CHEMOTAXIS AND FORAGING BEHAVIOR

IN OCTOPUS RUBESCENS

Anna Fabrizio
University of Washington
School of Aquatic and Fisheries Sciences
Seattle, Washington, USA
March 2009

Assignment for FISH 494

 ABSTRACT

Octopuses are one of the most complex invertebrates and have a well-developed sensory system.
Part of that sensory system is their ability to sense chemical cues and “taste” things in their
environment through their suckers. Limited studies have studied the ability of octopuses to orient
themselves to chemical cues over distance. Previous studies have only explored the potential of
octopuses to respond to direct chemical cues or extracts from crustaceans. The purpose of this
study was to explore distance chemotaxis abilities of octopuses when exposed to live prey.
Octopus rubescens were put through behavioral trials in a Y-maze to determine if they could find
prey in the maze based on “taste” alone. Both blind and visual trials were done to observe
differences between hunting with vision and hunting by chemotaxis. The octopuses were most
responsive during visual trials and were able to successfully find the crab during 54% of the
visual trials. The octopuses were less responsive during blind trials and only found the crab one
time. Additionally, gene expression and protein analysis was done on the prey of the octopuses
during the trials: the shore crab Hemigrapsus oregonensis. Analysis was done to determine if
there is a significant difference in stressed organisms and that it would cause octopuses to find
stressed organisms easier. No conclusions were drawn from the gene expression analysis. The
protein analysis appeared to show that two proteins (an arginine kinase and superoxide
dismutase) were expressed more frequently in stressed crabs compared to unstressed crabs.
Further research is needed to determine whether or not octopuses can find live prey using
distance chemotaxis.
INTRODUCTION

Over 300 octopus species are distributed in just about every habitat throughout the world’s
oceans. As one of the most advanced invertebrates, octopuses have been a point of interest for
behavioral study in a wide variety of capacities. Their neurological network is particularly
complex in that they have a developed brain but lack a spinal column. Their arm functions are
also partially independent from the brain, meaning that each individual arm can perform a
separate task from the other arms (Sumbre et al. 2001). This is especially useful when hunting
for food. Their well-developed vision is also used frequently in hunting (Lee 1992).

Octopus diets vary depending on habitat, prey availability and life stage (Rodhouse and
Nigmatullin 1996). Octopuses feed on live prey and are opportunistic predators. Through
observation and stomach content studies, octopuses have been shown to feed on practically
anything they come across while they are foraging. Adult octopuses will feed primarily on a
variety of different crustaceans and mollusks. Some octopuses will also feed on fish or other
cephalopods.

While a variety of foraging behaviors have been defined they are generally categorized into two
main behaviors: “poke” (also known as probing or groping) and web-over (also known as web-
casting or pouncing) (Mather 1991a). Poke hunting is generally described as when octopuses
extend one or more arms or arm tips into crevices, holes, between rocks or in any hidden
environment location where food may be located (Mather 1991a). Web-over hunting is described
as when an octopus covers part of its environment by arranging the arms in such a way that the
membranes between the bases of the arms forms an encompassing web so that any organisms
inside the web are trapped (see Figure 6) (Mather 1991a; Yarnall 1969; Forsythe and Hanlon
1997).

Although these behaviors are primarily tactile in nature, they are also dependent on the visual
ability of an octopus in its environment (Forsythe and Hanlon 1997). More complex
environments provide less visual range for octopuses to distinguish specific prey. In these
environments, such as coral reefs and rocky bed, octopuses are more likely to use poke
behaviors. In less complex environments, where hiding places of prey can be more easily
identified, then they are more likely to use the web-over technique.

Most octopuses are nocturnal feeders and many live in deeper waters where vision is
compromised. Therefore, their chemoreceptive abilities are assumed to be highly developed.
Octopuses have chemoreceptors in their suckers (Graziadei 1962). Each is individually
controlled by nerves and is connected to the brain through complex nerves in the arm. The
chemoreceptors in their suckers are quite sensitive. Octopuses have been shown to be able to
identify between identical objects based on the solution that they have been soaked in (Wells
1963).

Lab tests have shown that octopuses can follow chemical cues over distance through Y-mazes,
suggesting a distance chemotaxis that does not rely on visual cues (Chase and Wells 1986; Lee
1992). However, these test procedures have not mimicked natural prey encounters well.
Therefore, distance chemoreception in octopuses may not be as developed as these tests would
seem to indicate. It is more likely, and more often observed, that octopuses rely on visual cues to
orient themselves to their environment, including when they are foraging (Mather 1991a; Mather
1991b; Yarnall 1969; Mather and O’Dor 1991). This sort of visual connection and learning is
indicative of the octopus’ well-developed brain and can even be suggestive of consciousness
(Mather 2008).

The purpose of this research is to expand on previous distance chemotaxis studies by addressing
the issue of using live prey during Y-maze experiments. Since previous experiments had not
directly used live prey in their studies, the question of whether or not octopuses use distance
chemotaxis in natural circumstances has not been answered. Furthermore, Octopus rubescens has
not been used in any previous chemotaxis studies.

MATERIALS AND METHODS

Animals
Four wild-caught Octopus rubescens were collected from Puget Sound and brought to the Seattle
Aquarium where the behavioral experiments took place. The octopuses were kept in separate
holding containers in tanks of re-circulating, filtered seawater from Puget Sound. Two octopuses
were used for Y-maze experiments. Prior to the start of experimentation, all octopuses were put
on a fasting regimen consisting of feeding one live Hemigrapsus oregonensis once every three
days. Tests were conducted on feeding days once experimentation commenced.

H. oregonensis specimens were collected by the researcher during low tides at local beaches. A
total of 101 individuals were collected from the Golden Gardens beach in Seattle, WA and the
Des Moines Marina beach in Des Moines, WA. They were size-selected for individuals with
carapace length between 3 and 5 cm. They were kept in a container in a separate holding tank
from the octopuses.

Y-maze behavior experiments

Set-up
A 0.61 x 0.305 x 0.305-m (2 x 1 x 1-ft) tank was retrofitted to form a Y-maze. Water in-flow
came in from the aquarium’s filtered seawater supply, through plastic tubing to a tube splitter
and into two valves that lead into the tank. Water flowed at the same rate through both in-flow
valves. Water flowed out of the tank through a standpipe at the opposite end of the tank. The
tank also had a two-piece lid made of clear plexiglass.

To form a Y-maze within the tank, plexiglass dividers were constructed and placed within the
tank. The half of the tank containing the standpipe was separated from the other half using a
clear, plexiglass wall with a hole near the bottom for the octopuses to crawl through. A plastic
grating was placed in front of the hole and secured in place using a plastic clamp during
acclimation periods. The half of the tank containing the in-flow pipes was divided using a T-
shaped plexiglass structure that was either black (opaque) or clear. The black T was used during
blind trials and the clear T was used during visual trials. Water flow through the tank was tested
using green food dye. No mixing was shown between the arms of the Y-maze. Dye flowed
directly through the arm, through the hole in the dividing wall and to the standpipe without
contaminating the water flowing out of the other arm. It took about 1-2 minutes for the dye to
reach the holding compartment and thoroughly mix.

Boxes were constructed to hold the crabs at the ends of the Y-maze arms. Clear boxes were
constructed that minimized water leakage from the inside of the box to the water in the tank.
Opaque boxes were constructed out of black plastic grating with < 2-cm holes. These boxes were
also modified to clip onto the piping coming into the tank from the water in-flow valves. This
was so the water flowing into the Y-maze arms would flow directly past the crabs before
entering the tank.

The tank was blacked out using plastic black sheeting to eliminate light and movement
distractions. The sides and bottom of the tank were covered. For the first half of testing, only the
Y-maze half of the tank was blacked out. For the second half of testing, due to space issues at the
aquarium, the tank was moved and the remainder of the tank was blacked out. The top of the
tank was left clear for observation. (Fig 1)

Figure 1. Test tank diagram. Arrows indicate direction of water flow. Components: a) standpipe, b) barrier
wall, c) hole in barrier wall, d) plastic grating (to cover hole during acclimation), e) T-wall, f) crab boxes, g)
in-flow valves

Testing procedure
Octopuses were moved from their home tanks to the testing tank by removing the individual
containers from the home tank and putting them in the testing tank and allowing the octopuses to
swim out. The octopuses were then allowed to acclimate to the tank for 5-10 minutes (based on
preliminary trials and previous studies) with the grating in place on the divider to prevent the
octopus from entering the maze. Then a crab was moved from the holding container into one of
the boxes. A number randomizer was used to determine which arm the crab would be put in
during each test. The number randomizer was also used to determine which trial was to be done
on which days. This was done to prevent the octopuses from exhibiting learned behavior. After
the crab was placed in the box, 1-2 minutes was allowed for any crab “smell” to reach the
holding compartment of the tank. Then the grating was removed from the middle barrier and the
octopus was observed for about 40 minutes. After 40 minutes, the trial would stop, regardless of
whether or not the octopus made a choice. Data was collected regarding time of day and size of
crab, and when a choice was made, the time elapsed for the octopus to go through the barrier and
the time elapsed for the octopus to make a choice. The octopus was determined to have crossed
the barrier when its head passed through the hole. A choice was determined to be made when the
octopus’ head passed around the barrier into the Y-maze arm.

Crab analysis
H. oregonensis specimens were subjected to stress tests to analyze any differences between
stressed and non-stressed crabs through gene expression and protein analysis. To induce
mechanical stress on the crabs, 6 individuals were placed in a salad spinner and spun rapidly for
2.5 minutes. After being spun, the 6 experimental crabs were each placed in 13 mL of filtered
seawater in individual beakers. In addition, 6 control crabs were also placed in 13 mL of filtered
seawater in individual beakers. The crabs were allowed to remain in the water baths for 1 hour,
to give them time to excrete any stress-related compounds. At the end of an hour, the water
samples were collected into 15 mL conical tubes and placed in a -20 C freezer for future
analysis. The crabs were then quickly sacrificed and dissected. The gills were removed from
each individual. One gill from removed for RNA analysis and the other gill was used for protein
analysis.

Protein analysis
Each gill was placed in 0.5 mL of CelLytic MT solution in 1.5 mL Eppendorf microcentrifuge
tubes and was then homogenized thoroughly. The solution was spun in a microfuge for 10
minutes and the supernatant, containing the extracted protein, was transferred to a new tube then
stored at -20C. The protein was quantified using a Bradford assay but not normalized. Then an
SDS-PAGE was run for 30 minutes at 150 V. The gel was soaked in Coomassie stain for 5
minutes and then rinsed in acetic acid. This was repeated twice, then allowed to rinse in acetic
acid overnight.
Protein identification was accomplished by comparing the protein bands to brachyuran protein
sizes in the Swiss Institute of Bioinformatics ExPASy Proteomics TagIdent tool.

Gene expression
RNA was extracted from each gill using the Tri-Reagent method. The extracted RNA was
reverse transcribed to cDNA using AMV RTranscriptase. The cDNA was amplified, with
designed primers, using standard PCR protocol at annealing temperatures of either 50C or 55C.
Amplified cDNA was then run through an agarose gel at 105-110V for 30-40 minutes.

Primers were designed, using NCBI, for three stress-related genes identified in Carcinus maenas,
a closely related crab species. (Table 1, Table 2) The three genes were for: crustacean
hyperglycemic hormone (2 primers: CHH and CHH6), metallothionein (Mt), and Na+/K+-
ATPase (Na/K).
Gene Abbrev. Accession #
mRNA for crustacean hyperglycemic hormone (CHH) CHH X17596

CHH (PO-type) variant 6 precursor, mRNA, complete cds CHH6 AF286086

mRNA for metallothionein (Mt gene) Mt AM743086

Na+/K+-ATPase alpha subunit mRNA, partial cds Na/K AY035550

Table 1. Carcinus maenas genes and accession numbers

Gene Primer sequence

CHH Forward CCTCGCCAATGGAGCCCAGC
Reverse CCTGGAGGCACGCGAGGAGA
CHH6 Forward CACGCTCCACGCCAGGCTAC
Reverse CCTGCAGGCCGAGGCAACAT
Mt Forward AAGTGCACCTCCTGCCGCTG
Reverse AGCGTCCATCAGCATCCCGC
Na/K Forward TCCAGGGACCCCAGACGCAG
Reverse TAGTCTCCGCCACGGCTGCT
Table 2. Primer sequences for C. maenas genes

Water samples
Water samples were analyzed using a commercial saltwater aquarium testing kit (Aquarium
Pharmaceuticals Saltwater Master Test Kit) for pH, ammonia, nitrite, and nitrate. Two trials were
done per test per sample for 10 different water samples (5 control and 5 stressed), except for
nitrate where only one trial was done per sample. Filtered seawater was also tested as a control.

RESULTS

Behavior experiments
19 total trials were performed: 12 with Octopus 1 (O1) and 7 with Octopus 2 (O2). (Table 3) Out
of the 19 trials, 8 resulted in a choice. During 7 of the choice trials, the octopus chose the arm
containing the crab. Out of the 8 choice trials, 2 were blind trials. One blind choice trial resulted
in the octopus choosing the non-crab arm.

OCTOPUS 1
Trial Type Arm Time Time Total Choice
# through hole to choice time
1 Visual L 709 31 740 crab
2 Visual R - - - -
3 Blind R - - - -
4 Visual L 583 12 595 crab
5 Blind L - - - -
6 Visual R 1249 6 1255 crab
7 Blind R - - - -
8 Visual L - - - -
9 Visual R 691 2 693 crab
10 Visual R 584 22 606 crab
11 blind L 315 30 345 crab
12 blind R - - - -
OCTOPUS 2
Trial Type Arm Time Time Total Choice
# through hole to choice time
1 Visual L - - - -
2 Visual R 1760 124 1884 crab
3 Blind R - - - -
4 Visual L - - - -
5 Blind L - - - -
6 Visual R - - - -
7 Blind R 1914 11 1925 Non-
crab
Table 3. Behavioral trial results showing the type of trial, the arm the crab was placed in, the amount of time
through the hole in the barrier wall and time to choice once past the barrier (if choice was made). All time is
in seconds.
 VISUAL BLIND
Figure 2. Choice data for visual and blind trials.

Behaviorally, octopuses exhibited more frequent active behavior during visual trials. They would
“stand” by raising their body with their arms, change color, and/or use their arms to reach away
from themselves in an explorative nature. These behaviors were expressed 100% of the time
during visual trials and 63% of the time during blind trials. Octopuses were also more likely to
interact with the researcher during blind trials.

Figure 3. Amount ofVISUAL BLIND

active behavior shown during visual and blind trials.
Water sample analysis Sample pH Ammonia Nitrite Nitrate
No significant differences between stressed (mg/L) (ppm) (ppm)
Filtered 7.4 0.0 0.0 120
and non-stressed water samples were seen. seawater
(Table 4) However, for the nitrate tests, the C1 8.4 0.25 0 10
C2 8.4 0.375 0.125 20
stressed crab water samples had lower
C3 8.8 0.25 0 10
average nitrate than the non-stressed crabs. C4 8.8 0.25 0 10
C5 7.8 0.25 0 20
S1 8.4 0.25 0 5
Protein analysis S2 8.4 0.25 0 5
The protein gel showed bands in all samples. S3 8.6 0.25 0 5
(Figure 2) From the gel, 11 proteins of S4 8.4 0.5 0 10
S5 8.4 0.25 0 5
interest were identified and compared to Table 4. Water sample testing results for filtered
seawater (control), C1-C5 (unstressed crabs), and S1-S5
sizes on the public database. Out of the 11, 2 (stressed crabs)
proteins were unidentifiable, 5 proteins were
identified as arginine kinase, 1 protein was identified as hemocyanin subunit 2, 1 protein was
identified as superoxide dismustase, and 2 cuticle proteins were also identified.

Figure 2. SDS-PAGE. On the left is the unmodified gel showing bands. On the right is the modified gel, showing the
11 proteins of interest. From top to bottom: hemocyanin subunit 2, unidentified, 3-7: arginine kinase, unidentified,
superoxide dismutase, 10-11: cuticle proteins.
Gene expression
Genes were able to be amplified onto PCR gels. The CHH and Na/K primers seemed to work the
best out of the four primers. However, due to unidentifiable contamination and/or issues with the
primers, the PCR gels did not provide any quality banding or conclusive results.

DISCUSSION

O. rubescens was shown to have the ability to adapt to the testing conditions of Y-maze
experiments, as other octopus species have been shown in the past. The individuals showed that
there is the possibility for limited chemotaxis in the species. In addition, specific proteins were
identified in H. oregonensis that could potentially be involved with predator identification of the
crabs.

Behavior trials
Although no definitive conclusions can be reached due to the results, the trials do seem to
indicate that the octopuses do respond to this type of testing procedure. Even though the majority
of the trials in which an animal made a choice were visual trials, the two blind trials are still
important.

The blind trial in which the octopus did find the crab (O1 - #11) is particularly important. It
suggests that there was some cue that the octopus responded to and it is likely that that it was a
chemical cue. This trial did happen after several choice trials were completed with O1, which
could mean that the octopus did learn how to go through the maze to find food. However, this
trial was done more than two weeks after the previous trial, which had been shown during this
process to be a significant enough amount of time for the octopuses to “forget” about the testing
procedure. (The octopuses would react negatively to the researcher when time between trials was
greater than 1 week.)

The second blind trial in which the octopus made a choice (O2 - #7) is also significant as is the
only trial where an octopus chose to go down the arm not containing the crab. This animal had
been showing increasingly aggressive behavior as the trials had progressed and it is possible that
the choice was merely made because the octopus wanted to move around. However, she did
quickly make a choice once it went through the barrier, suggesting that she knew where she
wanted to go based on a cue of some kind. During the one prior trial with O2 where she made a
choice (O2 - #2), the crab had been in the right arm. During this trial, the arm with the crab was
on the left. It is possible, but not probable, that the octopus remembered that the crab was in the
right arm during the previous trial. However, almost 3 weeks had passed between the two trials.

All the visual trials were fairly consistent regarding the behavior of the octopuses. Their direct
behavioral response to visual identification of the crab was apparent and much more frequent
than the blind trials. This suggests that the octopuses respond more readily to visual cues than
chemical cues. The importance of their vision was also indicated during blind trials when the
octopuses would interact with the researcher. The interaction increased once the entirety of the
tank was blacked out on all sides during the second half of testing. This resulted in frequent
behavior termed “peek-a-boo behavior” by O1. O1 would position herself near the surface of the
water in such a way that she could have visual contact with the researcher during observation
periods if visual contact was obstructed. O2 developed a more aggressive tendency during the
second half of testing. She would frequently try to escape down the standpipe but also directly
interacted with the researcher during transportation between tanks as well as during observation
periods. This generally manifested itself as excessive squirting of water through the siphon at the
researcher and attempts to grab onto and bite the researcher’s hands. This happened more
frequently during blind trials than during visual trials. The increased interactive behavior of the
octopuses during blind trials suggests that when the octopuses were placed in an environment
with no visual complexity, they will show more interest in things outside of their immediate
environment.

Further behavioral tests are needed for definitive results on the ability of octopuses to orient
themselves over distance to chemical cues in live prey. Future studies should involve longer time
periods as well as a larger number of test animals, to further reduce personality and behavioral
biases. The excretions of crabs (or other prey items) should also be measured to determine the
concentration of chemical signals that could potentially be detected by octopuses. Prey choices
could also include other taxa, such as bivalves.
Water sample analysis
The water samples were stored at -20C for over two months before they were tested. It is
probable that the length of storage resulted in an inaccurate measurement of any of the tests run.
The nitrate control (filtered seawater) was at an abnormally high level (120 ppm). For control
purposes, the ideal amount of nitrate in the filtered seawater should have been between 0-2 ppm.
The original filtered seawater was unlikely to have such a high level of nitrate since the nitrate
levels for the water samples was much lower than this.
Water sample test results from stressed crabs, compared to non-stressed crabs, should show
higher ammonia levels (due to increased ammonia excretion), higher pH (due to increased
respiration), higher nitrite (due to increased ammonia excretion), and higher nitrate (due to
increased waste production). Future tests on the excretions of stressed crabs should be done
immediately after gathering water samples.

Protein analysis
The superoxide dismutase protein as well as one arginine kinase protein seemed to be expressed
more in stressed crabs than non-stressed crabs. This is expected because superoxide dismutase
and arginine kinase are expressed during stress. Superoxide dismutase is used in anti-oxidant
defense by breaking down reactive oxygen species that can be created in excess during stress.
Arginine kinase increases the production of ATP, which is needed at various levels during times
of stress. However, since 4 other arginine kinase proteins were expressed in varying patterns.
The cuticle proteins expressed were most likely seen due to contamination during the dissection
of the crabs. The hemocyanin subunit 2 protein was most highly expressed due to the fact that
the tissue sampled was gill tissue.

Further tests of the effect of mechanical stress on crabs may need to include more intensive stress
on the crabs. It is possible that more definitive effects of stress could have been seen in the
protein gel if the crabs had been exposed to a longer period of time in the salad spinner. Other
tissues may also be tested to look for different stress-related proteins. The gill tissue had low
amounts of protein in them originally and it may be more beneficial to look at a tissue that would
contain a higher concentration of proteins.
Gene expression
The RNA extraction protocol was done over the span of several weeks, rather than being finished
immediately. In addition, the amount of RNA extracted was unable to be quantified or
normalized due to unknown contamination. Due to time constraints, and limited resources for
crab specimens, these procedures were unable to be re-done. The primers, however, seemed to be
a good choice for analyzing gene expression in the gills. Future trials could include these primers
to analyze the gene expression in gill tissues. Future trials could also analyze different tissues,
particularly if different tissues were analyzed for protein expression.

Conclusion
Although this study does not conclusively prove that octopuses cannot use distance chemotaxis
when searching for live prey, it does bring more questions into play. Further studies, particularly
behavioral studies, with octopuses and live prey in maze situations or other directional choice
trials are required to determine the distance chemotaxis abilities of octopuses. Another aspect to
analyze could be the difference in chemotaxis abilities for octopuses when prey animals are
stressed. It is possible that stress can increase the excretion of compounds that octopuses can
taste in the water, thereby making it easier to find prey that are stressed than prey that are not.

The sensitivity of octopus’ chemoreceptive capability is something that is still being explored.
Recent research is also continuing to explore octopus foraging behavior in the wild. The question
of distance chemotaxis in octopuses is something that can help identify the overall abilities of
octopuses to hunt as well as help explore the overall complexity of the octopus nervous system.
Their ability to find live prey over distance through chemotaxis is something that must be
addressed to understand the full capacity of octopus sensory systems.
REFERENCES

Chase, R., and Wells, M.J. 1986. CHEMOTACTIC BEHAVIOR IN OCTOPUS. Journal of
Comparative Physiology a-Sensory Neural and Behavioral Physiology 158(3): 375-381.

Forsythe, J.W., and Hanlon, R.T. 1997. Foraging and associated behavior by Octopus cyanea
Gray, 1849 on a coral atoll, French Polynesia. Journal of Experimental Marine Biology and
Ecology 209(1-2): 15-31.

Graziadei, P. 1962. RECEPTORS IN SUCKERS OF OCTOPUS. Nature 195(4836): 57-&.

Lee, P.G. 1992. CHEMOTAXIS BY OCTOPUS-MAYA VOSS ET SOLIS IN A Y-MAZE.

Journal of Experimental Marine Biology and Ecology 156(1): 53-67.

Mather, J.A. 1991a. FORAGING, FEEDING AND PREY REMAINS IN MIDDENS OF

JUVENILE OCTOPUS-VULGARIS (MOLLUSCA, CEPHALOPODA). Journal of Zoology
224: 27-39.

Mather, J.A. 1991b. NAVIGATION BY SPATIAL MEMORY AND USE OF VISUAL

LANDMARKS IN OCTOPUSES. Journal of Comparative Physiology a-Sensory Neural and
Behavioral Physiology 168(4): 491-497.

Mather, J.A. 2008. Cephalopod consciousness: Behavioural evidence. Consciousness and

Cognition 17(1): 37-48.

Mather, J.A., and Odor, R.K. 1991. FORAGING STRATEGIES AND PREDATION RISK
SHAPE THE NATURAL-HISTORY OF JUVENILE OCTOPUS-VULGARIS. Bulletin of
Marine Science 49(1-2): 256-269.

Rodhouse, P.G., and Nigmatullin, C.M. 1996. Role as consumers. Philosophical Transactions of
the Royal Society of London Series B-Biological Sciences 351(1343): 1003-1022.

Sumbre, G., Gutfreund, Y., Fiorito, G., Flash, T., and Hochner, B. 2001. Control of octopus arm
extension by a peripheral motor program. Science 293(5536): 1845-1848.

Wells, M.J. 1963. TASTE BY TOUCH - SOME EXPERIMENTS WITH OCTOPUS. Journal of
Experimental Biology 40(1): 187-&.

Yarnall, J.L. 1969. ASPECTS OF BEHAVIOUR OF OCTOPUS-CYANEA GRAY. Animal

Behaviour 17: 747-&.