the 40e60% gel (Fig. DNA sequencing and phylogenetic analysis were performed as previously described (Chao et al. 2008). G. 3a were present in all of the brine samples but were not found in the koji samples. also revealed that band 3 only had clear corresponding bands in these koji samples.9 after aging for 2 months and then remained stable.06 5. 16S rDNA amplification. and then. With the exception of bands 34 and 35 that were only present in brine aged for 1 week (Fig. b Bacteria counts are represented as log10 cfu/ml. 3b and c). 3a) were selected. bands AeX (highlighted in Fig. 40e60% (bands HeO. I and O shown in Fig. respectively. The pH subsequently decreased further to 4. 3d) and 50e70% (bands PeX. However.1  106 to 1. The identification results are presented in Table 3.2  105 cfu/mL after aging from 2 weeks to 4 months. agglomerans was present in both the koji and brine samples.1 42 e: Not determined.2.7. reaching a range of 1. 3b and d). sequencing and phylogenetic analysis This analysis was performed as previously described (Chao et al. a Bacteria counts are represented as log10 cfu/g. After placing the koji in a vat with salty water and salt. the salt concentration then increased from 35% to 39% after aging for 1 week to 3 months (Table 2). 3a had corresponding bands (with similar migration positions) in all samples. 15. as shown in Fig. Salmonella enterica (band 14).2  108 cfu/g) of all of the collected samples. 930F. Isolates with identical RAPD patterns were placed in a group and considered to represent the same strain. 3b and d). Wei et al. 3c. the concentrations of the bacteria were slightly reduced to 3. the bands developed from E1eE3. 3. 3b). pH values and salt concentrations in the fermented samples of inyu.06 5. Bands with positions similar to bands JeN shown in Fig. 520R. These results suggested that P. In fact.56 5. The salt concentration of brine aged for 1 day was 30%. The bands highlighted in Fig. Results 3.

as members of the same group. together with both koji samples. However. 2M. Bands with different migration distances (AeX) were selected from different samples. DGGE profiles of the V6eV8 regions of bacterial 16S rDNA. 2 months.3.256 C. 1M. re-amplified and subjected to sequencing. 10% . these results cannot rule out the possible presence of trace amounts of corresponding sequences in the koji samples. (a) A 30e65% denaturing gradient gel was used to analyze nested PCR products amplified from DNA directly extracted from inyu fermentation samples. / Food Microbiology 33 (2013) 252e261 a KM PI 1D 1W 2W 1M 2M 3M 4M b d c 1W 1M P1 Q1 X KM PI C1 E1 C2 E2 G1 A KM PI I1 O1 H1 I2 O2 H2 I3 J B 1W D E3 F G2 1W 1W K L M N O3 P1 Q1 2M P2 Q2 R S T U V W 2M Fig. only had corresponding bands in brine aged for 1 week. marcescens and C. thus. To verify the RAPD profiles. the brine samples that had been aged for 1 week and 1 month and appeared to contain all of the bands in all of the brine samples. 3a). Isolates that showed identical RAPD patterns were regarded as identical strains and. The bands AeG. and bands ReX were present in the brine samples that had been aged for 1 and 2 months (Fig. 1 week. 2006). 3 months and 4 months. 3. Wei et al. Moreover. 1W. 21 and 7 groups selected from 5%. Lanes KM and PI: koji samples from the koji-making and preincubation stages. farmeri was also found in band 16. farmeri. respectively. which had corresponding bands were also present in koji samples (Fig. 3b). The different numbers behind the same letter indicate bands obtained from different samples that migrated the same distance. 3M and 4M: brine samples from outdoor aging for 1 day. RAPD analysis has been widely used for studying the genetic diversity of bacteria (Atienzar and Jha. were further subjected to an evaluation of their bacterial diversities using the plate count method. 1 month. B and DeQ were observed for almost all brine samples.-L. Bacterial diversity determined using the plate count method According to DGGE analysis. Bands indicated by numbers alone were excised. 3. a total of 120 groups were obtained from koji samples in the KM (21 groups) and PI (5 groups) stages and from brine samples that had been aged for 1 week (46. PeX and HeO were further excised. lanes 1D. A total of 212 isolates were analyzed by RAPD-PCR using 3 sets of random primers (data not shown). 2 weeks. similar migration patterns for bands A. (c) 50e70% or (d) 40e60% denaturing gradient gels. reamplified and subjected to a second round of DGGE analysis using (b) 30e50%. Therefore. C.

licheniformis in brines aged for 1 week and 1 month. dispersa. 1. Staphylococcus kloosii and S. P. These results suggested that . Enterobacter asburiae (JQ829479) or Enterobacter cancerogenus (JN644583).1  103 cfu/mL of B. However.1  102 to 1. band 15: Enterobacter hormaechei (JQ831744). 4e10. coli 16S rDNA.5 and 32. P. respectively). S. 12e13.5  106 and 5. (24%) presented concentrations of 7. One representative isolate from each group was chosen for full-length sequencing of its 16S rDNA. Delftia (1 species). b Sequence identity with a sequence in the GenBank database is represented by (the number of the identical base)/(total length of the DNA fragment). S. In addition. E. S. sciuri. B. The excised bands were reamplified and separated by DGGE using 3 different ranges of denaturing gradients (Fig. Pantoea (1 species) and Staphylococcus (5 species) genera. pulveris. Although DGGE provided a broad and rapid overview of the microbial population dynamics. Brachybacterium rhamnosum made up the bulk of the community (34%) with a concentration of 2. 4e10. were identified (Table 4). Cronobacter sakazakii (HM748461). 3aed).9  103 cfu/mL of B. 3 Closest relative (accession no. 2. washing. band 34: Weissella cibaria (HM369807). pumilus.0  107 cfu/g. B.) Staphylococcus Staphylococcus sciuri (JF935130) Enterobacteria Citrobacter farmeri (FN433046) Citrobacter farmeri (FN433046) Enterobacter cloacaec (CP003678) Enterobacter cloacaec (JQ766938) Enterobacter cloacaec (CP003678) Enterobacter cloacaec (JQ904624) Enterobacter hormaecheic (JF772054) Klebsiella pneumoniaec (JF772079) Klebsiella pneumoniaec (JQ701742) Klebsiella pneumoniaec (JQ917917) Pantoea agglomerans (GU991862) Pantoea agglomerans (GU991862) Salmonella enterica (CP003416) Serratia marcescens (DQ182326) Lactic acid bacteria Weissella confusac (JQ754469) Enterococcus faecium (JQ778275) Banda Identityb 1 364/364 (100%) 16 28e30 11 15 22 31 17e18. 2012). S. band 20e21: Klebsiella variicola (JQ659780) or Enterobacter cancerogenus (JN969367). respectively) was only isolated from 5% NaCl agars. Delftia tsuruhatensis and 4 species of Staphylococcus (including Staphylococcus cohnii. 5  102 and 6. 6 additional species (C. 23e26. the other bands targeted nucleotide positions 1021e1384. enterica.7  107 cfu/g. band 31: Enterobacter hormaechei (JF772054). agglomerans. respectively). respectively. rhamnosum. 36 19 20e21 3 37 14 27 363/364 364/364 363/364 361/364 362/364 330/330 364/364 364/364 (99%) (100%) (99%) (99%) (99%) (100%) (100%) (100%) 364/364 364/364 364/364 363/364 363/364 363/364 (100%) (100%) (100%) (99%) (99%) (99%) 34 35 364/364 (100%) 364/364 (100%) Only highest homology matches were presented. Brachybacterium (1 species). gallinarum and S.6  108 cfu/g) increased in the koji from the PI stage by 1. most of these species were absent from the subsequently collected samples. subtilis in brines aged for 1 week and 1 month. Klebsiella pneumoniae (EU924134) or Klebsiella variicola (AM937459). c Other possible species with same identity were as follows: band 2. a Bands are numbered according to Fig. with the exception of the isolate obtained from the koji during the PI stage that had a 98. whereas B. subtilis in brines aged for 1 week and 1 month. respectively.5  105 cfu/mL while aging from 1 week to 1 month in isolates selected from 5% NaCl agar. hormaechei (2. 4). cohnii. pneumoniae and S. K. respectively. we revealed the bacterial compositions during the different stages of the inyu fermentation using both culture-independent and culture-dependent techniques. Although the koji from the PI stage yielded the largest population among all of the collected samples. 3. 4. condimenti. A total of 32 isolates that were identified as different species that had been selected from the various samples and plates with differing NaCl concentrations were further subjected to molecular phylogenetic analysis on the basis of their 16S rDNA (Fig. 23e26 and 36: Stenotrophomonas acidaminiphila (JN941322). hormaechei and K.9  103 cfu/mL of B. licheniformis. belonging to 6 genera) were identified using nested PCRDGGE (Table 3). with concentrations of 5. and K. Kurthia (1 species). Enterobacter (3 species). Here. These manufacturing processes that are characteristic of inyu production led us to elucidate the associated bacterial communities. amyloliquefaciens. providing valuable information regarding the functions of the bacteria during fermentation. and 13 additional species (B. S. E. 32e33 2. loading in vats and sunlight exposure aging during inyu production. Klebsiella (1 species). Enterobacter asburiae (JQ829479) or Enterobacter cancerogenus (JN644583). B. Pantoea dispersa and Kurthia gibsonii made up 14% of the community. The production of inyu. hormaechei (28%) was found at a concentration of 1. no such evaluations that focused on inyu fermentation have been reported. with concentrations ranging from 1. marcescens.0  106. Providencia rettgeri (GU049676) or Raoultella planticola (EF551363). Bacillus amyloliquefaciens increased from 2.0  104 cfu/mL in brines aged for 1 week and 1 month.7  104 to 1. a type of fermented soy sauce made in Taiwan. respectively) and 10% NaCl agar (2. pneumoniae (1. 3bed). Four species (E. belonging to 3 genera) were identified using both techniques. subtilis.-L.0  107 cfu/g) and E. pneumoniae.6% similarity score for Enterobacter pulveris. tsuruhatensis. confusa. Klebsiella oxytoca (JN644535). Enterobacter aerogenes (HQ398232).7  102 cfu/mL) in brine aged for 1 month. E. the DGGE profiles of the bacterial V6eV8 16S rDNA amplified directly from fermented samples were a mixture of amplicons (Fig. gibsonii. The DNA fragment of band 31 targeted nucleotide positions 1055e1384 of the E. S.0  106. only the levels of E. B. All of the isolates yielded similarity scores of over 99% to their corresponding species. including the Bacillus (4 species). 12e13. However. In brine aged for 1 week. K. Bacillus pumilus (2. band 11 and 22: Erwinia chrysanthemi (JF816284). employs a longer fermentation period for koji making and a higher temperature for brine aging than traditional soy sauces. with a total of 6 genera and 8 species. kloosii.5  106 and 2. respectively.6  104 cfu/ mL of B. Staphylococcus condimenti.1  103 and 1.. kloosii). / Food Microbiology 33 (2013) 252e261 Table 3 Sequencing results of selected DGGE bands in Fig. farmeri. D. 4 species of Bacillus were identified as being dominant in the isolates selected from the agar plates containing 5% NaCl.5  107 cfu/g) 257 and K. sciuri. The koji from the KM stage exhibited the highest diversity of bacteria. E. A total of 8 genera and 17 species of bacteria. band 19: Klebsiella variicola (FR828822) or Klebsiella oxytoca (JN848786). cloacae (3. subtilis and Bacillus licheniformis were detected in isolates selected from both 5% NaCl agar (5  104 and 8. only two additional species.5  102 and 3. an artificial method and nonsterile operations are used for koji making. respectively) and 1 month (12 and 8 groups selected from 5% to 10% NaCl plates. these characteristics led to the hypothesis that a much higher level of bacterial diversity would be associated with inyu production. Among these. Discussion Recently.6  103 and 3. faecium and W.2  103 cfu/mL.C. with the exception of E. were identified. band 17e18 and 32e33: Enterobacter cloacae (JQ904624). licheniformis in brines aged for 1 week and 1 month.0  106 cfu/g). respectively.5  106 cfu/g for Staphylococcus gallinarum. E. cloacae. 4. pulveris (5. In brine samples that had been aged for either 1 week or 1 month. and 15% NaCl plates. were also identified in isolates selected from 5 to 15% NaCl agar plates (Table 4). the microbial communities involved in the soy sauce manufacturing process were analyzed using the PCR-DGGE method (Tanaka et al.0 fold. pneumoniae. gallinarum and S. hormaechei. Wei et al.0  105 cfu/g. Staphylococcus spp. preincubation. this species was also detected in isolates selected from 10% NaCl agar (5. belonging to 7 genera) were identified using a traditional plating technique (Table 4).

because the ranges of the second round of DGGE gels (30e50%. This inability caused the differing mobilities of bands such as 2.85 6. subtilis and B. 3d and Table 3). In fact. 3bed) that had identical sequencing results (Table 3). a series of reports have identified other possible roles for Bacillus in fermented food.40 6. B.32 e 2. were identified in the brine samples using the plate count method. subtilis isolated from Chinese traditional douchi.48 4. no fungi were detected in the brine plated on Yeast Malt agar (data not shown). 1991).05 e e e e 0% Enterobacteria Enterobacter cloacae Enterobacter hormaechei Enterobacter pulveris Klebsiella pneumoniae Pantoea dispersa Brachybacterium Brachybacterium rhamnosum Kurthia Kurthia gibsonii Staphylococcus Staphylococcus cohnii Staphylococcus condimenti Staphylococcus gallinarum Staphylococcus kloosii Staphylococcus sciuri Delftia Delftia tsuruhatensis Bacillus Bacillus amyloliquefaciens Bacillus licheniformis Bacillus pumilus Bacillus subtilis c 1Mb e: Not found. a Bacteria counts are represented as log10 cfu/g. 3d and Table 3) and W. 2 fibrinolytic enzymes have been characterized from B. the only LAB detected in our inyu brine samples using DGGE analysis were E. Thus. licheniformis. Rogosa and Sharpe) agars containing 15% and 10% NaCl.70 e e e e e e e e e e e e 4. B. no LAB were found by plating the brines that had been aged for 1 week and 1 month on MRS (de Man. halophilus. and its production employs a manufacturing procedure similar to that of inyu (Teng et al. 23e26 and 36 (Fig.33 e 1. none of these species were found in our DGGE profiles.-L. 2004). suggesting that some halophilic microbes.70 2.. 4e10. For instance. B. In addition.07 e 2.20 e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e 7.29 e e e e e e e 5. 3a also suggested that the bacterial communities might be similar among the samples. In this study. B. However. 2004. douchi is made primarily from black soybeans.33 e e e e 5. the pH values associated with inyu production decreased from 5. pumilus have been shown to have the . c Salt concentration in the agar plates. the brine aged for 1 month contained just Bacillus and no other genera of bacteria (Table 4). The halophilic Bacillus found in the brine might exhibit such activities. The DGGE profile shown in Fig. G.40 7. a food prepared by fermenting fish with salt in a ratio of 2e6:1 (17%e50% salt) (Toyokawa et al. Like inyu.70 8. The brine is acidified by halophilic LAB. Another reason that the 37 bands yielded only 10 species may be that the bacterial genomes contained multiple copies of the rDNA operon.93 2. 3bed) (Ercolini. Table 2) than in traditional soy sauce (25% or 19% after 1 year of aging) (Huang and Teng. 2008). H.. Tanaka et al. a halotolerant serine protease has been characterized in B. 2004. which will then limit the growth of undesirable microorganisms during the fermentation process (Huang and Teng. 2009). Nevertheless.70 e 3. Species Samples KMa PIa 1Wb 0% 5% 10% 15% 5% 10% 15% e 7. the results obtained using the plate count method revealed that no common species could be found in all samples (Table 4). 2010).84 4. respectively (data not shown). Bacillus species are renowned for their strong amylase and protease activities.19 e 3.4 to 4. licheniformis isolated from fish sauce. subtilis has been used as a starter culture to control the fermentation of natto and kinema (Steinkraus.59 e 3. leading to sequence variations in each strain. which we were unable to separate by DGGE.75 3.. B..17 3. however.06 e e e e e e e e e e e e e e e e e e e e e e 2. pumilus and B. Ko et al. 2004). Moreover. Four Bacillus species. / Food Microbiology 33 (2013) 252e261 Table 4 Quantification of bacterial species in the fermented samples of inyu. The application of this species as a starter culture in fish sauce fermentation has been found to be effective in reducing the accumulation of biogenetic amines that cause adverse health effects in consumers when ingested in considerable amounts (Zaman et al. amyloliquefaciens. Surprisingly. faecium (band 35 in Fig.258 C. though not LAB. the DGGE analysis would show multiple bands for each strain (Fig.22 e 6.70 6. Furthermore. Only 10 species were identified after DNA sequencing of 37 bands (Table 3). LAB are the main bacteria that are useful in soy sauce brine fermentation.65 6.70 2.. 40e60% and 50e70%) overlapped. 12e13.43 2. This result is not surprising. For example. 2012). subtilis. nucleotides just downstream of the primer F-968 cannot be verified by direct sequencing of the re-amplified products of these DGGE bands. b Bacteria counts are represented as log10 cfu/mL. amyloliquefaciens. isolated from fish sauce.9 during aging from 1 to 2 months. amyloliquefaciens and B.40 4. The limited populations of halophilic LAB identified during the inyu brine fermentation might be due to the much higher concentration of salt present (30e42% during aging from 1 day to 4 months. This result might be due to the similar GC contents of the nested PCR products among Bacillus species. such as T.48 7.40 e e e e e e 3.70 e e e e e e e e e 6. These persistent bands in the DGGE fingerprints might have originated from dead cells that were present in the primary fermentation samples during the KM stage (Thanh et al. were involved in the acidification of the inyu brine. I and O had corresponding bands almost in all of the collected samples. bands E. 2011).. was found to produce histamine oxidase. a complicated bacterial composition might exist in the inyu samples. Wei et al. In addition to their proteolytic activity. B. confusa (band 34 in Fig.

Panels a and b illustrate the results for species of gram-negative and grampositive bacteria.C. Bootstrap values (expressed as the percentages of 1000 replications) greater than 90% are shown at branch points. Wei et al. Phylogenetic tree based on the 16S rDNA sequence analysis showing the phylogenetic placement of species isolated from kojis at the koji-making (KM) and preincubation (PI) stages and from brines aged for 1 week (1W) and 1 month (1M) during the fermentation of inyu. 4. The tree was constructed by the neighbor-joining method (Escherichia coli was used as the outgroup).-L. . / Food Microbiology 33 (2013) 252e261 a 259 Pseudomonas aeruginosa DSM 50071T (NR_026078) 1000 1W10C9 Delftia tsuruhatensis IFO 16741T (NR_024786) PI2 1000 Enterobacter pulveris E444 (EF059835) Pantoea ananatis ATCC 33244T (NR 026045) 1000 Pantoea agglomerans DSM3493T (NR_041978) 1000 KM9B 1000 Pantoea dispersa GTC1472T (AB273743) Citrobacter farmeri CDC 2991-81T (NR_024861) Enterobacter asburiae E53 (HQ407230) 999 Enterobacter hormaechei EN 562T (AJ853890) KM8A PI3B Enterobacter aerogenes JCM 1235T (NR 024643) Klebsiella pneumoniae ATCC13884T (Y17657) 973 KM6 PI1 960 Klebsiella variicola ATCC BAA-830T (NR 025635) Enterobacter cloacae ATCC13047T (NR 028912) 991 Enterobacter dissolvens LMG2683T (Z96079) Enterobacter ludwigii DSMZ 16688T (AJ853891) PI4 5% b 1000 999 977 1000 1000 1000 1000 1000 1000 5% Escherichia coli ATCC11775T (X80725) Dermabacter hominis DSM7083T (NR 026271) Brachybacterium nesterenkovii DSM9573T (NR_026270) Brachybacterium tyrofermentans CNRZ 926T (NR_026272) KM2C Brachybacterium rhamnosum LMG19848T (AJ415376) KM1 Kurthia gibsonii NBRC15534T (AB271738) 1000 KM4A Staphylococcus sciuri DSM20345T (NR_025520) Staphylococcus condimenti DSM11674T (NR_029345) 1000 1W5D2 Staphylococcus carnosus GTC1232T (AB233329) 1W10A13 1000 KM5A Staphylococcus kloosii ATCC43959T (AB009940) 1W10A11 991 1W15A2 Staphylococcus cohnii ATCC49330T (AB009936) 1W10A3 Staphylococcus arlettae ATCC43957T (NR_024664) 1W10A10 Staphylococcus gallinarum ATCC35539T (D83366) 966 KM7 Staphylococcus succinus ATCC700337T (AF004220) Bacillus aerophilus 28K (AJ831844) 1M5C7 1W5D1 Bacillus pumilus DSMZ27T (AY456263) 1W5B14 1M5B31 1W10C10 1000 1M10A10 Bacillus licheniformis BCRC11702T (EF433410) 1000 Bacillus aerius 24K (AJ831843) Bacillus vallismortis DSM11031T (AB021198) 1M5B1 1W5B26 Bacillus nematotocita B-16T (AY820954) Bacillus amyloliquefaciens NBRC15535T (AB325583) 965 1M10A32 Bacillus mojavensis NBRC15718T (AB021191) 1W5B29 1W10C4 1M5A1 1M10A33 Bacillus subtilis IAM12118T (AB042061) Fig. respectively. The scale bar represents 5% sequence divergence.

.. dispersa and S. H. M53eM60. pneumoniae strains have been identified that do not possess 3 of the known enterotoxin genes (Keuth and Bisping.N. agglomerans and S. Leroy et al. D. and no hemolytic activity was identified (Onda et al. 2008).. F.. their proteolytic and lipolytic activities also contributed to the generation of flavor-active compounds during sausage fermentation (Montel et al. H. 1994). The presence of the Staphylococcus species identified in this study was not surprising and can be explained as contamination that occurred during the nonsterile fermentation process. amines and esters that are important for creating a more complex flavor during soy sauce aging (Huang and Teng. which was also found in 1M brine. To our knowledge.. most of the bacterial species found in the KM koji. T. Nine species belonging to the family Enterobacteriaceae were identified using both screening methods (Tables 3 and 4 and Figs. B. tsuruhatensis has been isolated from activated sludge collected from a domestic wastewater treatment plant in Japan and was able to degrade various aromatic hydrocarbon compounds (Shigematsu et al. 2001). condimenti and S. 1999).. hormaechei.. Corbo.J. isolated from Italian table olives “Bella di Cerignola”. S. Valenzuela-Encinas. Bevilacqua. enterica (Kanemitsu et al. 2010. 2012). Zell et al.. Members of the Enterobacteriaceae have the capacity to adapt to a wide variety of environments and can be isolated from a range of host species. sciuri.. 2011. Gutierrez-Miceli. 2004). S. 2003. These enterobacteria. Journal of Food Science 75. B. Mei (National Taipei University of Education. this species has also been described as the causative agent of a human catheter-related infection (Preiswerk et al. 1994). M. However. / Food Microbiology 33 (2013) 252e261 capacity to produce both a pleasant aroma and antimicrobial substances against pathogens during the manufacture of soumbala (Ouoba et al. P. belonging to the family Dermabacteraceae.. K. R. K. M. 2007). However. P. 2012) and thus provide a natural safety control. licheniformis and B. Sinigaglia. 1998. Casaburi et al. This study might be a great benefit for the further modification of the fermentation process to produce inyu with more attractive flavors without safety concerns. M. Sarika et al. subtilis have previously been reported as the dominant organisms in doenjang and are thought to play important roles during fermentation (Yoo et al.. kloosii in soy sauce fermentation (Tanaka et al. Staphylococcus and Bacillus species might also contribute to the inhibition of pathogenic bacteria as well as the possible role of S. Gallo.. The family Enterobacteriaceae. It has been reported that 2 strains of E. The former 2 strains were also identified in the koji and brine of soy sauce using DGGE analysis (Tanaka et al. meat starter culture. 1976. A. Staphylococcus is a common component of the microbial flora of human and animal skin (Wesley et al. 2011). rhamnosum. Mutation Research 613.. which were also found in our samples. Atienzar.-M. 2006. Keuth and Bisping. Their possible thermotolerant and halotolerant properties might be valuable for both other food fermentations and industrial applications. Marsch. might produce useful catalysts that give inyu special flavors during brine fermentation. 2012) in the early brine fermentation steps.. some reports have shown that Staphylococcus might have a functional significance in fermented products. Taipei) for their technical assistance with the nested PCR-DGGE analysis. have been isolated from miso. 2005. including E. such as pulque (Mexico) and taberna (Mexico) (Escalante et al. 2010). bacteria from both genera. including Brachybacterium. this is the first report describing the presence of these species in fermented food. subtilis also contributed to the production of the organic acids. pneumoniae and P. Once these bacteria are classified to be undesirable. A. K. B. 558e563. S. Holden et al. 2005). nested PCR-DGGE analysis combined with a plate count method was used for the first time to assess the bacterial communities involved in inyu production. R.... the safety issues related to the Staphylococcus species could be determined by analyzing the hemolytic activity of the bacteria as well as inyu brine.. marcescens have been detected in healthy or Botrytis-infected grapes (Nisiotou et al. Cannarsi. kloosii. pneumoniae.R. Kurthia and Staphylococcus species. Acknowledgments We thank Prof.. tsuruhatensis were 3 other species that were isolated from koji at the KM stage or brine aged for 1 week using the plate count method (Table 4). In brief. Ho and Prof... 3 and 4). S. Dendooven. 2007... the sole survivors in the PI koji. 2003). 1996. The combination of the 2 techniques overcame the limitations of each individual method and provided a more global insight into the bacterial diversity that is associated with inyu fermentation. Furthermore.A. also disappeared in the subsequent brine sample. Zell et al. On the other hand. 76e102. The random amplified polymorphic DNA (RAPD) assay and related techniques applied to genotoxicity and carcinogenesis studies: a critical review. gallinarum. Ayora-Talavera. 2009). K. In addition. J. S. In conclusion. may have been present due to contamination during koji fermentation but were then inhibited by the 30e42% (300e420 g/L) salt concentrations present during brine fermentation. sciuri has been successfully used as part of a consortium starter culture in cheese production (Bockelmann and Hoppe-Seyler. and it has been suggested that this bacteria was involved in the production of vitamin B12 during fermentation (Mulyowidarso et al.. cohnii is also a member of the CNS group and can be found in the human environment.. For example. 1990. References Alcantara-Hernandez. class Actinobacteria. doenjang and marri (Onda et al. H. gibsonii and D. S.. Validov et al. Five Staphylococcus species were identified in koji from the KM stage and from brines aged for 1 week using the plate count method (Table 4). The bacterial community in ‘taberna’ a traditional beverage of southern Mexico. rhamnosum... Letters in Applied Microbiology 51. Wei et al. cloacae. and the closely related species (based on 16S rDNA) Brachybacterium squillarum have been isolated from salt-fermented seafood in Korea (Park et al. The first 3 strains have been subjected to tests for potential pathogenic risks. M. B. 2008. Rodriguez-Alvarez. .. It is well known that Enterobacteriaceae contains many potential animal and plant pathogens. the desirable or undesirable effects of bacteria during brine fermentation should be clarified in further studies. Moreover. especially the latter. Jha. 2006). E.. 2010. Alcantara-Hernandez et al. F. which belong to the coagulase-negative group of staphylococci (CNS).. 2007). 1998). L..-L. Recently. Castanon-Gonzalez. gallinarum and S. were absent after koji washing. C... they might be prevented by introducing bacteriocin-producing LAB to lower the pH and produce antimicrobial proteins (Chang and Chang. 2011). 2003..A. sciuri was also identified by DGGE analysis (Table 3). 2011).-C.. pneumoniae has been isolated from tempeh.. none of these species were found in the brine samples (Table 4)... Characterization and implications of Enterobacter cloacae strains. 2010). Thus. This species has been described as a plant growthpromoting bacterium and has been proposed as a potential biocontrol agent against plant pathogens (Han et al.. In addition to the unusual high-salt and hightemperature environment used for the fermentation of inyu brine. a traditional fermented soybean food in Indonesia. 1996. 2005. cloacae isolated from Italian table olives were inhibited by salt concentrations of 70e80 g/L (Bevilacqua et al. the nitrate reductase and antioxidant activities of CNS Staphylococci have been reported to be important for color formation and for preventing the formation of off-flavors and rancidity (Montel et al.A. 2008). K.260 C. agglomerans have been detected in fermented drinks. Certainly.

Keuth. N.H. 2008. In: Chen. H. Springael.. 2003. 66e76. Saris...W. Systematic and Applied Microbiology 28. I.. K.. K. Y. 1118e1122.. Selamat.H. M. M... S111eS123. nov.S.. International Journal of Food Microbiology 128.G..W. Dicks. Smith. Mogi. Kadowaki.H.C. G. (Ed. Isolation and identification of microorganisms in Korean traditional soybean paste and soybean sauce. Zaman.). 1976. G. S.A. 1413e1421...C. Y.S. Palmer. Weisburg. International Journal of Systematic and Evolutionary Microbiology 61. 1994.R... Ueda.. O. F.. K. Journal of Agricultural and Food Chemistry 53. Diawara.H. Melvin. Y. 2005... Hombach..).Z. W. Ko. S. L.... Journal of Microbiological Methods 56.. L. Linda.. K. L. Staphylococcus hominis subsp. G. 2007. Chen. Lee. Kennedy.. Soy Sauce.. Toth.N... Dong. Steinkraus. Ludwig... Characterization of Staphylococcus sciuri sp... Y.. H. Brachybacterium squillarum sp. Hoppe-Seyler. B. Watanabe. K. Lee.. Stanley. 1479e1483. Determination of microbial diversity in meju. 1998. 246e251.F... Fleet. Jespersen. Noller. (Ed. K.J. 697e703. P.... M. Lane. L. Shida. M. T. 16S ribosomal DNA amplification for phylogenetic study. pp. 307e314. 461e471. nov.H. P.... Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli. H. 2008. Functional meat starter cultures for improved sausage fermentation.H. 2011.C. Hong. Muyzer. radicis-lycopersici in stonewool substrate. R. 130e134. Lin. T. Time series analysis of aerobic bacterial flora during Miso fermentation... Volatile compounds of Soumbala. Cocolin. B.. Barbara. Rantsiou. Tuan. J. 2004. International Journal of Food Microbiology 145. M. D. 2003.. Annan.M. Giles-Gomez.. T.. Microbial diversity of traditional Vietnamese alcohol fermentation starters (banh men) as determined by PCRmediated DGGE.H. Heidt..C. International Dairy Journal 11.. 126e134. 4801e4805. M. D. V. A. Takahara. A.L..S. 489e499.... Montel. 799e812. Novobiosepticus subsp. 1978. Kim. Wang. Carol. H.. Y. T. Monitoring of the microbial communities involved in the soy sauce manufacturing process by PCR-denaturing gradient gel electrophoresis. Ercolini. 1993.... 2005. Albrecht.. pp. A. Endo. 1991. Wang.C. Rinkinen.. Applied and Environmental Microbiology 60. In: Westby. International Journal of Food Microbiology 131.J. Jinap.K.. Makarova. M. Toyokawa. Kim. Yanagida. K. S. 1996. In: Hui. Uitterlinden.. Bakar.H. T. Holden. Journal of Food Science 76. E. 2011. M.. 2012. Journal of Agricultural and Food Chemistry 57.H. Watanabe. 2012.. 162e168.V. R. nov. M. .. V. B. Chang. 1998.. International Journal of Systematic and Evolutionary Microbiology 53. Mulyowidarso. M. 84e91.K..O. Delftia tsuruhatensis sp. E.. 43e47.. Chao. International Journal of Food Microbiology 106... Journal of Applied Microbiology 99.. Kim. E. 2011.W. de Waal. Takagi.C. Y.. Brosius. 2011. Oda. U.... S..K. Korean Journal of Applied Microbiology and Biotechnology 27. M.C.. a traditional Mexican alcoholic beverage. J. J. 113e117. Pepe. A. Johansson. Wattiau. 695e700.. International Journal of Food Microbiology 135. Amann. K... Chang.. Soy sauce and its umami taste: a link from the past to current situation. Natural Publishing.A. Hernandez. Mai le... Ouoba. W. Gotz.G. J. Characterization of toxin production of coagulase-negative staphylococci isolated from food and starter cultures. Shigematsu. Letters in Applied Microbiology 51. 2006. F. Cordova-Aguilar. Y..). 87e92. Backhaus. Sun. 2004. 26.H. In: Reuter. Onda. Chang. Beasley. Applied Microbiology and Biotechnology 86. Casaburi. Mary.. Characterization of a novel plant growth-promoting bacteria strain Delftia tsuruhatensis HR4 both as a diazotroph and a potential biocontrol agent against various plant pathogens. B. 255e273. Nam.M. M. Qi. Journal of Applied Microbiology 102. Tsuji. Journal of Medical Microbiology 60. Fermented whole soybeans and soybean paste. S. D.. Mot. D. Kim. J. 2001. T. Talon.K. Watanabe. 2010. CRC Press. Hatta. 2009.H. C. 2007. M... F. S. Klein. Yoo. Pritchard.. 2006. 2007. G. International Journal of Food Microbiology 145. Y.. PCR-DGGE fingerprinting: novel strategies for detection of microbes in food.. Shinohara.C. using a polyphasic approach. F. N. H.. 77e82.. Ahrne... Wesley. Ahn.. P. Colonization outwith the colon: plants as an alternative environmental reservoir for human pathogenic enterobacteria. 268e273.W... Thanh. S. M. Yasuda. Dhivya. 5636e5643.. Handbook of Food and Beverage Fermentation Technology. Saito..S. Huang. V.. 261 Nubel. Bisping. Masson. 22e37.. K.. L.... Purification and characterization of a halotolerant serine proteinase from thermotolerant Bacillus licheniformis RKK-04 isolated from Thai fish sauce. 1975..... J. G. D. K.. P. T. Jennifer. Sun. H. M.. X.P.D. A. Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis. Chang..F.L. Novel starter cultures to inhibit biogenic amines accumulation during fish sauce fermentation.. S. 1999. van den Berg.. using nested PCR-denaturing gradient gel electrophoresis. J. Lee.... T. Journal of Bacteriology 178.. S.. Roh. K..F. Isolation of a bacteriocin-producing Lactococcus lactis and application of its bacteriocin to manage spoilage bacteria in high-value marine fish under different storage temperatures. 1997. S. Applied Biochemistry and Biotechnology 167. M. S. Du Toit... R. 2009...... S..A... International Journal of Systematic Bacteriology 26. Montel. A. sp. 2005. Tanaka.. Y.. Han.. 297e314.. pp. / Food Microbiology 33 (2013) 252e261 Bockelmann. Mauriello. S. U. De Vuyst. W. Cho. Growth inhibition of foodborne pathogens by kimchi prepared with bacteriocin-producing starter culture.. Poll. 1996. Effects of temperature and sodium chloride concentration on the activities of proteases and amylases in soy sauce koji. 6862e6870. Manninen. 2008. M.I. J. Yokotsuka. Fukuta. Proceedings of the National Academy of Sciences of the United States of America 75... A. D...Z. D. H. M. 2004. H. M72eM78.. P.. Letters in Applied Microbiology 37...Y. R... Preiswerk. CRC Press. and its subspecies. Abu Bakar.. L. Meat Science 49. Yang. 1990. Handbook of Food and Beverage Fermentation Technology. Tagami. Wieshuber... M. Schleifer. G. Lugtenberg. R. Molin.L. O. 270e285.. Tachibana. (Eds. Alteration of the canine small-intestinal lactic acid bacterium microbiota by feeding of potential probiotics.. Lee. H. M. Bolivar.E. Barns. L. S. International Journal of Food Microbiology 123. Kamilova. Journal of Applied Microbiology 102. N.L. Gosset. S.J.. F. W.T. Herborn. Nisiotou.. Berdagué. FEMS Microbiology Reviews 33..E. M. Lee..A. Systematics of probiotic lactic acid bacteria with reference to modern phenotypic and genotypic methods.J.K..Y. B. Food Microbiology 13. R. nov. T. Iliopoulos.I. S.. Jakobsen..H. B. Kang.-L. K. African alkaline fermented foods and their relation to similar foods in other parts of the world. 1998.. Park.. Wang. Bacterial role in flavour development.. H. Zell. Analysis of microbial communities in doenjang.and N-acetyl-D-glucosaminenegative. Ouoba. Leroy. K. Tomii. K. Kunishima.P. Technological activities of Staphylococcus carnosus and Staphylococcus simulans strains isolated from fermented sausages. Journal of Applied Bacteriology 68. 1280e1289. 1991. Z. Lipton. Lioe.C. 643e650... 2004.J.. Yumihara. Wei et al.. Kim. 100e106. M.. Snaidr. P. a fermented African locust bean (Parkia biglobosa) food condiment. M. a novel trehalose.I. Inden.C..S. Association of bacteria with the fungal fermentation of soybean tempe. Hertel... 2009. Randomly amplified polymorphic DNA (RAPD) for rapid typing of Lactobacillus plantarum strains. R71eR76. Reitz. Diversity of lactic acid bacteria in suan-tsai and fu-tsai.. F. 2011. Verluyten.M.J. K. Biochemical activities of Micrococcaceae and their effects on the aromatic profiles and odours of a dry sausage model. L. Bacterial species associated with sound and Botrytis-infected grapes from a Greek vineyard. Rousset-Akrim. Reilly.. Felske.. International Foundation for Science. Human infection with Delftia tsuruhatensis isolated from a central venous catheter. L. S. Buckle. Blaiotta.L. S.J. 6539e6543.. Meat Science 71. F.F. Reungsang.. Ullrich.. Applied and Environmental Microbiology 59. Engelen. Park.. M. S. R. Endo.. Jakobsen. Stephan. Wu. Selection of bacteria able to control Fusarium oxysporum f. Eugene. Jung. H. F.W. Villani.. LopezMunguia. The surface flora of bacterial smearripened cheeses from cow’s and goat’s milk. K. R. M. S. International Journal of Food Microbiology 127. 2008. Proceedings of a Regional Workshop on Traditional African FoodsdQuality and Nutrition.. FEMS Microbiology Ecology 50. Tsai.... A. Morimura. Talon. V.. Speich. M. 1495e1499. 2010. W. B. 1995. 155e159. 134e141. D. S..C. Teng. F... a terephthalate-assimilating bacterium isolated from activated sludge. 37e50.. J... Takazane. Vitamin B12 production by Citrobacter freundii or Klebsiella pneumoniae during tempeh fermentation and proof of enterotoxin absence by PCR. Letters in Applied Microbiology 21... Yasuda. Schillinger. R. Soy Sauce. novobiocin and multiple-antibiotic-resistant subspecies isolated from human blood cultures. C. Diversity of lactic acid bacteria in fermented brines used to make stinky tofu.. A. Ryngaert... Song. N. International Journal of Systematic Bacteriology 48.S. Chao.... J. CRC Press. 2010. Quednau. Microecology and Therapie. Rusch. J. J. R.. M. 388e394. 246e248. Shoyu Kenkyujyo Kenkyu Houkoku 24. vol.S. M. Resch.... G.J.F. Applied and Environmental Microbiology 72. P. Sarika. G. Influences of Bacillus species in shoyu koji on shoyu brewing (part 1) isolation and identification of antifungal antibiotics producing bacteria. Vanbroekhoven. 2009. 432e436. H. Bae. L. Hsieh..H. Park. S. G. L. Kida. Nychas. J. Food Microbiology 31. Journal of Bacteriology 173.. Kim. Cai. Su. International Journal of Food Microbiology 124. Holzapfel... Wesley. Teng.I. G. M. 689e703. Y. Rosenstein. 2005. Acinetobacter diversity in environmental samples assessed by 16S rRNA gene PCRDGGE fingerprinting. 1867e1875.. W. 203e210. Escalante. Y. Aishwarya. T....I. Analysis of bacterial community during the fermentation of pulque...H. E..N.. Bloemberg. Kwok. A..W. S. H. Metabolomic insight into soy sauce through (1)H NMR spectroscopy. Kaku.). a Korean fermented soybean paste.J. S. An increased incidence of Enterobacter cloacae in a cardiovascular ward.. Inyu. traditional fermented mustard products of Taiwan. Pelletier.. Hachimine..H. C. 265e271. Validov.. Y. isolated from salt-fermented seafood. 963e970. G. 1e10. J. Lee. H. Numaguchi. H. Journal of Hospital Infection 66. C.G.Y. Journal of Food Science 75.. Antimicrobial activity of Bacillus subtilis and Bacillus pumilus during the fermentation of African locust bean (Parkia biglobosa) for Soumbala production.. Tsai. Diawara.J.K. 1521e1525. T.. X. (Eds.. Kanemitsu.. fermented cooked soya beans. A.H.. Taipei. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA.. using nested PCR-denaturing gradient gel electrophoresis. G. A.