You are on page 1of 163

ACTO TERCERO

Rocas, huesos, neuronas y genes, odas a la
vida y su historia

De la Biología al Mito

H. Azurduy-Ferreira

Cronos,
dios del Tiempo, devoraba a todos los hijos que tenía, pues
temía que alguno le quitara su trono. Entonces nació Zeus.
Su esposa, Rea, lo dio a luz secretamente, y le entregó a su
esposo, en cambio, una piedra envuelta en pañales. Cronos,
engañado, devoró la piedra inmediatamente. Zeus fue criado
por las ninfas y amamantado con la leche de cabra. Cuando
creció, se hizo copero de su padre, y le echó una pócima en la
bebida. Al beberla, Cronos vomitó a todos sus hijos,
empezando por la piedra y siguiendo por Hades, dios del
mundo de los muertos, Poseidón, dios de los mares, Deméter,
diosa de las estaciones, Hera, con quien después se casaría
Zeus, y Hestia, diosa del fuego del hogar.

37

De la Biología al Mito

VIII

H. Azurduy-Ferreira

EVIDENCIAS

1. Los fósiles
Es factible imaginar el desconcierto de los primeros humanos que tuvieron
conciencia de aquellas estructuras pétreas con formas que parecían haber sido
esculpidas o grabadas. Las primeras explicaciones en relación a su naturaleza,
fueron curiosas y llamativas, muchos pensaron que eran objetos malignos,
experimentos del creador, restos dejados por el gran diluvio, etc.
Richard Lyell es el primero en afirmar que la corteza terrestre no siempre tuvo la
conformación actual, sino que gracias a las fuerzas internas de la Tierra (lo que hoy
conocemos como movimientos convectivo s del magma), la misma sufrió muchos
cambios, como la formación de montañas, elevación de grandes porciones
terrestres, formación de valles, etc. Las consecuencias teóricas fueron evidentes; se
comenzó a concebir que la Tierra era mucho mas antigua de lo que se pensaba; que
los sedimentos o estratos rocosos no eran mas que vestigios de lechos marinos,
lacustres, deltaicos o pluviales cuyas edades solo podían ser concebidas en millones
de años y que los fósiles albergados en esas capas rocosas podían indicarnos las
características de cómo fue la vida en el pasado incluso antes de que el mismo
hombre ¨aparezca¨. La historia nos indica que el primero en afirmar, que los fósiles
son vestigios de vida en el pasado, fue Leonardo da Vinci.
Hoy en día, para un evolucionista, los fósiles se constituyen en una especie
de ventanas a través de los cuales podemos rescatar fotografías del pasado, muchas
veces estas fotografías pueden resultar no muy claras o con ciertas distorsiones de
imagen, pero con la suficiente información como para formarnos una idea de qué
hubo y cómo fue un “momento” determinado de la historia geológica. Cuando
hablamos de historia geológica, es como hablar de un libro antiguo y polvoriento al
que le puede faltar hojas, en este caso es evidente que no tendremos acceso al
detalle de las hojas faltantes, lo que no impedirá que nos aproximemos al
argumento general de la obra. Algún literato acucioso se preguntaría con mucho
tino ¿y si falta el nudo de la obra? Al respecto, diría que es ahí cuando surgen los
grandes problemas y conflictos en paleontología ya que son ¨hojas clave¨ que
contienen una información importante para resolver nudos del gran teatro de la
evolución, cuyo argumento del pasado venimos escribiendo en base a lo que nos
dicen los fósiles.

Intento de definición de un fósil
Para alguien sin formación previa, un fósil sería una piedra con un diseño llamativo. ¿Es
dicha aseveración incorrecta? un paleontólogo diría que sí, ya que no incorpora los rasgos
históricos del fósil. En realidad, ambos tendrían razón a medias ya que fácticamente los
fósiles son rocas con un significado y cuya trascendencia, valor e implicaciones nacen de un
enfoque individual que puede ser muy diverso o heterogéneo. De ahí la importancia de las
definiciones científicas de consenso. En el caso de los fósiles, su definición antes que a su

38

Dichas evidencias pueden ser restos del organismo fosilizado (huesos. Origen de peces mandibulados. PALEOZOICO Origen y desarrollo del hombre moderno. Gran diversificación de invertebrados marinos. Primeras plantas terrestres vasculares. Diversidad de anfibios. 1995).a. Continúa la diversificación de invertebrados marinos. huevos con embriones. (Modificado de Rich et al. Diversificación de reptiles. Azurduy-Ferreira estructura como materia. 225 m. troncos. La mayor extinción en masa. Diversidad de anfibios.) o rastros indirectos que lograron preservarse y que demuestran su existencia (huellas. hojas. etc. Evolución de las angiospermas. plantas con semilla. pieles. 39 . Cretácico La mayoría de los continentes separados. Primeros insectos alados. Primeros reptiles. Aparición de las gimnospermas. Se desarrolla la agricultura y las civilizaciones.a. Se incrementa el frío (glaciaciones). GRANDES EVENTOS Y VIDA CARACTERÍSTICA Cámbrico Diversificación de peces óseos. hongos. Origen de protovertebrados. adopta un significado a los ojos de quien sabe leer y entender no solo la forma biológica sino el espacio temporal. huevos. Bajo nivel del mar. recurre a su rasgo principal. 1995 y Long. helechos. Extinción de grandes aves y mamíferos. anfibios. Leakey y Lewin. incluyendo primeros dinosaurios y primeros mamíferos. Dado el significado histórico. Origen de los ammonoideos. Diversificación de peces agnatos (sin mandíbulas). Extinción en masa al terminar el periodo. Pérmico Continentes agregados en Pangea. incluyendo amonites y dinosaurios. Dominan las plantas gimnospermas.a. insectos. El mundo animal y vegetal adquiere su aspecto actual. ESCALA DEL TIEMPO GEOLÓGICO desde el Cámbrico y acompañada de los principales eventos biológicos y tectónicos que caracterizaron a cada periodo. dientes. Revolución marina en el mesozoico. Gran diversidad de trilobites. plantas angiospermas. Radiación de los mamíferos. CENOZO ICO ERAS PERIODOS Cuaternario Terciario MESOZOICO 65 m. incremento de la diversidad en angiospermas. Primeros reptiles. Futuyma. los fósiles son reconocidos ante todo como evidencias directas de organismos que vivieron en épocas geológicas pasadas. 1998. serpientes. Extensos bosques de tempranas plantas vasculares. Devónico Silúrico Ordovícico 570 m. Prosperan los moluscos cefalópodos. Los continentes adquieren su posición actual. Mamíferos arcaicos. Aparición de la mayoría de los phyla en relativamente “corto” período de tiempo. aves. el histórico.. Glaciaciones. mamíferos y aves (aunque se difunden aún las aves con dentición). impresiones de piel y heces fecales reconocidas en Paleontología como coprolitos). de ahí que esa estructura pétrea sin dejar de ser tal. y peces teleósteos. 1996. insectos polinizadores. Jurásico Diversidad de dinosaurios y otros reptiles. Aparecen las aves (Archaeopterix). Triásico Continentes comienzan a separarse. Plantas criptógamas invaden tierra firme. organismos preservados en ámbar.De la Biología al Mito H. Primeros peces agnatos (Sacabambaspis janvieri de Bolivia). Carbonífero Se forma Gondwana.

Azurduy-Ferreira Proceso de formación de un fósil o Tafonomía (Taquet. 1993a).De la Biología al Mito H. 40 .

De la Biología al Mito H. De igual forma. De esta manera la historia geológica ha sido dividida en Eras. Darwin encontró muchos fósiles de mamíferos extintos como: gliptodontes. después. y. Es que ha sido posible que los mismos contribuyan a proyectar una historia del pasado. de modo que su tarea se complica de forma análoga a los vacíos y enigmas existentes aún en el conocimiento de muchas culturas humanas. Durante el viaje del Beagle me sentía profundamente impresionado al descubrir en las llanuras pamperas grandes animales fósiles recubiertos de una armadura semejante a la de los armadillos actuales. debido a las evidencias dejadas en obras tan monumentales como sus pirámides. materiales de cerámica o grabados en bajo relieve (izquierda abajo). las evidencias de vida conservadas en las rocas como Archaeopteryx (izquierda arriba) nos permite remontarnos millones de años atrás. milodontes. sus características biológicas. Las evidencias fósiles en base a las que se escribe la historia geológica son similares a los vestigios arqueológicos con los cuales tratamos de reconstruir el pasado del hombre ¿Podemos negar la existencia de la cultura egipcia? Parece que no.600 millones de años). consagré todo mi tiempo a poner en orden mis notas y a hacer observaciones y experimentos sobre la transmutación de las especies. roedores. hasta organismos sobre los cuales podemos no solo evidenciar su existencia sino. buscando un modo sistemático de narrar la misma. La diferencia radica en las magnitudes de tiempo en las que una (la arqueología) llega hasta los albores en los que Homo sapiens comienza a desarrollar cultura material. megaterios. mientras que otra (la paleontología) se remonta a periodos en los que el hombre no había ¨arribado¨ aún. Epocas y Edades teniendo como puntos de partida el origen de la Tierra (4. Periodos. sus acontecimientos. etc. en fin. cuyo desarrollo y con esa nuestra manía de historiadores hemos convenido en estratificar. su significado en el proceso histórico de la vida. por el orden en que los animales de especies casi semejantes se reemplazaban unos a otros a medida que se avanzaba hacia el sur del continente (hace referencia a América). 41 . etc. Azurduy-Ferreira Mensajes entre rocas (Opus 1) En su exploración de la costa Sudamericana. por el carácter sudamericano de la mayoría de las especies de las Islas Galápagos y muy especialmente por la manera cómo ellas difieren ligeramente entre sí en cada isla del grupo…” Siendo los fósiles elementos naturales que nos permiten una aproximación al pasado geológico. una de sus impresiones sobre tales circunstancias podemos conocerla en un fragmento de su autobiografía: “A partir de septiembre de 1854. sus papiros.

pómulos. felis no fue muy desarrollada. Esto hace suponer que la inteligencia de B. etc. Conocida la conformación ósea y muscular podemos deducir aspectos relacionados con el movimiento. ubicación del foramen magnum y sus implicancias en el andar bípedo. Los huesos también dejan rastros claros respecto a inserciones nerviosas que los recorrieron principalmente en cavidades y canales craneales y vertebrales. con lo que su reconstrucción respecto a su coloración podría mostrar un dientes de sable con manchas o franjas. nos puede dar una pauta real sobre la constitución anatómica y corporal de un vertebrado. Barbara felis. Conocido el movimiento. etc. desplazamiento. Es el caso de los moldes cerebrales obtenidos a partir de los cráneos de homínidos arcaicos. dándonos pautas acerca del sistema nervioso de los organismos en cuestión. etc.De la Biología al Mito H. características corporales. hábitos. etc. a su masa corporal. nariz. reconstruyen organismos enteros a partir de la conformación esquelética de un tipo de estos reptiles. felis usara como estrategia de ataque o cacería la emboscada aspecto que requeriría de un patrón de coloración efectivo de camuflaje. Es así. mientras que su cerebro era casi equivalente al de un pequeño gato montes. leones. 42 .). mentón. boca. conocemos también que los reptiles voladores (pterosaurios) tenían una capacidad visual extraordinaria pero un olfato muy pobre dado sus grandes lóbulos ópticos y pequeños lóbulos olfatorios en el cerebro. indicándonos acerca de la forma y tamaño. ó que los primeros mamíferos estuvieron provistos de un sentido olfatorio muy desarrollado. tigres.) situación esta. disposición y abundancia de circunvoluciones cerebrales. Es así. En este sentido lo más probable es que B. la misma que nos da una valiosísima información sobre la forma. una especie de tigre de dientes de sable (ya extinto). tuvo un cerebro muy pequeño en relación. que no es más que la aplicación de metodologías forenses que eventualmente se las realiza en humanos actuales para identificar por ejemplo. cerebros y sentidos Un anatomista. que constituiría la parte mas especulativa pese a que posean argumentos razonables o lógicos. ya que una cola larga es fundamental para realizar giros bruscas durante la persecución. un cadáver del que solo se poseen restos óseos y no así datos de identificación. Los huesos pueden poseer marcas de los órganos que sostuvieron. tal y como se ve en felinos actuales. tamaño del cerebelo. que un conglomerado de huesos armados siguiendo simples principios de anatomía (o anatomía comparada en el caso de organismos poco conocidos). como el. Azurduy-Ferreira Músculos. teniendo de esta manera aún mas pistas para conocer aspectos no solo comportamentales sino de inteligencia. a partir de los cuales sabemos cuál fue su capacidad cerebral. De esta manera los dinosaurólogos. podemos pasar a ciertos aspectos relacionados con el comportamiento (velocidad. Al margen de ello. que gracias a los datos mencionados anteriormente sabemos sobre el sistema sensorial de muchos peces fósiles. situación que describe a un animal que difícilmente pudo haber realizado persecuciones efectivas y de larga distancia. es decir su envergadura era aproximadamente a la de un oso actual. sabe que un hueso desprovisto de carne puede decirnos mucho sobre los músculos que lo circundaron. Además de aspectos externos como la forma del rostro (frente. jaguar. su conformación esquelética muestra a un animal lento y con cola muy corta y apenas visible.

etc. migraciones. Anteriormente habíamos indicado que la consecuencia anatómica inmediata de un esqueleto reconstruido es la forma del cuerpo que este sostuvo o protegió. así. de donde tendríamos una idea acerca de la posible estructura social. dispersión. hábitat. Hábitos Los ensanchamientos en determinadas áreas cerebrales. quien además de ello redujo considerablemente los huesos de las alas. si es (o fue) carnívoro o herbívoro. Los pingüinos dad o sus hábitos acuáticos han desarrollado una estructura alar particular. Por ejemplo. en la que el vuelo ha sido sustituido por el nado y en consecuencia. Los ejemplos de estructuras que hacen predecible los hábitos y hábitats de determinados organismos (como los anteriormente mencionados) son incontables. puede permitirnos discernir además. esta situación. caminar bípedo o cuadrúpedo.De la Biología al Mito H. pero sí se encontraron huellas que confirmaban su presencia. estrategias de sobrevivencia. es posible. Por ejemplo. Azurduy-Ferreira Forma y función La forma de un esqueleto puede decirnos muchos acerca del organismo a investigar. completamente densos y cortos (no cilíndricos. cambio de velocidad. establecer a partir de la observación de la estructura. dirección. producto de la acción de caracoles con la habilidad de introducir una especie de lengua provista de diminutos dientecillos (radula) con la que devoraba la carne del interior de su presa. como evidencias de parasitismo en aquellos casos en los que el hospedero demuestra orificios en su superficie. nos indica que el mismo utilizaba dicho microhábitat. De las mismas se dedujeron velocidad aproximada de traslación. los huesos alares de los pingüinos son aplanados. La ausencia de quilla en el esternón de algunas aves evidencia una clara incapacidad de volar. tamaño del animal. es decir la posibilidad de saber si los mismos formaban manadas. Caracoles marinos fósiles encontrados sujetos a superficies de otros organismos nos indican evidentes indicios de que los mismos se alimentaban de desechos producidos por sus hospederos (comensalismo) cuando estos se alimentaban. pueden indicarnos si un animal cazador localizaba preferentemente su presa a través de la utilización de la vista o el olfato. en las canteras de Kal Orq’o no se encontró dinosaurio alguno. etc. etc. cooperación. 43 . son signos de actividades desarrolladas por el mismo en un momento determinado de su existencia. Así. si vemos pequeñas almejas actuales con espinas que las cubren. volador o fosorial. tal y como sucede con caracoles parásitos actuales. cangrejos fósiles encontrados dentro de túneles de gusanos marinos. como fue el caso del ave dodo (Raphus cucullatus –ya extinto) de la isla Mauricio. Por ejemplo en Sucre. huecos y largos como en aves típicamente voladoras). aspectos como la función de las estructuras y de esta manera conocer sus hábitos. y usados a modo de remos. etc. Las huellas fósiles mas allá de ser evidencias indirectas de la presencia o existencia de un organismo en un determinado lugar y tiempo. huellas de esta naturaleza pueden sugerirnos si la traslación de un conjunto de organismos de la misma especie pudo haber sido en grupo o no. si es (o fue) cursorial (que corre). podemos deducir que las mismas se distribuyen en lechos muy lodosos e inestables ya que las espinas le son útiles para permanecer estables y de esta manera no hundirse considerablemente dentro del lodo. si un determinado organismo es (o fue) vertebrado o invertebrado. Al margen de ello. El hallazgo in situ de algunos organismos nos puede permitir deducir algunas de las actividades realizadas por el mismo.

600 m. luminosidad. 44 . nautilos. Posteriormente en el tiempo aparecen los primeros invertebrados marinos (ostras. Estromatolitos actuales. abisal. velocidad de sedimentación. bipedismo en el desplazamiento. trilobites. uno de ellos fue concretado en 1950 por H. las temperaturas de verano fluctuaron entre 20 y 21 °C. de antigüedad. C. A partir de los resultados obtenidos. zonas marinas (litoral. y que murió en su cuarta primavera. evidencian claramente. El gran perfil temporal que el registro fósil nos brinda debe ser tomado como una proyección parcial de la vida pasada. pueden ser encontrados en costas australianas. las mismas. etc. batial. es evidente en el registro fósil. y que además durante su periodo de vida. y cuyas huellas fueron encontradas sobre ceniza volcánica petrificada. braquiópodos. Por ejemplo. Urey. el mismo que tiene vestigios de vida de hace casi 3.a. una serie de datos paleoclimáticos muestran que a finales de la era Mesozoica (era de los reptiles) el clima cambió considerablemente ante la baja de las temperaturas. jibias. quien en base. etc. Por ejemplo los corales fósiles pudieron haber estado asociados (como sucede ahora) a zonas no muy profundas y de aguas claras.a. Azurduy-Ferreira Huellas fósiles han sido cruciales a la hora de confirmar al primer homínido bípedo (Australopithecus afarensis) que vivió entre 3.) de 150 m. lirios de mar. determinó que el animal desovaba en verano. hay muchos que no están conservados. de modo que en la trama que reconstruimos pueden eventualmente no estar incluidos. Esta situación ha sido y es uno de los temas más delicados y conflictivos cuando se habla de recrear tendencias evolutivas en base a los fósiles. han sido desarrollados. Mientras que el estudio de los sedimentos puede establecer. donde aún se distribuyen y sobreviven. corales. etc. les siguen los primeros peces.De la Biología al Mito H. deltaico. ambiente (lacustre. que geológicamente se correlacionan con estratos sedimentológicos en los que se encontraron cráneos de esta especie homínida. marino y/o fluvial).6 y 3 m. lo que sugiere a su vez que dicho cambio fue uno de los factores que incidió en la desaparición de estos fascinantes reptiles. caracoles marinos. granulometría. Ambientes y asociaciones La presencia de determinados tipos fósiles pueden darnos datos valiosos en relación. Fósiles de palmas son signos de ambientes cálidos. este periodo de cambios climatológicos coinciden con el fin de los dinosaurios (fines del periodo Cretácico). luego los reptiles y finalmente tanto aves como mamíferos (entre los que se encuentra el hombre). salinidad. ya que si bien contamos con muchos de los protagonistas de esa historia pasada. direccionalidad de la corriente. a ciertos parámetros físicos de un determinado paleoecosistema.a. que vivió casi cuatro años. con la aparición de las primeras algas verdeazules.). así como los helechos fósiles son indicadores de ambientes húmedos. Restos fósiles de renos pueden ser claros indicadores de ambientes muy fríos.. las mismas que se conservan en estructuras fósiles denominadas estromatolitos. Evolución La progresión de formas simples a mas complejas. Métodos para la determinación de paleoclimas. como temperatura. a isótopos de oxígeno de un belemnoide jurásico (pariente de los actuales pulpos.). etc. luego los anfibios. la utilización del método de Urey se hizo común a la hora de abordar aspectos relacionados con paleoclimas.

una historia sin códices (Opus 2) El re gistro fósil nos muestra que los vertebrados más antiguos son los peces. Con esta nueva adaptación los reptiles se “independizan” aún mas. Eriops. Azurduy-Ferreira La proyección de tendencias evolutivas a partir de fósiles tienen que ser tomados como un nivel de conclusiones temporal. los mismos que a finales del Devónico se convierten en los primeros vertebrados en colonizar tierra firme en forma de anfibios muy primitivos denominados laberintodontos (dientes con conducto longitudinal) Ejemplos de anfibios de esta etapa son Ichthyostega. El pez más antiguo fue encontrado en Bolivia. Escena 1: El primer canto de una rana El siguiente paso evolutivo fueron los anfibios. sí. La poiquilotermia (incapacidad de regular la temperatura corporal) sigue siendo mantenida. el nombre de la especie va en alusión a Philippe Janvier. Este pez pertenece al periodo Ordovícico y es parte del grupo de los agnatos (peces sin mandíbula). escamas. es la reproducción terrestre y el desarrollo del amnios (que posteriormente se mantiene en mamíferos y aves) cubierto por una “cáscara” externa que protege al embrión de la desecación cuando el huevo es ovopositado en ambientes secos. los huevos no pueden ser puestos en medios secos ya que no cuentan con una “cáscara” protectora a la desecación. Al margen de ello. de ambientes acuáticos. de ahí su nombre. aunque sus hábitos pueden ser predominantemente terrestres. aunque evidencias de notocorda (especie de cordón flexible que sostiene el cuerpo) son encontrados entre los representantes del Phylum Hemichordata. la de aletas. dado el hecho de que el futuro nos puede traer nuevos elementos de juicio no considerad os en fases de investigación tempranas. un paleontólogo francés cuya labor es notoria en el campo de los peces devónicos del mundo. respiración branquial (en la fase adulta de su desarrollo). Acanthostega. los reptiles muestran un mayor grado de osificación en relación. no se desvincula completamente del medio acuático. en la localidad de Sacabambilla (Cochabamba). en la que se evidencia el desarrollo progresivo de los miembros. Cacops. Escena 2: Escamas sobre tierra Los reptiles en el registro fósil. una de las “novedades” evolutivas más importantes en los reptiles. El paso evolutivo de peces a anfibios no incluye la pérdida de vértebras . como miembros adecuados para el desplazamiento en tierra (aunque también sean efectivos para ambientes acuáticos). Los resabios de lo que alguna vez fue una estricta dependencia del medio acuático son evidentes en su ontogenia temprana (fase larval). De los peces al hombre. Sacabambaspis janvieri.De la Biología al Mito H. Es decir. 45 . En la segunda fase. lo que les proporciona una mayor efectividad de locomoción en ambientes terrestres. una primera fase estrictamente acuática (renacuajo). a los anfibios. el acortamiento paulatino de la cola hidrodinámica y la formación de branquias. ya que por ejemplo se reproduce en el agua. “aparecen” después que los anfibios (Carbonífero medio) y en forma de “lagartijas” pequeñas (Hylonomus). etc. etc. y el desarrollo de nuevas estructuras. etc. Organismos intermedios entre pez y anfibio (Eusthenopteron) evidencian un traslado de los vertebrados del agua hacia ambientes terrestres.

los mismos que denotan características intermedias entre ambos organismos. Escena 4: ¨Icarus primigenius¨ Las aves también son el producto de la evolución de los reptiles. Posteriormente son evidentes en el registro fósil especies del género Homo como: H. es decir.a. y 300.-300. España.a. ramidus (4. anamensis (4.De la Biología al Mito H. Archaeopterix lithographica el ave mas antigua hasta hoy encontrada (calizas de Solnhofen. etc. lo que nos da una idea de cuan sorprendente es esta forma intermedia entre ave y reptil.). en el registro fósil.000 años (yacimiento de la Gran Dolina) y al que han convenido en denominar Homo antecessor. Azurduy-Ferreira Escena 3: De los pelos y su origen Los mamíferos evolucionan a partir de “reptiles mamiferoides”. y con una capacidad craneal entre 600-800 c.c.c. garras en las alas y dientes en las mandíbulas. evidencian la ausencia de superficies de inserción para el músculo supracoracoideo. Posterior al registro de esta ave hubo un gran vacío de casi 65 m.6 m.c.a. Los huesos alares por su lado.9) m.).a.000 años.). es decir.500 c. denotan la presencia de plumas. una gran cantidad de fósiles de homínidos europeos.a. boisei (2.a. destrucción mecánica por parte de los predadores. A. habilis (2. solo aves y mamíferos comparten esta propiedad). A. data de hace aproximadamente 150 m.2-3. H.400 c. H.4-1 m.y 1.4-1 m. fue clave para que los mamíferos progresen en este planeta y se irradien evolutivamente a diferentes ambientes ecológicos que quedaron desocupados. Los restos de los homínidos más antiguos provienen de Africa y pertenecen al género Australopithecus el mismo que como especies tiene a A.). que es fundamental para que las alas sean elevadas hacia arriba durante el vuelo. (centímetros cúbicos).). Alemania). robustus (2. A. sapiens sapiens (100.000 años) y en los que han sido hallados.000 años.000 años –aunque nuevas evidencias elevan las edades a rangos entre 53 y 27.a.2 m. fueron muy pequeños y activos predadores de insectos.000 c. entre ellos un organismo que hoy en día nos es demasiado familiar y al que conocemos con el denominativo de hombre.) y terrestres los mas. De no haber sido preservadas las plumas. Los primeros registros fósiles de mamíferos verdaderos (Megazostrodon) provienen del periodo Triásico tardío y su forma recuerda a la de las actuales musarañas.c.6-3 m.a.a. erectus (1. los primeros fósiles de Archaeopterix pudieron haber sido descritos fácilmente como los pertenecientes a un reptil. luego del surgimiento de los mamíferos. entre ellos uno que data de hace 800. aethiopicus (2.8 m. La extinción de los dinosaurios hace 65 m.a.). Todos ellos con capacidades craneales que oscilaron entre menos de 400 y 450 c. neanderthalensis (300.4 m. la misma que por ejemplo les permite aumentar sus posibilidades de dispersión en su distribución biogeográfica y ser más activos ante bajas temperaturas. etc. A.a. Los fósiles de Archaeopterix.). una cola muy larga. su principal dieta.). Con los mamíferos aparece la homeotermia (condición fisiológica que permite al organismo regular su temperatura.) y H. excelentemente conservados. lo que es fácil de explicar dada la baja probabilidad de fosilización de huesos de estos organismos (fragilidad ósea. lo que hace suponer que Archaeopterix mas que volar lo que hacía era planear o desarrollar un “vuelo” no efectivo. acuáticos (ballenas. acción de factores climatológicos como el viento.000 y 30.000 años a la actualidad y 1.4-1 m. es así que hoy vemos que los mamíferos han ocupado ambientes aéreos (murciélagos).5-1. delfines. Aquí hay que destacar los hallazgos realizados en Atapuerca. poca probabilidad de un enterramiento inmediato.) que 46 .a. afarensis (3. de capacidad craneal).c. en un complejo de yacimientos geológicos (que oscilan entre 1. 1. A. (Jurásico tardío).

ambos aunque de líneas epistemológicas opuestos (no hay que olvidar) generados en la mente humana como una forma de interpretar y definir la vida en sus diferentes facetas. Las plumas son buenos aislantes con lo que ayudan a mantener el calor corporal y sin duda la función más efectiva se relaciona con el vuelo (tanto en alas como en cola).De la Biología al Mito H. Azurduy-Ferreira son muy raros en el registro fósil. cuyo origen (se supone) se desarrolló a partir de escamas reptilianas altamente modificadas. los organismos voladores por excelencia.. unas veces guiadas por constructos ideológicos de orden metafísico o estad ios de conocimiento de la lógica positivista. vuelan a alturas de 9. Las aves son hoy.a. Esquina sup. 47 . Las plumas han sido una de las grandes “novedades” evolutivas en las aves. alcanzan distancias de hasta 38. De esa verdad inobjetable se pueden proyectar imágenes. desde la primera de Gideon A.000 km y desarrollan velocidades que bordean los 280 km/h. significados. y una de ellas fue denominada como Iberomesornis.000 m. explicacione s y simbologías diversas. Mantell donde se aprecia la ubicación de la garra defensiva en la nariz. es decir son tangibles a nuestros sentidos y por lo tanto sujetos de mensura y reproducción mental o material. izquierda: el primer esqueleto montado de Iguanodon cuya postura bípeda (nótese) difiere de la primera. Tendencia en la evolución iconográfica de Iguanodon. hasta la forma iconográfica actual. mas recientes que Archaeopterix. hasta que en España en la cantera de La Hoya fueron descubiertos restos fósiles de tres nuevas aves. su antigüedad bordea los 115 m. Ante quimeras y mitos anatómicos (Opus 3) Los fósiles son estructuras naturales reales.

puede ser reproducible en la reconstrucción en base a su equivalente del lado contrario y así sucesivamente hasta obtener una representación esquemática de un cráneo que con mucha suerte y criterio puede ser reproducido de manera casi completa. O el caso de una salamandra fósil que en un principio se pensó que era un ancestro del hombre. posee un anecdotario que testimonia los cambios que la misma fue sufriendo. resultó ser de un cerdo. en la punta de la nariz. Esta situación la experimenté de sobremanera durante la descripción de un mamífero ya extinto del grupo de los toxodontes y cuya envergadura era mayor a la de un hipopótamo o rinoceronte actual. estuvo posicionada por un tiempo en el extremo de su cola. aunque la labor puede no terminar ahí cuando se pretende ¨revivir ¨ o mejor dicho obtener una representación de cómo pudo haber sido el espécimen fósil en vida. La reconstrucción no es mas que la definición anatómica en base a las estructuras óseas identificables y reproducibles. dicha uña aparece en sus primeras reconstrucciones. En organismos actuales el estudio sistemático puede tener muchas mas ventajas y elementos de análisis que en organismos fósiles. Otro caso fue el de Iguanodon. Restaurar el enorme cráneo requirió de mucha paciencias hasta considerar que podía ser reconstruido. El cráneo de un roedor o murciélago perfectamente limpios. Y aquí. Es así que por ejemplo la cabeza de un reptil ya extinto (Plesiosaurus ) cuyas características son su cuello más largo que su cola. cabeza pequeña y cuerpo parecido al de una tortuga marina. Este enorme herbívoro al que bauticé como Cephalocristatus rosavespae deambuló y ramoneó en antiguos parajes de la zona de el Torno (Santa Cruz). un dinosaurio que poseía una tremenda uña de forma cónica en la muñeca para clavarla en el cuello de sus atacantes. sitio donde fue encontrado. completos y acompañado de la piel taxidermizada y el resto del esqueleto son lujos impensables para el paleontólogo. Y uno de los casos más curiosos fue el hallazgo de un hueso fósil que supuestamente evidenciaba un Homo fósil en Norteamérica!. tal como ya se argumentó en párrafos anteriores. en función al desarrollo de tecnologías y metodologías a partir de las cuales se obtengan resultados más fiables. pues bien.De la Biología al Mito H. existen muchas posibilidades y dificultades de diferente índole. Azurduy-Ferreira La paleontología. 48 . Reconstruyendo un fósil Una de las experiencias mas excitantes que viví y espero seguir viviendo es el dar con entidades biológicas que no habían sido descubiertas o descritas antes. como otras ciencias. Si un hueso determinado no está presente en un lado. Lo que esquematizo abajo es una secuencia simplificada de la reconstrucción de la cabeza de Cephalocristatus rosavespae.

que podemos estar al lado de algún pariente en un bus sin siquiera imaginarlo. Así como la Taxonomía. la mandíbula inferior es inferida de la estructura mandibular superior. Esta palabra tan simple ha tenido gran significado en la historia de las poblaciones biológicas en el transcurso del tiempo geológico. ¿Cómo llegué aquí si mis ancestros vivieron en Portugal? La respuesta que para algunos puede tener razones incluso existenciales. 2. ¿Cómo explicamos el hecho que aves muy emparentadas. c. avestruces y casuarios. no olvidemos que las mismas son sistemas muy dinámicos en el tiempo y espacio. la Biogeografía puede tener profundas implicaciones históricas a la hora de tratar de entender ciertos patrones que la vida nos expone actualmente. Esbozo craneal a vista lateral. ¿Porqué la ausencia de marsupiales en Africa y Eurasia. Azurduy-Ferreira b c a Reconstrucción de Cephalocristatus rosavespae. Cráneo reconstruido visto de arriba. la zona achurada define la expansión del sistema dentario. tenemos raíces parentales en Portugal o Marruecos y que producto de movimientos itinerantes de nuestros ancestros la trama gene alógica puede ser tan errática. b. a. Es como cuando de pronto nos enteramos que siendo bolivianos. Una pregunta obvia al respecto sería. En recuadro: cráneo de un chancho tropero (Tayassu pecari) como escala. de manera drástica a estímulos 49 . estén en continentes o ambientes insulares separados si no pueden volar?. reaccionando. Cabeza hipotética. La Biogeografía ¿Porqué hoy existen elefantes solamente en Africa y Asia?. tiene una razón que quizás podemos resumir en una palabra: dinámica. como piyos. si los fósiles mas antiguos de este grupo de mamíferos están en Asia? Éstas son algunas preguntas que requieren de una revisión y escudriñamiento de los eventos físicos y biológicos que en el pasado pudieron haber intervenido en la conformación de los patrones de distribución actuales. En recuadro: fragmentos dentarios.De la Biología al Mito H.

Esta sola reacción ha sido una constante desde los grandes movimientos migratorios de grandes manadas de Dinosaurios en el Cretácico. Si el espacio donde habito y me proveo de recursos sufre una sequía atroz o es sujeto de heladas prolongadas me veré obligado a buscar un mejor lugar. fue más extensa en el pasado de la que que conocemos hoy. de modo tal que pueden abandonar ciertos espacios para trasladarse a otros más confortables o adecuados para su subsistencia. ¿Qué pasaría si llegamos a concluir que no existen parientes vivos en Europa? Nos encontraríamos con la paradoja de que el espacio geográfico de donde vienen nuestras raíces ya no alberga a pariente alguno. Esta situación que describimos como simple analogía. deambularon tanto en tan poco tiempo como para desperdigarse por diferentes partes del mundo. En este contexto es importante en Biogeografía entender que: 50 . Asia. otras poblaciones biológicas hicieron lo mismo en mucho más tiempo (millones de años).De la Biología al Mito H. Bajo el mismo concepto. que la distribución parental nuestra. éste parece haber sido uno de los estímulos mas importantes de donde se generaron complejos patrones de desplazamiento en el pasado y que hoy constituyen unos de los temas fascinantes en el entendimiento de los patrones actuales de distribución. hasta los desplazamientos de Homo desde Africa a diferentes partes de este planeta. una rama que además trata de explicar las causas y factores que intervinieron en el tiempo. así quizás ubiquemos puntos en Sudamérica y Norteamérica quedando pendiente Portugal de donde tenemos entendido que provienen nuestros ancestro. la línea de la biología encargada de estudiar la distribución de las especies extintas y/o actuales es la Biogeografía. hablamos de una causa similar en muchos grandes movimientos en el pasado. tendremo s que marcar puntos en un mapa donde sabemos que existe un pariente vivo. Llegando a zonas tan lejanas de su origen. existan murciélagos vampiros solamente en Sudamérica y no así. En tal sentido si hablamos de raíces aún mas ancestrales nuestro centro de origen europeo lo tendríamos que trasladar en realidad a Africa y así entenderíamos que Tolstoi.000 años deambuló por las estepas africanas. si nos proponemos entender la distribución actual de nuestro espectro parental. Oceanía y Africa. que puede ser complicado entender el modo y la razón. mostrándonos de esta manera. así. y aquí. los puntos de distribución no incluirán Europa sino solamente América. sin imaginarse siquiera que su descendencia cambiaría de tal forma que si hoy se encontrara cara a cara con alguno de ellos. su sentido paternal tendría que ser muy fuerte para no huir de aquél extraño blanco con cabello rojo y lleno de pecas en el rostro. Si tal ejercicio lo hubiéramos realizado decenas de años atrás de seguro que nuestros puntos hubieran incluido Europa. Pero porqué nuestros ancestros tuvieron que moverse y salir hacia otros continentes. Azurduy-Ferreira ambientales extremos. Así. fue algo que sucedió en muchos grupos biológicos actuales y que condicionaron en muchos de ellos su actual distribución. en Europa. Si nuestros ancestros portugueses. Mandela y Lenon tienen un ancestro común que hace más de 100. a respuesta podría estar en algún tipo de crisis que forzó un determinado desplazamiento. para conocer la razón por la que por ejemplo.

Azurduy-Ferreira 1. concibe su idea en 1910 mientras observaba absorto.a. transporte de enormes cantidades de sedimento. Todas las zonas de unión entre placas son altamente inestables tectónicamente. Wegener. responde a sus estímulos y que posee un potencial evolutivo que se manifestará de acuerdo a sus cualidades genéticas y adaptativas. Esa sola idea a la postre se convirtió en una teoría que nos mostró una faceta de nuestro planeta en el que los continentes deambularon por millones de años como la metafórica ¨Balsa de Piedra¨ de Saramago y que geológicamente denominamos Derivas Continentales. que él en ese momento no sabía explicar. hubieron “momentos” en la historia geológica. Australia. la tectónica de placas nos dice. hasta lograr la conformación actual. elevamientos de cadenas montañosas. Estas fuerzas interactúan para dar como resultado una paulatina y generalmente imperceptible dinámica. la paleontología.De la Biología al Mito H. de modo que son muy susceptibles a eventos de temblores. en los que todos los continentes estuvieron juntos en un bloque supercontinental al que se denominó Pangea y de donde paulatinamente se fueron separando y adoptando ubicaciones diferentes. cabe señalar que las evidencias fósiles nos dicen que hace 190 m. mientras que Eurasia y América del Norte constituía otro bloque continental llamado Laurasia. Del conjunto de datos provenientes de dichas fuentes. 3. lo que le hizo pensar que alguna vez Sudamérica y Africa estuvieron unidas. Madagascar. como la formación de valles. Para entender aquello es importante entender que la corteza terrestre no es más que un enorme rompecabezas de cuyas piezas irregulares o placas. 51 . Cada organismo es una entidad que esta ligada íntimamente a su medio en el que se desenvuelve. en un bloque continental llamado Gondwana. La India. es mas. se separaron. Lo que observó en esa oportunidad. se separó de la misma y migró hasta chocar con la Placa Euroasiática dando origen a lo que hoy conocemos como la cordillera de los Himalayas y en la actualidad India y Australia son parte de una misma placa (la Placa Indoaustraliana). Balsas de piedra y las Derivas Continentales La idea de las derivas continentales se le ocurrió a Alfred Wegener. fue una congruencia entre las costas que separa el Atlántico. terremotos y actividad volcánica. erosión devastas superficies. Africa y la Antártida. la paleoclimatología y la propia biogeografía. la geología. y que por fuerzas. Aquí. de tal modo que el cambio del medio incite a las poblaciones biológicas a una determinada respuesta evolutiva. India. 2. aunque podemos indicar que en este propósito intervinieron líneas como la geofísica. Todo cambio físico de esta naturaleza incidirá directamente sobre la vida que se distribuye sobre su superficie. deposición de los mismos en diferentes sistemas acuáticos y el desplazamiento paulatino de los continentes (derivas continentales). que implique su adaptación a una nueva condición ambiental o en caso extremo su extinción. resulta un esferoide que es nuestro planeta. un mapa del mundo. Nuestro planeta es un sistema físico que responde a grandes fuerzas internas y externas que inciden sobre el mismo. estuvieron unidos América del Sur. que los continentes no siempre tuvieron la configuración actual. que formó parte de Gondwana. un meteorólogo alemán que nació en 1880. Lo que vemos como Sudamérica en un mapa Mundi no es más que la parte emergente de la Placa Sudamericana que se conecta en el margen oeste con la Placa de Nazca. elevamiento de considerables porciones de corteza terrestre. Explicar el cúmulo de evidencias que explican las Derivas Continentales nos llevaría un capítulo integro.

Placa Indoaustraliana. Placa Antártica. 1. 12.De la Biología al Mito H. 11. Placa de Los Cocos. Placa de Nazca. Placa del Pacífico. 52 . Placa Filipina. Placa Euroasiática. 8. 7. Placa Norteamericana. 10. 4. 6. Placa Africana. Placa del Caribe. 5. Placa Sudamericana. Note el sentido opuesto entre 1 y 4. producto de ello la placa de Nazca subduye (se incrusta hacia abajo) en la Placa Sudamericana provocando el plegamiento o levantamiento de la costa oeste del continente sudamericano. Placa Arabe. un enorme rompecabezas de ¨piezas móviles¨ 8 11 10 6 3 2 9 10 7 1 1 4 5 12 Placas tectónicas. 9. 2. Azurduy-Ferreira La Tierra. 3. Las flechas indican las principales tendencias respecto a la dirección de movimiento de las placas.

a. India (c). Australia (e).a.a. determinó en el tiempo geológico: (1) la evolución 53 . 2 a b c d 3 e 65 m. En el recuadro 6 la unión Sudamérica-Norteamérica a través del istmo de Panamá no está esquematizado. Tal como se indicó. El recuadro 1 muestra un sector de Gondwana: Sudamérica (a). Africa (b). Este fue el caso de Sudamérica que permaneció en ese estado aproximadamente 60 m. Antártida (d). las derivas continentales condicionaron diversas configuraciones continentales de modo hubieron periodos de tiempo en los cuales algunos continentes se mantuvieron completamente aislados tal como Australia en nuestros días.a. 6 Hoy Fig. hasta la actualidad. 1 115 m.a.. Este proceso en el que hubieron ¨momentos¨ de contacto y aislamiento entre continentes. 4 53 m. 6 Derivas continentales desde hace 150 millones de años. Madagascar 5 39 m.De la Biología al Mito H. Azurduy-Ferreira 150 m.a. (Modificado de Begon et al. El punto negro marca la ubicación actual del Polo Sur para tomarlo como referencia en relación a las diferentes posiciones de los continentes en el tiempo. 1990).

que nos muestra que en el pasado geológico los marsupiales tuvieron una distribución más amplia. familias vivientes de aves corredoras existen en Africa (Struthionidae –avestruces-). Azurduy-Ferreira de faunas con un conjunto de especies propias (si hablamos de aislamiento) o (2) el intercambio de especies de especies entre continentes en momentos de contacto intercontinental. En la actualidad. Este hallazgo cambia el escenario geográfico en la investigación sobre el origen de estos mamíferos y que nos enseña una lección muy importante en paleontología y biogeografía histórica: los centros de origen definidos en base a los restos fósiles más antiguos.y Casuariidae -casuarios-). los marsupiales se encuentran en continentes aislados ya que como dijimos anteriormente. -piyos y suris-). Observe cómo los marsupiales están hoy ausentes tanto en Eurasia. Sudamérica y Australia estuvieron unidos entre sí antes de que Gondwana se fragmente. pueden ser consideradas como una posibilidad temporal sujetas de una modificación o sustitución probable a futuro. Así. Australia y Nueva Guinea (Dromiceiidae –emus.De la Biología al Mito H. Nueva Zelanda (Apterygidae –kiwi-) y América Tropical (Tinamidae -tinamus-). Africa y gran parte de Norteamérica. OJO: Si bien se consideraba que los marsupiales mas antiguos provenían de Norteamé rica. 54 . aspecto que se ve reforzado por el registro fósil. El achurado define la distribución de estos mamíferos tanto para el Cretácico como para la actualidad. no pueden volar. en un artículo reciente de la revista Science del 2003 se da ha conocer el hallazgo de Sinodelphys szalayi una especie descubierta en China y cuya antigüedad data de hace 125 millones de años. marsupial fósil boliviano. En la foto: Pucadelphys andinus. restringida hoy a dos continentes. es decir 25 millones de años mas antiguo que el encontrado en Norteamérica. Sudamérica (Rheidae. Cretácico tardío (68 MA) HOY Variación histórica en la biogeografía de los marsupiales. Otro caso muy interesante es la distribución actual de las aves corredoras que c omo sabemos.

La pregunta en este caso es obvia. Perú. Alfred Wegener.De la Biología al Mito H. Australia (que se está moviendo hacia el Norte) colisionará con el sudeste de Asia y la región que hoy constituyen la ciudad de Los Angeles. es decir. La Paleoprovincia Malvinocáfrica (subregión de Gondwana) estuvo conformada por Sudamérica. ¿cómo es que aves que no pueden volar y que están tan estrechamente emparentadas aparecen distribuidas en lugares tan distantes unas de otras. favoreciendo de este modo a procesos de diferenciación (ver mas adelante especiación y biogeografía de islas). dirección. ¿porqué algunas especies de arañas sudamericanas tienen parientes muy cercanas en Australia. ¿Porqué existen grupos biológicos de Sudamérica y Africa que evidencian una mayor afinidad e ntre si. 55 . los mismos que hoy en día es posible encontrarlos solamente en estratos geológicos de Brasil. Africa y posiblemente la Antártida. en cuyo dominio geográfico se distribuyeron trilobites endémicos típicos de la subfamilia Calmoniinae. Cálculos de velocidades relativa de desplazamiento. en relación grupos biológicos de Europa?. como nexos que si bien en el tiempo se fueron diluyendo. Wegener Murió trágicamente en Groenlandia. las Isla Malvinas y Sudáfrica. Die Entstehung der Continente und Ozeane (El origen de los Continentes y Océanos) que a la postre se convirtió en la obra fundamental en el entendimiento de las derivas continentales y sus consecuentes implicaciones en el desarrollo de la biogeografía histórica. Azurduy-Ferreira Los datos morfológicos y moleculares (DNA) indican este grupo de aves es monofilético. La respuesta puede estar en el entendimiento de los procesos tectónicos que se dieron en el pasado. una parte de Africa (Placa Somalí) se separará del bloque continental principal. Argentina. meteorólogo alemán quien en 1915 publica su libro clásico. al punto de que hasta hace poco años muchas de ellas eran tratadas incluso como géneros similares tanto en Oceanía como en Sudamérica? Estas afinidades son interpretadas evolutivamente. es decir comparten un ancestro en común y que no son producto de una convergencia evolutiva (ver modalidades de evolución más adelante). completamente aisladas entre sí y separadas incluso por océanos?. no es más que el reflejo de un pasado en el que se compartió un espacio geográfico común. Uruguay. San Francisco y la Península de California (parte de la Placa del Pacífico y cuya zona de contacto con la Placa Norteamericana es la falla de San Andrés) quedará completamente aislada del resto del continente Norteamericano. la manera en cómo las poblaciones biológicas fueron modificando su distribución geográfica en este planeta. Cada año las placas tectónicas se mueven unos cuantos centímetros en determinadas direcciones. el Mar Mediterráneo entrará en contacto con el Mar Rojo. Diversas formas fósiles sugieren la existencia de Paleoprovincias que se caracterizaron por contener dentro de si formas de vida que los caracterizaron. Sudamérica volverá a estar completamente aislada. tiempo y distancia hace prever que de aquí a 50 millones de años. durante una expedición cuyo propósito era el de seguir buscando evidencias que consoliden su teoría sobre el movimiento de las placas continentales. es decir que el ancestro común tuvo que haberse distribuido en Gondwana y una vez que dicho supercontinente se fragmentó poblaciones del mismo quedaron aisladas unas de otras.

y condicionar procesos migracionales. es así que hoy en día en Sudamérica podemos encontrar mamíferos como los jaguares. caballos. por 56 . exista una población aislada de la misma especie de murciélago . favoreciendo de esta manera a su dispersión. cuyo nombre científico es Lionycteris spurrelli resultó ser primer registro para Bolivia. Momentos como éste los pudimos experimentar luego de una intensa campaña de campo en el Parque Noel Kempff. Así como el Istmo de Panamá se constituyó en un puente de comunicación. tapires. Si con el registro de Lionycteris spurrelli extendíamos la distribución amazónica de la especie alrededor de 700 km al sur. el descubrir una nueva especie pue de ser una de las situaciones más emocionantes. ratone s. que habita medios semisecos. Azurduy-Ferreira Eustasia y el gran intercambio Los factores abióticos que determinan la distribución de los organismos no son solo tectónicos sino también eustáticos (cambios en el nivel del mar) y regímenes climáticos. De todo el conjunto de especies de estos mamíferos voladores una. Las causas pueden ser diversas y están condicionadas fundamentalmente por el clima. que contrastan contratan notoriamente con el hábitat de las poblaciones amazónicas? Tal cuestionamiento. Entendemos por migración a la aptitud de las poblaciones de trasladarse de un lugar a otro de manera periódica o no. Puentes de esta naturaleza se formaron en diversas regiones y por determinado tiempo. donde realizamos una especie de ¨retiro espiritual¨ con los murciélagos. Las plantas también migran a través de vehículos como el agua y el viento los cuales transportan las semillas a considerables distancias. Sudamérica establece comunicación con Norteamérica hace 6 m. los recursos alimentarios y la época reproductiva. estado de Minas Gerais. chanchos de monte. Beringia (región que conectó Norteamérica con Eurasia). actuó y actúa como una barrera para los organismos marinos del Atlántico y Pacífico. y que por supuesto sirvieron para que diversos organismos se desplacen sobre los mismos y se dispersen hacia otras regiones y continentes de los cuales estuvieron completamente aislados y en es to no nos referimos exclusivamente a eventos tectónicos sino también eustáticos ya que por ejemplo durante los periodos de Glaciación los niveles del mar bajaron considerablemente (regresiones marinas). con lo que quedaron expuestas grandes extensiones de tierra permitiendo la conexión entre continentes o entre islas.a. hurones. fragmentarlas y aislarlas entre sí. ardillas. Si en la taxonomía. zorros y osos entre otros que son vinieron desde Norteamérica. ¿qué interpretación podemos dar al hecho de que al sureste de Brasil. la conexión temporal entre islas del Archipiélago Malayo o la conexión también temporal del Japón con el resto de Asia.De la Biología al Mito H. en biogeografía.. El registro fósil y la tectónica de placas nos indica que luego de permanecer aislada. son algunos ejemplos de este tipo de eventos. Estos tres factores han interactuado en el tiempo para por ejemplo crear barreras entre poblaciones. el registrar una especie en una zona geográfica que dista mucho de los límites conocidos puede significar algo similar. Este hecho permitió que muchas especies migraran de Sudamérica a Norteamérica y viceversa. a través del Istmo de Panamá que hasta ese “momento” yacía bajo el mar. nuevo dato biogeográfico que además nos abrió nuevos cuestionamientos como el que describimos abajo (por cierto no resuelto aún). nos grafica las implicaciones y alcances de la biogeografía en un contexto histórico ya que su resolución implicaría recurrir a hipótesis como por ejemplo: la existencia de corredores antiguos de vegetación.

Este es uno de los conceptos claves en evolución que nos muestra a las homologías. En tal sentido. esta especie de murciélago. sirvió de base para que Darwin posteriormente redefina el concepto y cuyas implicaciones en nuestro entendimiento de las afinidades y relaciones evolutivas. si ellos han sido heredados de un órgano equivalente del ancestro común”. es un término acuñado por Richard Owen en 1848. longitud. desde vértebras de ballena azul (que circunstancialmente en alguna oportunidad usé de asiento). que dependiendo de la especie. d. cuyo diámetro no excede en algunas especies los 2 mm. Azurduy-Ferreira donde. solo que cambios climáticos determinaron la fragmentación y modificación espacial de estos paleocorredores de vegetación. El contacto con colecciones de Museo me dio la posibilidad de entender la relación entre huesos de diversa naturaleza. 3. Ametrida centurio (murciélago). Según Darwin: “órganos de dos organismos son homólogos. Tayassu pecari (chancho tropero. como una forma de establecer afinidades evolutivas de los organismos que los poseen. etc. Es importante señalar que pese a que órganos homólogos pueden sufrir cambios en las formas descendientes del ancestro. (Inia boliviensis (delfín de río o bufeo). es asumido que los mismos se deben fundamentalmente al factor genético que gobierna el desarrollo del rasgo o carácter en cuestión. Homologías Homología. entre ellas. con el consiguiente efecto en la separación de poblaciones. hasta la bulla auditiva de un murciélago insectívoro. veremos que siempre habrá un hueso nasal. adquieran un nuevo sentido. analizando las estructuras óseas de los vertebrados se puede ver que existe una serie de aspectos anatómicos que expresan una organización corporal común. c. poblaciones amazónicas de L. Si vemos cualquier cráneo de mamífero. Tapirus terrestris (anta). quien aunque le asignó un sentido enfocado hacia una Morfologia Idealista. 57 . spurrelli se pudieron haber conectado con regiones mas sureñas del Brasil.De la Biología al Mito H. posee una determinada forma. murciélagos y ballenas provienen de un ancestro común del que se derivaron tanto ¨x¨ como ¨y¨. a. b. a d c b Huesos nasales (sin escala) en cuatro especies de mamíferos. o sea que si el órgano ¨x¨ de un murciélago es homólogo con el órgano ¨y¨ de una ballena. Nótese las grandes modificaciones nasales (flechas) que al ser producto de modificaciones venidas de un ancestro común son estructuras homólogas.

aunque al mismo tiempo evidencien modificaciones muy notorias como resultado de procesos de adaptación a determinados hábitos y medios ecológicos. sea para posibilitar la comunicación por celular o la definición de una imagen de nitidez absoluta. ballenas. pero un origen y estructura diferente. es decir sin fertilización. Si partimos de la forma. Vestigios ¿Porqué muchas especies tienen órganos o estructuras que no usan?. De este modo. ésta es una planta cuya flor ha prescindido de un polinizador para reproducirse. En palabras simples. por ejemplo las garras de un Velociraptor (tipo de dinosaurio carnívoro) y las de un jaguar tienen la misma función y semejanza. Pero ¿será que no habrá algún rasgo tecnológico que permita identificar un nexo común entre ambos? La fibra óptica puede ser la respuesta. entre los mamíferos sean éstos jirafas o ratones. ambos están haciendo uso de estructuras cuyo origen es común. Peces que habitan en 58 . Si ponemos ante nosotros un televisor de alta tecnología y un celular con botones muy complicados de digitar. Así. forma y función aparentarían no tener nexo de parentesco alguno. la imagen de TV y el sonido de un celular podemos considerarlos en nuestro ejemplo como funciones ¨homólogas¨ ya que el principio que las genera es el mismo. veinte o un centenar). ¿Si todo organismo es el resultado de un diseño perfecto. las extremidades anteriores del caballo. están dispuestos de acuerdo a un mismo patrón. Azurduy-Ferreira Los huesos pertenecientes a las extremidades delanteras en cocodrilos. ¿encontraríamos alguna relación ¨de parentesco¨ entre ambos?. ¿es esta una evidencia de la inexistencia de la intervención de un diseño divino?. caballos. Así como existen estructuras anatómicas homólogas existen también estructuras análogas es decir. 4. porqué incorporarle estructuras y moléculas que no va a utilizar y que por el contrario pueden ser una desventaja para el organismo que la porta? Las flores amarillas en Taraxacum officinale (diente de león) son casi indistinguibles para sus potenciales polinizadores. todos tienen siete vértebras cervicales. En este contexto. desarrollando semillas por apomixis. Todos los vertebrados tienden a poseer cuatro extremidades (nunca poseen seis. cumplen funciones que en los murciélagos son muy diferentes de modo tal que aunque el caballo trote y el murciélago vuele. proyecta un conjunto de información visual y sonora que informa y entretiene. por medio de la identificación de un rasgo tecnológico común estaríamos estableciendo un grado de relación entre dos artefactos que por sus dimensiones. estructuras que si bien tienen la misma función su origen embrionario son diferentes. Por ejemplo. diríamos que ambos son tan diferentes que no guardan relación alguna. la otra. posee principalmente cuarzo . Desde esa perspectiva no encontraríamos relación alguna. dicho material resultado de una compleja aleación que determina sus atributos conocidos.De la Biología al Mito H. la una. Al margen de ello. está la función. murciélagos y seres humanos. posibilita una comunicación interpersonal sin cables y enchufes de por medio. estructuras homólogas son todas aquellas que tienen un origen común pero que no cumplen necesariamente la misma función. aves.

Darwin en su obra El Origen del Hombre. b. Apéndice humano (flecha). a Vértebra coccígea b c d 59 . Rudimentos de su ancestro cuadrúpedo.. En estadios embrionarios tempranos. En ballena. Dedos vestigiales (flechas) en caballo. d. Escarabajos que no vuelan. A nivel molecular se evidencian una serie de aspectos raros pero interesantes a la vez y que podemos incluir en este acápite.De la Biología al Mito H. músculos rudimentarios que permiten a algunas personas mo ver las orejas (como tantos mamíferos a la hora de despojarse de mosquitos que se posan en la misma). retienen alas rudimentarias que no tienen una funcionalidad. que no codifican nada. más del 90% de su genoma no codifica nada y posee genes comunes con ratones y moscas. como: el apéndice (que no tienen función alguna en los humanos y si en animales herbívoros como conejos o cobayos en los que es grande y alberga a bacterias que les permite digerir la celulosa). Resabios de ancestros con cola en hueso coccígeo de humano. es decir. e. mencionó una serie de ejemplos de estructuras vestigiales en el hombre. Ejemplos de estructuras vestigiales o no funcionales Isquion Pelvis Fémur e a. a los mismos se los conoce como segmentos “sin sentido” o ¨DNA basura¨. En el genoma de muchos organismos existen segmentos de DNA no funcionales. esto incluye a los pseudogenes. el hueso coxígeo (cuatro huesos fusionados y que son vestigios degenerados de vértebras caudales). los mismos que no transcriben secuencia alguna y que guardan cierta similaridad con los genes funcionales de los que se derivaron (ver mas adelante tópicos referidos a genética). En el caso del hombre. c. el hombre despliega 12 pares de sacos branquiales que posteriormente se cierran y degeneran. Taraxacum officinale (diente de león) que se reproduce por apomixia (ver texto). la erupción aberrante y dolorosa del molar extra conocido comúnmente en nuestro medio como la “muela del juicio” y que tiene que ser extraído para tranquilizar al individuo que sufre dicha dolencia. Azurduy-Ferreira cavernas y otros animales despliegan ojos que degeneran en su proceso de desarrollo.

comportamientos innatos y por otro. cualidades que le permiten tener una gama de respuestas y pautas motoras que en definitiva se constituyen en atributos evolutivos dados a lo largo de su filogenia y que a su vez le pueden permitir desplegar por un lado. otras no. el comportamiento puede sufrir una modificación o simplemente no manifestarse. es posible observar crías de gorrión (Passer domesticus) siendo alimentadas por sus madres. una ineludible relación entre estructura y función. quedando como una simple potencialidad. Estas crías. como una expresión de un substrato de carácter genético. otras filtrar.). a c b d Cuatro formas de pico que responden a estrategias alimentarias diferentes. b. El comportamiento puede ser asumido de manera parcial. Paralelo al ejercicio del picoteo la cría sigue siendo alimentada. cuya gama es diversa. Existen aves que lo usan para cortar.De la Biología al Mito H. En las aves. desarrollar estructuras cognitivas que le posibilitan incorporar y procesar una gama de información nueva a ser utilizada en su experiencia cotidiana. condiciona y direcciona la manifestación del mismo. si bien todas las aves tienen picos. Esta diversidad de usos y funciones tienen una estrecha relación con la forma y los hábitos. que tiene la aptitud de usar con el pico. hasta que con el tiempo logra perfeccionar su comportamiento alimentario por medio de la experiencia. llegando en algunos casos a utilizar herramientas como el pinzón de las Islas Galápagos. Azurduy-Ferreira 5. d. El comportamiento En el patio de mi casa (así como en otras) durante los meses de octubre y noviembre. es decir que por medio de esta estructura. le dan a cada organismo. Estos substratos a los que hacemos referencia. no todas las especies utilizan esta estructura con la misma finalidad . no con mucho éxito los granos o migajas de pan. espinas de cactus para extraer insectos que pueden encontrarse en oquedades de troncos y a los que si no fuera por la espina le fuera imposible llegar. otras libar. construcción del nido. a. este pico es uno de los más curiosos por la organización invertida. pico carnívoro (ave rapaz). c. Pico filtrador (flamenco). aunque semanas posteriores trata de “picotear”. nervioso y anatómico que en términos generales delimita. Por ejemplo. agresión. 60 . inicialmente deambulan tras de su protectora esperando que se lo alimente. Si la estructura tiene un desperfecto. acicalamiento. unas perforar. que evidencia. Unas especies pueden desgarrar. el organismo puede manifestar diferentes acciones conductuales que le permitan desenvolverse en su medio. pico insectívoro (mirlo). Esto implica en líneas generales. el pico es una estructura cuya función puede intervenir en diferentes funciones (alimentación. frugívoro (loro). etc.

sino algo más delicado. Escena 2: El chimpancé que nunca habló En el caso del lenguaje se recurrieron al estudio de: (1) las impresiones cerebrales en los cráneos de homínidos fósiles. Desarrollo de un lenguaje particular y raro dentro del mundo animal. se erigió en un ícono en el desarrollo de la Psicología. en grado de un notable caminar erecto. la 61 . Freud como el caso de Darwin. Como el surgimiento de la teoría de la gravitación universal o el Neodarwinismo. Azurduy-Ferreira Escena 1: Un Homo sin Freud La Psicología tiene como objeto central. hasta el desarrollo de un ordenador cuántos eventos y cambios se produjeron en la evolución de la conducta humana y cuales fueron los logros evolutivos que se pueden destacar. entre las más famosas) y (4) finalmente. ? : HOY HACE 2.5 MILLONES DE AÑOS Homo habilis Homo sapiens De las primeras herramientas pertenecientes a Homo habilis. En este aspecto noto que el conocimiento de la psicología humana irrumpe abruptamente en sus objetos de estudio y sin mayores consideraciones que el estado temporal actual. (2) estudio de la comunicación en primates. Reducción de dientes caninos. los símbolos o materiales y el bipedismo como ejemplos para tratar de entender algunos aspectos sobre la evolución comportamental del hombre. Modificación en la estructura de manos y pies. el Psicoanálisis marcó un hito en la búsqueda del entendimiento de la conducta humana. un molde cerebral de un homínido fósil o una secuencia de DNA que interviene en la manifestación de una determinada conducta?. ¿Qué pensaría Freud al tener ante si. La paleoantropología nos indica que los rasgos evolutivos más importantes del hombre son: - Caminar bípedo. tomemos el lenguaje. Cerebración (aumento paulatino del tamaño cerebral en relación a la masa corpórea). su tratamiento y la esencia misma de su naturaleza inmensurable. y así. (3) los símbolos elaborados por el hombre arcaico en cuevas como las descubiertas en Francia (Altamira y Lascaux. una especie con grandes conflictos y contradicciones. crear un mundo simbólico y tecnología. Razonamiento abstracto que le permite desarrollar signos.De la Biología al Mito H. Mis experiencias esporádicas impartiendo clases de etología a estudiantes de psicología me despertaron muchas preguntas respecto al modo en el que esta ciencia encara no solo el estudio. ¿cuánto limita a la psicología tradicional la ausencia de una visión evolutiva del hombre? Son cosas que me pregunto al tiempo de imaginarme a Freud en una sesión de psicoanálisis para un Homo habilis. De estos rasgos evolutivos en el hombre.

que también es parte de su dieta. Para tal efecto un chimpancé puede utilizar piedras o agarrarla y estrellarla contra el suelo o un tronco. Una vez que la presa llega dentro de dicha semiluna. luego procederá a desgarrarla y alimentarse de ella. es evidente. utilizando algún fragmento óseo en forma de palillo. los chimpancés pueden expresar rasgos comportamentales como la conspiración. la cría que esta junto a ella aprenderá este comportamiento. La división de labores entre macho y hembra. el complot por el poder. el canibalismo. la hembra puede recolectar alimentos vegetales o permanecer algún tiempo considerable cerca de los termiteros a los que introduce ramas largas y de esta manera obtiene termitas para su alimentación. entre los que podemos mencionar: - Inteligencia Comunicación Socialización Facilidad de adaptación a ambientes ecológicos diversos Bipedismo Larga duración en la relación madre-hijo Tradición social Caza cooperativa Uso y elaboración de herramientas Similitudes anatómicas.De la Biología al Mito H. Del cráneo sacará los sesos. Azurduy-Ferreira interpretación de las herramientas y/o utensilios elaborados desde la aparición de Homo habilis (hace 2. altruismo recíproco y un sistema social muy cohesionado producto de una fuerte interacción social. El estudio de los chimpancés (Pan troglodytes) con una perspectiva de afinidad evolutiva con nuestra especie fue particularmente interesante. el sadismo. lo aplicará y lo transmitirá de la misma manera en que le fue transmitido y así mantener un conocimiento que en las sociedades humanas denominamos tradición cultural. 62 . Los chimpancés poseen un gran sentido cooperativo en la cacería. producto de la labor del grupo de persecución. los más jóvenes recurrirán a utilizar ramitas con el mismo propósito. la semiluna se cierra y ataca. fisiológicas y genéticas Por otro lad o. la confabulación. formando grupos de persecución de la presa y un grupo de ataque que espera estático en una disposición en forma de semiluna.5 millones de años). dada la existencia de una amplia gama de rasgos comunes.

pero también es sabido que su lenguaje simbólico. En lo concerniente al estudio de impresiones cerebrales dejadas por homínidos extintos. con las cuales podrían comunicarse. es algo que pueden desarrollar con una suficiencia y creatividad tal. Este razonamiento llevó a indagar en cerebros de otros homínidos. es el centro donde se organiza el sentido gramatical. de que hagamos un ordenamiento correcto en las palabras para que las mismas tengan un sentido en relación a la idea que se pretende trasmitir. Ejemplos clásicos venidos de la experiencia de etólogos como los esposos Gardner han permitido evaluar y tratar de entender la magnitud de las capacidades de aprendizaje de estos primates. La zona de Broca es evidente gracias a que la misma denota una protuberancia que puede ser detectada en moldes obtenidos de cerebros en humanos. Lucy o Washoe fueron chimpancés hembras muy famosas por lo que se llegó a indagar de ellas.De la Biología al Mito H. Las Zonas de Broca y Wernicke Paul Broca (1824-1880) anatomista francés. si estaríamos frente a dos homínidos de especies diferentes comunicándose por señas que no entendemos. Paul Broca) y la zona o área de Wernicke. es conocido que nuestro cerebro alberga dos centros que pueden ser evidenciados en una conformación cerebral normal. que pueden asimilar lenguajes simbólicos humanos desarrollados para personas sordomudas. la fonación. que los chimpancés poseen una estructura laríngea y faríngea que no les permite emitir palabras. es decir. Azurduy-Ferreira Es sabido. Lana. por medio de algún tipo de lenguaje hablado. estaría en desventaja ante otra entidad biológica capaz de descifrar gestos. como son la zona o área de Broca (en honor a su descubridor. descubrió. boca y garganta para producir sonidos. nuestra presencia con todas las ventajas que el habla significa. que una zona ubicada en la parte anterior del hemisferio izquierdo. Area de Broca Fascículo Area de Wernicke Corteza motora Corteza visual Corteza auditiva Paul Broca (1824-1880) 63 . con la gran sorpresa de evidenciar zona de Broca incluso en Homo hábilis. Esto nos lleva a pensar en la posibilidad de que hace aproximadamente dos millones de años hubieron homínidos comunicándose entre sí. Así. es decir. estaba encargada del control de los movimientos de la lengua. La zona de Wernicke por su lado se encarga.

estatuillas) encontrados. hablaba de algún modo.Todo artefacto simbólico no tendría sentido ni razón de ser si previamente no se le ha asignado un nombre. un proceso mental en el que se establecieron nuevas rutas neuronales en el cerebro. y un fuerte sentido de cooperación grupal.De la Biología al Mito H. En relación. intensa interacción social. Esta condición le permitió liberar dos extremidades para otro tipo usos que no sean los de traslación. iba a convertirse en un evento evolutivo que rompió la monotonía natural? Iconografía sobre la evolución del hombre. Escena 4: ¨Homo primigenius¨ El caminar completamente erecto es otro de los logros evolutivos importantes en la “carrera evolutiva” del hombre. Por lo tanto la necesidad de un lenguaje en este orden de cosas es fundamental. eventualmente mal interpretada y tergiversada.5 millones de años) fue una experiencia inolvidable que como nunca me condujo a tratar de ver más allá de las estructuras pétreas al frente mío. puede revelarnos. muchas veces mas aspectos relacionados con la mente del individuo que lo fabricó. y la relación de éstos con el lenguaje. cambios en la distribución de vegetación. hubo una mirada de alguien al que de manera un poco difusa es posible distinguir a través de unas simples esquirlas de piedra. 64 . podemos indicar que: . una voluntad. hubo una intención. pueden ser indicios indirectos de que el que los construyó. Azurduy-Ferreira Escena 3: Símbolos y la palabra El tener en mis manos fragmentos de piedra de un Museo Paleontológico pertenecientes a las herramientas más antiguas hasta ahora encontradas (2. . al estudio de herramientas y símbolos dejados por homínidos extintos. En realidad su desarrollo evolutivo es mucho más complejo que una fila de 5 homínidos ¨andando por el tiempo¨. Y es que detrás de las mismas hubo una acción. una manos torpes que las manipularon. ¿Quien iba imaginar que esas criaturas marginales y que incluso disputaban carroña con otros organismos en sus fases tempranas.Para la elaboración de símbolos son necesarias aptitudes lingüisticas. Nuestro conocimiento sobre este proceso no es total pese a los grandes avances paleoantropológicos. En otras palabras lo que nos quieren indicar los puntos anteriormente señalados es que las herramientas de piedra y elementos simbólicos (pinturas rupestres. . En el cambio a un caminar bípedo intervinieron una serie de factores entre los que podemos mencionar: cambios climáticos. así no nos extrañe si en el futuro el panorama evolutivo del hombre tiene nuevos integrantes o nuevas interpretaciones.Un artefacto de piedra o de otra naturaleza. a su uso propiamente dicho. un significado o un uso. hubo un indivíduo jadeante y sudoroso bajo el sol africano. que en relación.

6 . Sabemos que el homínido más antiguo es Ardipithecus ramidus (4. logro de sistemas sociales donde las labores estén muy bien definidas. Azurduy-Ferreira Tradicionalmente. Hoy en día hay un gran consenso entre biólogos evolucionistas en que uno de los grandes factores. El caminar bípedo fue constatado por primera vez por Mary Leakey en Australopithecus afarensis (3. es decir grandes campos abiertos a los cuales los primeros homínidos tuvieron que trasladarse y tratar de adaptarse. se pensaba que la causa que llevó al hombre a un caminar bípedo fue la necesidad de permanecer en postura de alerta frente a sus potenciales predadores en campos abiertos. se desarrolle. El trasladar alimentos supone por lo tanto. la habilidad.De la Biología al Mito H. nos encontraremos con un escenario natural propicio para que un rasgo de esta naturaleza. hicieron pensar. (tal y como lo hacen mucho s primates no humanos actuales).3 m. etc. esto sin dejare de mencionar la influencia de la interacción social en el cuidado parental de las crías y la competencia entre unidades sociales. ser más eficientes en el logro de recursos. que intervinieron en la capacidad para resolver problemas. Estos cambios de los que hacíamos referencia. 65 . aunque de él no se tienen evidencias de un caminar bípedo. La competencia entre unidades sociales por recursos. elaboración de herramientas cada vez mas complejas.4 m.a. de que el factor fundamental (y para muchos el único) fue el simple paso de ambientes boscosos. ¨premió¨ la inteligencia. ello implica: trasladar alimentos a la unidad social. debido a la vocación que los individuos tienen que seguir para permanecer incorporados dentro. desarrollo de estrategias cada vez más complejas.). fue la interacción social dentro de las unidades sociales.a. utilizar fundamentalmente los brazos y un caminar bípedo obligado.). producto de cambios climáticos que incidieron en la reducción paulatina de bosques y el aumento a su vez de grandes sabanas. la consecuencia de todo ello fue la evolución de las habilidades cognitivas. si a esto anexamos los cambios en Africa mencionados. claro que en este aspecto. la capacidad de aprendizaje de los individuos del grupo y la comunicación (básicamente un proceso de selección natural). a sabanas. no debemos olvidar que Africa sufrió grandes modificaciones en el paisaje.

Posterior a esta fase. pueden ser tratados como un carácter o rasgo susceptible de variación. mientras que el de los picaflores es de estructura y elaboración más compleja en la que puede incluir musgos. cambio o evolución. 66 . sino además en aspectos adaptativos y de filogenia comportamental (Entender la evolución del comportamiento pasa por dar por hecho la base genética de muchos comportamientos y el efecto de la Selección Natural sobre los mismos).De la Biología al Mito IX H. von Frisch. N. Tinbergen y K. hasta ahora una paloma no ha construido un nido en la forma del que construye un picaflor o viceversa El ave cuclillo y ¨su¨ nido prestado Existen aves que no construyen nidos y que más bien usan los nidos de otros. Azurduy-Ferreira Etología y Evolución El observar el modo en que una avispa construye el habitáculo en el que depositará sus huevos. Y por lo que sabemos. es un comportamiento que las avispas aprenden?. no se dedicaron solo a indagar en los mecanismos del comportamiento. estableciéndose de este modo un tipo de comportamiento cuyas connotaciones en aspectos ecológicos. K. entre 1930s y 1950 se establece el periodo moderno del estudio comportamental (Etología). Por ejemplo. energéticos y comportamentales nos puede abrir una perspectiva sobre la importancia de la interacción ecológica en procesos de evolución. fibras suaves e incluso tela de araña que tapiza la superficie interior. los nidos de las palomas se caracterizan por no ser muy elaborados y de apariencia relativamente simple ya que usa generalmente ramitas que superpone formando una especie de plataforma circular. los movimientos con fuerte base genética en la construcción de un nido pueden señalarnos ciertos indicios de afinidad entre aves. sudamericanas y australianas? El estudio de la evolución del comportamiento es tan antiguo como la teoría evolutiva. de modo que así como la forma de los huesos craneales pueden sugerir grados de afinidad entre mamíferos. ¿Todas las avispas construyen nidos?. Para explicar esto quizás es necesario ¨confesar¨ algunas preguntas que para mí en ese momento no tenían respuestas: ¿El construir nidos. ¿Qué determina o condiciona las dimensiones y forma del nido?. Sentado dicha preposición podemos darnos cuenta que tipos de comportamiento definidos genéticamente. sin puntos de cohesión permanente. Lorenz. fue para mi uno de los primeros acontecimientos que me llevaron a pensar sobre algunos aspectos del comportamiento y sus implicaciones en la evolución biológica. Así. si existe una gran diversidad de formas de nidos ¿puede el solo hecho de analizar la morfología de estructuras construidas por especies diferentes. ¿qué diferencias o similitudes existen en el comportamiento de construcciones de nido entre avispas africanas. Darwin ya estableció muchas interrogantes con respecto al comportamiento y no solo en El Origen de las Especies sino en otras obras como The descent of Man (1871) y The Expression of the Emotions in Man and Animals (1872). darnos una pauta sobre su grado de afinidad evolutiva?.

El huevo del cuclillo se desarrolla y eclosiona más rápidamente que los de la especie visitada. Una vez que el polluelo nace. Graficando de manera diferente lo pensado por Withman y Timbergen podemos recurrir a algo que es relativamente común escuchar de boca de 67 . ésta seguirá alimentando a un polluelo que no es suyo. el grado de especialización es tal que el huevo de cuclillo. y ovoposita el suyo entre los mismos (a tiempo de quitar y tirar uno del nido). El instinto materno en la especie parasitada es tan fuerte que pese a haber una notoria diferencia de tamaño. Azurduy-Ferreira El cuclillo (Cuculus canorus) es una ave que se caracteriza por no construir un nido donde nidificar. se despliega un comportamiento duro y sorprendente a la vez. Polluelo de Cuclillo siendo alimentado por una madre cuyo nido fue parasitado con el huevo de la cría que justamente alimenta. de modo tal que será el único habitante del nido y así. La misma acción la repite con los huevos restantes. cayendo luego. la cuclillo hembra aprovecha alguna ausencia de la otra hembra que se encuentra incubando sus huevos. puede llegar a imitar los huevos de la especie a la que ¨visita¨. y recurre al uso temporal de nidos perteneciente a otras especies.De la Biología al Mito H. quienes de manera independiente observaron que existen patrones conductuales que son similares e invariables entre diferentes especies separadas por miles de kilómetros. hasta que la etología describió al comportamiento como un rasgo evolutivo más de las especies. y sin previo aprendizaje despliega un patrón comportamental guiado por el simple instinto. usando fundamentalmente su espalda sobre la que ubica el huevo flexionando luego las patas hasta que el huevo llega al borde. El polluelo de cuclillo nacido comienza sistemáticamente a deshacerse de los otros huevos. Por tal motivo. La palabra Instinto es y fue un término que la Psicología adoptó para asignarla a todo comportamiento exento de experiencia y el aprendizaje de modo que es una manifestación ¨innata¨. Las primeras luces en el ámbito de la etología sobre el tema de los instintos provienen de estudios realizados por Charles Otis Withman en colúmbidos (palomas) y Nico Tinbergen en láridos (gaviotas). hasta que el mismo pueda volar. Lo instintivo y lo innato fueron términos de alcance y aplicación algo nebulosos. este hecho les hizo pensar de que el comportamiento podría tener mayores implicaciones que las conocidas hasta ese momento. El caso del cuclillo es un caso en el que la cría. todo el alimento traído por la mamá ocasional será para él.

alargando su pata hacia adelante a la altura del hombro. El perro se apoya en el trípode formado por sus ancas y sus dos patas delanteras y lanza su pata trasera hacia adelante. a la altura del hombro. Este tipo de comportamiento (pisotear fuego) es algo que también realizan los rinocerontes en Africa. De éste modo de razonamiento y de ver al comportamiento como evidencias del pasado. el pisotear fuego puede ser un rasgo etológico de iguales connotaciones. Antes de que el pájaro se rasque. es decir patos o gansos. Lo interesante es que ambos pertenecen al grupo de los ungulados perisodáctilos (con pezuñas impares) de modo que ese comportamiento que pudo haber sido ancestral sigue manifestándose hoy en organismos que habitan continentes diferentes.De la Biología al Mito H. de la que uno de sus principales impulsores fue Konrad Lorenz. Uno de sus tantos razonamientos para llegar a tal sentencia detallamos a continuación: “Cualquiera que haya observado a un perro rascándose la mandíbula o a un pájaro limpiándose las plumas de la cabeza puede atestiguar que lo hacen de la misma manera. siendo una de sus grandes pasiones el trabajo con anátidos. Uno podría pensar que sería más sencillo para el pájaro mover su pata directamente hacia la cabeza sin mover el ala. En la foto aparece con dos individuos juveniles que lo consideran su ¨madre¨. pero que guardan un determinado nivel de parentesco. ya que fue con quien tuvieron el primer contacto visual y corporal (en etología este tipo de respuesta comportamental se denomina impronta). Konrad Lorenz. y así nace la Etología Clásica. Si entre anta y rinoceronte poseer pezuñas impares es un rasgo morfológico que evidencia un nivel de afinidad a nivel de Orden. 68 . Azurduy-Ferreira cazadores o campeadores: ¨las antas tienen la maña de pisotear fogatas¨. Su labor y visión científica permitió incorporar la teoría evolutiva al estudio del comportamiento animal. El hecho curioso es que la mayoría de los pájaros (así como virtualme nte todos los mamíferos y reptiles) se rascan exactamente con el mismo movimiento! Un pájaro también se rasca con la pata trasera (con la garra) y al hacerlo baja el ala. etólogo alemán y principal impulsor de la Etología Clásica. No veo como explicar esta torpe acción a menos que admita que es innata. sino también el comportamiento”. se incorpora la Teoría Evolutiva a la Etología. que puede permanecer plegada sin estorbar para nada el camino hacia la espalda. quién alguna vez aseveró: “no solo ha evolucionado la estructura. debe reconstruir la vieja relación espacial de miembros del pasado cuadrúpedo común que lo relaciona con los mamíferos”.

R. En la parte superior y en la raíz del árbol se muestra un ejemplo de cómo es que los mismos fueron mapeados.37. mientras que los números negativos son caracteres que desaparecieron en el curso evolutivo del grupo.-1 3. algunas de las cuales mostraron comportamientos ritualísticos extraordinariamente complejos.35. cómo elementos comportamentales complejos han sido a menudo derivados de elementos comportamentales primitivos y de la adición de otros nuevos.31 Corapipo leucorrhoa Masius chrysopterus Ilicura militaris Machaeropterus deliciosus Machaeropterus regulus Machaeropterus pyrocephalus Pipra serena Pipra suavissima Pipra coronata Manacus manacus Manacus vitellinus Sección de un árbol filogenético sobre el que se mapearon caracteres comportamentales de 28 especies de aves de la familia Pipridae. los mismos que están presentes en el repertorio de una o más especies y mapeo los mismos sobre el árbol filogenético construido lo que le mostró la secuencia histórica en el que los elementos comportamentales. de modo que deben ser tomados como formas sintéticas de exponer el tema.De la Biología al Mito H. 1.25. aunque cabe señalar que los mecanismos por los cuales actúan. fueron siendo sacados o incorporados en el repertorio conductual.7.38 Corapipo gutturalis 34. 1990) La intervención de los genes en el comportamiento es algo que vamos a tratar más adelante. son mucho más complicados que los que se exponen. Lo que hizo Prum fue inferir la filogenia de las 28 especies. Prum describe además.29 16. (Modificado de Prum. 69 .26. Luego distinguió 44 caracteres comportamentales. a partir de datos anatómicos del aparato bucal. O. Azurduy-Ferreira Estudios filogenéticos en base a datos comportamentales han sido realizados. Prum desarrolló un análisis filogenético a partir del estudio de ritos de cortejo en 28 especies de ave s de la familia Pipridae.-2 Pipra 44. Las líneas por su lado representan los grados de afinidad entre especies. Cada número simboliza un carácter.5.44.

ACTO CUARTO Mensajes ancestrales de un gen .

siendo reconocidas recién en 1900 (año considerado como de nacimiento de la Genética) aunque para entonces Gregor Mendel ya había fallecido. MENDEL. que (5) el carácter recesivo solo se puede manifestar en su condición homocigótica (eso explica la proporción 3:1 mencionada anteriormente). Para entender su relación con la teoría evolutiva. siendo su manifestación o expresión acorde a determinados patrones de interacción y principios cuantitativos. aparecían individuos que manifestaban flores blancas en una proporción 1:3 (de cada cuatro flores una era blanca). Todas estas conclusiones fueron ignoradas durante 35 años. procesos y mecanismos de la herencia. herencia limitada por el sexo. Azurduy-Ferreira GENETICA Y EVOLUCION Cuando hablamos de Genética básicamente nos referimos a la rama de la biología que se encarga de estudiar los principios. hoy conocidos como las Leyes de Mendel. transportaban tanto e l gen que codifica el rojo como el gen que codifica el blanco (heterocigotos). alelos múltiples. epístasis. etc. sin embargo luego de realizar cruces entre individuos de la primera generación. Su trabajo desarrollado en base a experimentos con guisantes lo llevó a la conclusión de que existen unidades hereditarias (que él denominó factores) que son transmitidas a la descendencia y que se manifiestan siguiendo determinadas proporciones cuantitativas. un monje agustino. Su descubridor. que (4) el carácter do minante se puede expresar tanto en su condición homocigótica como heterocigótica. Este monje se dio cuenta que si cruzaba guisantes de flor roja con guisantes de flor blanca.De la Biología al Mito X H. herencia influenciada por el sexo. quien a su vez puede transmitir el mismo a una generación siguiente. que (3) los individuos parentales transportaban genes que solamente producían flores blancas o genes que solamente producían flores rojas (homocigóticos). DE UNOS GUISANTES AL CONCEPTO DE GEN Gen es una secuencia de nucleótidos (fragmento de DNA) que interviene en la conformación de las características y rasgos biológicos de un individuo. Esto hizo suponer que (1) el carácter rojo era dominante (genes dominantes) al blanco (genes recesivos). desarrolló su trabajo en un tranquilo jardín del monasterio de Brno (Checoslovaquia). veamos previamente algunos aspectos generales de los principios genéticos. 71 . la primera generación se componía de un 100 % de individuos que exhibían flores rojas. herencia ligada al sexo. Posteriormente y con el desarrollo de nuevas metodologías se descubrieron nuevas variantes y formas de expresión genética a las contenidas en dichas leyes. que (2) en la primera generación todos los individuos que aunque rojos. solo por mencionar: codominancia. de nombre Gregor Mendel.

bacterias.C. Visto de esta manera. el resultado será una escalera helicoidal que en definitiva es el aspecto de una molécula de DNA.000 millones de peldaños en el modelo de escalera que habíamos imaginado. Si dicha escalera la fragmentamos por la mitad y en sentido longitudinal (es decir a lo largo). amebas. de modo que su contenido epistolar dice algo de ambas. A-T-C-G : EL ALFABETO DE LA VIDA Como se dio a entender anteriormente. De las cuatro bases (A. Azurduy-Ferreira WATSON Y CRICK. Los cromosomas son corpúsculos que resultan de la condensación de hebras de DNA. por lo que uno completo equivale a un par de bases nitrogenadas. y animales (incluido el hombre) comparten este rasgo 72 . un hijo viene a ser una especie de misiva resultado de la combinación o ¨mezcla¨ de otras dos previamente escritas. tres bases juntas (codon) codifican un tipo de aminoácido. lo que hacen los progenitores de un hijo es mezclar la información que traen de manera individual en cada uno de sus sobres y transmitirlo a su descendencia. ¿no sería lógico esperar que los mecanismos de herencia varíen?. dicho propósito se concretó en 1953.G) que representan las bases nitrogenadas mencionadas anteriormente.000 millones de pares de bases o sea 5. cada hebra posee (para que tengamos una idea) 5.G. siendo este ¨juego de sobres y cartas¨ uno de los más dinámicos e importantes en biología. cada medio peldaño representará una base nitrogenada. plantas. De todo ello podemos deducir que basta el cambio en la estructura de una base (mutación) para que se codifique un aminoácido diferente.De la Biología al Mito H. ¿porqué tanto virus. Guanina y Timina) las mismas que se unen de forma específica entre sí (Adenina con Timina y Citosina con Guanina). Nuestro genoma está compuesto por un número haploide de 23 cromosomas (el número diploide es 46). luego giraremos sus extremos en sentidos opuestos. Citosina. imaginemos una escalera muy larga y flexible. por lo que la sucesión de bases se constituye en un mensaje que definirá las secuencia de aminoácidos y por ende el tipo de proteína. estos sobres. Muchos aminoácidos pueden estar codificados por más de un tipo de codon.C. TOCANDO LA MOLÉCULA DE LA VIDA James Watson y Francis Crick se dieron a la tarea de determinar la estructura de la molécula de DNA.T) se pueden obtener 64 posibles combinaciones agrupándolos en tríadas (codones). es decir desde un virus hasta una ballena azul. por eso es que no existen 64 tipos de aminoácidos sino. una molécula de DNA básicamente tiene la función de albergar y transmitir un mensaje que puede ser de carácter estructural o comportamental y que va en “sobres cerrados” a los que llamamos genes. contienen dentro de sí fragmentos de DNA que determinan cualquiera de los mensajes mencionados anteriormente y así como nuestro alfabeto se compone de 23 letras en base al cual se fundamenta nuestro lenguaje. al margen de que algunos codones no codifican nada sino simplemente son espaciadores o no funcionales. Existen cuatro tipos de bases nitrogenadas (Adenina. menos. es interesante saber que el lenguaje genético se repite en todos los organismos vivos sin excepción. en el caso del mensaje genético este se compone de cuatro letras (A. En este contexto y si es que en verdad cada organismo fue creado de manera individual. Para tener una idea de la forma de esta molécula. Por otro lado. Si toda esta información la transformamos a bits veremos que la información acumulada en un cromosoma equivaldrá aproximadamente a 40 tomos de libros de 500 páginas cada uno. Dicho así. el primero contaba en ese entonces con 23 años y el segundo con 34.T.

CROMOSOMAS. si el Esperanto no prosperó entre las sociedades humanas. b y c. C=Citocina. pero la segunda requería de argumentos evolutivos con una previa fundamentación genética como la que exponemos a continuación. C D G P T P C P D D P G D c P A D D D P T A D b a a. Watson y Crick en circunstancias en las que se daba a conocer su descubrimiento producido 53 años luego de que se descubriera el trabajo de Mendel. Tal como se dijo anteriormente los cromosomas no son mas que moléculas de DNA en su máximo estado de co ndensación. por lo que la pérdida de un segmento de un cromosoma o el cromosoma entero implicará a menudo la inviabilidad de los gametos y la pérdida de genes. ya que un abordaje eminentemente biológico bastaba. En los organismos eucariota como indicamos anteriormente. Estructura simplificada de la molécula de DNA desde un modelo tridimensional de la molécula (A=Adenina. La primera parte de la pregunta era relativamente sencilla. Azurduy-Ferreira genético? Más allá de cualquier apreciación peyorativa lo evidente es que existe un lenguaje genético que viene hablándose a lo largo de millones de años y una de cuyas frases somos nosotros (simplemente como analogía. VEHICULOS DE LOS GENES En una clase para estudiantes de Psicología me preguntaron que si al igual que el hombre. los 73 . D=pentosa.De la Biología al Mito H. P=Grupo fosfato). las moscas también tienen cromosomas y por qué. es una metáfora que quizás debemos a considerar en el futuro del hombre y su entorno). G=Guanina. T=Timina. el esperanto con el que la vida se escribe a sí misma.

1 2 3 6 7 8 13 14 15 9 4 5 10 11 12 16 17 18 Cromosomas sexuales (XX) 19 20 21 22 X Y Cariotipo de un individuo femenino de Homo sapiens que muestra los 23 pares que componen su genoma. o en caso de células sexuales (óvulos y espermatozoides) existe un proceso de reducción a la mitad (meiosis) con la finalidad de que una vez unidos óvulos y espermatozoides se mantenga el número normal de cromosomas en la especie. 74 . algunos gusanos poseen 2 cromosomas. el número de cromosomas no determina niveles de inteligencia o evolución. sino. el chimpancé 48. pues no es así. En recuadro: La Venus de Milo. la mosca común 12. existen cangrejos que poseen 200 y ciertos helechos pueden tener hasta 1. el perro doméstico 78. que son precisamente estas alteraciones a procesos considerados normales los que eventualmente pueden producir poblaciones de organismos diferentes genéticamente hablando (nuevas especies). Los cromosomas en los procesos de división en células somáticas (no sexuales) duplican su número (mitosis) para que ambas células mantengan el mismo número cromosómico. Azurduy-Ferreira cromosomas no son más que corpúsculos que resultan de la condensación de las largas moléculas de DNA y cuya forma y número difiere entre las especies. Si pensábamos que nuestro número cromosómico era el mayor. claro que existen fenómenos naturales que en determinado momento pueden alterar el normal proceso mitótico o meiótico (situación a la que haremos referencia cuando hablemos sobre mutaciones). el hombre 46. pero en todo caso es importante dejar sentado. Así.De la Biología al Mito H.200 cromosomas! Hay que aclarar que ciertas especies pueden tener un igual número cromosómico pero en ese caso no es el número cromosómico lo que marca la diferencia entre especies. la paloma común 80. el patrón de información contenida en los genes.

lo que evolutivamente significa que tenemos una mayor afinidad de parentesco con los ratones que con los peces. De la microfotografía que se obtenga se obtendrán recortes es individuales de cada cromosoma para luego ser apareados (no nos olvidemos que expresará un número diploide) y acomodados tal como se muestra en la página anterior. ratónes.De la Biología al Mito H. Por ejemplo la forma de los cromosomas del hombre con los del chimpancé y gorila son más similares entre sí. Humano (a). a b c d e Aspecto de una Lemnacea Wolffiella hyalina Wolffiella lingulata Wolffia columbiana Morfología cromosómica en algunas especies de animales y plantas. Notemos que la forma cromosómica humana difiere considerablemente de la de los peces. ratón (b). en relación a la morfología de los cromosomas de la mosca de la fruta o plantas como las Liliáceas (lirios. Abajo: nótese la gran similitud de formas entre las tres especies. 75 . pez (d). anfibio (c). anfibios y peces expuestos en la figura anterior. Azurduy-Ferreira La forma de representar el número de cromosomas de una especie es lo que denominamos cariotipo. tres especies de una planta acuática de la familia Lemnaceae (e). se lo obtiene por un proceso en el que básicamente se induce químicamente a una célula a que condense el DNA contenido en su núcleo y llegue a una fase en la que todos los corpúsculos de DNA condensados (cromosomas) se agrupen para luego ser sujetos de colorantes que los teñirán y así. Un ejemplo de aquello es lo que graficamos a continuación en base a la morf ología cromosómica del hombre. pero se asemeja más con la de los ratones. azucenas) o Agaváceas (ágaves). posibilitar su observación desde un microscopio. La morfología de los cromosomas varía en la medida que las especies pueden ser poco o muy afines evolutivamente hablando.

es un rasgo frecuente entre las aves y que a su vez las diferencia por ejemplo de los mamíferos. Meses atrás. respecto a peces y anfibios. etc. como gorilas y el mismo hombre hubieran sido creados independientemente y no tuvieran relación evolutiva alguna ¿no era de esperar que la morfología cromosómica fuera muy diferente entre sí? ¿Por qué esas diferencias genéticas leves entre organismos que por otras vías (anatomía. etología. este patrón cariológico. es que considerando la mayor semejanza entre cromosomas de ratones y el hombre. Volvemos al sentido de una pregunta que nos hicimos en un apartado anterior. si tanto chimpancés. caracterizado por la abundancia de microcromosomas. ambos poseen una mayor afinidad evolutiva entre sí. Azurduy-Ferreira Hombre Ratón Anfibio Pez Afinidad cualitativa entre organismos basada en la morfología cromosómica Cromosomas La inferencia que podemos hacer de este esquema.De la Biología al Mito H.) y de manera 76 . tuve la oportunidad de ver por primera vez cromosomas de una lorita del género Myopsitta y quedé intrigado por la abundancia de cromosomas diminutos (Microcromosomas) que vistos al microscopio son solo pequeños puntos que dificultan grandemente su ordenamiento e identificación. fisiología. paleontología.

XI EVOLUCION MOLECULAR DNA es una molécula cuyas propiedades de transmisión y replicación. Darwin nunca vio un gen. Los griegos no vivieron el momento del descubrimiento de Leweenhook cuando gracias a su primitivo microscopio pudo ver algo que ningún hombre había visto antes: una célula. el peregrinaje del conocimiento ha pasado por varias etapas. Azurduy-Ferreira independiente. ausentes en otro nivel de organización biológica mayor. pero lo intuyó . se los ha definido como organismos afines? La respuesta puede ser entendida únicamente si se concibe una relación evolutiva entre los organismos en cuestión y por lo visto. Tecnología disponoble posible recién desde hace menos de 15 años. no a partir de la suposición de creaciones individuales. 77 .De la Biología al Mito H. por el sistema Scanning Tunneling Microscope. así como la Psicología clásica intuyó la influencia genética en el comportamiento sobre algo que denominó instinto. codon. y es que su universo de indagación estuvo condicionado entre otras cosas. exones. en la que pueden estar albergadas muchas respuestas evolutivas. pero pese a ello intuyeron niveles de organización orgánica menores a las que sus ojos les permitía ver. intrones. u otras parecidas de uso corriente en la actualidad . Desde la etapa Darwiniana. Darwin no tenía idea de términos como marcadores moleculares. Algo que Darwin e incluso biólogos de hace dos décadas no tuvieron la oportunidad de ver Micrografía obtenida de la molécula de DNA. por las limitaciones tecnológicas propias del momento. la hacen una herramienta molecular adicional. DNA.

los primero s anfibios o los primeros peces. etc. textura. Bajo estas consideraciones la Evolución Molecular es una manera de indagar en evolución desde el estudio de moléculas orgánicas. hemos retrocedido cerca de 500 millones de años. La molécula de DNA posee una propiedad fundamental en evolución: Se replica y puede ser transmitida. bajo la presunción de que entender las rutas evolutivas de fragmentos clave de un genoma. Azurduy-Ferreira Un Sucha cabeza negra (Coragyp atratus) así como otras aves carroñeras posee quimiosensores olfativos tan sensible. en un contexto histórico puede permitirnos reconstruir rutas evolutivas y por ende sugerirnos cuan emparentado está un Itonama de Bolivia c o n u n Machiguenga del Perú. sino leves variaciones de sus manifestaciones. menos eficiente?. muchos de cuyos vestigios están desperdigados en el material hereditario de las especies actuales. En las hormigas la comunicación es fundamentalmente química y definida en cambios leves de las feromonas secretadas por otras hormigas. o sea los que abordan problemas filogenéticos los que pueden ser inferidos a partir de la relación genética entre grup os (macroevolución) o aspectos relacionados con genética de poblaciones (microevolución). que puede percibir olores a cientos de metros de altura. amenaza. Cuando decimos ¨olores¨ estamos hablando fundamentalmente de moléculas cuya estructura determina una propiedad que es específica. es decir cuya finalidad es la indicar cómo una mutación afecta la función de una determinada proteína (es más eficiente?. cuántos genes comunes tenemos con el Mono nocturno sudamericano. han estado en el genoma de hombres primitivos como Homo habilis. sabores. Este mecanismo de replicación y transmisión le ha posibilitado transitar por millones de años y gracias a diversos mecanismos reproductivos desarrollados en sus temporales portadores. O en otro nivel de análisis. Tan solo con remontarnos a los primeros peces. etc. La praxis… Estudios sobre Evolución Molecular pueden tener dos tipos de enfoques: a) Aquellos dedicados al estudio de la evolución de moléculas. de modo tal que interpretar la molécula de DNA y sus propiedades bioquímicas. así el espectro de variantes en los niveles de feromonas define un conjunto de señales que pueden ser sinónimo de: alerta. consistencia. respecto a un Eyak del Artico. de modo que todo cambio en su estructura significará un cambio en sus propiedades. De este modo vemos que los químicos no e s que trabajen con moléculas propiamente dicho . así la historia evolutiva podemos verla como la historia de los cambios genéticos. pero no es que literalmente ¨lean moléculas¨. dureza. 78 . es funcional?. sino con la manifestación de sus atributos que pueden ser colores. la rata canguro de Africa o la Tuatara de Nueva Zelanda.De la Biología al Mito H. tiempo en el cual la molécula ha dejado sus rastros en las formas de vida que ha producido (si tenemos en cuenta que toda estructura o forma de un organismo esta determinado por los genes). Adelobasileus cromptoni (el mamíferos mas antiguo conocido). los primeros reptiles surgidos en el planeta.. olores.). densidad. puede ayudarnos a inferir las rutas evolutivas (valga la redundancia) de las especies portadoras de los mismos. de modo que muchos de los genes que portamos. etc. b) Aquellos que usan las moléculas para estudiar evolución en sí.

y con la única finalidad de dar una idea de cómo pueden ser utilizadas las mismas. filogenia.De la Biología al Mito H. El alineamiento y/o ubicación de las proteínas teñidas (en forma de bandas) en el gel. aunque sorprendente e inexpectablemente Lewontin y Hubby (1966) reportaron que por medio de electroforesis de proteínas se detectó altos niveles de variación genética en Drosophila (mosca de la fruta). etc. Microsatélites e. RFLP (Iniciales de Restriction Fragment Length Polimorphisms) d. Esta metodología toma ventaja del hecho que proteínas no desnaturalizadas con diferente carga eléctrica migran a diferentes velocidades a través de diferentes tipos de gel preparados para tal efecto y a los que se aplica corriente eléctrica a ambos extremos. nueve años antes (1944) Avery. MARCADORES MOLECULARES Existen cinco metodologías básicas para inferir relaciones evolutivas: a. Electroforesis de proteinas Smithies (1955) introdujo el uso de electroforesis en gel de almidón para proteínas. Secuenciación A. sistemática. Hunter y Markert (1957) y Markert y Moller (1959) establecen tinciones para actividades enzimáticas específicas. paleobiogeografía. delimitación de especies. 79 . de tal manera que proteínas cargadas positivamente migrarán hacia el cátodo y las negativas hacia el ánodo (muchas proteínas tienen diferentes cargas producto de la composición diferente en relación a los aminoácidos). Azurduy-Ferreira Dadas las características de esta parte del libro solo veremos de manera general como las moléculas pueden ser utilizadas para estudiar evolución. modos de especiación. MacLeod y McCarty ya habían reconocido a la molécula de DNA como el material genético y tres años previos (1941) Beadle y Tatum identificaron a las proteínas como su producto genético primario. Electroforesis de proteínas b. Una de sus más evidentes limitaciones de esta metodología es que puede eventualmente esconder variación ya que no todas las substituciones en los aminoácidos cambian la movilidad electroforética de la proteína. es necesario indicar que si bien Watson y Crick (1953) son los primeros en describir la estructura de la molécula de DNA. monomorfia. nos dará datos en relación a genotipos para un determinado gen. Su aplicabilidad puede estar relacionada con estructura poblacional. polimorfia. sin entrar en mayores detalles. para ello realizaremos una sinopsis de las herramientas moleculares utilizadas en la actualidad. origen de plantas poliploides y tasas de evolución entre otros. mientras que Harris (1966) reportó lo mismo para Homo . Abriendo criptas A modo de hacer justicia y tratando de reflejar ciertas circunstancias en su real dimensión histórica. DNA-DNA hibridación c.

lo que implica a su vez que se trata de DNA extranuclear . se transmite por vía materna (mitocondrias solo poseen los óvulos y no así los espermatozoides) y posee una alta tasa de mutaciones 80 . hacer que las mismas se disocien y finalmente posibilitar de que las mismas se reasocien azarosamente y conformen una nueva molécula de doble hélice. Una de esas grandes aplicaciones se dio en estudios realizados a partir del uso de DNA mitocondrial (DNAmt o mtDNA) que es una molécula de forma circular encontrado en las mitocondrias. uno de los mas renombrados evolucionistas en la actualidad. es decir.De la Biología al Mito H. los enlaces de hidrógeno se rompen y ambas cadenas se separan quedando como resultado dos cadenas simples. El DNAmt se caracteriza por contener a 37 genes (entre ellos los más conocidos son citocromo b y la región de control). describen metodologías relacionadas con la hibridación de moléculas de DNA. 5’…A*CTAGT…3’ 3’…CTTAA*G…5’ 3’…TGATC*A…5’ " " " " John Avise (Universidad de Georgia). constituyéndose así en la primera demostración de que era factible detectar polimorfismos en la molécula de DNA para ser aplicados en un nivel poblacional. filogenia y determinación d e relaciones evolutivas. descubren las endonucleasas de restricción. presenta en 1978 y por primera vez. el apareamiento correcto de bases nitrogenadas entre sí será mayor. Es justamente este principio el que nos posibilita mezclar DNA proveniente de especies diferentes. y que la comparación está restringida a una fracción (copia simple) del genoma. Es de esta manera que este método es muy utilizado en sistemática. Este método se fundamenta en la naturaleza (cadena doble) de la molécula de DNA y el hecho de que los nucleótidos se encuentran apareados en cadenas compleme ntarias unidas por enlaces de hidrógeno. RFLPs (restriction fragment length polimorphisms) Linn y Arber (1968) y Meselson y Yuan (1968). sucediendo lo contrario en caso inverso. Es obvio esperar que mientras más relacionados (evolutivamente) sean los organismos en cuestión. que en palabras simples son enzimas que tienen la cualidad de separar segmentos específicos de la molécula de DNA. lo que a su vez desencadenó un gran número de posibilidades investigativas en relación a explorar en segmentos discretos de DNA e indagar sobre su influencia en la evolución de determinadas poblaciones. pero en este caso una molécula de DNA híbrida. A y T se unen específicamente por dos enlaces de hidrógeno mientras que C y G lo hacen siempre por tres. son una especie de “tijeras inteligentes” que “saben” que regiones de la molécula tienen que cortar. estudios pioneros sobre el uso de enzimas de restricción para el análisis de variación de DNA en poblaciones. las mismas que pueden volver a unirse entre sí bajando la temperatura (no olvidemos que son cadenas complementarias). Por ejemplo: la enzima EcoRI solo corta en zonas (*) donde existen las siguientes secuencias: 5’…G*AATTC…3’ o la enzima SpeI. Algunas limitaciones de este método son que gran cantidad de polimorfismo intraespecífico puede ser problemático en la determinación de relaciones filogenéticas. C. Azurduy-Ferreira B. Cuando la molécula es expuesta a temperaturas de 100°C. DNA-DNA H ibridación Wetmur y Davidson (1968) y trabajos posteriores.

relaciones evolutivas. En el proceso. D. El proceso de secuenciación (de manera simplificada) consiste en (1) extracción de DNA (nuclear o extranuclear). estructura de poblaciones. biogeografía. de tal manera que cualquier cambio en los pares de bases nitrogenadas será detectado ya que el mismo no podrá ser cortado. (4) pasar las muestras al secuenciador automático. etc. Los trabajos pueden estar relacionados con sistemática. El tratamiento de dicha información dependerá de las características intrínsecas de lo secuenciado y de los propósitos del trabajo que se pretende realizar. Es necesario aclarar que no son sinónimo de minisatélites ya que éstos poseen hasta 20 bp. E.000 años y a ese ancestro se le llamó “Eva” ya que como mencionamos anteriormente. es decir DNA de cloroplasto (cpDNA o DNAcp). reconstrucción de filogenias. Estos segmentos tienden a estar distribuidos azarosamente a lo largo del genoma. la posición relativa de cada zona cortada es mapeada de tal manera que posteriormente se pueda comparar con el mapa proveniente de otro organismo y determinar los sitios específicos en los que ambos difieren. o sea. Los microsatélites mutan mucho mas rápido que un gen funcional y por ello son de mucha utilidad para estudios a nivel de poblaciones. nos referimos al proceso por el cual podemos determinar la secuencia de bases nitrogenadas en la molécula de DNA. (2) purificación de DNA. Microsatélites Son segmentos de DNA muy cortos (2 a 5 bp –pares de bases nitrogenadas-) y que poseen una alta tasa de variación. como por ejemplo: …AAAATTCGGGTTTTTTTTGAAAACCCCAAAAAAA…etc. obtener muchas copias por medio de PCR. las enzimas de restricción cortan la molécula circular en segmentos. Estudios de esta naturaleza (DNA extranuclear) son también realizados en plantas. el procedimiento para su obtención es también a través de la utilización de endonucleasas de restricción. 81 . Kreitman (1983) estudia la variación en la secuencia de DNA en un gen de Drosophila melanogaster (mosca de la fruta). Azurduy-Ferreira (10 veces mas que el DNA nuclear). es decir despojarla de las proteínas que envuelve (histonas). La combinación de las propiedades del DNAmt para estudios evolutivos y la utilización de relojes moleculares sustentó la hipótesis de que el ancestro de la humanidad vivió en Africa hace unos 200. Entre 1985 y 1986 se desarrolla la tecnología de PCR (Reacción en Cadena de la Polimerasa) que básicamente permite obtener copias (miles o millones) de una determinada molécula (o segmento) de DNA. biparentalmente en algunas y paternalmente en muchas (principalmente gimnospermas). el DNAmt es transmitido únicamente por vía materna. conservación de vida silvestre. de donde la información pasará a una base de datos informatizada de donde puede ser recuperada.De la Biología al Mito H. Secuenciación Cuando hablamos de secuenciación. luego. (3) amplificación o clonación de DNA. Estas características sumadas a su fácil “manipulación” en laboratorio y análisis lo hacen atractivo para estudios poblacionales en animales. descritas anteriormente. A mayor existencia de sitios comunes se considera que la relación evolutiva es mayor. Este tipo de DNA es transmitido en la mayoría de las plantas maternalmente.

En el mismo. Azurduy-Ferreira En el caso de estudios eminentemente evolutivos las secuencias provenientes de diferentes organismos. pueden ser “vaciadas” a determinado tipo de programa (existen varios) que nos permitirán “manipular la información”. esto implica que existe una mayor afinidad entre 1 y 3. mientras que las poblaciones 1 y 3 lo hicieron con posterioridad. que en relación a la población 3. el proceso va acompañado por el manejo de una serie de modelos matemáticos complejos que guían al investigador. las poblaciones 1 y 2 guardan una mayor similitud entre sí. Un ejemplo muy simplificado sería el siguiente: Se han obtenido secuencias de DNAmt de individuos provenientes de 3 poblaciones y nuestra intención es saber por un lado el grado de afinidad evolutiva que existe entre las mismas e indagar en su historia. se evidenciarán las afinidades evolutivas de los organismos en cuestión.De la Biología al Mito H. El resultado será la obtención una serie de gráficos (cladogramas) de los que se elegirá el mas parsimonioso. …AATTTTTTTTTTTTTTTTGGGG… Existe una mayor afinidad evolutiva entre las poblaciones 1 y 3 en relación a la población 2. 82 . Las secuencias genéticas son: POBLACION 1 …AAAAATTTTTTTTTGGGGGCC… POBLACION 2 …AATTTTTTTTTTTTTTTTGGGG… POBLACION 3 …AAAAAATTTTTTTGGGGGGCC… Si analizamos las secuencias. entonces: P1 …AAAAATTTTTTTTTGGGGGCC… P3 …AAAAAATTTTTTTGGGGGGCC… P2 La población 2 se separó primero en el tiempo.

BIOLOGIA MOLECULAR Y NEODARWINISMO Una vez demostrada la base celular de la vida. Un ejemplo. la razón era que los conceptos propuestos por dichos autores. era la ausencia de un mecanismo que explicase la herencia.a. Ejemplos moleculares adicionales son los que concluyen que la hemoglobina humana (proteína encargada de transportar oxígeno en la sangre) posee los mismos aminoácidos que la hemoglobina de los chimpancés (Pan troglodytes) y que difiere solo en dos con los gorilas (Gorilla gorilla). Uno de los principales impulsores del Neodarwinismo fue el genetista Theodosius Dobzhansky (1900-1975) quien publicó en 1937. Los planteamientos esenciales de esos trabajos generaron enormes controversias. Trabajos mas recientes (Bailey et al. De la síntesis entre la teoría darwiniana y la teoría genética moderna. Con el advenimiento de la Biología Molecular y sus métodos para indagar en niveles muy finos de las moléculas de la herencia se hizo posible el abordar nuevos temas en Evolución hasta entonces no considerados. el papel de los ribosomas en la síntesis de proteínas. el paleontólogo G. Simpson.De la Biología al Mito H. contradecían expectativas en disciplinas como por la paleontología. dos trabajos de Zuckerland y Pauling (1962 y 1965). hace 15 a 30 m. Otros evolucionistas que impulsaron esta nueva concepción de darwinismo fueron el genetista J. la Genética y la Bioquímica se encaminaban en una nueva dirección y bajo una nueva concepción: la Evolución. Esta nueva perspectiva de le teoría evolutiva permitió indagar en un nuevo y vasto campo investigativo en el que la Biología Molecular. La conformación de la doble capa de las membranas celulares. Con los avances recientes de la genética se han podido resolver tres problemas que Darwin no pudo dilucidar: 1) Cómo se transmiten los caracteres genéticos de generación en generación. el ornitólogo Ernst Mayr y el botánico Ledyard Stebbins.y gorilas –Gorilla gorillaentre otros). los trabajos de Sarich y Wilson en cambio evidencian que dicha separación se produjo hace tan solo 5 m. Haldane. y tal como él mismo lo reconoció. S. nace el Neodarwinismo o Teoría Sintética. los estudios sobre ultraestructura y bioquímica de la célula han revelado un sinnúmero de homologías nuevas en los niveles de organización ultramicroscópica y molecular en los organismos vivos. a diferencia de la anterior clasificación en la que los ¨simios¨ eran incluidos en una familia diferente (Pongidae). B. la organización interna de las cilias y flagelos. una serie de trabajos de Sarich y Wilson sobre la relación evolutiva entre la especie humana y varias especies de primates (chimpancés –Pan troglodytes. Todo ello derivó en que en la actualidad tanto humanos como simios sean incluidos en la misma familia (Hominidae). el Darwinismo Clásico llenaba un vacío y se daba inicio a una nueva etapa en el desarrollo de la Teoría Evolutiva. una de las grandes falencias en la obra de Darwin. Como hemos mencionado. Genética y el Origen de las especies. con ello. y mucho más lejos del orangután (Pongo pygmaeus). sugieren un sentido de ¨unidad biológica¨. Azurduy-Ferreira GENETICA. la misma surge en la década de los 60 con dos eventos principales: el primero. sus resultados nos colocan mucho más cerca del chimpancé y del gorila. 1991) 83 . 2) porqué los caracteres genéticos no se mezclan y 3) cómo surgen las variaciones sobre las cuales actúa la Selección Natural. G.. la universalidad del código genético. uno de ellos fue la Evolución Molecular .a. El segundo. entre otros. la visión premolecular proponía que la línea que llevó a nuestra especie se separó de la que llevó a los monos superiores..

30 1.44%). Graficando el cambio de posición sistemática del hombre respecto a los otros grandes primates en un contexto pre y post-molecular tenemos: DEFINICIÓN PREMOLECULAR Hombre FAMILIA HOMINIDAE Chimpancé Gorila Orangután FAMILIA PONGIDAE DEFINICIÓN POSTMOLECULAR Hombre Chimpancé Gorila FAMILIA HOMINIDAE Orangután 84 . Azurduy-Ferreira demuestran que las secuencia de DNA de pseudogenes como el ? ? -globina poseen los siguientes niveles de divergencia: ORANGUTAN ORANGUTAN GORILA CHIMPANCE HOMBRE 3. hombre -orangután 3.39 3.56% (o dicho de otra manera una similitud del 98.69 GORILA CHIMPANCE 1. 1991) Del cuadro anterior podemos interpretar que entre el hombre y el chimpancé (para ? ?-globina) existe una diferencia de 1. Taxonómicamente es evidente que el hombre y los chimpancés conforman un grupo hermano (rango filogenético que determina una muy estrecha afinidad entre quienes lo componen) que se diferencia o ¨aleja¨ progresivamente de los gorilas y considerablemente de los orangutanes.56 HOMBRE Niveles de divergencia genética (%) en secuencias de ? ?-globina (de Bailey et al.82 1. mientras que para hombre -gorila 1.69%.30% y así sucesivamente.De la Biología al Mito H.42 3.

Para concebir un reloj molecular ideal tenemos que asumir los siguientes hechos (factores). chimpancés y hombre de su linaje ancestral? Cuando se trata de hacer entender esta situación en el contexto de los relojes moleculares generalmente recurro a la siguiente metáfora: es. . El punto donde los mismos se intersecten marcará una determinada edad en el pasado.5 y 3 substituciones.De la Biología al Mito H. éste. determinar el tiempo en el que dos ramas evolutivas divergieron en el pasado? o dicho de otro modo ¿cómo podemos a partir de las moléculas. Azurduy-Ferreira DE KRONOS A LAS MOLÉCULAS Volviendo a los trabajos de Sarich y Wilson. De ahí es que Sarich y Wilson (considerando que en esta proteína en particular chimpancés y humanos difieren en 12 unidades) determinaron que ambas especies se separaron hace aproximadamente 5 millones de años. como lanzar dos proyectiles desde dos lugares diferentes al pasado. De esta manera se descartarían muchas posibilidades en relación al piso(s) geológico(s) en el(los) que se tiene que buscar y circunscribirse de esta manera a espacios geológicos verticales mas reducidos y mejor definidos. . saber hace cuanto tiempo se separaron gorilas. El fundamento general para establecer el “momento” (a partir del uso de relojes moleculares) en el que dos líneas evolutivas se separaron radica en que primero. será interpretado como el ¨momento¨ en el que dos linajes evolutivos se separaron o como diría Avise ¨el punto en el que dos linajes evolutivos Coalescen¨. pero que pueden ser rastreados a partir de evidencias actuales. es obvio suponer que así como se fueron gestando cambios morfológicos divergentes a partir de estructuras preexistentes en la población ancestral. lo que quiere decir que la velocidad de substitución en el tiempo de un aminoácido por otro. es mas o menos constante en las especies. De esta manera (aunque los fundamentos son mucho mas complejos que los descritos) podemos darnos cuenta que los relojes moleculares no son mas que relojes evolutivos que marcan eventos de disyunción de linajes producidos millones de años atrás.En la combinación de datos paleontológicos y moleculares para la reconstrucción de filogenias ante la eventual ausencia de fósiles. segundo. muy distantes entre sí y con un determinado grado de inclinación cada uno. Por ello las variaciones que observaremos serán estocásticas (debidas al azar).En la revisión (o eventual redefinición) de datos paleontológicos relacionados con separación de linajes. ¿cómo es que ellos pudieron a partir de datos moleculares. existe una fuerte correlación entre divergencia en la secuencia genética y el tiempo en el que dicha divergencia se produjo. Los relojes moleculares (con excelente calibración) pueden ser usados por ejemplo: . también se fueron dando cambios divergentes a partir de un pool génico (poza génica) común a dos grupos de organismos. . 85 .El cambio molecular es una función linear de tiempo.Predeterminarción de horizontes geológicos en los cuales (a partir del uso de relojes moleculares) es plausible buscar determinados ancestros fósiles de organismos actuales. Por ejemplo Sarich utilizó albúmina como reloj molecular y determinó que en el transcurso de un millón de años se pueden dar entre 2. con substituciones que se acumulan siguiendo una distribución de Poisson.

y así determinar un ¨momento¨ evolutivo. Una regresión de tiempo. existe una brecha entre lo ideal y lo posible. la dimensión de la misma dependerá de la calidad del reloj molecular a utilizar. Si las tasa de sustitución genética pueden ser constantes en el tiempo y de esta forma se puede predecir niveles de divergencia futura. es como en el caso de la datación relativa a partir de los fósiles. Las especies A y B son la representación de un proceso a lo largo de la historia geológica. según datos moleculares. considerando un determinado número de substituciones puede ser realizado sin errores. en tal sentido debemos indicar que no todos los relojes moleculares funcionan con la exactitud que se espera. que su utilización para la determinación de edades es imposible. En el caso de los relojes moleculares la exactitud del reloj molecular dependerá de la tasa de substituciones que lo caracterice. algunos son excelentes marcadores de edades ya que poseen una estrecha distribución vertical en la secuencia geológica. Azurduy-Ferreira Tasa de cambio es igual a lo largo de todas las posiciones (nucleótidos) comparadas y a lo largo de todos los linajes. entonces también es factible calcular las substituciones genéticas ¨en reversa¨. Especie A TIEMPO ACTUAL x° Especie B y° TIEMPO GEOLOGICO PASADO (millones de años) Edad en el que A y B divergieron en el tiempo. Es importante afirmar que en el tema de los relojes moleculares. haciendo una analogía. y cada rama en el árbol puede ser analizada de manera independiente. la relación en este sentido será: a menor número de 86 . El árbol filogenético puede ser reconstruido sin error. Punto de coalescencia (Pool génico ancestral) Proyectiles Representación esquemática de la determinación de un eve nto de divergencia evolutiva a partir del uso de relojes moleculares (elaboración propia). El número de substituciones a lo largo de cada linaje en el árbol puede ser reconstruido sin error. mientras que otros son pésimos marcadores ya que su distribución ve rtical es tan amplia.De la Biología al Mito - H.

se descubren dos géneros de aves (Pitohui e Ifrita) que evidenciaron concentrar batracotoxinas e n s u p i e l y plumas como uno de sus productos metabólicos. 87 . recientemente Dumbacher et al. pasando por los reptiles se hubiera dado una especie de GAP (vacío) evolutivo en los reptiles. Por otro lado dicho género es parte de la familia Melyridae que posee una amplia distribución en el mundo. los cuales pudieron haber producido batracotoxinas. ¿Cómo explicamos el hecho de que tres géneros. Nueva Guinea. ellos trabajaron con un reloj molecular cuya tasa de substitución entre 2. es decir. Por ejemplo en el trabajo de Sarich y Wilson. solo que ahora los mismos están extintos. esta sustancia tóxica (una de las mas letales identificadas en la naturaleza) era conocida solamente en exudaciones dérmicas de la rana venenosa Phyllobates de América del Sur. dos de aves y uno de anfibios. compartan un complejo molecular con similar estructura y por ende similares propiedades? Obordar el cuestionamiento asumiendo de inicio un razonamiento filogenético (es decir estrictamente evolutivo). Bajo la HIPOTESIS B. adquieren los insumos primarios con los que metabolizan la toxina.5 y 3 lo que lo hace un excelente marcador. separados continentalmente.De la Biología al Mito H. Un escarabajo para dos Tendría algún significado un contexto evolutivo. Tratar de demostrar esta opción implicaría de antemano demostrar una coherencia biogeográfica histórica entre los grupos implicados ya que estaríamos suponiendo que se trata de rasgo derivado ancestral y descartar la posibilidad de una simple manifestación atávica fijada por selección natural. mientras que por otro lado se han determinado tasas de substitución en otras proteínas que oscilan entre 1 y 35 lo que los hace pésimos relojes moleculares. Así. (2004) indagaron en la dieta de las aves guineanas. establecer si la producción de batracotoxina se genera en el genoma o existe una fuente externa a partir de la cual tanto la rana sudamericana y las aves de nueva guinea. (2000) reportan 6 tipos de batracotoxinas para Ifrita kowaldi. Especimenes analizados de este escarabajo evidenciaron altas concentraciones de batracotoxina. La otra posibilidad (HIPOTESIS B) nos lleva a preguntarnos el origen o raíz metabólica. interviene un tercer elemento en escena que aunque algo inesperado nos muestra los matices en los que nos podemos encontrar al pensar en moléculas y evolución. nos llevaría a considerar (HIPOTESIS A) posibles factores históricos que habrían intervenido en el pasado para que de un stock ancestral en la evolución de los anfibios a las aves. suponiéndose que de igual forma que como las aves papuinas (Pitohui e Ifrita) la rana Phyllobates adquiere su fuente de batracotoxina. aspecto que los llevó a concluir que la base de la batracotoxina en estas aves es tá en su alimento. incluyendo Sudamérica como parte de ella. el hecho de que especies que habitan ambientes extremos en frío como ciertos insectos. El caso es que hasta entonces. peces o anfibios posea n una ¨proteína anticongelante¨ con una estructura molecular similar? O que un grupo de rana s sudamericanas y ciertas aves de Nueva Guinea produzcan sustancias tóxicas producida por un mismo tipo de moléculas? En 1992 en Papua. situación ésta que simplemente evidencia las fluctuaciones en las tasas evolutivas en el nivel molecular. Dumbacher et al. y observaron que uno de los itemes más consumidos era un escarabajo del género Choresine. Si bien la Homobatracotoxina es reconocida como la toxina g enérica. Azurduy-Ferreira substituciones el reloj molecular será más exacto.

La fórmula que se presenta es del tipo homobatracotoxina. 88 . Azurduy-Ferreira Pitohui Phyllobates El ave Pitohui de Nueva Guinea y la rana venenosa Phyllobates de Sudamérica comparten la capacidad de sintetizar batracotoxinas.De la Biología al Mito H.

De la Biología al Mito XII H. Por lo demás. DNA aún sin desnaturalizar. Palpar reliquias biológicas de e sta naturaleza puede estar entre las cosas más excitantes. la aplicación de metodologías como DNA-DNA hibridación. Azurduy-Ferreira GENES FOSILES Una de las experiencias inolvidables en esta aventura que significa la Biología fue la de tener entre mis manos restos de pelos de mamut. si un tejido (óseo.) se ha preservado durante miles o millones de años y bajo condiciones mínimamente favorables (bajas temperaturas). ya que es lo más cercano a ¨acariciar¨ un megamífero pleistocénico como el mamut. muscular. secuenciación. etc. estaríamos ante una información genética que se asemeja a una ventana más abierta al pasado. si se da el caso. que deambuló desde la estepa arcaica que fue Beringia hasta lo que hoy es México. RFLPs para 89 . es factible esperar que del mismo pueda extraerse DNA antiguo (DNAa). Reconstrucción iconográfica y una muestra de pelos de Mammuthus primigenius. depositados en la colección de tejidos para estudios genéticos en un Museo para estudios del Artico. se han desarrollado una serie de protocolos especiales para la extracción de un material de esta naturaleza que dada sus características. Años atrás. la idea de extraer DNA a partir de material fósil podía haber sido considerado un argumento digno de una película de ciencia ficción. es muy frágil y requiere de procedimientos muy delicados y precisos. Materiales de esta naturaleza han podido conservarse gracias a las bajas temperaturas que circundaron al individuo muerto de modo que no solo se pudo conservar órganos como el sistema digestivo. Con tal finalidad. sin embargo. piel u otros. dérmico. sino además. La Muestra es parte de fragmentos de piel colectados de permafrost en la Siberia rusa.

De la Biología al Mito

H. Azurduy-Ferreira

microsatélites, DNAmt, o DNAn (nuclear), son factibles para ser aplicados a estudios
de organismos antiguos en un nivel individual, intrapoblacional o interpoblacional.
Muchos estudios sobre DNA fósil han sido realizados y con diferentes enfoques
al margen de los eminentemente evolutivos, ellos son: patológicos, arqueológicos,
genético poblacionales, conservacionistas, etc. Este enfoque no solo ha servido para
que se centre la atención en organismos de millones de años de antigüedad sino
también en especímenes que por ejemplo han permanecido guardados en MUSEOS DE
HISTORIA NATURAL por mas de 100 años y de los cuales no se poseían datos
genéticos. La labor de los MUSEOS en este sentido es muy importante, a fin de por
ejemplo de comparar datos sobre variabilidad genética entre poblaciones con mas de
una centuria de antigüedad y poblaciones actuales.
Pero volviendo a organismos mucho más antiguos, de los resultados obtenidos a
partir de trabajos realizados en DNA fósil, se ha llegado a la conclusión de que las
moléculas de DNA pueden persistir cientos, miles y aún millones de años en ciertos
especímenes extraordinariamente preservados.
Producto del desarrollo de la biología molecular, se ha logrado extraer y
secuenciar DNA proveniente de diferentes organismos cuya preservación es excelente,
por ejemplo, organismos que hayan sido enterrados rápidamente por ceniza volcánica,
organismos que hayan sido atrapados en resina vegetal (posteriormente transformada
en ámbar), organismos preservados en permafrost (subsuelo congelado), organismos
sumergidos en aguas bajas en oxígeno y organismos muertos en cuevas muy frías.
Condiciones que exponen al organismo a altas temperaturas y a humedad tienden a
desnaturalizar y destruir el DNA. En un laboratorio de Inglaterra se determinó que el
DNA expuestos a los elementos, se degradaría completamente en 10.000 años a
temperaturas moderadas.
El DNA más antiguo extraído, proviene de insectos atrapados en ámbar
(encontrados en el Líbano) y con una antigüedad de 120 millones de años (m.a.). Ha
sido extraído también, DNA fósil de Proplebeia dominicana (tipo de abeja de 45 m.a.),
Mammuthus primigenius (mamut de 50.000 años), Equus ferus (caballo euroasiático
de 42.000 años), Equus hemionus (asno asiático de 27.000 años), Nothrotherium
shastense (tipo de megaterio de 13.000 años), Bos primigenius (especie emparentada
con los actuales vacunos de 6.500 años), Homo sapiens (especímen de hace 4.500 años),
Aptornis otidiformis (tipo de ave de 3.000 años), Papio cynocephalus (primate africano
de 2.300 años).
La aplicación de una tecnología de esta naturaleza en el campo de la evolución
es muy amplia y, dependiendo del grado de preservación, muy valiosa (recordemos las
limitantes que significan para un paleobiólogo, el hecho de no poseer información de
esta naturaleza), la misma va desde la biogeografía histórica hasta la filogenética
pasando por la conservación de vida silvestre.

Los ¨quaggas¨
El gran misterio en relación a los quagga era si estos équidos , guardaban una mayor relación
con los caballos o con las cebras. A través de simple morfología no era fácil discriminar grados
de diferenciación, por lo que se recurrió a ut ilizar DNA antiguo de quagga y comparar su
secuencia con DNA proveniente de caballos (Equus caballus) y de diferentes especies de cebra.
El resultado demostró que los quaggas estaban más emparentados con las cebras que con los

90

De la Biología al Mito

H. Azurduy-Ferreira

caballos. Este caso fue uno de los primeros en los que se aplicó la tecnología del DNA fósil a la
resolución de un problema filogenético concreto.

La foto de este quagga (Equus quagga)
es una de las 5 que se conservan en el
mundo, la misma fue tomada en un
zoológico europeo.
Estos
équidos
vivieron en Sudáfrica y el último
individuo de la especie murió en 1883.
Restos
de
piel
muy
antigua
conservados en un museo, permitieron
obtener secuencias de DNA que
posibilitaron
dilucidar
una
gran
incógnita sobre su grado de parentesco
con los caballos y las cebras.

En el caso de Homo, en 1997 aparece un sorprendente trabajo de Krings y
colaboradores, en el que se logró extraer y estudiar la secuencia de mínimos restos de
DNA provenientes de osteocitos (células óseas que eventualmente pueden ser
encontradas en los intersticios del tejido esponjoso del hueso fósil) perteneciente a un
hombre de Neandertal. De hecho el material fue extraído de un húmero proveniente
del sitio original en el Valle de Neander (Alemania). El propósito de dicho trabajo era
dilucidar nuestro grado de parentesco que tenemos con los neadertales. El resultado:
los neandertales se encuentran fuera del rango de variación de Homo sapiens, por lo
que dicho resultado se vuelca en favor de la hipótesis de que los neandertales
representan una especie diferente de Homo. Más aún, encaja perfectamente en las
predicciones de las hipótesis del origen africano de nuestra especie, y de una historia
de expansión a partir de Africa a expensas de otros homínidos.

91

De la Biología al Mito

H. Azurduy-Ferreira

Principales impulsores del
Neodarwinismo. Arriba
(izq. a der.) R. Fisher, J. B.
S. Haldane y S. Right.
Centro (Izq.) E. Mayr y J.
Huxley. Abajo (Izq. a der.) L.
Stebbins, G. G. Simpson y T.
Dobzhansky. (De Futuyma,
1998)

92

tejiendo la vida .ACTO QUINTO Rutas y azar.

ya que en sus desplazamientos. lo perfecto e incoherente solo existe en nuestra mente y puede evidenciar simplemente nuestras limitaciones respecto a su entendimiento. etc. el clima. Meses después. 94 . Lo que parece imperfecto o aberrante en un lugar puede ser la mejor forma adaptativa en otro. Observar la manera efectiva en como se desenvuelve sobre vegetación flotante (tarope o repollitos de agua) me proporcionó muchas luces. 1. di con un ejemplar de gallareta (Jacana jacana). da la apariencia de que “caminara” sobre dicho elemento. la reproducción. Cuando hablamos de mecanismos de la evolución tratamos de englobar un conjunto de principios que son los que intervienen y actúan de diversa manera sobre el genotipo y fenotipo de las poblaciones biológicas. las enfermedades. pueden ser todos aquellos fenómenos o eventos naturales que regulan el crecimiento y dirección evolutiva de las poblaciones. Pero mi gran duda estuvo relacionada con la razón para tal desproporción ¿porqué la gallareta tenía dedos tan largos y que beneficios le podría significar una característica de tal naturaleza en su medio?. Selección Natural El Origen de las Especies se constituye en una gran argumentación de la idea darwiniana en relación a como los organismos se estructuran y adaptan para desenvolverse en su medio y condicionados por factores selectivos. Agentes selectivos pueden ser el alimento.De la Biología al Mito XIII H. Azurduy-Ferreira MECANISMOS La evolución llega a ser la ciencia en la que muchas de sus manifestaciones puede contradecir percepciones y conceptos que nos habíamos formado previamente. la predación. El caso de la ¨jacana¨ o ¨gallareta¨ En mis primeros días en el Museo y “curioseando” en las gavetas de colección de aves. esto según la manera de influencia de los mecanismos evolutivos. tuve la oportunidad de visitar “Lago Caimán” en el Parque Nacional Noel Kempff Mercado y donde me propuse dedicar algunos ratos a la observación de esta especie y tratar de r esponder el cuestionamiento planteado. A ello se suman su tamaño pequeño y peso muy ligero al punto de que ocasionalmente cuando se desplaza sobre hojas que no emergen considerablemente del agua. Por entonces solo sabía que dicha especie era acuática y que su actividad se circunscribía en gran medida a las orillas y en especial sobre vegetación flotante. Alguna vez escuché adjetivos como ¨evolución imperfecta¨ o ¨evolución incoherente¨. entonces el grado de estabilidad no fuera el mismo y sus desplazamientos serían muy torpes e ineficientes si consideramos que de ello depende el éxito para conseguir alimento. competencia por recursos. Si los dedos de Jacana jacana fueran muy cortos. en realidad era la primera vez que veía tan cerca algo así. me llamó mucho la atención la gran desproporción existente entre la longitud de sus dedos (tremendamente largos) y el cuerpo. se observaba que los dedos largos y muy delgados le posibilitan una gran estabilidad en e l movimiento producto del área que abarcan una vez que los mismos se desplegan y posan sobre las plántulas flotantes.

y de esta manera responder a las necesidades alimentarias propias de la especie. Una de las consecuencias de esta fuerza evolutiva es la adaptación. Si descartamos la mutación como factor causal de este rasgo morfológico en la gallareta. de los que se alimenta de pequeñas cantidades de sangre y con un efecto no traumático o mortal. no solo por sus movimientos. Observando la fotografía. Bajo este contexto existen tres aspectos importantes a considerar en la poblaciones cuando se habla de SN: adaptación. La razón de ambas características radica en sus hábitos. Azurduy-Ferreira En este caso y considerando que Jacana jacana no posee aptitud para el nado o carece de patas muy largas (como en las aves zancudas). recombinación de material hereditario o deriva genética al azar. notemos que en el individuo no se perciben alas y que posee patas con uñas muy desarrolladas. ya que se ha adaptado a una vi da parasitaria especializada en murciélagos . de tal manera que la disminución de uno de los factores incidirá en los otros dos. salvo por un detalle.De la Biología al Mito H. nos parece estar frente a una mosca que ya no necesita volar y que se vale de un organismos en el que no solo encuentra alimento sino también ¨transporte¨. es una fuerza que actúa eventualmente y bajo determinadas circunstancias en contra de aquellos fenotipos que no tienen un valor adaptativo. sobrevivencia y reproducción. sino por su capacidad de aprehensión (importante si nos imaginamos un murciélago volando y maniobrando en el aire). los ácaros poseen cuatro pares de patas y en este espécimen solo vemos tres (rasgo de un insecto no de un acaro o garrapata). es decir que por SN no se producen nuevos fenotipos (como es el caso de la mutación). Por lo tanto la SN se constituye en una fuerza que dirige el rumbo o dirección de los cambios que se producen debido a mutaciones. Uno de los casos de adaptación mas sorprendente que he podido observar son estas moscas ectoparásitas de Murciélagos. Es importante señalar que la SN no es una fuente de variación genética en si misma. así y por selección el rasgo se fue fijando progresivamente en la población dado el éxito ecológico que le significó a la especie en su proceso evolutivo. 95 . los mismos están íntimamente ligados y condicionados entre si. Así. cuya morfología nos recordaría por un momento a un ácaro. Esculcando en la piel de murciélagos recién capturados se puede ver cuan efectiva es su morfología para ¨vivir entre pelos¨. sino. era evidente que la “adquisición” de estructuras adaptativas de esta naturaleza le permitían acceder a lugares a los que de otro modo no lo podría hacer. es evidente que el desarrollo de tales estructuras en esta especie estuvo dirigida a un éxito alimentario de modo que la selección natural pudo haber actuado a favor de los individuos con dedos algo más largos.

Si en cambio de su reservorio sacan la o las respuestas adecuadas. lo que a su vez incidió en la caída de sus niveles demográficos. 1. Este tipo de SN generalmente ocurre en medios estables donde las condiciones tienden a reducir variación feno típica. Para graficar mejor la idea sobre Selección Natural. Poniéndolo en otros términos. entonces estamos hablando de una Selección Natural Estabilizante . Esta situación. estamos hablando de una Selección Natural Direccional. Azurduy-Ferreira El efecto mas inmediato de la SN está en la progenie y cómo esta se comporta ante una determinada presión selectiva hacia un determinado carácter. Si la SN favorece a ambas variantes de colores extremos (azul y verde claro) en desmedro evidente de las 96 . las iguanas marinas. si su reservorio o variabilidad disminuye. con el tiempo el alimento en tierra comenzó a ser escaso. En dicho lugar al margen de otros organismos existen iguanas. La difusión del carácter sustituto estará en función a la respuesta genética de la población y la dimensión del reservorio genético disponible para dicha respuesta. 3. 2. en este aspecto y para entender las variantes de este mecanismo podemos imaginar una población de serpientes (de la misma especie) que exhibe n una variedad de colores que van desde el azul intenso pasando por el verde oscuro hasta individuos que exhiben el verde claro. Consideremos que hipotéticamente las poblaciones ancestrales (que habitaban una de las islas pequeñas) se componían aproximadamente en un 50% de iguanas terrestres y un 50% de iguanas marinas. Influencias de la Selección natural La SN tiene diferentes formas de incidir sobre las poblaciones naturales. La selección direccional es más común durante períodos de cambio ambiental o cuando miembros de una especie a un nuevo hábitat con condiciones ambientales diferentes. están aquellas cuya actividad es terrestre y las que son acuáticas. toda población posee en su reservorio genético un conjunto de respuestas guardadas en caso de emergencia. y sufrirán un aplazo que es sinónimo de extinción. mientras que en el medio acuático se mantuvo estable. las que según el tipo. Si llegado el momento sus respuestas son demasiado limitadas o nulas la SN no los aprobará. mientras que las marinas poseen membranas interdigitales y una cola aplanada (ambas características les permite un desplazamiento efectivo en el medio acuático). resulte no adaptativo. Esta situación no solo las mantuvo estables demográficamente sino que además les permitió comenzar a ocupar espacios cedidos por iguanas terrestres y a las que anteriormente no se podía acceder producto de una intensa territorialidad por parte de las iguanas terrestres. Por su lado. Este factor selectivo (alimento) incidió negativamente sobre las poblaciones de iguanas terrestres las mismas que se comenzaron a ver limitadas en sus recursos. Si la SN favorece a una de las variantes de colores extremos (azul o verde claro). que dado un cambio ambiental. gracias a sus atributos evolutivos pudieron hacer uso del alimento disponible en el mar. Las iguanas terrestres se caracterizan por no poseer membranas interdigitales en las patas y una cola redondeada. con ella se reducen el número de respuestas al examen que eventualmente tienen que rendir a la SN.De la Biología al Mito H. Si la SN actúa con mayor intensidad contra los especímenes que exhiben los colores extremos (azul y verde claro) permitiendo que las formas intermedias (verde oscuro) se proliferen con notoria intensidad. visitemos por un momento las Islas Galápagos. permitió que los fenotipos acuáticos prosperen y se difundan considerablemente a diferencia de los fenotipos terrestres que comenzaron a desaparecer y a hacerse cada vez más raros. entonces continuarán con su recorrido evolutivo.

¿porqué unas aves han desarrollado picos muy largos y finos. Puede ser un milimétrico crustáceo u una orca marina. ¿porqué algunos felinos como los dientes de sable desarrollaron en el pasado colmillos tan largos?. direccionando los fenotipos en sentidos diferentes. ¿Qué hace que un insecto desarrolle tal modificación alar como para ser confundido con una espina?. Esta variante de SN típicamente ocurre cuando las condiciones ambientales son variadas y las mismas benefician considerablemente a las formas. AL COMENZAR LA SELECCION SELEC. Pero que pasa si al azar hacemos un acercamiento a nivel microscópico en la porción distal de la pata de un crustáceo y de ahí comenzamos un ¨paseo¨ por todo el cuerpo del mismo.De la Biología al Mito H. estaríamos haciendo referencia a un caso de Selección Natural Disruptiva. Esa sola perspectiva nos brinda tal diversidad de formas que el solo pensar en registrarlas nos llevaría a la conclusión de que necesitaríamos más de una vida. como si fueran de especies diferentes (especie polimórfa). ¿a que se debe que existan roedores con cola mientras que otros prescindan de ella?. DISRUPTIVA De la forma y sus atributos La forma es un tema fascinante en biología y ha sido uno de los tópicos fundamentales en la historia natural. como en el Océano Pacífico. haciendo parecer a indivíduos de la misma especie. ESTABILIZANTE SELEC. ¿porqué ciertos roedores llegaron a desarrollar envergaduras similares a la de un rinoceronte actual? La naturaleza está plagada de un sinnúmero de formas que pueden estar albergadas tanto en una gota de agua de estanque. ese nivel de observación nos mostrará tal diversidad y complejidad de estructuras que el panorama 97 . DIRECCIONAL SELEC. esa perspectiva nos muestra organismos que se desplazan de un lado a otro en un medio acuático. Azurduy-Ferreira N° de Individuos I formas intermedias (verde oscuro). mientras que otros poseen picos cortos y robustos?.

son rastros históricos que la evolución ha dejado y a partir de los cuales podemos tratar de entender algo de la historia biológica. con la sola contemplación las palabras fluían espontáneamente. El Aye-Aye es uno de los innumerables ejemplos relacionados con estructuras y formas sorprendentes. no encontré una mejor estrategia que la de imaginarme caminando sobre la topografía corporal de los mismos y así. cuya longitud y estrechez (flecha) le permite colectar larvas que constituyen una parte importante de su dieta. de modo que muchas estructuras y formas pueden ser simples resabios o atavismos de fases evolutivas previas. El Aye-Aye (Daubentonia madagascarensis) . ¿Puede un gibón o un lémur.De la Biología al Mito H. Aquí es necesario recordar el caso de órganos vestigiales. Ante ellas veo estructuras ¨fósiles vivas¨ o recuerdos valiosos que con todos las complicaciones que nos puedan causar. Si detecta algo. Así. De hábitos nocturnos. los que llegan a un determinado nivel de desarrollo pero que no cumplen función alguna. ¿qué impresión nos causaría? Haciendo una pequeña prueba en mi casa sobre esta pregunta. Un Aye-Aye con sus dedos medios mutilados estará en desventaja y no podrá colectar larvas aunque los haya detectado. Las formas pueden cumplir una determinada función o no. Aunque Lo cierto es que las atribuciones que le podemos asignar por su aspecto. una oda a la forma Este prosimio que habita en Madagascar. la respuesta predominante fue: miedo. vemos en él un organismo cuyo efectivo sistema de detección y extracción de larvas es el resultado del uso combinado de estructuras especializadas y de cuya efectividad individual dependerá el éxito de la acción. Recuerdo que cuando me vi ante la tarea de describir trilobites durante la realización de mi tesis. Si en una noche de caminata y en media selva nos encontramos frente a frente con un Aye-Aye. hacer lo que un Aye-Aye? Aparentemente no. se desplaza sobre árboles en los que apoya sus grandes y sensibles orejas tratando de detectar sonidos de larvas de insectos que pueden estar en alguna oquedad. no condicen con su historia natural la que 98 . Azurduy-Ferreira organísmico que teníamos del mismo cambie producto de haber tenido un nivel de aproximación de mucho mayor detalle. literalmente roe la corteza con sus incisivos muy especializados hasta que loqre un orificio por donde introducir su dedo medio. La estructura de su mano es única entre los primates por poseer 4 garras y una sola uña en el pulgar. fue identificado inicialmente como roedor por la forma de sus incisivos . resultado de un proceso natural de adaptación hacia una determinada forma de vida.

han llevado a esta especie al borde de la extinción. un tiempo en el que la Selección Natural elige y selecciona. sigue teniendo estructuras anatómicas propias de un carnívoro y que llegado el momento las puede usar (dientes caninos. puede mantener latente muchas conductas propias de un lobo.). sacamos a pasear o aseamos los fines de semana. Los nativos Malagasy de Madagascar ven en el Aye-Aye al ¨ser portentoso que puede matar con la mirada¨ esta superstición que nace de su expresiva y envolvente mirada entre otros factores. no es un perro sino un lobo modificado. A partir de tales circunstancias. etc. Azurduy-Ferreira nos indica que este primate es basicamente frugívoro e insectívoro de modo que simplemente se dedica a desarrollar sus hábitos naturales que le permitan subsistir. que nos sería difícil concebir que un Chihuahua no es más que un lobo modificado. los datos genéticos nos indican que el ¨perro¨ no ha dejado de ser Canis lupus de modo que si haríamos una equivalencia entre nombre común y nombre científico.De la Biología al Mito H. Nuestros perros con los que jugamos. de modo que los criterios de selección en esta circunstancia puede ser: expresión de colores corporales melánicos (negros). desarrollo de estructuras que eviten la pérdida de calor excesiva. su morfología fue progresivamente dirigida hacia fines tan diversos. Pero ¿Qué sucede cuando la forma es direccionada por un factor extranatural? Simplemente se convierte en selección artificial. sistema auditivo. el caso del perro que no dejó de ser lobo Todos los organismos que vemos hoy son la expresión de la forma y función en el tiempo. como es denominada por los etólogos). Para graficar mejor la idea: Un abrupto cambio climático de índole glacial plantea diferentes problemas que tendrán que ser resueltos por los organismos afectados. Estos. ¿Qué pensamos cuando un perro ataca o mata? Este tipo de circunstancias debemos entenderlas como momentos en los que por estímulos determinados se desencadena una acción arquetípica o ancestral (Mecanismo Desencadenante Innato. De este modo podemos ver que la adaptación y las formas producto de un proceso de selección natural. 99 . pueden resolver muchos problemas y disyuntivas naturales en un grupo biológico. el pequeño y juguetón caniche que sale a recibirnos meneando alegremente la cola. contrastan con criterios como una mayor producción de leche para cubrir mejor las demandas o lograr un mejor panorama económico. y es que el ¨perro¨ pese a haber sido sometido a un proceso en el que se han reprimido muchas de sus acciones naturales de su pasado silvestre. Además. es decir una especie diferente a Canis lupus (nombre científico del lobo). Selección Artificial. El perro puede ser un ejemplo al que podemos acudir. siendo sus criterios fijados por la mente humana. Los perros por mucho tiempo fueron considerados como Canis familiaris. capacidad olfativa. por lo familiares que nos resultan. etc. son el resultado de la domesticación de los lobos. aunque es necesario también entender que el mito y la superstición son aspectos no previstos por la evolución. Hoy.

Anomalías como ésta son comunes y producto de cambios drásticos. a c d 1890 b 1935 Los ¨perros¨ poseen aún estructuras (a) para desplegar comportamientos agresivos típicos de un lobo. e xisten razas como Bulldog que se pasan su vida con dificultades respiratorias. un chino y un somalí no son de especies diferentes pese a mostrar diferencias considerables en color. muchas razas de perros tienen de por sí. etc. Todas las fotos (a. su ataque por lo tanto puede ser tan letal como la forma ancestral.De la Biología al Mito H. es excesivamente grande o el caso del perro Doberman cuya masa cefálica puede llegar a ser mayor a su capacidad craneana. y en segundo lugar . pensemos por un momento qué sucedería si reducimos drásticamente y por selección artificial el largo del pico de una garza o la trompa de un elefante. Entre c y d nótese la progresiva retracción de los huesos nasales y la mandíbula superior. las razas de lobo desarrolladas por el hombre. Así. es decir. el lobo (c). varios problemas para sobrevivir. De la forma ancestral. de modo que manifestará trastornos conductuales que lo llevarán a estadios de ¨locura¨ o agresividad indiscriminada (de ahí el mito que hemos creado para esta raza). Es más. Muchas razas requieren de cesárea forzosa debido a que la cabeza del feto por nacer. ya que el nivel de reducción de los huesos nasales ha sido tan drástico que los reportes veterinarios indican altos niveles de intervención para este problema en dicha raza. b. Lo más probable es que la garza pierda su efectividad en la pesca y el elefante se vean en grandes dificultades para obtener su alimento. generalmente no son aptas para desenvolverse en un medio silvestre (¿qué tiempo sobrevivía un perro pequinés liberado a su suerte en medio de un bosque amazónico?). hasta una forma en la que la mandíbula inferior se extiende considerablemente mas adelante que la superior. sino mas bien estéticas. no se ha presentado un factor selectivo de tal magnitud como para estimular una respuesta evolutiva que condicione cambios morfológicos considerables. rápidos y sin valor adaptativo en estas formas biológicas casi artificiales forzadas a desarrollar estructuras que generalmente no responden a principìos funcionales. Lo mismo sucede con las formas derivadas del lobo. c y d) pertenecen a una sola especie: Canis lupus. conformación facial. hacia formas de nariz achatada han dado lugar a la obtención de razas como el Bulldog (d) cuyo aspecto en 1890 difería del típico que conocemos hoy. culturales o de otra índole. potencialmente toda especie tiene aspectos y formas ¨guardadas en caso de emergencia¨. Es como en Homo sapiens. 100 . Una pregunta que alguna vez me hicieron es: ¿Porqué los lobos en la naturaleza no han desarrollado otras formas ya que tienen tanta potencialidad genética? El caso es que por un lado. la progresiva selección. Azurduy-Ferreira El lobo es uno de los grandes ejemplos sobre la diversidad de formas que pueden estar escondidas o latentes en la carga genética de una especie. Medidas represivas ante tal circunstancia han sido desarrolladas (b).

La selección natural lleva también a la divergencia de caracteres. En esencia De Vries no se equivocó y el concepto terminó siendo 101 . y los organismos que exhibían los mismos vinieron a conocerce como mutantes. de la misma manera que cualquier otro carácter hereditario. pero eventualmente aparecía un carácter que no existía en ninguno de los progenitores y ni siquiera en el linaje de esa planta en particular. la posibilidad de que otro organismo biológicos desarrolle formas muy diferentes por selección natural en un periodo de tiempo determinado. Azurduy-Ferreira Una de las grandes lecciones que podemos sacar de un hecho de esta naturaleza es que si los lobos han mostrado tal plasticidad morfológica y variabilidad genética como para expresar formas tan diferentes. Finalmente. resume una de las facetas fundamentales en la historia de la vida. 2. un orangután y un hombre. tanto mayor es el número que puede sustentar un territorio… Por lo tanto. quien en su libro y más específicamente en el capítulo referido a Selección Natural. tanto más aumentarán sus probabilidades de triunfo en la lucha por la vida. cuanto más diversos lleguen a ser los descendientes. se hayan desarrollado en unos cuantos millones de años formas diferentes como un Aye. como un pequinés y un San Bernardo. En dicho trabajo se dio cuenta que en la planta mencionada. De Vries supuso que estos caracteres obedecían a cambios abruptos en los genes o que el carácter producido por el gen cambiado se transmitía después. creo que no podemos dejar de considerar lo que en algún momento pensó Darwin.De la Biología al Mito H. “Si la selección natural ha obrado realmente de este modo. y la geología manifiesta claramente el importante papel que ha desempeñado la extinción en la historia del mundo. Así. Pero ya hemos visto que la selección natural ocasiona extinción. o la supervivencia de los más aptos. pues cuanto más difieren los seres orgánicos en estructura. adaptando las diferentes formas orgánicas a las diversas condiciones y estaciones. un mono araña. los patrones de herencia eran generalmente ordenados y previsibles. Mutación En 1902 el botánico holandés Hugo de Vries (uno de los redescubridores de la obra mendeliana en 1900) publica los resultados de un trabajo realizado en una hierba llamada Oenothera lamarckiana (hierba del asno) y que a la postre se constituiría en el fundamento para la definición y conocimiento de los eventos que hoy conocemos con el nombre de mutación. no nos debe extrañar el hecho de que de una forma ancestral. De este modo las pequeñas diferencias que distinguen las variedades de una misma especie tiende constantemente a aumentar hasta que igualan a las diferencias mayores que existen entre las especies de un mismo género o aun de géneros distintos”. es una alternativa de la que pueden hacer ¨uso¨ en momentos determinados de su historia evolutiva. De Vries denominó estos cambios mutaciones.-Aye. es cosa que tiene que juzgarse por el contenido general de los capítulos siguientes y por la comparación de las pruebas que en ellos se dan. durante la modificación de los descendientes de una especie y durante la incesante lucha de todas las especies por aumentar el número de individuos. costumbres y constitución.

los segundos son provocados por elementos radiactivos naturales como los rayos ultravioleta (UV). b). Se considera mutación. salvo que de los 2.). dichos cambios pueden ser inducidos o espontáneos. los primeros como su nombre lo indica. las deleciones posibilitan la pérdida de un segmento cromosómico y las duplicaciones permiten la adición de un segmento proveniente de un cromosoma homólogo. en los mismos. no cumplirá con las funciones para las que fue sintetizada. Bajo estas condiciones la misma. Azurduy-Ferreira aceptado por convención. entre los que figuraba Homo con un número diploide de 46. síndrome de Klinefelter. 102 . este cambio a su vez ocasiona la codificación de un aminoácido diferente y por lo tanto la traducción del mensaje genético dará como resultado una proteína diferente (mutante ). estas pueden ser categorizadas de transiciones en el caso de que A mute a G o viceversa (A<->G) y C a T o viceversa (C<->T).Mutaciones cromosómicas (alteraciones a nivel del cariotipo) Las alteraciones en el cariotipo pueden ser agrupadas en dos grandes grupos: (1) Poliploidias y (2) Rearreglos en uno o más cromosomas. En el caso de la anemia falciforme basta la alteración de un aminoácido p ara que dicha anomalía se manifieste. segmentos de cromosomas pueden sufrir ruptura y una posterior acomodación. etc. esas cantidades mencionadas son números diploides para cada una de esas especies. todo cambio súbito en la estructura del material genético o hereditario (genes en sí o cromosomas). que pueden actuar como agentes mutágenos (que inducen mutaciones). mientras que en las transversiones A o G muta hacia C o T o viceversa (A o G<->C o T). En páginas anteriores mencionábamos números cromosómicos para diferentes organismos. Hablamos de inversiones cuando el segmento luego de separarse sufre un giro de 180° y se reacomoda (en el mismos cromosoma) en sentido inverso. dos cromosomas intercambian segmentos luego de sufrir la ruptura de los mismos. situación que influye en rasgos psíquicos y físicos característicos (síndrome de Down –trisomía 21-..Mutaciones puntuales Que son a nivel molecular y que básicamente implican substituciones azarosas restringida generalmente a una sola base nitrogenada. que los organismos que sufren dicha anomalía son susceptibles de sufrir una o una serie de defectos patológicos. En Homo se dan casos en los que se producen individuos con un cromosoma adicional al número diploide. en las translocaciones.000 cambios en Oenothera lamarckiana que los tomó como mutaciones. Pero en ambos casos (inducidos o espontáneos) ocasionan un desorden molecular en los nucleótidos. En las plantas el duplicar el juego completo de cromosomas es muy común mientras que en los animales es algo muy raro y mortal. La mutación actúa en diferentes niveles. - - Poliploidia Cada organismo posee un juego característico de cromosomas. como el cáncer o la anemia falciforme por ejemplo. Es así.. Cuando un organismo aparece súbitamente con un número mayor al diploide entonces estamos frente a un caso de poliploidia. son provocados por el hombre a través de materiales radiactivos como por ejemplo el plutonio o los rayos X.De la Biología al Mito H. solamente dos resultaron ser mutaciones verdaderas. Rearreglos cromosómicos Son cambios estructurales que se producen en los cromosomas. a saber: a).

A-J para CN-1. La forma mutante llegó a estado adulto y no tuvo problemas para desarrollar sus actividades.De la Biología al Mito H. y una menor fracción de ellas son favorables. K para CN-9 y L para CN-16). Stebbins (recordemos. uno de los impulsores del Neodarwinismo) sostiene que la proporción de mutaciones favorables puestas en una relación de una por cada mil. Cálculos estimados. C. Es de este modo que los organismos. Mutación inducida en una especie de peces (Fam. eventualmente pueden tomar ventaja de determinadas características producidas por mutación y “usarlas” en procesos adaptativos. 103 . y aunque solo una ínfima cantidad fueran ventajosas. mosca tetráptera (Drosophila melanogaster). Characidae). c a CN-1 CN-9 CN-16 Forma normal a Forma mutante b d Ejemplos de mutación. Azurduy-Ferreira Como podrán suponer la gran mayoría de las mutaciones son perjudiciales. Por su lado L. B. Considerando los resultados de varios estudios experimentales se ha determinado que la tasa promedio de mutación está en el orden de un alelo mutado en 100.000 individuos. aseveran que en una población de 500. d. a. cerca de un millón de nuevas mutaciones se producen en cada generación. En cromosomas humanos (CN=Cromosomas normales y sus variantes mutantes. es una estimación prudente.000 gametos. las mismas se tornan muy importantes si consideramos miles de generaciones y dimensiones temporales que abarcan miles o millones de años. Sindactilia en humanos.

aunque anteriormente vimos el caso de las moscas parásitas de Murciélagos que ¨han prescindido¨ de ellas. Como resultado. Alguna vez uno de los chicos del museo me preg untó si las lianas o bejucos eran una forma vegetal anormal y mi respuesta fue. De este modo el ¨sentido erótico¨ ha tenido un tránsito fluctuante en la evolución humana. esto. ¿Qué pensaríamos al ver una mosca sin alas? Respuestas como aberrante pueden ser comunes. 104 . La voluptuosidad era para el hombre primitivo un símbolo de erotismo. y a la promesa que eventualmente puede significar un determinado tipo de mutación para la evolución. de tal manera que la evolución es una competencia de formas y estructuras. aunque a la luz de lo que vemos hoy nos podemos dar cuenta que es un sentido muy variable y que puede depender de varios factores de índole cultural con una ¨pizca¨ de genética. El fenómeno de la mutación es sinónimo de una posibilidad latente. Tan solo por un momento invirtamos la situación e imaginemos ¨bosques¨ domina dos casi exclusivamente por lianas que se arrastran. lo bonito y lo feo pueden ser considerados un invento nuestro. haciendo referencia a las impresiones humanas de lo diferente. sino lo efectivo o inefectivo. no siempre es efectivo y los ¨mostruos¨ que emergen súbitamente y por azar. pero que en términos de un desenvolvimiento natural pueden ser sorprendente y fascinantemente exitosos. Existen además. de modo que en medios de esa naturaleza el poseer alas significa una desventaja o defecto. pueden surgir eventualmente formas biológicas exitosas para determinados medios y bajo ciertas condiciones. Azurduy-Ferreira Lo ¨anormal¨ y lo ¨feo¨ ante lo efectivo y adaptativo Si hay algo que aprendí de la Biología es que en la naturaleza no existe lo bonito ni lo feo.De la Biología al Mito H. Las lianas son de esas formas de vida que han demostrado una gran plasticidad evolutiva y que simplemente son el resultado de un proceso adaptativo hacia hábitos distintos a la forma típica de árbol. logrando así. de modo tal que en un contexto biológico. En ese tipo de paisaje imaginario emergen muy de vez en cuando formas arb óreas que por el hecho de ser diferentes y menos evidentes no significa que sean formas de vida anómala. En este juego de la efectividad pueden surgir organismos cuyo aspecto no concuerde precisamente con nuestra visión estética. De este modo. un mejor desenvolvimiento en sus hábitos como ectoparásito. debido a que la selección natural elimina paulatinamente a individuos con alas ya que los mismos son presa fácil de los fuertes vientos que hacen que se estrellen y perezcan. De esta forma de ver las cosas nace el concepto no coloquial de ¨monstruos prometedores¨. ya que de la gran cantidad de formas no adaptativas y que la selección natural absorbe o desecha. nuestro concepto de lo perfecto o normal puede verse afectado en casos en los que una mutación determine una forma de vida con rasgos grotescos o exóticos muy diferentes a lo que entendemos como ¨normal¨ o ¨bonito¨ pero cuya capacidad para desenvolverse en otro tipo de medios signific ará ciertamente su éxito. pueden ser actores nuevos y muy exitosos en el teatro de la vida. Una de las cosas que aún no sé. tenemos a formas vegetales serpentoides que trepan sobre árboles para llegar a exponerse a la luz solar con la finalidad de lograr el proceso de fotosíntesis. casos en los que moscas mutantes ápteras (sin alas) prosperan a grandes alturas (montañas). es . crecen y se extienden sobre el suelo. no. En la naturaleza. lo que definimos como bonito. y que quedaron testimoniados en hermosas estatuillas que expresan mujeres de dimensiones considerablemente voluptuosas. en qué momento el hombre incorpor ó en su imaginario cultural sus símbolos estéticos.

Asumamos que tres poseen el genotipo TT (sin membranas en las patas). la modalidad de sus manifestaciones 105 . lugar en el que los cazadores redujeron la población a 20 individuos.Deriva genética al azar La deriva genética es el cambio que se produce en el pool génico (poza génica) de una población pequeña como producto del azar. Hasta esta parte del argumento podemos ver que en la evolución juega también al azar.000 individuos. Azurduy-Ferreira 3. por lo tanto la muerte de los individuos fue producto deL azar. de modo que si bien existen mecanismos conocidos. en cambio en una población pequeña tendrá un efecto desproporcionadamente grande de una generación a otra.De la Biología al Mito H. entonces la frecuencia del alelo t sufrirá una drástica disminución. Desde entonces (recién entonces) este mamífero fue protegido. no se encontró variación producto del cuello de botella al que la población fue sometida como consecuencia de un severo proceso de cacería. por lo tanto es de suponer que la poza génica de las iguanas marinas se debió haber derivado de esos pocos individuos provenientes de áreas continentales. si por azar los tres individuos muertos eran tt. ya que la SN en este caso no está implicada. los mismos producen pequeñas poblaciones sobrevivientes que tienen que “rehacer” la población original. Otra situación que puede producir pequeñas poblaciones suficientes para DGA es la colonización de un nuevo lugar por un número pequeño de individuos. Si consideremos una población de solamente 10 iguanas marinas. La situación de una población suficientemente pequeña como para produc ir Deriva Genética al Azar (DGA. Al respecto hay que considerar que en poblaciones inmensamente grandes los cambios que se produzcan no afectarán considerablemente las frecuencias genéticas de la misma. producto de lo cual la población se recuperó a mas de 30. Eventos como terremotos. Un ejemplo dramático es el que se produjo en 1890 en los elefantes marinos de California. obviamente que las frecuencias génicas producto de la DGA no llegarán a ser las mismas aunque demográficamente la población se recupere. Los cuellos de botella en las poblaciones son producto de desastres que drásticamente reducen el tamaño poblacional. debido a que asumimos que todos los individuos tienen las mismas condiciones. sin embargo luego de la examinación de 24 loci (plural de locus) de genes provenientes de elefantes marinos. dos son Tt (también sin membranas) y cinco son tt (con membranas). El efecto fundador fue importante en la evolución de muchas especies en las Islas Galápagos. de aquí en adelante) es conocida como cuello de botella. Es el caso de las iguanas marinas las mismas que son el resultado de la evolución de unas pocas iguanas terrestres provenientes de la zona continental de América del Sur. Este tipo de cambios relativos en la frecuencia de un alelo sería un caso de microevolución causada por el azar. inundaciones o fuegos pueden matar gran cantidad de individuos sin que intermedie selección alguna. Por ello la recuperación demográfica no es suficiente y puede ser engañosa en el tiempo si se piensa en conservación desde una perspectiva evolutiva (ver el Acto 10). En casos muy extremos una hembra preñada o una simple semilla podría fundar una nueva población. En este caso los cambios al azar en la poza génica es llamado efecto fundador. en la gran ruleta que puede significar el desarrollo de la vida. ahora supongamos que tres de ellas sucumben ante un terremoto.

habrá la posibilidad de reproducirse y por ende incorporar a la población genes nuevos y que eventualmente pueden cambiar las frecuencias génicas de un determinado rasgo. 1998). Variación geográfica en la serpiente Elaphe obsoleta de Norteamérica. 4. si un evolucionista establece que entre dos poblaciones de arañas muy parecidas y separadas por un río. el aislamiento de dos poblaciones pueden determinar el inicio de procesos de diferenciación entre sí y que eventualmente pueden determinar en el tiempo la obtención de dos especies. Uno de esos niveles es el genético y por medio del cual las poblaciones pueden “recibir” o “dar” genes. En evolución.De la Biología al Mito H. a diferentes niveles. le pueden sugerir que algo está aconteciendo en términos evolutivos. estableciendo así un flujo genético entre individuos o poblaciones. las diferencias morfológicas entre ambas poblaciones. Su periplo iniciado hace millones ha sido posible gracias a las diferentes maneras de reproducción de sus circunstanciales portadores. no existe flujo génico. no logren especiarse Como hemos visto. Estos los han llevado y los llevan de un lugar a otro y toda vez que pueden los diseminan. De este modo. si son aceptados. aunque leves. el concepto de flujo génico es importante dado el hecho de que su efecto tiende a reducir diferencias genéticas entre las poblaciones de modo tal que un eventual proceso de aislamiento se trunque y así. 106 . Así. el flujo génico ocurre cuando individuos fértiles transfieren genes de una población a otra. Nótese que no son especies diferentes sino subespecies cuyas diferencias de alguna manera se han logrado por una paulatina reducción del flujo génico entre las mismas (de Futuyma. Pensemos en individuos de una población de pécaris que se encuentran con un grupo mas grande. Flujo génico Los genes no solo son viajeros en el tiempo sino también en el espacio. Las poblaciones son entidades muy dinámicas que interactúan entre sí. Azurduy-Ferreira puede eventualmente ir incluso en contra de ciertas lógicas y tradiciones intelectuales.

ACTO SEXTO Argumentos para un guión .

proponen el Equilibrio puntuado como modelo alternativo al conocido anteriormente.De la Biología al Mito XIV H. TIEMPO Especiación (Millones de años) Cambios graduales en la morfología MORFOLOGIA Representación del Gradualismo Filético de Darwin. mientras que la genética molecular descubrió otra cara en la que el azar es un factor que interviene considerablemente. Los modelos son útiles en tanto y en cuanto se haya hecho una lectura e interpretación adecuada del fenómeno. Los modelos son instrumento estadístico que en teoría y a partir de la interpretación de un fenómeno. los modelos pueden ser algo más complejos y grises. para Darwin los cambios evolutivos en las especies se dieron de forma gradual es decir en base a transformaciones paulatinas y progresivas. G. la evolución nos puede poner en situaciones contradictorias y no consistentes con un determinado modelo preestablecido. Darwin y sus contemporáneos interpretaron la faceta lógica de la evolución. modelo. J. así. no es así. históricamente el Gradualismo filético de Darwin permaneció como modelo evolutivo hasta que E. Gould y N. modelo según el cual los cambios en los procesos evolutivos fueron graduales. Simpson y postulados teóricos de E. pueden adquirir un valor predictivo. basados en anteriores observaciones de G. Como hemos indicado. Si alguien piensa que Darwin desenmarañó todos los aspectos de la evolución como fenómeno. Azurduy-Ferreira PARADIGMAS Una de las palabras que en biología me causa cierto ¨escozor mental ¨ es. Eldredge en 1972. 108 . Mayr. Situaciones ideales para los que elaboran modelos pueden ser la ciclicidad o cierta constancia en la manifestación de sus variables . Dadas las características estocásticas en ciertas facetas del fenómeno Evolución.

Patrones que reflejan equilibrio puntuado en el registro fósil. Un ejemplo es el trabajo desarrollado por Seeley (1986) quien reporta transiciones morfológicas rápidas ocurridas en Littorina obtusata (especie de caracol marino) entre 1871 y 1984 en Nueva Inglaterra en respuesta a una intensa SN provocada por Carcinus maenas (cangrejo. llegando a migrar y distribuirse ampliamente en dicho lugar. quedando de esta manera el equilibrio puntuado explicado por principios biológicos neodarwinistas. pero hay una gran discusión y desacuerdo entre los biólogos evolucionistas en relación a los mecanismos que producen este patrón. Observando conchas de museo pertenecientes a L. predador de L. briozoos. esto. TIEMPO (Millones de años) Estasis (fase estacionaria) Cambios rápidos en la morfología MORFOLOGIA Representación del Equilibrio Puntuado de Gould y Eldredge. El debate principal en este sentido. obtusata. Al respecto. posterior a ese año. mientras que aquellas coleccionadas recientemente no lo eran tanto aunque de paredes gruesas. etc. el registro fósil describe muchas veces cambios súbitos en los organismos fósiles de un estrato sedimentario a otro.De la Biología al Mito H. los llevó a pensar que los cambios en realidad no son graduales sino abruptos y seguidos por largos periodos en los que no se produce cambio alguno (estasis o equilibrio). Seeley se dio cuenta que aquellas coleccionadas en las costas de Nueva Inglaterra antes de 1900 eran altamente espiraladas y de paredes muy delgadas. para Gould y Eldredge. pueden ser ampliamente documentados. modelo según el cual los cambios en los procesos evolutivos rápidos y seguidos por una fase de estasis. algunos biólogos evolucionistas concluyen que diferencias morfológicas en el registro fósil representan eventos de especiación en los que la SN no influiría en gran medida. Azurduy-Ferreira En contraste. obtusatta). Pruebas de esta última aseveración han sido presentadas a partir del estudio de organismos actuales. radica en que si el equilibrio puntuado puede ser explicado por mecanismos neodarwinianos. mientras que otros afirman que la SN puede causar transiciones rápidas pero al mismo tiempo graduales. quienes observaron dicho patrón en linajes fósiles de invertebrados marinos (trilobites.). Esta especie de cangrejo antes de 1900 no se distribuía en las costas de Nueva Inglaterra. Dichos cambios abruptos serían sinónimos de especiación para los autores de este modelo. Hoy en día y por 109 .

. el trabajo de Seeley en organismos actuales. estructura de la población. en su trabajo Seeley señala las siguientes conclusiones: . mostrarían una aparente discontinuidad en el registro fósil debido al breve periodo de tiempo transicional (si tomamos en cuenta el tiempo geológico). pueden ser periodos transicionales y de cambios graduales rápidos dirigidos por presiones selectivas (disruptivas o no) muy intensas sobre determinadas poblaciones de las que hay que considerar que poseen cualidades ecológicas. obtusatta no están aisladas reproductivamente. son poco frecuentes y un tanto raras de encontrar. es decir que se pueden reproducir entre si. Moraleja paleontológica: En el caso de darse especiación alopátrica en el registro fósil. condición ecológica y grado al que cambios en un carácter son constreñidos en su desarrollo. se inclinan fuertemente en favor de la hipótesis de que la rápida transición morfológica (100 años) en L.Las formas altamente espiraladas y de paredes delgadas son mucho más vulnerables al ataque de C. Finalmente. nos puede sugerir que lo que Gould y Eldredge suponen como cambios abruptos seguidos por un prolongado periodo de estasis (sin modificación). obtusata altamente espiraladas y de paredes delgadas mientras que la predominancia de poblaciones de L. . .Principios darwinianos clásicos no deberían ser desestimados a la hora de explicar discontinuidades en los linajes fósiles. propias. obtusata. obtusata son más vulnerables al ataque de Carcinus maenas que conchas poco espiraladas y de paredes gruesas.Modelos teóricos predictivos muestran que transiciones rápidas conducidas por SN. Estas diferencias intraespecíficas llevó incluso a algunos sistemáticos a clasificar equivocadamente a algunos especímenes coleccionados antes de 1900 como una especie diferente (Littorina palliata).Los estudios acerca de predación de C. De alguna manera. obtusata poco espiraladas y de paredes gruesas son claramente predominantes.La variación intraespecífica en L. De este modo el entendimiento de los procesos actuales puede ayudarnos a entender procesos biológicos del pasado. estas formas intermedias. . maenas sobre L. maenas que las formas poco espiraladas y de paredes gruesas. mientras que estudios genéticos demuestran que ambas formas de L. 110 . Otro aspecto muy interesante reportado por Seeley es el hallazgo de formas que pueden ser catalogadas como intermedias entre altamente espiraladas de paredes delgadas y poco espiraladas de paredes gruesas.De la Biología al Mito H. no tendríamos que esperar encontrar formas derivadas en una columna geológica ya que las mismas se encuentran en un área diferente producto de eventos migratorios que han hecho que la población se fragmente o separe provocando una divergencia geográfica en su distribución. maenas. reproductivas y de dispersión. obtusata es producto de la predación de Carcinus maenas. obtusata fue en respuesta a una intensa Selección direccional provocada por C. Azurduy-Ferreira observación in situ es posible encontrar solo algunas poblaciones de L. El periodo y grado de respuesta a la Selección diferirá de acuerdo al tipo de organismo. Estudios de campo y laboratorio demostraron que conchas altamente espiraladas y muy delgadas de L.

111 . pueden ser simplemente producto de las limitaciones propias del modelo aplicado . La eventual inconsistencia de ciertos modelos con determinad as evidencias de aparente incongruencia. el área gris de lo inentendido y al que . en mi teoría sobre el gradualismo filético. denominamos ¨lo ilógico¨. Azurduy-Ferreira Angeles fósiles Peces Trilobite Esto es algo que realmente no me ayuda para nada. siendo la diferencia. ante un probable mecanismo evolutivo desconocido y cuya manifestación fenomenológica obviamente diferirá de las hasta ese momento entendidas. como el astrónomo Kepler aseveró. No olvidemos que los modelos funcionan con variables verificables y aplicables en función de un determinado nivel de conocimiento cuyo dominio generalmente incluye una fracci ón de un todo.De la Biología al Mito H.

para finalmente darnos cuenta que su nivel de especialización es tal. esa sola contemplación y descripción de lo observado es algo que hicieron Darwin. sino que además. Humbolt o d´Orbigny. pero luego vemos que no tiene antenas y que su estructura bucal no es propia del grupo de las hormigas y así sucesivamente hasta llegar a la conclusión de que se trata de una araña! ¿Porqué una araña tendría que desarrollar una forma parecida a la de una hormiga? Entender esta pregunta puede requerir de mucho tiempo y paciencia. Azurduy-Ferreira MODALIDADES ¿Qué direcciones ha adoptado la evolución en el tiempo?. ¿Porqué un tiburón y un delfín tienen similitud en su morfología general siendo el primero un pez y el segundo un mamífero acuático?. Si de entre el conjunto de organismos que van y vienen sobre un tronco cualquiera ponemos atención en una hormiga que con mayor detalle notamos que tiene cuatro pares de patas y no 3 como todos los insectos ¿qué conclusión sacaríamos? Una mutación sería una posibilidad. ¿porqué un ratón y un humano son tan diferentes siendo ambos mamíferos?. el mimetismo no solo es morfológico sino también molecular! ups! ¨Conflictos¨ que puede generar la evolución (una hormiga poniendo al descubierto a una araña imitadora de hormigas luego de constatar que posee 8 patas y no 6) 112 . grandes expertas en la lectura de moléculas odoríferas llamadas feromonas. muchos de ellos lamentablemente imperceptibles a nuestros oídos producto de las limitaciones auditivas y visuales propias de nuestra especie. donde tomará hongos sembrados por sus circunstanciales hospederas. Así. Cuando nos internamos en el ¨monte¨ hay muchas cosas que están aconteciendo y sonidos que se están ejecutando. ¿por qué ciertas orquídeas han desarrollado modificaciones florales que imitan a una hembra de avispa a la algún desairado macho intentará copular? Estudiar la vida en una perspectiva evolutiva puede depararnos muchas y fascinantes sorpresas de la naturaleza. El solo observar un tronco seco nos mostrará una gran variedad de formas biológicas desplazándose sobre él. que no solo se puede confundir entre las hormigas para ingresar a sus cuevas .De la Biología al Mito XV H. su olor es tan similar que las hormigas. Solo se requiere de algo que quizás incluso los biólogos estamos perdiendo con tanta avalancha tecnológica y códigos binarios: la observación in situ. no percibirán a un extraño.

resistencia fisiológica a las altas concentraciones de CO2 (dióxido de carbono). El registro fósil nos muestra otro ejemplo. Uno. pasando el Rio Piray y luego de un tramo boscoso. etc. y (3) el progresivo desarrollo de caracteres en función a caracteres un grupo biológico diferente (Coevolución) . del ejemplo descrito podemos identificar tres principales direcciones de la Evolución. La razón para tal parecido parte de la ¨necesidad ¨ de adaptarse a ambientes parecidos es decir con poca o casi nula precipitación. Otro ejemplo podría ser el que se da en plantas que viven ambientes desérticos o semidesérticos. cuerpo relativamente cilíndriforme que le permite un movimiento efectivo dentro los túneles. Ambos. Al oeste de la ciudad de Santa Cruz.De la Biología al Mito H. (1) La aproximación a una morfología propia de un grupo biológico distinto (Convergencia adaptativa o Evoluci ón convergente). altas temperaturas. en América los podemos encontrar en regiones como el Chaco. Evolución convergente Sin necesidad de escudriñar demasiado en el registro fósil y fijando nuestra atención en organismos actuales podemos darnos cuenta que muchos organismos tanto vegetales como animales gracias a desenvolverse en ámbitos ecológicos comunes y sin tener parentesco cercano han desarrollado estructuras adaptativas similares o parecidas de carácter análogo u homólogo. 1. patas cortas. Azurduy-Ferreira Conocido de alguna manera lo referido a la historia natural de tal interacción. etc. desiertos de Arizona y Sonora. Así. Las películas en el desierto de Sahara son muy famosas y en alguna ocasión escuché de boca de alguien. Esta confusión es comprensible dado el parecido externo entre estas plantas pese a ser de familias diferentes. Ciertamente. su admiración por los “cactus” que supuestamente se veían en la pantalla. posibilidades de altos niveles de evapotranspiración. todos sabemos como son los cactus (familia Cactaceae) y las características que los mismos tienen. lo que dicha persona vio no fueron cactus sino más bien plantas xeromórficas (típicas de ambientes secos) de otras familias como Aclepiadaceae y Euphorbiaceae . Las Pampas del Urubó como se las conoce. de manera súbita se hacen evidentes extensa pampas abiertas de rasgos relictuales. los tigres dientes de sable se caracterizaron precisamente por la presencia de colmillos exageradamente grandes 113 . la otra pregunta estaría referida a los mecanismos evolutivo s que intervinieron en el origen de una interacción de esta naturaleza. un roedor del género Ctenomys boliviensis (conocido localmente como Cujuchi) y otro. aunque de aparente disimilitud han logrado adaptaciones como las mencionadas anteriormente de modo que ambos pueden ser considerados como especies resultado de un proceso de evolución convergente hacia una forma de vida hipógea. son el hábitat donde convergen dos tipos de mamíferos hipógeos. uno de los armadillos más raros del Neotrópico cuyo nombre científico es Chlamyphorus retusus (¨Tatujeicuarajoya¨ en guaraní). de modo que tenderán a desarrollar hojas diminutas o modificadas en forma de espinas. región andina. (2) la diferenciación morfológica de araña a hormiga (Divergencia Adaptativa o Evolución dive rgente). orejas diminutas. etc. Es el caso del caso organismos hipogeos (es decir que llevan una vida subterránea) que sin estar emparentados poseen hábitos parecidos fundamentados en sus estructuras adaptativas es decir: uñas fuertes.

etc. Aquí cabe enfatizar la fuerza evolutiva del medio para modelar formas o estructuras biológicas que al estar expuestas a factores selectivos de igual magnitud o direccionalidad los ¨productos¨ tenderán a converger en distintos aspectos como la forma. Es en este lapso de tiempo. en esta modalidad . la divergencia adaptativa en mamíferos placentarios puede ser rastreada en el registro fósil. en el que se diferencian la mayoría de los órdenes modernos de mamífer os. el mismo que nos muestra que la divergencia se inicia durante el Paleoceno y se intensifica entre los 10-15 millones de años. En Australia. Por ejemplo. Evolución divergente Esta es una modalidad evolutiva de sentido opuesto al caso anteriormente descrito. Pese a ello se han podido establecer ciertos lineamientos en el proceso de diferenciación de los mamíferos los mismos que tendrían como ancestro a un diminuto 114 . basado en homologías. aunque lastimosamente es la fase geológica que alberga al peor registro fósil de todo el Cenozoico. Abajo: Araña de la familia Salticidae. existe un ancestro común a partir del cual se originan diversas formas de vida adaptadas a variados ámbitos ecológicos. Lo que parecen antenas son las patas delanteras accionadas cual antenas. Dos formas de vida convergentes: Arriba: Hormigas. 2. de modo tal que en realidad posee cuatro pares de patas y no tres como se puede observar en las hormigas. fueron encontrados restos fósiles de un marsupial carnívoro con características parecidas fundamentalmente en lo que a los colmillos concierne. lo que implica cambios en la estructura aunque manteniendo un plan anatómico común. En tal sentido la evolución convergente surge como el resultado evolutivo de organismos no emparentados entre sí y que han logrado adaptarse e n ámbitos ecológicos similares desarrollando estructuras o fisonomías parecidas.De la Biología al Mito H. la fisiología. el comportamiento. Azurduy-Ferreira que le valieron su nombre.

vasos sanguíneos. Es evidente que la divergencia adaptativa ha dirigido a los mamíferos en corto período de tiempo (teniendo en cuenta el periodo geológico) hacia “destinos” ecológicos diversos. Darwin afirmó en El origen del Hombre: “Sabido es de todos que el hombre está constituido sobre el mismo tipo general o modelo que los demás mamíferos. tapires o el propio hombre. Azurduy-Ferreira mamífero muy parecido a las actuales musarañas. murciélagos. ratones. abarcando agua. Al respecto. Abajo: Araña Salticidae que imita a hormigas. 115 . de un murciélago o de una foca. osos hormigueros. aire y tierra e implicando eventos macroevolutivos (al nivel de orden) que explican lo drástico de los cambios logrados. Arriba: una tarántula (Theraphosidae). aunque manteniendo en todos los casos ese ineludible nexo evolutivo. monos. a partir del que habrían divergido formas tan heterogéneas como las ballenas. nervios. Dos arácnidos divergentes. Todos los huesos de su esqueleto son comparables a los huesos correspondientes de un mono.De la Biología al Mito H. y vísceras internas”. Lo mismo se puede afirmar de sus músculos.

Polinizadores que a su vez adaptaron sus estructuras bucales para lograr sus propósitos. que asevera que la coevolución es un patrón evolutivo detectable por simple análisis filogenético. interdependencia. Es producto de esta relación eminentemente alimentaria que surge una de las modalidades evolutivas más apasionantes y complejas en la naturaleza: la Coevolución. De hecho. Como sabemos existen organismos que viven a expensas de otros. Aunque ambos conceptos asimilan de igual forma la idea de coespeciación. fueron precisamente sus observaciones las que cimentaron la Coevolución como una línea teórica particular en Evolución. aunque es necesario indicar que existen diferentes formas de abordar el concepto. en la que la direccionalidad evolutiva del hospedero condiciona la direccionalidad evolutiva del parásito. Entre los muchos ejemplos que existen podemos indicar el caso que se da en ciertas especies de plantas de Acacia. llegando a tener una relación en diferentes grados de dependencia. La relación parásito-hospedero (endosimbiosis) demuestra otro grado de relación coevolutiva. tienen una modificación especial en sus hojas que consiste en el desarrollo de glándulas en la nervadura principal. quienes a tiempo de utilizar un recurso (néctar floral) pueden polinizar la misma y así posibilitar la fecundación. Estas hormigas se caracterizan por ser muy agresivas y atacan intensivamente a cualquier herbívoro que se quiera alimentar de la planta. La palabra coevolución es muy “gráfica” al darnos una idea de interrelación. Darwin puso particular atención en el fenómeno de polinización.. Estructuras y hábitos de un organismo desarrollados en función de las características de otro. Bajo este criterio han sido elaborados árboles filogenéticos tanto de hospederos como de parásitos de manera independiente para 116 . En fin. etc. o en otro caso. existen dos grandes concepciones: el primero. Plantas que desarrollaron un sinnúmero de estrategias para ser atractivas a sus polinizadores. unas veces deseadas y otras no. En estos tipos de relación puede darse el beneficio solo para uno y daño para el otro (parasitismo) o beneficio para ambos (mutualismo). Azurduy-Ferreira 3. así. las mismas que segregan sustancias de las que las hormigas en cuestión se alimentan. en las que viven algunas especies de hormigas del género Pseudomyrmex. que indica que la coevolución es un proceso de respuestas adaptativas recíprocas y el segundo.De la Biología al Mito H. en el que aves. vemos formas de vida que en su trayectoria evolutiva ¨decidieron¨ vivir dentro de otros de modo tal que llegaron a depender de ellos a tal grado que muchas estructuras útiles en su forma de vida anterior ya no les sirvieron y terminaron prescindiendo de ellas. Ante la ausencia de estas hormigas se ha considerado que las plantas alcanzan tal grado de vulnerabilidad ante la ausencia de Pseudomyrmex que los niveles poblacionales de este tipo de acacias decae n considerablemente. es una de las facetas de la Evolución con grandes implicaciones de naturaleza ecológica y de conservación biológica. Literalmente pareciera que defienden (costo) la plantan y evitan su predación. insectos o mamíferos (murciélagos). matan a la planta que se quiera desarrollar sobre la misma. Coevolución La vida es un juego de interacciones y convivencias. como aquellos extremos en los que la ausencia de uno condiciona la desaparición del otro. interacción. a cambio del alojamiento y alimentación (beneficio) que la misma les provee. Estas plantas.

molares vestigiales. rostro retraído. El registro fósil. éste es un ejemplo que grafica muy bien esta tendencia evolutiva aparentemente infinita del cambio paralelo entre predador-presa.) se ven ante predadores cada vez mas especializados y altamente eficientes para vulnerar los diferentes tipos de conchas. endémico de México) cuyo rostro prominentemente elongado le permite llegar al néctar albergado en flores tubulares. Abajo: un murciélago nectarívoro notablemente especializado (Musonycteris harrisonii. etc. la evolución de rasgos de ofensiva y defensiva en organismos relacionables ecológicamente. bordes reforzados al nivel del orificio de apertura y lo más sorprendente. nos muestra evidencias de relaciones ecológicas por ejemplo del tipo predador-presa. ostras. Azurduy-Ferreira buscar patrones que demuestren lo dicho. aunque sean un tanto difíciles de establecer feacientemente. Linajes con concha gruesa. condicionados selectivamente por el desarrollo de nuevas estructuras de ataque por parte de sus predadores. Por ejemplo durante el Mesozoico los moluscos (caracoles. En este ejemplo. Evidentemente en este caso las fuerzas selectivas actuaron contra aquellas formas más vulnerables mientras que gracias a fuerzas selectivas direccionales o disruptivas. Dos especies resultado de procesos de coevolución hacia hábitos diferentes. espinas muy grandes en la superficie que podrían ser efectivos por lo menos para algunos predadores. los moluscos desarrollan estructuras de defensa. se pueden superponer. dichas evidencias. sugieren que procesos coevolutivos han ocurrido. entre ellos están nuevas formas de peces y crustáceos que desarrollan estructuras que aumentan su eficiencia a la hora de alimentarse de moluscos con concha externa. 117 . Es el caso de árboles filogenéticos construidos para algunas especies de artrópodos y sus respectivos endonsimbiontes (bacterias en este caso). Los resultados evidencian tal grado de paralelismo que ambos árboles filogenéticos (tanto de parásitos como de hospederos).De la Biología al Mito H. nuevas formas comenzaron a aparecer. Arriba: el murciélago vampiro (Desmodus rotundus) de hábitos hematófagos. incisivos prominentes.

es el que se da en ambientes insulares dado que las islas se constituyen en laboratorios de evolución a ¨corto plazo¨ si consideramos factores como: alta competencia. relaciones tróficas especiales –ausencia de predadores en algunos casos-. topografía. Darwin y Mayr lo percibieron. cada isla es un laboratorio vivo de evolución. nichos ecológicos limitados. mamíferos grandes que tienden al enanismo. ¿cómo se pueden explicar eventos de colonización insular por aves que no vuelan? Lo que él se imaginó fueron 118 . Si la tasa de colonización es igual a la tasa de extinción el número de especies se mantiene sin cambio y en equilibrio. etc. como son aves que no vuelan. Es a partir de ahí que la teoría de Isla Biogeográfica se torna formal y sus conclusiones generales en este contexto. La teoría de la Isla Biogeográfica tiene como una de las principales referencias. Islas muy pequeñas tendrán tasas de extinción más al tas. ¿Cómo llegan a una isla organismos con poca capacidad de “desplazamiento”? o. donde los organismos experimentan continuamente nuevos fenotipos. Así. espacio restringido (mas aún si hablamos de grandes mamíferos o aves. plantas con una casi nula capacidad de dispersión. tal como Wallace. y elaborar modelos matemáticos en base a los cuales se puedan realizar predicciones al respecto. Quienes. la publicación de The Theory of Island Bi ogeography de Mac Arthur y Wilson (1967). Si la tasa de colonización excede la tasa de extinción el número de especies crece. limitadas fuentes de alimento. Estas condiciones hacen de estos ambientes propicios para encontrar indicios de evolución distintos a los que nos brindan áreas continentales. producto de una intensa recolección de datos biogeográficos en islas trataron de explicarse los factores que definían la diversidad en una isla. La fauna y formas insulares fueron motivo de atención para Darwin quien se cuestionó acerca del motivo de la incapacidad de volar de aves que habitan islas o plantas con estrategias pobres en dispersión. mamíferos pequeños que tienden al gigantismo. Existe relación entre la magnitud del área insular y el número de especies. en otras palabras. etc. Azurduy-Ferreira EVOLUCION INSULAR Una de las escenas más excitantes en evolución. fueron: - El número de especies en una isla se incrementa por colonización y decrece por extinción. escaso o nulo flujo génico lo que de por si conduce a un aislamiento geográfico seguro). poca chance de dispersión. Las islas son centros en los que la variabilidad genética potencial tiene una gran chance de manifestarse producto de procesos selectivos intensos o su ausencia parcial en determinados casos y de esta manera evidenciar fenotipos extraños y raros para ámbitos continentales. es un centro de especiación por excelencia.De la Biología al Mito XVI H.

Darwin supuso en algunos casos.De la Biología al Mito H. Strigiformes. La explicación más ampliamente aceptada para que aves sin la capacidad de volar se desarrollen están relacionadas con presiones selectivas asociadas a la ausencia de predadores y recursos alimentarios limitados. Así. Columbiformes. Gruiformes. etc. reducción del tamaño. Bajo presiones selectivas reducidas tanto de predadores como de competidores. ha perdido la capacidad 119 . etc. La evolución de la incapacidad de volar en algunas aves. . dípteros. ortópteros y homópteros. Respuestas evolutivas pueden incluir: cambios con la finalidad de conservar energía. En Nueva Zelanda alrededor del 35 % de aves tanto terrestres como de hábitos acuáticos son o fueron (en el caso de las ya extintas) incapaces de volar. Aves fósiles con la misma condición fueron encontradas en islas del Pacífico. a la masa de los músculos de vuelo. los solitarios de las islas Reunión y Rodríguez (Raphus solitarius y Pezophaps solitariaon respectivamente). mientras que en Hawai la proporción es del 24% (20 especies). dodos. reducción de tejidos metabólicamente caros. aves elefante (Aepyornithidae) de Madagascar y las moas (Pachyornis spp) de Nueva Zelanda. la incapacidad de volar pudo haber sido logrado por la reducción de masa muscular relacionada con el vuelo y la consecuente reducción en la masa total. un insecto ortóptero que ante la ausencia de mamíferos con hábitos subterráneos. Azurduy-Ferreira grupos de ancestros arrivando a islas y transformándose después a través de procesos selectivos en lo que él tenía al frente.Insectos Grupos de insectos insulares ápteros (incapaces de volar). el dodo de la isla Mauricio (Raphus cucullatus). himenópteros. a menudo esta asociado con el incremento de la masa corporal. Si todos estos factores selectivos fueran combinados con variación heredable en relación. que las causas eran atribuibles al desuso de los órganos.Aves Ejemplos de aves con la incapacidad de volar podemos encontrarlos al menos en ocho ordenes de aves (Struthioniformes. han sido reportados en coleópteros. lepidópteros. Aunque. aves elefante. lo que nos conduciría al pensamiento lamarckiano clásico sobre en “uso y desuso” de órganos. es el caso de Deinacrida rugosa. Anseriformes. El resultado fueron aves como las moas. Historias evolutivas en islas . presiones selectivas pudieron haber promovido incremento del tamaño corporal sin un incremento compensatorio en la masa de los músculos que actúan en el vuelo. las poblaciones insulares parecerían estar libres de ciertas presiones selectivas que bajo otras condiciones actuarían produciendo otro tipo de fenotipos. Psittaciformes. Ante la ausencia de mamíferos predadores y otros grandes vertebrados terrestres. reducción de músculos implicados en el vuelo. Ciconiiformes y Passeriformes). Convergencias adaptativas a nichos ecológicos propios de mamíferos han sido evidenciados en algunos insectos. La gran lista de este tipo de aves incluye al cormorán de las galápagos (Phalacrocórax harrisi). su tamaño relativo y habilidad de volar se atrofiarían a través de generaciones.

son muy reducidas. un evolucionista que trabajó en las islas Hawai y otras islas de la Polinesia escribió: “. las estructuras que facilitan la dispersión por aire o mecanismos para adherirse a mamíferos (garfios. tienden a ser mas fácilmente transportables por viento o agua. ha incrementado el tamaño corporal y ha ocupado nichos ecológicos que en otras circunstancia hubieran sido habitados por roedores geófilos. La flora de estas islas debe haber arribado producto de dispersiones de larga distancia.. lo que trae como consecuencia la aparición paulatina de tamaños y fenotipos diferentes a los que se ven comúnmente en áreas continentales.De la Biología al Mito H. surgían preguntas en relación a los factores evolutivos se hubieran dado para que dichos mamuts enanos se desarrollen y las condiciones por las cuales éstos pudieron haber sobrevivido a diferencia de sus congéneres gigantes continentales. Pero más allá de ello. . y es evidente que durante procesos evolutivos en áreas insulares. observé frutos y semillas que parecían incongruentemente pobres en su capacidad de dispersión.. los mismos que se alimentan de plantas leñosas. pueden desarrollarse muy rápidamente. 120 . Los propágulos (semillas) de plantas herbáceas. de esta manera. son las que tienen una mayor tasa de colonización en islas y una predominancia evidente. las que tienden a ser mas pesadas.Plantas – Carlquist. que evidenciaba la existencia de mamuts enanos insulares!. Ante estas condiciones las plantas a menudo se desarrollan libremente y sin presiones selectivas por parte de sus potenciales predadores. varios grupos de plantas han perdido su capacidad de dispersión”. quizás hasta en menos de una década. menos flotantes y menos resistentes a las aguas marinas. espinas y prolongaciones en forma de alas).mientras trabajaba. Cambios morfológicos asociados con la reducción de la capacidad de dispersión. por otro lado. porque alteraba considerablemente la fecha de extinción de los mamuts y la segunda. Islas y la evolución corporal A principios de 1997 aparece en el New York Times el siguiente titular : “Dwarf Mammoths may have put off demise”. Muchos de los cambios que resultan en la reducción de la capacidad de dispersión de las plantas. donde la presencia y acción de sus predadores (selección natural) dirige y conduce la expresión genética en un sentido diferente. estas adaptaciones son muy evidentes tanto en frutos como en semillas. Azurduy-Ferreira de volar. Mamuts enanos que sobrevivieron a la gran extinción que supuestamente acabó con “todos” los mamuts? Esta fue una desconcertante noticia por dos cosas. están asociados con adaptaciones para la colonización de hábitats propios de islas. Muchas islas no poseen mamíferos herbívoros folívoros y ramoneadores. Diferencias entre plantas de continentes e islas fueron observadas por Darwin quien que plantas que son típicamente herbáceas en ambientes continentales. la primera. tienden a ser leñosas y de gran tamaño en islas.

6 toneladas). bisontes. Por isótopos radiactivos se determinó que la antigüedad de los dientes oscilaba entre 4.000 años existían aún grupos de mamuts deambulando en la isla de Wrangel.000 años producto de las bajas en el nivel del mar gracias a los efectos de la Glaciación Wisconsiniana. mamuts.000 años más recientes que aquellos que marcaban la fecha de extinción. Habitaron enormes estepas de la actual Siberia y Alaska. rinocerontes lanudos. La paulatina elevación del nivel del mar hizo de dicha irregularidad topográfica una isla donde se refugiaron entre otros organismos. Beringia fue un gran puente intercontinental que mantuvo unidas a Norteamérica y E urasia por alrededor de 8. la extinción de este tipo de mamuts es aún un tanto controversial . las mismas que en un “momento” determinado formaron una gran región geográfica denominada Beringia.000 años más. La “historia de los mamuts enanos” comenzó cuando tres científicos rusos encuentran restos fósiles de mamuts “pequeños” en una remota isla del Artico (Isla de Wrangel de posesión rusa).000 años.De la Biología al Mito H.000 y 7. La conclusión era evidente. Una vez aislados. su distribución llegó hasta lo que hoy conocemos como México produciéndose su extinción supuestamente hace 10. Inicialmente la excitación del cambio de fecha respecto a la extinción de los mamuts quizás hizo perder un tanto la perspectiva en relación a cuestionarse sobre el tamaño de los dientes (25% mas pequeños) llegándose a pensar que s e trataba de individuos juveniles.000 y 12. hizo que Mammuthus primigenius derive en una forma insular mucho más pequeña. sirviendo incluso en su momento de refugio (uno de los refugios pleistocénicos) para muchos animales que se dispersaban producto del clima adverso. lo sorprendente fue que los estratos sedimentarios que albergaban dichos restos eran 6. sumado a las condiciones ecológicas insulares y la expresión de genotipos potenciales producto de intensas presiones selectivas.La pesadilla de un mamut Tratemos de desarrollar el caso. los mamuts (Mammuthus primigenius) como sabemos fueron una especie de “elefantes lanudos” de gran tamaño y con colmillos particularmente largos y de una curvaturacaracterística. tigres dientes de sable.000 años aunque. Pero ¿cómo sobrevivieron y evolucionaron hacia formas más peque ñas estos peculiares mamuts? Si vemos los datos geocronológicos del área.000 años!. para algunos la razón fue el arribo de cazadores a la isla.. este gran puente sirvió para el paso de muchos organismos (incluyendo el hombre) de un continente a otro. hace 4. y que lo más probable es que la capacidad de carga (capacidad de un ecosistema de sostener los organismos que lo componen) de la isla.4 toneladas (a diferencia de los adultos conocidos de 6. hubiera sido sobrepasada provocando la extinción de e stos 121 . que siendo uno de los organismos dominantes de la estepa. etc. quedaron a expensas de los factores y condiciones insulares y pudieron subsistir 6. El hallazgo consistió en 29 dientes completos y muchos fragmentos de dientes y huesos. aunque por otro l ado científicos rusos indican que no existen restos arqueológicos que demuestren la “coexistencia” entre mamuts enanos y el hombre. E n Beringia habitaron leones. Estudios posteriores determinaron que esos dientes pequeños pertenecían a individuos adultos con un peso de 2. Con todo. vamos a ver que Beringia conectó ambos continentes aproximadamente entre 20. Azurduy-Ferreira . y por supuesto el mamut. de modo que la Isla de Wrangel emergía como un gran promontorio visible en la estepa de Beringia por entonces con la extensa superficie del suelo expuesta. Este aislamiento.. lo que hace suponer que en fechas inferiores el nivel mar comenzó a subir y a romper la conexión entre Eurasia y Norteamérica.

. Por ejemplo. ¿Tienen todavía alguna sorpresa escondida estos diminutos mamuts? . Esta última aseveración se pone en entredicho al haberse comprobado la presencia de Eskimos (Esquimales) en la isla 3. esta cualidad de las islas de provocar fenotipos enanos o gigantes es denominado síndrome de isla.Organismos más pequeños requieren menos recursos para sobrevivir y reproducirse. Individuos más grandes poseen una mayor energía y reservas de agua. median poco más de 3 m de altura. Aunque individuos más grandes pueden requerir más recursos. . predadores grandes pueden alimentarse de presas grandes o pequeñas. y evidencias arqueológicas que indican actividad de cacería en la isla de Zhokov (de igual posesión rusa) 8. etc. aves extintas 1.500 años atrás y mencionadas anteriormente.El porqué Cuál es la razón para que ciertos organismos tiendan al gigantismo y otros al enanismos en ambientes insulares? Las ventajas para los organismos de gran tamaño puede n ser: - Individuos más grandes pueden explotar una mayor diversidad de recursos. Azurduy-Ferreira lanudos y fascinantes habitantes. tienden a ser mas especializados y más eficientes en la asimilación de nutrientes y energía. . Es el caso de la existencia de elefantes enanos durante el pleistoceno de hasta 75 cm (Elephas falconeri) o 1 7 0 c m (Elephas mhaidriensis). lo que animales mas grandes no pueden hacer.Individuos pequeños. Casos de gigantismo han sido reportados también en iguánidos.000 años atrás. Otros casos de enanismo han sido reportados en canguros. producto de su requerimiento de menos recursos. Esto sería particularmente importante en islas donde los recursos pueden ser muy limitados. ellos pueden también dominar territorios más extensos. serpientes. varánidos (lagartijas monitor). las ventajas serían. patos.Organismos pequeños pueden explotar pequeños espacios y refugiarse mas fácilmente de predadores y de esta manera evitar condiciones ambientales de estrés.000 años atrás. Dado de que ellos pueden adquirir suficientes recursos para sobrevivir y reproducir. individuos más grandes pueden producir camadas más grandes. las musarañas actuales que miden unos pocos centímetros. crotálidos (serpientes cascabel). teidos (lagartijas). las moas (Diornis giganteus ). 122 . varánidos (dragón de la Isla de Komodo). .Otros casos Anteriormente hemos visto casos de gigantismo en aves e insecto s y hoy un evidente caso de enanismo en mamíferos. tortugas. han sido reportados al margen de los mencionados anteriormente. Muchos casos sobre síndrome de isla. tortugas. etc. tuvieron ancestros insulares gigantes (Deinogalerix koenigswaldi) de hasta 55 cm (sin tomar en cuenta la longitud de la cola). Respecto a organismos de tamaño pequeño. lacértidos (geckos o chupa-cotos).De la Biología al Mito H. en el pleistoceno también existieron ciervos enanos (Megaceros cretensis) de hasta 60 cm de altura.

climáticas. pastizales de altura. raro. valles. lagunas. 123 . lo que a su vez nos hace prever la posibilidad de que a futuro nos sea posible evidenciar muchos fenotipos nuevos que pueden ser sinónimo de grotesco. las mismas que incitan a que el acervo genético de una población “saque a relucir” formas conservadas para “determinadas eventualidades”. Las propiedades evolutivas insulares nunca nos terminarán de sorprender por los mecanismos y patrones ecológicos que las caracterizan. Biogeográficamente islas pueden ser todas aquellas porciones geográficas. Azurduy-Ferreira El concepto de isla en un contexto biogeográfico y evolutivo adquiere una dimensión y ac epción diferente al que generalmente estamos acostumbrados a usar. Con todas esas singularidades y propiedades como centros evolutivos. altitudinales. climáticos. etc. ecológicos. Así. etc. novedoso o singular. altitudinales y biológicas nos hacen ver en el S ubandino boliviano un complejo de islas geomorfológicas que brindan un escenario evolutivo de una dimensión y significancia distintas a las que Darwin visionó para las Islas Galápagos. que por factores geomorfológicos. retienen inconex as poblaciones biológicas. (La imagen muestra el patrón geomorfológico de un sector del Subandino donde se delimita sectores de la Cuenc a Mizque y que se extiende entre los departamentos de Santa Cruz y Cochabamba ). las cualidades geotectónicas. es decir cimas de montaña. los sistemas insulares son al mismo tiempo los escenarios con las tasas de extinción más dramáticas de modo que el atributo insular se convierte en uno de los objetos de Conservación Biológica y aquí aplico el sentido lato (amplio) de isla.De la Biología al Mito H.

ACTO SEPTIMO Del sexo y la cultura. un réquiem a Freud .

La fuerza cultural puede instaurar en el individuo determinados modelos mentales que condicionan su percepción de él mismo. fue el nacimiento de la Sociobiología.La cultura es el producto exclusivo y específico del ser humano y constituye sus características distintivas en el cosmos". esto. desde la lógica Aymara el pasado esta adelante porque es lo que conocemos. es algo que se aprende. 124 . Nadie nace con la idea de Dios fijada en su constructo mental . a conocer las implicaciones evolutivas del comportamiento. socialización. son algunos de los atributos que el hombre se asigna a sí mismo como exclusivos e imposibles de ser evidenciados en otros organismos. El nativo Chiquitano del oriente de Bolivia. entre otras cosas. es decir: sobrevivencia. Esta heterogeneidad de conceptos ha dado lugar a que ciencias como la etología. situación que además le facilita y permite una convi vencia social con los demás.De la Biología al Mito XVII H. Los Chiriguanos no apuntan al arcoiris porque creen que su mano quedar á tullida. esta forma de ver y explicar un fenómeno es algo que aprendió y lo asumió como algo cierto y verdadero. el entorno o el cosmo s. Todo grupo de organismos que posee cultura toma elementos de su entorno.. Esta incorporación de unidades de información cultural (que como veremos mas adelante Dawkins los denomina memes) condicionarán muchos rasgos comportamentales en el desenvolvimiento del organismo en su medio. es el conjunto de hábitos. 1997) dice que "la cultura. desarrollen vastos campos de investigación tendientes. ve en el arcoiris el camino del Jichi (deidad mitológica serpentiforme) y difícilmente vamos a convencerlo de lo contrario. mientras que el futuro esta detrás porque es lo que no conocemos. Una de las consecuencias. los demás. ya que el asumir de manera colectiva una determinada percepción cultural . y valores . cualquier disonancia o asinomorfia introducida. implica fortalecer los lazos entre los que componen el grupo. los incorpora en su estructura cognitiva (basada en sus cualidades genéticas) y los aplica en su cotidianidad.. si escucha un trueno nos dirá que dos jichis están peleando... Kroeber (en Pelaez y Baró. etc. cultura y razonamiento.aprendidos y transmitidos. Azurduy-Ferreira SOCIOBIOLOGIA Y CULTURA Sociedad. técnicas ideas. rituales.y los comportamientos que inducen. los Machiguengas del Perú pintan con motas negras a sus hijos en los días de tormenta para que los espíritus vean en ellos a un jaguar y no se los lleven. puede romper el esquema social establecido. que se constituye en la última gran síntesis en el seno de la biología y cuyas repercusiones en sociología y psicología son muy evidentes. la capacidad de descifrar los códigos Hammurabi o leer las Escrituras del Mar Muerto.

ya que el retorno del sonido emitido le proporciona no solo datos de distancia. y sus cuevas en las que habitaban como entradas o puertas al más allá. el rey inca incluía en su atuendo real (pechera y capa) retazos de piel de murciélago. que no es otro que el Guardián de Copan en el mundo Maya y que fue inspirado en el murciélago vampiro (Desmodus rotundus). en cuestión de segundos y de manera milimétrica y pasmosamente sincronizada pueden capturar una polilla al vuelo y usando su membrana que se extiende entre las patas (uropatagio) que utiliza como una especie de red. ubicación en tercera dimensión. uno de los grandes rasgos que me llamaron la atención de estos mamíferos voladores. Es decir.De la Biología al Mito H. etc. aunque durante mi estadía en esta región pude comprender que el gran valor evolutivo de sus pocas especies está en sus cualidades adaptativas de modo que pueden desenvolverse en condiciones tan extremas en las que pocas especies pueden subsistir. sino también. El único murciélago para Alaska (Myotis lucifigus) puede resistir el invierno con temperaturas mayores a -15° reduciendo al mínimo su metabolismo. Son éstos fuertes nexos sociales los que posibilitan la conformación de grandes colonias que reproductivamente son importantes ya que permiten producir niveles de temperatura favorables para la supervivencia de las crías que nacen desnudas y con un sistema de regulación térmica algo deficiente y que requiere ser reforzado justamente por el calor proporcionada por el contacto corporal con otros individuos de la colonia. polinizan flores. Este hecho me hizo recordar algo que quizás hoy nos puede parecer raro pero que en su momento tuvo un significado muy fuerte en civilizaciones antiguas. modifican la morfología de hojas grandes para obtener refugios temporales en forma de tiendas en los cuales guarecerse. momento en el que volará con una carga energética mínima que le tiene que alcanzar exactamente para conseguir alimento. Dicha forma de ver a estos mamíferos voladores se dio también entre los mayas y aztecas quienes reverenciaban a deidades como Kamazotz. quién entre otras cosas me comentó que asociados a un conjunto cerámico de la cultura Inca fue registrado un cráneo de murciélago aún sin identificar. envergadura. Y es que los murciélagos eran concebidos como mensajeros de los dioses. entre la Biología y el mito Una tarde tuve la visita de José Zansetenea (discípulo del arqueólogo argentino Dick Ibarra Grasso). etc. la creencia generalizada de que todos los murciélagos son vampiros o que son ratones transformados. etc. Grupos de tierras bajas bolivianas como los Ayoreode. Azurduy-Ferreira Los murciélagos. caso contrario corren el riesgo de perecer. ven a los murciélagos (chavotós en su lengua) como elementos portadores de mala suerte. Los propios murciélagos vampiros cuya diversidad se reduce a tres especies de las 210 registradas hasta ahora en nuestro país. de modo que determinados sonidos o vocalizaciones provenientes de ellos tienen un efecto supersticioso. controlan las poblaciones de insectos que eventualmente se constituyen en plagas para el propio hombre. Murciélagos en el hielo Visitar el Artico puede ser una de las experiencias con pocas expectativas en términos de diversidad biológica si tan solo vemos el caso de Alaska donde no existen serpientes. En nuestra sociedad de influyent e raigambre occidental. Existen murciélagos que por otro lado. y estar en esa condición envuelto en una fría escarcha hasta que las temperaturas asciendan a niveles favorables. según crónicas de los propios españoles. son los fuertes lazos sociales y afectivos que poseen. Su sistema de localización fundamentalmente en los insectívoros es notable. tienen la cualidad de regurgitar partes de lo que tomó al que se lo solicita y de castigar con la indiferencia colectiva a aquél individuo que se niega a compartir su alimento. dispersan semillas. Por otro lado. de modo que una vez procesan la lectura. ha determinado una percepción errónea de estos mamíferos que a la luz de su Historia Natural sabemos que son importantes actores de los procesos ecológicos en los ec osistemas donde se desenvuelven. de forma. ritmo cardiaco. solo existe una especies de rana (Rana sylvatica) o una sola especie de murciélago. respiración. 125 . Mas allá de lo mencionado hasta aquí. caso contrario perecerá por inanición.

De la Biología al Mito H. así como otros aspectos. de modo que la apreciación es parcial y con una serie de matices cuyo tratamiento equilibrado en las sociedades humanas es uno de los grandes retos para lo que se ha venido en llamar Educación Ambiental. que nuestro desconocimiento sobre ellos no nos permite apreciar o al menos observar el modo en que varios murciélagos revolotean cerca de un poste de luz cazando insectos o e n temporada de fructificación del bibosi (Ficus bibosi) en áreas de la ciudad. mínimamente se tendría que preguntar. Los murciélagos. son solo uno de lo s casos cuyo concepto e idea cultural carece generalmente de elementos naturales en la mente colectiva. Murciélago polinívoro. Tuttle 126 . es generalmente desconocido en las sociedades modernas. un reto en las sociedades modernas Quien haya tenido la paciencia de leer lo escrito hasta aquí. Su importancia en la polinización vegetal. Azurduy-Ferreira Educación ambiental. donde se los generaliza equívocamente como vampiros. qué tipo de concepto o idea nos evocan los murciélagos como entidades biológica y no como íconos modificados culturalmente que en sociedades ¨modernas¨ tienden a sufrir tal transformación. Foto: M. se producen grandes aglomeraciones de murciélagos del género Artibeus a l o s que se puede observar con toda claridad el modo en que se alimentan.

Este caso. con la ayuda de otros jerárquicamente inferiores. la misma. perpetúan indirectamente muchos de sus genes. para los sociobiólogos. como una tendencia que se centra en la evolución de la conducta social como producto de la Selección Natural. al hacerlo. En síntesis. es el comportamiento altruista en animales no humanos y en el que un individuo parece comportarse de tal manera que beneficia a otros en vez de beneficiarse a sí mismo. pero que jerárquicamente son inferiores dentro del mismo. Azurduy-Ferreira E. emitiendo sonidos de alarma ante el asecho de algún predador. y es evidente que el éxito de esta modalidad depende del número de copias de los genes comunes al grupo. sostiene que ¨somos un producto primario de nuestra evolución y que por lo tanto respondemos al llamado primitivo de nuestra herencia¨. cuya función es la transmisión de información genética para las siguientes generaciones. no ganan nada con su esfuerzo. estos roedores de hábitos fosoriales (construyen madrigueras) viven en grandes colonias en las que unos cuantos actúan como centinelas.De la Biología al Mito H. genética de poblaciones. Después. Los machos que ayudaron a establecer el grupo dominante. en el que los beneficiarios están relacionados genealógicamente (genéticame nte emparentados). de todos los machos de un mismo grupo. los organismos y sus adaptaciones (incluyendo su conducta) son formas que tienen los genes para producir más copias de si mismos. garantiza que los genes que comparte con ellos se perpetúen dentro de la población (otro caso de selección de linajes). el macho dominante del grupo vencedor se aparea frecuentemente con las hembras. Las células y tejidos del organismo sostienen las funciones del sistema reproductor. La vida de los centinelas se pone en peligro cuando el animal sale de su refugio para escudriñar el entorno. que también acuden al sitio de apareamiento. de comportamiento altruístico. biólogos evolucionistas e impulsores de la Sociobiología surgida en 1975 con la publicación de Sociobiology: The New Síntesis. se reúnen en un territorio especial de apareamiento y ahí ejecutan sus vistosas exhibiciones de colas en abanico. se ha mostrado que los miembros de un grupo son hermanos de la misma pollada. Un caso de comportamiento altruista fue observado por los biólogos Watts y Stokes en el apareamiento de los guajolotes silvestres (pavos comunes). etología y evolución con la finalidad de tratar de explicar el comportamiento animal (Homo incluido). el estudio de los efectos de la SN sobre el comportamiento social. Alexander. 127 . es decir como la expresión de genes que han sido modelados por Selección Natural. el comportamiento social evoluciona al igual que un carácter anatómico. o lo que es lo mismo. Wilson. uno acaba por dominar sobre los otros. R.Dawkins y R. Varios grupos distintos de machos. Para ello han integrado en su discurso ciencias como la sociología. El centinela actúa de este modo para proteger a sus hermanos y parientes. Otro caso muy interesante es el que se presenta con los perritos de las praderas. describen a la misma. y puesto que comparten muchos genes con el macho dominante. Uno de los comportamientos mejor demostrados desde la óptica sociobiológica. es conocido como selección de linajes. en este sentido para los sociobiólogos. Sin embargo luego de un estudio más detallado de un grupo. en los cuales existe una jerarquía de dominancia. arqueo y glugluteo ante las hembras.O.D. La idea de determinación biológica es importante para los sociobiólogos en este contexto. este patrón comportamental de cooperación puede observarse en los grupos sociales más complejos. ecología. Uno de sus principales postulados es la dependencia genética de los organismos en su desenvolvimiento natural. Como resultado.

existen casos en los que existe cooperación entre individuos no emparentados estrechamente . sin embargo. que no puede ser explicado por selección de linajes. este hecho hace de que el niño tenga una intensa interrelación social con otros niños miembros de su propio kibbutz. Sin embargo. existe poca atracción sexual o interés romántico entre sí. lo que demuestra cuán controversiales pueden ser. En el libro de Wilson (antes mencionado) aunque la mayor parte es referida a indagar la sociobiología en animales no humanos. existen madres que no tienen crías y que se prestan a cuidar a crías de otras hembras.De la Biología al Mito H. cuando llegan a adultos. Esta manera de abordar el tema. ¿Nosotros los humanos evitamos el incesto principalmente porque estamos programados genéticamente para ello. Este hecho. Muchos biólogos se cuestionan. reaviva esa vieja discusión sobre el comportamiento humano referida a los genes versus ambiente. afecta y refuta abiertamente ideas como las que sostienen que nuestros patrones sociales son 128 . Por su lado los sociobiólogos responderían de que. En general todas las culturas tienen leyes y tabúes que prohíben el incesto. teoriza sobre bases evolutivas en ciertas clases de comportamiento social en humanos. Jane Goodall (famosa etóloga inglesa). en relación a él. es basado en la experiencia (se ha visto que gente que rompe con este tabú ha te nido hijos con defectos de nacimiento). descubrió que los chimpancés a veces salvan a otros chimpancés con los que no están emparentados. como un ejemplo de mecanismo social innato de evitar el incesto. una vez que el niño alcanza una determinada edad. tiene un fuerte componente innato. En kibbutzim tradicionales. Shepher (1983) nos muestra el caso de grupos comunales israelí es conocidas como kibbutzim (del singular. Esta variante de altruismo es conocida como altruismo recíproco. en el último capítulo. ¨la evasión del incesto es muy común en las culturas humanas y ocurre en muchos animales no humanos¨. El debate se torna muy polémico cuando sus conceptos son aplicados al comportamiento social humano. por si mismo se puede constituir en evidencia de que el evitar el incesto. a pesar de los deseos de los padres y líderes del kibbutz (presión cultural). Al respecto. La conclusión sugiere que pese a que las personas de un kibbutz pasan mucho tiempo juntos y a una temprana edad. en el estudio de Shepher en el que se toman en cuenta más de 5000 personas. Posteriormente y a una relativa temprana edad. el argumento en pro de la socialización asevera que el incesto es un comportamiento aprendido y que el estigma social fijado. podemos tomar en cuenta un ejemplo que nos sirva de fondo para tratar de entender la posición sociobiológica. cómo la teoría sociobiológica puede ser aplicada. los padres persuaden a sus hijos a que los mismos se casen con algún miembro de su propio kibbutz. los mismos que crecieron en este tipo de sociedad. mostraron que matrimonios entre miembros de un kibbutz fueron extremadamente raros. Para un sociobiólogo esta es una prueba en el que los humanos tienen una resistencia innata al incesto que generalmente se impone a las presiones culturales dadas por padre y líderes del grupo social. en el futuro el eventual beneficiario puede ser recíproco y "retornar el favor" recibido. Generalmente los postulados de la Sociobiología han sido malinterpretados y llevados incluso al campo del sexismo y racismo. Azurduy-Ferreira Pero el altruismo no solo se da entre organismos emparentados. en el que obviamente los usuarios tienen fuertes lazos familiares). y es que en realidad el discurso sociobiológico. kibbutz). o porque las tradiciones y leyes sociales (cultura) no lo permiten? Ante este cuestionamiento. De modo parecido entre los delfines. pasa gran parte de su tiempo en una especie de grandes centros de guarderías propios de un kibbutz (especie de clan familiar.

Finalmente. . donde tuve la fortuna de registrar arañas coloniales enormes del género Eryophora cuyo sistema d e tela es predominantemente multiplanar. era una masa de puntos moviéndose al unísono. ya que de las alrededor de 40. si en un contexto filosófico pretendemos un futuro social cierto. comenzaron a moverse de manera coordinada y siguiendo un patrón de desplazamiento grupal similar. y que nosotros podemos cambiar cualquier patrón indeseable a través de educación. posicionándose en el centro un individuo por subcomplejo y cuyo número puede ser mayor a 200 entre hembras y machos. esquizofrenia. Obviamente que no somos autómatas dirigidos por un rígido modelo genético. Es evidente que dentro de este tema pueden darse posiciones extremas. durante una expedición a una de las lagunas salinas del Chaco en el Parque Kaa -Iya. . Azurduy-Ferreira moldeados únicamente por cultura y aprendizaje. dado su íntima filiación con el programa adaptacionista y su a veces irreflexiva indiferencia a otros factores como los culturales. es en algún grado genéticamente controlado e influe nciado. incluso por parte de los Sociobiólogos los que en algunos casos han sido tan reduccionistas en sus hipótesis y aseveraciones. Indagaciones posteriores me hicieron notar que la colonialidad (y sus variantes) son un evento evolutivo raro o al menos no muy frecuente entre los arácnidos. Arañas coloniales. no existen razones para asumir que nuestro comportamiento no es afectado por nuestros genotipos (homosexualidad. están también sus argumentos en pro de la humanidad misma. Si caía atrapada una polilla en uno de estos 129 . y es que en un punto de una estrecha senda. en plena evolución social Las arañas fueron algo ajenas a mi interés hasta que durante la búsqueda de huesos de dinosaurios en el Parque Nacional Amboró me encontré de manera inesperada (como muchas de las circunstancias en Biología) ante algo que me quitaría algunas horas de sueño posteriormente. cosa que en perspectiva. y estructurada en base a la unión de subunidades individuales menores. etc).000 especies de arañas conocidas alrededor de 40 desarrollan sistemas coloniales. debemos tratar de entender las manifestaciones. aunque del mismo modo. cientos de diminutas arañas rojizas que al sentir vibraciones que provoquéa propósito. El beneficio de un complejo ¨comunal¨ de arañas pude entenderlo un poco más. deriva genética al azar y correlaciones genéticas. entonces deberíamos conocerlo en todo detalle. incentivos y programas sociales. Los sociobiólogos en ocasiones son tachados de panseleccionistas. distracción. si nosotros mismos hemos ignorado el rol de nuestra herencia biológica.No podemos esperar encontrar soluciones. bulimia. mecanismos y fenómenos sociales en cada nivel y usar cada herramienta disponible para tal efecto. de modo que si se recurre a la genética en este caso es porque existen suficientes evidencias como para pensar que muchas respuestas sociológicas pueden estar escondidas en nuestro genoma. lo que me indicaba una forma de sistema social muy estrecha cuyas connotaciones evolutivas no comprendía en lo más mínimo en ese momento. Así como los individuos varían extensivamente en rasgos fisonómicos ¿porqué no esperar también variaciones hereditarias en el comportamiento? Lo cierto es que más allá de esas posiciones audaces e irreverentes en las que la sociobiología sostiene que el comportamiento humano en algún grado es programado a través de la evolución.De la Biología al Mito H. estaba frente a un sistema de tela de araña de estructur a tridimensional (forma poliédrica) y que contenía dentro. que han dificultado grandemente su interpretación y adecuación a un determinado cuerpo teórico o epistemológico.Los sociobiólogos argumentan que si nuestro comportamiento. .

Psicología evolutiva En el sentido tradicional. si vale el término. en la India se han descubierto tarántulas coloniales cuya asociación (entiendo) puede ser una respuesta a una forma de presión selectiva que habría estimulado una respuesta adaptativa de índole comportamental. siendo las primeras mucho más pequeñas que las segundas. si bien hasta ahora no se conocen tarántul as de hábitos coloniales en el Neotrópico. Dada esta perspectiva la Psicología Evolutiva se relaciona estrechamente con la Sociobiología y se fundamenta en el hecho de que la arquitectura heredada de la mente humana es el producto de procesos evolutivos por lo que se espera encontrar un engranaje funcional entre problemas adaptativos y la estructura de los mecanismos 130 . Ahora bien. de los adolescentes. etc. por qué asumir desde nuestra visión de humanos. las arañas no pueden decir mucho en una sesión de psicoanálisis. ¿Si se trataría de un comportamiento análogo y no homólogo. La sola contemplación de un evento natural como éste. la razón por la cual me hubiera gustado observar algo así con Darwin y Freud. que la acción de la araña ¨oportunista¨ es tal? De Darwin intuyo de alguna manera sus argumentos. por ejemplo) pueden estimular ciertas respuestas evolutivas. los individuos circundantes se dirigían hacia el sitio de captura y tomaban una parte de la polilla para luego retornar a sus sitios respectivos. ¿consideraría Freud a una araña como oportunista?." En esta concepción la noción del tiempo esta limitado en un sentido meramente ontogénico. En los alrededores comenzaron a aparecer arañas de otra especie un poco mas grandes y que intentaban quitar las presas obtenidas por las más pequeñas. es imaginarme la discusión de ambos sobre el suceso. Algo que hubiera querido contemplar junto con Darwin y Freud es un evento natural que observé en un punto del Chaco bolivian o. mientras que de Freud no estoy siquiera seguro de su ánimo para responder cosas como éstas. de los niños. la psicología del recién nacido. en el futuro y producto de determinadas presiones selectivas (nuevos y más agresivos predadores espec íficos. ¿Qué implicaciones evolutivas encontraría Darwin en un comportamiento como el ¨oportunismo¨ que compartimos con las arañas?. sin la pretensión inmediata de sacar conclusiones o mas preg untas (impulso siempre t entador) nos puede brindar un momento en el que el fenómeno se reduce a una pieza minúscula de un todo que funciona de manera silenciosa. Azurduy-Ferreira subsistemas. ¿Qué tipo de argumentos esgrimiría Freud sobre el oportunismo en animales no humanos?. Así. quedándose el ¨dueño¨ del sitio de captura con su parte respectiva. La vida colonial puede tener diferentes aristas y producirse en arañas a las cuales tomaríamos como solitarias exitosas. hasta dejarla inmóvil. es decir. logrando la especie ¨oportunista¨ algunas presas obtenidas por una especie a la que aparentemente siguen para actuar en el momento oportuno. ¿Cómo se llega a una forma de organización social de esta naturaleza en un grupo de artrópodos constituido predominantemente por especies de hábitos solitarios muchos de los cuales han prescindido de las telas de araña llegando incluso a imitar la forma de heces de ave (olor incluido) con la finalidad de atraer sus presas? Preguntas como estas Darwin de alguna manera ya se las hizo. el significado del comportamiento adquieren una dimensión filogenética en el tiempo. Me refiero a la elaborada estrategia de ataque de arañas a hormigas soldado. luego la presa era transportada cooperativamente. cosa que no es de extrañarse cuando ciertas rutas sinápticas del cerebro establecen formas de razonamiento homólogos aunque entre ambas mentes exista un espacio temporal de mas de dos siglos. La otra acepción de Psicología Evolutiva entrelaza la teoría evolutiva y la Psicología Cognitiva con las que. la disputa fue intensa. El ataque era grupal y consistía en que cada individuo se trepaba rápidamente en el dorso e hincaba sus quelíceros (mandíbulas) en la parte posterior de la cabeza. la psicología evolutiva es entendida como "la evolución psíquica del ser humano. después de todo.De la Biología al Mito H. una de las cuales puede ser la colonialidad.

Dicho de otro modo es como poseer tres estadios cerebrales cada uno de los cuales posee manifestaciones propias en una gama tal que en cuestión de segundos. muy instintiva primero y de procesos emocionales y cognitivos mas complej os después. las acciones de solidaridad y voluntad mas nobles. Cerebros del pasado El cerebro como hemos visto en secciones anteriores. es aún una controversia. y una gran gama adicional desensaciones. por el Sistema Límbico y el externo por el Neocórtex. como en los Notocordad os (Gusanos bellota) hasta estructuras cerebrales tan complejas como el de un delfín. Sintéticamente. El lingüista Noam Chomsky (1986) arguye que todas las lenguas comparten ciertas propiedades fundamentales. la memoria. De esta especie de convivencia e interacción de tres subcomplejos cerebrales en uno. no por genes). el centro. así. Azurduy-Ferreira que se implican para resolverlos. las emociones. responsables por la adquisición y expresión del lenguaje. el amor. Dicha esquematización de nuestro cerebro evidencia diferentes fases de nuestra evolución. así. el gusto. En su seno se procesa el razonamiento. la superstición. en el primero se albergarían los instintos primitivos. un pulpo. funciones y capacidades cognitivas que no pretendemos desglosar. los sueños. el erotismo.De la Biología al Mito H. aquí Chomsky habla de una "gramática universal" que responde a módulos especializados u "órganos mentales". 131 . es una estructura que alberga y nos revela aspectos importantes de la evolución animal y va en dimensiones desde una diminuta dilatación de la médula espinal en su extremo anterior. en el segundo las emociones y en el tercero el razonamiento complejo. el deseo. Límbico como del Neocórtex y de cuya acción depende el los niveles y formas de expresión de los instintos primitivos. el remordimiento. Si esta hipotética arquitectura mental se fija y desarrolla por selección natural. recorre en el tiempo millones de años atrás hasta el origen de nuestros impulsos reptilianos. como los planes de destrucción y muerte mas siniestros que no tienen equivalente en otras especies biológicas. e l dinosaurio Troodon o el propio hombre. El cerebro humano a corte longitudinal podemos compararlo con un perfil geológico de tres estratos donde el superior es el más nuevo y el inferior el mas antiguos. un humano puede desplegar conductas equivalentes al ataque de un cocodrilo que degolla a un Ñu o la de un chimpancé macho que mata a crías de su misma especie. de modo que una acción de esta naturaleza. los olores. la parte mas interna está ocupada por el Complejo-R (Reptiliano). La acción represiva y de control sobre el Complejo-R vienen tanto del S. siempre latentes. Hoy en día el consenso general es que los humanos a diferencia de otras especies tienen una capacidad genética para el lenguaje (aunque el lenguaje hablado está determinado completamente por un aprendizaje social. se han generado en nuestra especie.

que están constituidos exclusivamente por hembras (cinegénesis) y que usan machos de otras especies para estimular su propia reproducción (especie unisexual). fue sorprendente. es que los huevos contenidos en el barro se enquistan. ¿Cómo pueden estos peces subsistir en una región donde los cuerpos de sufren una sequía estacional? La respuesta con que me encontré luego de indagar un poco. o el ramo de flores que un galán humano regala a su musa. El enquistamiento durará meses hasta las primeras lluvias que ablandarán el barro duro en el 132 . Otros. constituyen estrategias cuya finalidad es común y que son el producto del constructo cognitivo y genético desarrollado a lo largo de millones de años de evolución.De la Biología al Mito XVIII H. los organismos que se han adaptado a medios extremos en sequedad. Sabíamos que el tiempo de vida que les restaba era corto. han desarrollado estrategias o adaptaciones fascinantes que son las que determinan por hoy su éxito evolutivo. Las variaciones reproductivas son grandes en los diferentes grupos biológicos y los hay desde aquellos que para replicarse ¨inyectan subterfugiamente¨ su genoma a otro a quien usan como vehículo para producir copias de sí mismo (ejemplo: virus a las bacterias). es decir que su cubierta se endura formando una costra que posibilita mantener en estado de letargo al embrión que contiene. El sexo es una estrategia y un medio de multiplicación biológica. Estrategias que necesitan de machos y hembras por separado (doiocos) son las más caras energéticamente y las más ¨burocráticas¨ en su proceso. Los peces rivúlidos que viven en charcas temporales. Durante un viaje de prospección biológica a un punto del Parque Kaa-Iya y mas específicamente a una pequeña quebrada ya casi completamente seca. Azurduy-Ferreira ENTRE EL SEXO Y EL TABÚ Desde la dura tarea del escarabajo pelotero para obtener y transportar la bola mas grande de heces y así atraer a la hembra. En la naturaleza tiene diferentes connotaciones y su importancia en la perpetuación de las especies es determinante. a poco de desovar mueren. De este modo todos los adultos de la población perecen ante la ausencia de agua. Lo sorprendente aquí. Así. la danza prenupcial tan elaborada del ave del paraíso. El caso es que vimos en el recorrido una pequeña charca de no más de un metro de diámetro que llamaba mínimamente la atención. tal como se describió al hablar sobre en concepto de especie. hasta que removiendo el agua notamos la presencia de pequeños peces de la Familia Rivulidae (como el que aparece en la foto siguiente). el sexo como se cree generalmente ¨no siempre requiere de dos¨. no necesitan de un segundo y se reproducen a si mismos por gemación (como muchos protozoos) o hermafroditismo (organismos que poseen órganos masculinos y femeninos juntos). Los peces rivúlidos El Chaco es de los medios que por sus niveles de sequedad se constituye en uno de los más difíciles para el desarrollo de la vida. Existen especies como algunos peces.

tiene que exhibir ciertos rasgos como dimensiones de la cola. La ostentación de movimientos corporales como una forma o estrategia reproductiva se da desde insectos hasta aves. el pico. se debe en gran medida a la ¨decisión¨ de las mismas lo largo de la evolución de la especie y cuya preferencia o ¨gusto¨ hacia cierto tipo de formas y colores. etc. Este hecho que nos puede parecer tan simple ha tenido gran influencia en la evolución de ciertas formas y colores no solo en aves. Machos ¨a la carta¨. Esta adaptación reproductiva es la que le ha permitido a este grupo de peces el éxito evolutivo en ambientes xéricos (secos) como el Chaco. 133 . formas y colores bajo la decisión de las hembras Las variantes reproductivas pueden ser tan sorprendentes que llegan a requerir de intrincados factores o requisitos para su desarrollo. ha determinado muchas de las características de los machos que observamos hoy. estación del año. Así. como: determinados niveles de temperatura. Muchas aves en las que el macho difiere notoriamente de la hembra (dimorfismo sexual) tienen un patrón reproductivo en el que el macho que compite con otros. movimientos ritualísticos del cuerpo. El crecimiento de los renacuajos nacidos. es una carrera contra la desecación de la charca de modo puedan llegar a su edad reproductiva y así poder desovar asegurando la supervivencia de la población. intensidad y tamaño de manchas en las plumas. Azurduy-Ferreira que estaban enterrados y posibilitará su eclosión. tamaño de cornamentas. sino en muchos otros organismos. De modo que ciertas cualidades fenotípicas sumadas a la efectividad de los movimientos ritualísticos influyen en la selección de la hembra. intensidad de colores y tamaño de plumajes. muchas de las formas que vemos hoy. simplemente no tendrán el efecto esperado porque simplemente no llega a ser reconocido. etc. composición molecular de ciertos olores. Pez rivúlido del género Cynolebias colectado en un punto del Chaco cruceño. y que tienen que ser tan precisos que si rompen un determinado patrón de movimiento. como la presencia de penachos en aves macho o los llamativos colores que poseen y que contrastan notoriamente con las hembras.De la Biología al Mito H.

los tabúes. es una de las características que nos diferencia de otras especies animales. ¨los gustos¨ de uno de los sexos ha incidido en la forma del otro. simbólicos. anatómicos y fisiológicos desarrollados a lo largo de nuestra evolución que cabe mencionar. Azurduy-Ferreira Graficando el tema diríamos que en este caso. Para ejemplificar aquello acudimos a un fragmento de Harris (1989): ¨Los humanos son una de las especies más eróticas del mundo animal. pero los últimos son requisitos para el primero –exactamente lo opuesto a los ideales de la sociedad occidental¨. Nuestra especie emplea mucho más tiempo en el cortejo que precede a la cópula. Todos estaban de acuerdo en que el semen está finalmente almacenado en un depósito en la cabeza cuya capacidad es de veinte tolas (6.. verá la actividad sexual como una forma de liberación espiritual mientras que un hippie puede concebirla como una forma de protesta y un símbolo de paz en contra de la irracionalidad humana. La frecuencia de la cópula no es tan grande como 134 . Las sociedades humanas en su evolución han ido desarrollando y construyendo un conjunto de elementos conductuales. La muchacha mangayana recibe una demostración inmediata de virilidad y masculinidad sexuales como la primera prueba del deseo de su compañero por ella y como el reflejo de su propia deseabilidad.. puesto que todo orgasmo sexual significa la pérdida de una cantidad de semen laboriosamente formado¨. aunque al margen de aquellas que son eminentemente culturales exist en rasgos psicológicos. Un hindú. El afecto personal puede provenir o no de actos de intimidad sexual. entre ellos obviamente el sexo. y las sesiones de cópula duran más que en el resto de los primates.la intimidad sexual no se alcanza primero por el efecto personal. etc.8 onzas). más bien ocurre lo contrario. las tradiciones y la superstición que nuestra especie ha creado alrededor del sexo. El pene del hombre es más largo y grueso que el de cualquier otro primate y sus testículos los más pesados que los del gorila y el orangután. ¨Todo el mundo sabía que el semen no se podía encontrar fácilmente. La capacidad femenina para el orgasmo. está muy desarrollada. ¨Homo sexualis¨ El hombre es un organismo ritualístico en muchos de sus aspectos y al igual que otros animales despliega un conjunto de comportamientos cuya finalidad es de diverso orden. hace n falta cuarenta días y cuarenta gotas de sangre para hacer una gota de semen. El celibato era el primer requisito de la verdadera salud. los mitos. que d e acuerdo a determinados preceptos pueden diferir de una sociedad a otra. Así. iconográficos. Las formas de llegar al sexo entre los humanos puede n ser diversas. ideológicos. religiosos. aunque no exclusiva de los humanos como alguna vez se pensó. Los hindúes según Nag (1972) ven en el semen (como muchas otras sociedades) una fuente de fuerza que no debe malgastarse. De este modo las sociedades humanas pueden tener actitudes y percepciones diferentes respecto a la actividad sexual.De la Biología al Mito H. Marshall (1971) indica sobre los mangayanos de la Polinesia: ¨.

De la Biología al Mito

H. Azurduy-Ferreira

en los chimpancés, pero hay que tener en cuenta que los humanos se enfrentan
con el mayor número de restricciones a la sexualidad socialmente impuestas.
Dichas restricciones conducen a poluciones nocturnas características de los
machos –sueños húmedos- y una tasa de masturbación tanto masculinas como
femeni nas que solo son igualadas por los primates cautivos en los laboratorios o
en los zoológicos. La preocupación psicológica del macho humano por el sexo no
tiene paralelo en otras especies¨.
La homosexualidad : ante Dios, la sociedad y los genes
Una mañana en un programa televisivo, vi como un sacerdote católico, un evangelista
y un ciudadano discutían acerca del candente tema del momento: la concentración
masiva y marcha gay por las calles de Santa Cruz de la Sierra, acontecimiento inédito
y de seguro, un referente muy importante a tomar en cuenta a futuro por los
sociólogos. La discusión en esencia giró alrededor del grado de aceptación que deben
tener los homosexuales en la sociedad. Por supuesto, y como era de esperar, tanto el
sacerdote y el pastor evangelista condenaron a todo homosexual, por que según su
propia doctrina: “así lo mandan las escrituras”. Lo cierto es que más allá de
enunciados morales y reducir todo a un acto de pecado, en ningún momento se habló
sobre las razones o causas del homosexualismo, cosa que creo , no estaban con el ánimo
de analizar.
El comportamiento homosexual ocurre en casi todas las sociedades humanas,
las que frente al homosexualismo poseen diferentes posiciones, desde las más
liberales, hasta las más intolerantes y fundamentalistas. Paralelamente, la
“homosexualidad” es un comportamiento que también se manifiesta en animales no
humanos. Perkins y colbs. (1995) reportan comportamiento homosexual en ovejas en
una proporción del 8,5% (cercana a la proporción que se da en sociedades humanas),
ha sido también reportado comportamiento homosexual desde monos a insectos. Esto
quiere decir que la ¨homosexualidad¨ es un rasgo comportamental no exclusivo de la
especie humana. ¿Cómo aplicar entonces, el discurso freudiano a un escarabajo
homosexual? ¿Cuán pecadora es una oveja ¨homosexual¨ que nunca tuvo conciencia de
las leyes del hombre y sus dioses?
Es importante dejar establecido que estudios relacionados sobre el nivel
intelectual de personas homosexuales, han demostrado que poseen las mismas
capacidades y potencialidades para desenvolverse en cualquier área del conocimiento,
lo que descarta la creencia de que personas con esta condición son retrasadas,
anormales o enfermas.
Las investigaciones tendientes a indagar en la homosexualidad, fue
inicialmente de carácter puramente patológico, aunque los actuales investigadores,
tienden, a ver al homosexualismo como una parte de la variación en el comportamiento
y genética humanas. Las teorías psicológicas basadas mayormente en estudios de
psicoterapia atribuyen como causa, a la relación disfuncional del niño con sus padres;
como puede ser el caso de un padre emocionalmente distante o una madre
excesivamente dominante (Baron, 1999).
Haldeman (1991), afirma que es claro que los homo sexuales no escogen su
orientación sexual, es más, su orientación sexual aparentemente no puede ser
cambiada por psicoterapia u otra clase de intentos para alterarlo.
La otra respuesta alternativa para explicar la homosexualidad nació en el seno
de la genética, bajo la hipótesis de que la causa podía residir en factores

135

De la Biología al Mito

H. Azurduy-Ferreira

eminentemente hereditarios. Para ello se exploraron casos de gemelos idénticos bajo la
lógica suposición de que si eran factores genéticos los que intervenían en la
determinación de la homo sexualidad, entonces en ambos se tenía que manifestar el
rasgo. Bajo esta óptica Bailey y Pillard (1991) realizaron un estudio para determinar el
grado de concordancia de casos de homosexualidad en gemelos idénticos, gemelos no
idénticos y hermanos adoptados. Como ambos investigadores predijeron, la mayor
incidencia se dio en gemelos idénticos (52%), gemelos no idénticos (22%) y finalmente
adoptados (11%).
La evidencia mas fuerte y consistente en relación, a la hipótesis de que la
homosexualidad puede tener una causa genética proviene de un trabajo de Hamer et
al. (1993) quienes rastrearon la historia genética de la familia de un homosexual y
descubrieron una mayor incidencia relativa de homosexualidad entre la línea
proveniente de la madre que del padre, lo que sugería que el gen de la homosexualidad
podría encontrarse en el cromosoma X (el único cromosoma heredado exclusivamente
de la madre). Trabajos relacionados con genética del comportamiento como veremos
más adelante, tiene décadas de desarrollo lo que nos muestra que no es una idea tan
reciente. Experimentos fundamentalmente en moscas y ratones han sido realizados
para tratar de explicar por ejemplo la influencia genética en la agresión o el
alcoholismo. En este sentido, la variación genética y sus efectos en el comportamiento
individual y social tendr á que ser tomado en cuenta, por lo menos en aquellos casos en
los que el factor hereditario es evidente.
La reducción de este tema a un ámbito exclusivamente moral o religioso es
como indicar que si la ho mosexualidad está en los genes y los genes fueron
creados por Dios, entonces, Dios es el responsable del homosexualismo.

XIX

EVOLUCION MEMÉTICA O CULTURAL

"El hombre es una máquina de sobrevivir, un vehículo autómata programado a ciegas
con el fin de preservar las moléculas egoístas conocidas con el nombre de genes"
Dawkins (El gen egoísta)
Richard Dawkins se constituye en uno de los principales impulsores de la Sociobiología
(en sus trabajos y ensayos, es evidente la influencia de esta escuela). Al margen de
constituirse en uno de los defensores más fervientes de las ideas Darwinianas en la
actualidad , es uno de los evolucionistas mas prolíficos en obras divulgación científica
tales como : El gen egoísta, el Fenotipo extendido, El relojero ciego y Ríos fuera del
Edén.
Según Dawkins, nosotros existimos gracias a la necesidad que tienen los genes
de autopreservarse, por lo que ese instinto de autoconservación que todos los
organismos tienen no es que más que una de las estrategias que los mismos genes

136

De la Biología al Mito

H. Azurduy-Ferreira

poseen para persistir en el tiempo . El argumento dawkinsiano en esencia es sencillo: el
organismo individual es transitorio, el genotipo se desintegra en cada generación y
todo lo que subsiste de una generación a la siguiente es el gen. La manera en el que el
gen sobrevive consiste en formar réplicas. A mayor cantidad de réplicas, mayor
probabilidad tienen de sobrevivir. Como el organismo es la máquina que hace
sobrevivir a los genes, estos programan a la máquina para que produzca copias de sí
mismos con mayor celeridad, cualquiera que sea el costo personal.
Detrás de ese estilo particular que Dawkins tiene para explicar su teoría del
gen egoísta existe todo un planteamiento teórico y epistemológico que ayuda a
entender ciertos patrones sociobiológicos como el altruismo o la selección de linajes
vistos anteriormente.
Los memes
Al margen de lo anteriormente expuesto, Dawkins plantea además, un nuevo tipo de
substitución impulsada por factores culturales y fundamentada en determinados
patrones y/o unidades de información a los que denomina memes, estos, serían al igual
que los genes unidades autoreplicables y competitivas fijadas en el cerebro o en
productos fabricados artificialmente por ellos (libros, computadoras, etc.). Su
diseminación se produce de cerebro a cerebro, de un cerebro a un libro, de un libro a
un cerebro, de un cerebro a una computadora, de una computadora a otra y así hasta
el infinito. "Somos construidos como máquinas de genes y educados como máquinas de
memes", asevera Dawkins. Bajo este contexto podríamos pensar que muchos modelos
ideológicos (religión, evolución, economía, sociedad) vigentes actualmente, no serían
más que memes que se impusieron o que mantienen una pugna por imponerse y cuyo
crecimiento no es ni más ni menos como un árbol evolutivo.
La "evolución memética" que plantea Dawkins no deja ser una forma
metafórica de describir el desarrollo cultural del hombre y la diseminación de ideas,
ideologías, culturas, pensamientos, dogmas, etc. Aunque muchos memes ya han sido
establecidos para otros animales (mamíferos superiores fundamentalmente) desde el
momento mismo en que la acepción de cultura alcanza el aprendizaje social en otros
animales, son ejemplos extraordinarios las áreas culturales encontradas entre grupos
de chimpancés distribuidos en zonas geográficas diferentes y que se caracterizan por
poseer rasgos culturales que los diferencia en función al tipo de instrumento que han
aprendido a usar para conseguir alimento y que han sido transmitidos por aprendizaje
social de generación a generación; según esta última consideración, los chimpanc és
desarrollan tres formas de áreas culturales (descritos en Pelaez y Baró, 1997)
claramente definibles: (1) área cultural de los bastones, (2) área cultural de las hojas y
los tallos, y (3) área cultural de las piedras.

El caso de los ¨macacos japoneses¨
Un caso famoso de transmisi ón y fijaci ón cultural de un comportamiento, es el que unos
investigadores de manera accidental observaron en macacos japoneses, el caso fue que en una
isla japonesa se estaba estudiando aspectos demográficos y alimentarios de estos primates. Sin
mayores expectativas se decidió proporcionarles trigo, mismo que fue esparcido en la arena, es
obvio que la separación del grano de la arena, implicó una tediosa labor que estos primates
tuvieron que afrontar. Hasta que a una macaco hembra (a la que se llamó Imo) se le ocurrió

137

somos en gran medida lo que un determinado sistema social quiere que seamos.De la Biología al Mito H. religiosas. entonces: lo que llamamos educación. Un modelo memético simplificado puede ser como el se presenta abajo. Y es que todo organismo y teniendo en cuenta su complejidad. moral y ética. en un ejemplo más de la incorporación y transmisión de una tradición cultural (meme) en animales no humanos. ciencia que básicamente estudia la transmisión de unidades de información y los patrones implicados en el mismo. individuos. fue advertido por los macacos más jóvenes quienes comprendieron la importancia de dicho descubrimiento y siguieron el ejemplo de Imo. esta acción permitió que la arena se vaya al fondo mientras que los granos quedaron flotando permitiendo de esta forma su rápida separación. nuestro instinto es moldeado y esculpido de diferentes formas y bajo diferentes finalidades sociales. Los memes son estudiados por la memética. Azurduy-Ferreira tirar una mezcla de arena y granos al mar. ¿no serían simples formulas de autorepresión del instinto en pro de determinados prototipos de individuos que respondan a ciertos perfiles establecidos en diferentes momentos en la historia humana?. Siendo la cultura resultado de un diseño y una proyección humana que se transmite no genéticamente y que tiene la cualidad de direccionar. 138 . Este proceso de cribado. Así. Las flechas son la dirección de transmisión y los círculos. de modo que nuestras decisiones nacen de un estrato genético y cultural en cuyo grado y nivel de influencia puede intervenir un tercer elemento denominado voluntad . económicas o morales. Este modelo simplificado puede ser aplicado a cualquier acto de transmisión de una unidad de información cultural (meme). La generación siguiente de macacos continuaron con la utilización de dicho método y en la actualidad es una actividad rutinaria entre dichos pr imates. controlar o guiar la voluntad. constituyéndose de esta manera. al momento de nacer ya traen una información consigo (gene s) y una estructura neuronal (cerebro) dispuesto a recibir nueva información (memes) que se incorporará durante la ontogenia del individuo.

biológicos. que al anular en gran m edida los efectos de la selección natural por el desarrollo de sistemas artificiales o antroposistemas. nos iremos dando cuenta que nuestro universo para la voluntad como tal se va reduciendo considerablemente hasta algo tan minúsculo en el que cabe solo la duda. Aquí. y en verdad me vi en el gran dilema de incluirla o no como un acápite complementario del mismo. cabe preguntarnos si la voluntad no es más bien una forma consciente o inconsciente de ir en contra de una serie de esas decisiones albergadas en nuestros propios genes y que paradójicamente pueden impulsarnos a una especie de ¨masoquismo cotidiano¨. Siendo nuestro cuerpo un sistema susceptible de recibir estímulos y responderlos de acuerdo a sus atributos biológicos y cognitivos. nuestro ¨vivir¨ es una constante toma de decisiones y actitudes que pueden llegar a ser tan cotidianas. o de azúcar a nuestro café. de modo que antes de nacer. automáticas y rutinarias. al menos una vez en su vida¨ Descartes Lo expuesto hasta aquí me permite recordar una de las preguntas mas conflictivas en las que he estado enfrascado: Entre la influencia genética y cultural en nuestro comportamiento. Al respecto. 139 . Piaget o el mismo Freu d. Visto de este modo.De la Biología al Mito H. Lackan. Cosas tan simples como la cantidad de sal que aumentamos a nuestra sopa. que no han previsto respuestas. la gran variedad de anormalidades comportamentales que estimo supera en mucho a cualquier otro grupo biológico. ¿Cuál es el espacio real para la voluntad? Ésta. que perdemos conciencia sobre la razón de las mismas. etc. que nuevas formas de disfunciones y etotipos aberrantes vayan manifestándose en el futuro en Homo sapiens y para las cuales. pero que pese a todo lo hacemos a sabiendas de sus consecuencias. nuestro apego por lo dulce o lo salado pueden estar contenidos en una simple molécula contra la cual eventualmente tenemos que lidiar ya que producto de ¨sus impulsos eventualmente exagerados¨ nuestra propia salud puede verse afectada. Nuestra estructura biológica está predeterminada por los genes. religiosos. genéticos. Evolutivamente pienso que tal orden de cosas es entendible en una especie como la nuestra. pareciera una pregunta que en el contexto del presente libro no tendría sentido. muchas veces nos puede causar extrañez a las reincidencias en algo ¨no adecuado¨. están gobernados por nuestra constitución fisiología o costumbres culturales. Azurduy-Ferreira La voluntad. Esta especie de contradicción y tensión entre genes y voluntad se traduce en estados de ánimo y emociones a las que Freud calificaría como una confrontación entre el Ello y el Super Yo. ó el Neocortex cerebral versus el Complejo R. Así. ya existen una gran cantidad de decisiones tomadas y albergadas en una molécula de DNA cuya combinación resulta de tal entramado de posibilidades que nuestro nacimiento no es mas que un evento probabilístico en la gran lotería genética de la vida. Aunque luego de percibir el trasfondo biológico-cultural que dicha pregunta puede tener. Addler. una lotería cuyos números se vienen rifando y jugando desde hace millones de años atrás. nuestras luchas internas pueden ser contra los patron es codificantes de una parte de nuestro genoma. decidí incluir un extracto de ensayo que describo a continuación. Cabe preguntarnos entonces ¿qué grado de voluntad existe en ambos casos? Si hacemos un recuento de las decisiones y actitudes que están condicionadas ya sea por aspectos culturales. Es pues de prever. de ahí. estoy seguro. ha ido reteniendo o ¨reciclando¨ genes cuya acción etotípica anormal tiende a mantenerse y proliferar en las poblaciones humanas. ¿existe? ¨Todo hombre debería dudar de todo.

La direccionalidad que se le puede dar es incalculable para bien o para mal según se los conciba. queda ¨un tanto¨. sí. caso contrario puede ser objeto de la censura religiosa. ¿En qué grado somos n osotros mismos y no una simple abstracción o proyección genética o memética?. que generalmente es gobernada por la cultura o la religión. Esta especie de clonación memética es un procesos que se ha ido dando a lo largo de la evolución de las sociedades humanas las que han ido desarrollando sistemas de convivencia unas veces fundamentadas en drásticos y posesivos preceptos religiosos (fundamentalismo) en los que la voluntad individual posee límites definidos estrictamente en un sistema de adoración y un absoluto sometimiento espiritual en el que se concibe una forma de libertad que debe ser mantenida de una forma inmaculada y sin mancha alguna. la voluntad ronda de alguna manera en nuestra mente. en el caso de las sociedades liberales y económicamente desarrolladas. se pueden pasar la vida venerando a una piedra si en su religión (Sintoísmo) y teniendo una muerte de honor. venerando la Meca y si de paso aprovechamos para preguntarle a Alí qué significa para él la Meca. a los que por el momento desconoce. Desde la unión de un espermatozoide con un óvulo. ¿Qué efecto tendría la palabra Meca en un individuo sintoísta (que profesa el Sintoísmo)? ninguna. ¿Es la voluntad un objeto metafísico o una simple abstracción mental de un anhelo o deseo? 140 .. es decir instituciones extrabiológicas. que determinan una forma de desenvolvimiento en los que existen sensibles y complejos sistemas burocráticos de control impositivo. u otras. Aunque. Desde esta perspectiva sociológica y sin desconocer las posibilidades propias de la individualidad humana.De la Biología al Mito H. que tal si por un momento imaginariamente hacemos un enroque mental entre Ho y Alí? De pronto veremos a un individuo de rasgos asiáticos (Ho) confundido entre un grupo de barbados ataviados con sendos turbantes. existe un sistema de producción ávido de elementos humanos que deben mantener y alimentar el sistema. unas veces tratando de alcanzar un completo equilibrio espiritual como anhelo de vida. Cada uno. hasta el segundo previo a la muerte. de seguro nos mirará con indiferencia ya que en ese momento él no entiende cómo ese grupo de barbados. ¿Cómo tomar conciencia de la voluntad?. Los sistemas religiosos o económicos con un mejor control y manejo de las voluntades individuales muestran obviamente una mayor cohesividad y acción coordinada en diferentes niveles y aspectos de funcionamiento y reacción social. ¿Es la voluntad un resabio arquetípico o ancestral de nuestra forma de vida de cazadores recolectores que lidia en espacios mentales cada vez mas estrechos?. que se encargan de moldear prototipos sociales y espirituales a través de una sistemática incorporación de información extragenética (memes) que influirá en el individuo en sus actitudes. contribuyendo a óptimos y eficientes niveles de producción económica cuyos modos de incentivo mantienen un determinado ritmo competitivo ante otros semejantes. la combinación genética de dos seres que se unieron por azar. que como en el caso de las sociedades fundamentalistas está gobernada por un conjunto de códigos y preceptos si bien no religiosos. ¿Dónde comienza y termina realmente la voluntad?. cuyos matices coerciti vos pueden incluir la muerte. tanto el sintoísta al que llamaremos Ho como el musulmán que bautizaremos como Alí responden a preceptos religiosos fuertes que gobiernan sus decisiones y su forma de ver el mundo. Si bien en las sociedades fundamentalistas los clones meméticos están programados para adorar y defender con su vida la fe. convicciones y pensamiento futuros. veremos que sorprendentemente existen ciertos paralelismos que nos pueden hacer repensar esta aseveración. la voluntad puede ser ante todo una cualidad que en la evolución cultural del hombre ha sido el principal motivo para el establecimiento de determinadas reglas de juego colectivo. Esta visión que aparentemente tiene un enorme contraste con las sociedades llamadas liberales. el propio Alí puede llegar a ser venerado como una especie de semidios. Azurduy-Ferreira Si bien una buena parte de nuestro espectro de decisiones tienen un origen molecular.. sociales y económicos. o ¿que tal si le pedimos a un musulmán que deje de inclinarse en dirección a la Meca por una semana? Ni en broma.

ACTO OCTAVO ¿Genes o memes? .

una fundación física en el sistema nervioso y órganos de los sentidos.De la Biología al Mito XX H. etc. tiene a su vez un origen genético que lo determina y a partir del cual se estructura.) en cualquier organismo vivo. por ejemplo de la conservación. fue una de las claves para evidenciar los niveles de influencia o acción directa de lo genético sobre lo comportamental.. Ahora bien. del deseo. Los grandes avances de la genética y la biología molecular nos permitieron ¨fisgonear¨ con mucho mayor resolución en las intimidades de la molécula de la vida. de modo que en la cabeza de algún genetista pudieron haber rondado preguntas como: ¨si partimos del razonamiento de que el ambiente condiciona la manifestación de un determinado tipo de comportamiento. aunque algunos instintos sean mas poderosos que otros. ¿Cuánto de genético existe en nuestro comportamiento? Esta es una pregunta que puede traernos conflictos en relación a terminar viéndonos como marionetas manipuladas por moléculas. estructuras anatómicas. Históricamente esta fue una situación que despertó susceptibilidades morales y religiosas. de la venganza. aunque la tarea recién empieza. tener una mejor idea sobre sus ¨dominios¨. y de que todas las actividades mentales como la cognición y emoción tienen un factor causal estrictamente material. proteínas. ¿Por qué el hombre se arrepiente (aun en el caso que puedan tratar de ahuyentar los remordimientos) de haber cedido a un impulso con preferencia a otro. de modo tal que nuestro conocimiento respecto a descifrar códigos y mensajes que emanan de ella nos permiten hoy. El desarrollo de diseños experimentales adecuados. no basta esto para afirmar que los instintos sociales sean ordinariamente mas profundos o lo hayan llegado a ser por un hábito continuo en el hombre que los instintos. entonces porqué ratones que 142 . Azurduy-Ferreira DE LOS GENES A LA MENTE (complemento) “…debemos decir que. provocando actos correspondientes. 1998). toda fundación física (hormonas. y por qué siente a la par que ha de arrepentirse de su conducta?…” Darwin (El Origen del Hombre) El comportamiento es un fenómeno muy complejo que resulta de une serie de procesos cuyo entendimiento amerita un conocimiento profundo acerca de la naturaleza de los estímulos y la naturaleza de las respuestas. pueden ser afectados por lesiones físicas y otra clase de disfunciones cerebrales (Futuyma. esto es. aminoácidos. etc. Los psicólogos cognitivos usan la palabra mente para denotar las funciones de procesamiento de información del cerebro (Cosmides et al. Esta concepción del término denota la convicción casi universal que la “mente” no existe independientemente de la estructura física y actividad cerebral. 1992). La existencia de dicha fundación física es evidente a partir del hecho de que procesos cognitivos y emocionales de toda índole.

Si este rasgo comportamental puede ser transferido a otro linaje por cruces genéticos.De la Biología al Mito H. 3. implica la identificación de diferencias comportamentales entre razas genéticas de la misma especie o entre especies estrechamente relacionadas evolutivamente hablando (abordaje comparativo). que básicamente es el estudio de las causas genéticas y ambientales que determinan diferencias comportamentales entre organismos de la misma especie o de especies afines. Análisis genéticos del alelo mutante puede proporcionarnos una mejor comprensión del control genético de este gen sobre un determinado rasgo comportamental. En la segunda. está establecida. manifestando predisposiciones que pueden ser transmitidas a su descendencia determinando de esta manera linajes comportamentales diferenciales?¨ La gran controversia genes vs. Si organismos estrechamente relacionados viven en ambientes similares y sus necesidades de sobrevivencia son idénticas. Azurduy-Ferreira comparten el mismo ambiente. nace la genetica del comportamiento. La primera. En este contexto la Genética Comportamental se hace dos grandes cuestionamientos que a nuestro entender son importantes citar: • • ¿Cuánto es debido a genes y cuánto es debido al ambiente? ¿Cómo la herencia y el ambiente interactúan en la determinación de comportamientos? Bajo estas dos grandes cuestiones la Genética Comportamental ha definido tres grandes formas de abordar el estudio de comportamientos con bases genéticas: 1. y estudia los efectos de un solo gen (monogen) sobre determinados comportamientos. reaccionan de manera diferente a ciertos estímulos. El concepto reconoce la acción de otras fuerzas en la manifestación de un comportamiento al margen de los meramente ambientales y asigna una valoración importante a la relación filogenética de las especies (evolución). entonces cualquier diferencia comportamental puede deberse a diferencias genotípicas. 2. 143 . La genética del comportamiento a su vez ha ido estableciendo distintas especialidades o ramas de investigación en la medida en que se descubren comportamientos que están bajo un control genético parcial o total. La tercera es muy usada hoy en día. ambiente que floreció en los años 50s sirvió de estímulo para desarrollar una serie de investigaciones tendientes a indagar más sobre el tema. Este abordaje provee la información mas objetiva concerniente al rol de genes en el comportamiento. la influencia positiva del genotipo. Aunque un rasgo comportamental puede ser controlado por muchos genes o mutaciones en un solo gen que puede alterar el comportamiento. un rasgo comportamental es seleccionado de una población genéticamente heterogénea. Producto del establecimiento de este gran campo de investigación.

citado por Shermann (1999). Butterworth. Esta visión teleológica se contrapuso frontalmente a la de los conductistas (como Watson y Skinner) para quienes todo comportamiento es aprendido. aún fusionarse por un tiempo. como nuestra capacidad de diferenciar colores. todo comportamiento animal persigue un fin o propósito. Lorenz (1986) se cuestiona acerca de ello y demuestra cómo los funcionalistas (McDougall y Edward Chase Tolman) mostraban al instinto como un agente para el que no se requiere ni es aplicable una explicación natural. el mismo que esta determinado por su instinto extranatural e infalible. De forma casi desapercibida y mientras la mencionada confrontación se desarrollaba. Para McDougall (siguiendo al mismo Lorenz). sostiene el argumento d e que nuestra capacidad numérica es tan innata. lo que sucede es que los genes ejercen su influencia indirectamente a través de la influencia de reacciones químicas en el cerebro u otros órganos. esa era una época en la que el solo pensar que podría existir una relación entre genes y comportamiento era algo que rayaba en la locura. pero siempre vuelven a divergir. Charles Otis Withman y Oskar Heinroth describen la existencia de pautas motoras que como cualquier carácter morfológico tendrían un origen filogenético y estarían fijadas en el genotipo como producto de procesos selectivos dados en la evolución. Por cierto.De la Biología al Mito H. con una clara repercusión en ámbitos como la lingüística y la psicología cognitiva. Chomsky (1986) habla sobre estructuras cognitivas innatas cuya existencia demostrarían la existencia de algo que él denomina “gramática universal”. Lev Vigotsky (1896-1934) Psicólogo ruso afirmaba: “El pensamiento y lenguaje en su relación sufren muchos cambios y se ha establecido que sus cambios no son paralelos. pueden desenmarañarse y discurrir lado a lado. Sentada la posibilidad de que determinadas pautas motoras fueran de origen genético. especular y teorizar en el ámbito de la etología y la genética comportamental fundamentalmente. Esto se aplica tanto a la filogenia como a la ontogenia”. 144 . se comenzó a indagar. La visión darwiniana de lo instintivo y lo innato fueron tardíamente tomados en cuenta por la Psicología. Estas reacciones en determinados casos pueden depender de determinadas condiciones ambientales.¨ Mirando atrás Sir Francis Galton (1822-1911) hablaba del genio hereditario a principios de siglo. esta visión teleonómica marcó el inicio para que se asiente y defina una nueva escuela que conocemos como Etología Clásica. Ambas curvas de crecimiento se entrecruzan. Azurduy-Ferreira Aquí cabe citar una aseveración de Baron (1999): ¨Los genes no controlan directamente el comportamiento.

000 moscas. Lo cierto es que se llegó a determinar que en el comportamiento higiénico existía la interveneción de dos g enes. está constituido por 959 células somáticas. En 1964. r y u . Esta enfermedad. Finalmente transportan el material en el pico. éste no tendrá la capacidad de destapar celdas. mismos que indican una clara evidencia en favor de la suposición de que eran genes los que determinaban el comportamiento higiénico. mientras que aquellas colmenas en las que no existen obreras que manifiestan el comportamiento higiénico. se publican resultados sorprendentes sobre el cruce entre linajes resistentes y no resistent es. transportan material para construir un nido. pero tardan alrededor de tres años para perfeccionar este comportamiento y quedan trazas de la conducta de arrastre por tiempo indefinido. dado de que las progenies obtenidas muestran una heterogeneidad en el comportamiento. son neuronas. de transportar el material de ambas formas. Es así. 3 Experimentos relacionados con preferencia y aversión. R y U. mientras que sus genes dominantes. indujo 145 . ni de eliminar larvas infectadas. puede ser controlada por las abejas obreras de la colmena que manifiestan el comportamiento higiénico.De la Biología al Mito H. quien comenzó los estudios en esta especie desde 1968. 350 de las cuales aproximadamente. Entre sus características podemos mencionar que es un nemátodo que en adulto no pasa el 1 mm de largo. ha sido el foco para estudios de diverso orden entre ellos por supuesto. Los resultados del mismo indican que el geotropismo (positivo o negativo) en Drosophila esta controlado por poligenes (dos a mas genes que controlan un rasgo morfológico o comportamental). el primero determina la capacidad de r emover larvas y el segundo determina la capacidad de abrir celdillas. generalmente están infectados con Bacillus larvae. ejercen un efecto contrario. 5 Caenorhabditis elegans. destapará y eliminará. 4 Relación entre geotaxia y herencia fue demostrada a partir de un experimento en Drosophila realizado durante casi 30 años y que abarcaron mas de 500 generaciones y mas de 80. una bacteria que causa la “peste de abejas”. Dada su simplicidad. no evacuen a las larvas infectadas o viceversa. concluyen que las diferencias en los rasgos mencionados son atribuidas a diferencias genotípicas entre individuos. o tolerancia y suceptibilidad al alcohol en ratones y Drosophila (mosca de la fruta). otras especies acarrean el material en el pico. colocándolos bajo sus plumas. Sydney Brenner. destapará pero no eliminará. Colmenas en las que las obreras exhiben comportamiento higiénico son resistentes a la infección. 2 Los nidos de abejas. es un nemátodo (gusano) muy famosos en el ámbito de la genética y del que ya se posee el detalle de su genoma. el que tenga el genotipo Uurr. Azurduy-Ferreira Diez casos: 1 Los periquitos (Agapornis roseicollis) de Sudáfrica. aquellos relacionados con genética comportamental. que por ejemplo individuos con el genotipo UuRr. LoS híbridos se confunden y al principio tratan sin éxito. y el que tenga el genotipo uurr . el que posea el genotipo uuRr . eliminará larvas pero no destapará. que consiste en que las obreras abren las celdas y remueven a aquellas larvas que están infectadas y las evacuan de la colmena. como el hecho de que por ejemplo s existan híbridos que aunque manifiesten la capacidad de abrir celdas. son suceptibles a la enfermedad.

de poligenes que determinarían los mismos. la causa. n o p o demos olvidar la mutación que eventualmente pueden sufrir ciertas enzimas importantes en el accionar de los neurotransmisores. esta comprobado que tanto ezquizofrénicos c omo maníaco-depresivos poseen un componente genético que l os afecta. etc. termotaxias y comportamiento alimentario. caracterizado por cambios en la personalidad. 146 . evidencia la gran influencia de una mutación de un gen recesivo (que determina el color amarillo) en el muy elaborado y complejo ritual de cortejo en Drosophila. Desórdenes metabólicos de esta naturaleza se relacionan también con enfermedades como el síndrome de Lesh-Nyhan. Las anormalidades cromosómicas que desencadenan una serie de síndromes son también m u y conocidas (síndrome de Down. se han evidenciado u obtenido indicios en una serie de casos. es una anormalidad (mutación) genética que altera la estructura y funcionalidad de la cóclea y los canales semicirculares del oído interno. entre ellas son famosos los ratones waltzers (danzarines) que según evidencias arqueológicas llamaron la atención a los chinos 80 a. todo ello producto de la existencia de un extra trinucleótido –CAG. La enfermedad denominada como fenilcetonuria (PKU) es producida por un gen recesivo que determina una desmesurada producción de fenenilalanina (un aminoácido) que es incorporada en la sangre y que ocasiona un desarrollo anormal del cerebro. comportamiento agresivo. Este comportamiento mutante consiste en movimientos circulares continuos. como por ejemplo: la enfermedad de Huntington. iones de sodio y potasio se mueven a través de la membrana plasmática de la neurona.en el gen HD que desencadena procesos metabólicos anómalos. desórdenes físicos o psicológicos. acetilcolina. es decir en la eficiencia o deficiencia del movimiento ya sea de sodio o potasio. Klinefelter. que es producido por un gen recesivo. Por otro lado. es el caso de la enzima monoaminoxidasa la misma que es producida por un gen que al mutar determina un ineficiente funcionamiento de los n eurotransmisores (serotonina. cerca de una veintena de comportamientos mutantes. norepinefrina. hiperactividad y r etardo mental. 9 Pese a lo controversial que significa investigar sobre comportamientos con evidentes bases genéticas en el hombre.C.De la Biología al Mito H.). Azurduy-Ferreira diferentes mutaciones determinando la alteración de determinados patrones comportamentales. esquizofrenia. Turner. 6 Mutaciones comportamentales espontáneas o naturales han sido descritas en muchas especies. enfermedad de Tay -Sachs. Exper imentos en especímenes de Drosophila con anormalidades electrofisiológicas. de esta manera logró establecer feacientemente el origen genético de quimiotaxias. 7 En 1956 Margaret Bastock. GABA –Ácido gama amino butírico-. relacionados fundamentalmente c on ciertos así llamados. memoria. pérdida gradual de coordinación y degeneración progresiva del sistema nervioso. etc. dopamina. han demostrado la acción de genes en la generación y transmisión del impulso nervioso. lo que disminuye sus probabilidades de reproducción e implica una fuerte presión selectiva sobre los individuos mutantes. Aquí. La enfermedad de Alzheimer es provocada p o r u n g e n dominante que determina una acumulación anormal de polipéptidos aberrantes en el cerebro y que causa retardo mental en el que lo sufre.) que como sabemos están implicados en aspectos como el aprendizaje. ubicado en el cromosoma 15 y que determina una excesiva producción de lípidos en las células cerebrales que a su vez causan retardo mental en el individuo que lo produce. etc. 8 Durante el impulso nervioso. Hasta hoy se han detectado en los ratones. muchos investigadores hablan en estos casos. Sus observaciones indican que los poseedores del gen mutante alteran considerablemente su comportamiento durante el cortejo. movimientos de la cabeza de arriba hacia abajo e hiperirritabilidad.

1997) 147 . ha sido reportada en 1993 en una familia de holandeses poseedores de un gen defectuoso para una determinada enzima. para por ejemplo. Al respecto. La tendencia a la agresión producto de la herencia en humanos. dado el caso. S obre los ejemplos presentados ver para mayores detalles Klug y Cummings.De la Biología al Mito H. resultados estos. que concuerdan con otros realizados en ratones. determinaron que la agresividad en ratones se relacionan con un gen que produce óxido nítrico. sería interesante saber (no se sabe aun) la relación entre los niveles de este compuesto metabólico y la agresividad en el hombre. Azurduy-Ferreira 10 Solomon Snyder y colaboradores. elaborar inhibidores químicos en aquellos casos patológicos.

Ejemplos Bacterias (Escherichia coli) • Quimiotaxia Invertebrados • Mosca de la fruta (Drosophila melanogaster) Φ Fototaxia / Geotaxia Φ Ritmos circadianos (ritmos relacionados con los relojes biológicos) Φ Mutaciones neurogenéticas Φ Alcoholismo (tolerancia/suceptibilidad) • Abejas Φ Comportamiento higiénico • Nemátodos (Caenorhabditis elegans) Φ Comportamientos mutantes / Termotaxia. Variables • Cualquier rasgo “Mental” Φ Retardo mental Φ Inteligencia Φ Desórdenes afectivos Φ Comportamiento agresivo Φ Comunicación Φ Destrezas comunicativas • Cualquier aspecto implicado en una “Elección” Φ Preferencia alimentaria Φ Exhibición en el apareamiento Φ Quimiotaxias/Fototaxias (taxias en general) B. Azurduy-Ferreira SINOPSIS DE ALGUNAS VARIABLES Y EJEMPLOS DE ESTUDIOS EN GENETICA DEL COMPORTAMIENTO A. Vertebrados • Ratones Φ Aprendizaje Φ Nerviosismo (estudios sobre defecación) Φ Alcoholismo Φ Agresión Φ Comportamientos mutantes • Perros Φ Proyecto Genoma del perro • Humanos Φ Inteligencia ϖ Síndrome de Down ϖ Fenilcetonuria (PKU) ϖ Enfermedad de Tay Sachs ϖ Enfermedad de Alzheimer 148 .De la Biología al Mito H.

Azurduy-Ferreira ϖ Enfermedad de Huntington ϖ IQ (coeficiente intelectual) Φ Desórdenes de personalidad ϖ Esquizofrenia ϖ Depresión bipolar ϖ Alcoholismo ϖ Obsesión compulsiva ϖ Homosexualidad Φ Rasgos de personalidad ϖ Extroversión/ Introversión ϖ Personalidad Tipo A ϖ Neurotismo Φ Ritmos circadianos 149 .De la Biología al Mito H.

ACTO NOVENO El ocaso .

aseveraríamos con seguridad de que se trata de algún punto de la Tierra.De la Biología al Mito H. Si quitamos los recuadros en blanco: 151 . Azurduy-Ferreira Iconografía de un paisaje que visto así. aunque fragmentario. nos es familiar y mínimamente al menos.

Azurduy-Ferreira La misma iconografía se complementa con elementos biológicos que podemos ver como discordantes. (En la foto: Dinofauna Australiana) 152 . nuestro arribo a este planeta es muy reciente y mas de 65 millones de años después de que los dinosaurios . extraños o ajenos a nuestra cotidianidad y universo de percepciones. seres que nunca existieron. cuya trayectoria las vemos como una secuencia de sucesos unas veces exitosas en el tiempo y otras trucas en su carrera biológica. etc. las extinciones han sido eventos que en la historia geológica han definido rupturas de continuidad evolutiva en muchos grupos biológicos. Unos verían monstruos. que vemos representados. raros.De la Biología al Mito H. se extinguen. Si podemos notar en la iconografía nosotros no estamos incluidos y no es casualidad ya que tal como hemos venido esgrimiendo. enormes bestias. Así.

trascendentes e importantes en nuestro rol como especie biológica. casi inevitable. última gran extinción en la historia geológica de este planeta. haciendo alusión a la así considerada. de la producción de formas nuevas. que como hemos visto (gracias al registro fósil) posee una historia que nos revela eventos críticos suscitados millones de años previos a nuestro origen y ante los cuales. heredada de un antepasado común. aunque con factores que no intervinieron en las anteriores grandes extinciones (de ello ya hablaremos mas adelante). Darwin escribió en El Origen de las Especies: “La extinción de las formas antiguas es la consecuencia. Sobre el término extinción biológica pueden haber dos grandes acepciones: (1) Proceso de eliminación como en el caso de los genotipos menos aptos y (2) desaparición de una especie o taxón de un hábitat o biota dada. pues el proceso de modificación es necesariamente lento. cuya trayectoria e historia en un contexto cultural. Entender no solo sus causas sino también sus consecuencias en el equilibrio y funcionamiento de la biosfera (de la que el hombre. pues se ha roto el eslabón de las generaciones”. que forman nuevos grupos y subgrupos. jamás reaparece. tienden a dejar muchos descendientes modificados. tienden a extinguirse a un tiempo y a no dejar ningún descendiente modificado sobre la superficie de la tierra. El último li bro de Richard Leakey (paleoantropólogo keniata) aparece con el muy sugestivo título: The Sixth Extinction. Podemos comprender por qué cuando una especie ha desaparecido. por la supervivencia de unos pocos descendientes que prolongan su existencia en localidades protegidas y aisladas. Las especies predominantes. Un entorno . las especies de los grupos menos vigorosos. deberíamos cuestionarnos al menos sobre las lecciones que podríamos extraer respecto a la valoración y modo de administración actual del medio y la vida contenida en él. nunca reaparece. Lo cierto es que la misma no la tenemos que ver muy lejos en el tiempo pasado ya que la seguimos viviendo en la actualidad. sin excluir una eventual colonización posterior proveniente de otros lugares. Cuando un grupo ha desaparecido por completo.De la Biología al Mito XXI H. pero la extinción completa de un grupo entero de especies ha sido a veces un proceso lento. y depende de muchas circunstancias complejas. que pertenecen a grupos grandes. debido a su inferioridad. nos hace prever circunstancias no muy alentadoras para ella misma y su entorno. Cuando éstos se forman. Azurduy-Ferreira EXTINCION BIOLOGICA La desaparición de una especie del espectro biológico de este planeta tiene diversos significados e interpretaciones para la cultura y la ciencia. Los grupos de especies aumentan lentamente en número y resisten durante periodos desiguales de tiempo. 153 . en una de las tareas más complejas. con todas sus peculiaridades es parte) se constituye hoy en día.

se habrá dado con uno de los grandes ejemplos de conservación biológica. El Arca de Noé y el gran diluvio es uno de esos casos y aunque se ha argumentado científicamente la imposibilidad lógica de que en el mismo hayan cabido al menos.De la Biología al Mito H. aunque sabemos que hubieron especies de dinosaurios del tamaño de una gallina actual. el indicador básico de información ha sido la diversidad del registro fósil a lo largo del tiempo. aseveraciones creacionistas insisten. Mientras que dicho 99% representa la astronómica cifra de más de 2 billones de especies. y en la que una especie (Homo sapiens) es uno de los factores causales más importantes. 5 millones de especies aunque estimaciones teóricas hablan de 29. a raíz de lo cual y desde lo que de ha venido en denominar ¨creacionismo científico¨ surgen un conjunto de explicaciones que caen en un plano especulativo tal. más del 50% de las especies susceptibles de perecer en un evento catastr ófico de esta naturaleza. en aspectos como la coexistencia entre dinosaurios y el hombre (no reflejadas precisamente en la Biblia). Azurduy-Ferreira Extinción Biológica y el Mito del Arca Finalizada una conferencia. según el registro fósil nos muestra 5 grandes extinciones en masa a lo largo de 570 millones de años en las que se extinguieron más del 99% de las especies originadas en este planeta. sino. Para rastrear los eventos de extinción en el pasado. por qué pensaba que el Arca de Noé era un mito. la respuesta a la misma es la razón de este paréntesis La historia geológica. se tornan ¨incómodos¨ cuando existen pretensiones y esfuerzos innecesarios. esto es en palabras simples. reconocen una Sexta Gran Extinción que estaría ocurriendo hoy. La existencia del Arca como tal es un asunto aún en discusión y es algo que dejamos a los arqueólogos. y aquí no interesa si fueron 10 o 10. el esfuerzo de una familia y un hombre. Nuestro conocimiento sobre la diversidad biológica actual cubre alrededor de 1. o declaraciones que afirman que ¨si los dinosaurios se extinguieron fue por que no pudieron caber en el arca por su gran tamaño¨. el número de especies actual. se constituiría en uno de los primeros hombres que intentó un acto de conservaci ón ante un poder de destrucción. aunque si se lleg a a evidenciar la existencia de este mítico vehículo. una asistente me preguntó. que causan confusión por sus argumentos generalmente sofistas. familias u órdenes existentes en determinados periodos geológicos. aunque. resultado de este trabajo es factible obtener diversos patrones de origen y extinción como el ejemplo simplificado que vemos a continuación. Noé. tratan de dar una salida afirmando que los dinosaurios fueron conservados en estadios de huevo y de los que se habrían colectado un par de cada especie. La sumatoria de lo conocido y de lo que restaría por conocer (30 millones de especies) es lo que no cubre ni el 1% de la diversidad que se ha producido desde que la vida se originara en este planeta (el fósil más antiguo data de hace 3600 millones de años). que dado el caso. 154 . no llega ni al 1% de la biodiversidad histórica de La Tierra. ¿cómo supieron distinguir los sexos en estadios embrionarios primarios sin que medien pruebas genéticas previas? o ¿cómo resolvieron los casos de viviparidad según se desprende de investigaciones últimas? etc.000 especies las que se intentó salvar. aunque algunos científicos tal como indicamos anteriormente. 5 millones de especies que quedarían por descubrir. El conocimiento paleontológico y el biológico actual (ciencia). contar el número de especies fósiles. de hacer un paralelismo con las escrituras bíblicas (fe). Otras aseveraciones creacionistas que contradicen a la primera.

1966). sufre una gran crisis durante el Triásico.De la Biología al Mito H. plesiosaurios. etc. diversificación y extinción en dos grupos de vertebrados (modificado de Simpson. En el primer caso vemos que los más antiguos placodermos provienen del Silúrico. serpientes. aunque como vemos en el gráfico. La figura precedente representa la progresión en la diversidad biológica de dos grupos: peces placodermos (Clase de peces extinta. lagartos. El segundo caso (los reptiles) y siguiendo el registro fósil. cuyo evidente rasgo morfológico eran sus fuertes placas dérmicas) y los reptiles (dinosaurios. ictiosaurios. Pese a dicha constricción en su diversidad. Azurduy-Ferreira HOY RECIENTE TERCIARIO Extinción de los dinosaurios CRETACICO JURASICO TRIASICO Reptiles Periodos de diversificación Periodos de extinción PERMICO PENSILVANIANO Periodos de origen MISISIPIANO DEVONICO SILURICO ORDOVICICO CAMBRICO Placodermos Eventos de origen. pterosaurios.). se evidencia su origen en el Pensilvaniano a partir de donde se diversifica. vuelven a diversificarse en gran parte del Jurásico y Cretácico aunque al finalizar este último periodo una gran extinción se produce reduciendo gran parte de su diversidad de la que fueron parte los dinosaurios. etc. tortugas. fueron más diversos en el pasado. hoy extintos. los reptiles como taxón persisten en nuestros días. a tal punto de ser el grupo dominante 155 . prosperan en la transición hacia el Devónico y se extinguen paulatinamente al finalizar dicho periodo.

Azurduy-Ferreira en el Mesozoico (65 a 225 millones de años). focas y leones marinos (mamíferos). primeros vertebrados con mandíbulas. que se constituyeron en una novedad e innovación adaptativa que determinó su radiación en el Devónico y consecuente desplazamiento de muchos ostracodermos. Sin embargo especies y géneros (así como familias y órdenes) que entonces fueron dominantes. La competencia. mientras que ictiosaurios y mesosaurios (reptiles) fueron reemplazados por delfines. La clase de cambios ambientales implicados p uede ser extremadamente heterogéneos y la inhabilidad de los organismos para una apropiada respuesta adaptativa es también un problema complejo .De la Biología al Mito H. Ecología y extinciones Aunque todos los organismos vivientes representan a un linaje evolutivo continuo que se extiende en el tiempo. moluscos cefalópodos han sido suplantados por peces teleosteos. el caso de la dieta podríamos tomarlo como ejemplo. que requiere de un cambio adaptativo que ante la imposibilidad de realizarlo lo lleva a la extinción. aparentemente por drásticos cambios ambientales. pueden ser causa de extinciones. dinosaurios y otros grupos de reptiles fueron reemplazados por aves y mamíferos. Estas fluctuaciones de diversidad se repitió y afecto de diferente manera al desarrollo y evolución de la vida. una consecuencia de ello fue su reemplazo por parte de nuevos linajes (reemplazo ecológico). aunque el registro fósil cataloga episodios ocasionales (como las cinco grandes extinciones que describiremos mas adelante) en los que gran parte de la biota fue afectada. Estudios ecológicos en poblacione s actuales demuestran que la destrucción del hábitat es de lejos. Si el crecimiento poblacional (demografía) se torna negativo producto de la persistente 156 . En este contexto los biólogos estamos de acuerdo en que la eventual imposibilidad de adaptación a cambios en el ambiente. la más frecuente causa de extinción y son menores los ejemplos existentes respecto a extinciones provocadas por la introducción de predadores o enfermedades. Simpson habla de la integración organismo-ambiente. ballenas. Fue el caso de los ostracodermos (peces sin mandíbula ya extintos) que se alimentaban de sedimentos (sedimentívoros) y que empezaron a declinar durante el Devónico con la aparición de los placodermos. es otro factor a considerar pues la misma puede determinar el desplazamiento de un grupo (desplazamiento ecológico) por otro que resultó el “triunfador” de la disputa por el espacio y recursos producto de determinadas ventajas evolutivas traducidas generalmente en estructuras adaptativas novedosas y más eficientes para la explotación de los recursos por los que se compite. mientras que helechos y gimnospermas fueron en gran medida suplantados por angiospermas. estructuras estas. de modo tal que hoy tenemos en nuestro entorno muchos de estos organismos que continúan en esta carrera evolutiva iniciada en muchos de ellos hace más de 500 millones de años y que como en los caracoles podemos verlos en nuestro jardín. los relacionados con competencia interespecífica. el último evento de toda especie es la extinción. Por ejemplo en tierra. Un factor de importancia primaria e s la especificidad de adaptación. y menores aún. tiene mayores posibilidades de sobrevivir. hasta el origen mismo de la vida. que otra que depende exclusivamente de una clase o tipo alimentario (sobreespecialización). G. Hábitats tanto terrestres como acuáticos fueron ocupados por una biota muy diversa que formó comunidades ecológicas complejas. En los océanos. Extinciones han ocurrido a través de toda la historia de la vida. G. han sido eliminados o drásticamente reducidos por extinción. Una especie que puede vivir con un espectro alimentario amplio .

Devónico tardío. la extinción puede ser evitada solo si las especies cambian su distribución geográfica a través de la colonizac ión de lugares más favorables. ó. Schopf. Steven Stanley. pero en general (considerando a otros organismos) hay poca evidencia que las especies cambien su distribución geográfica como una respuesta inmediata a cambios como los relacionados con alteraciones de hábitat o la incursión de nuevos predadores y competidores. Extinciones en masa Se ha mencionado que ha lo largo de toda la historia de la vida se han producido extinciones según las evidencias provenientes del registro fósil. 157 . Thomas J. David Jablonski. podemos recurrir a un gráfico modificado de Jack Sepkoski (1984) que trabajó junto a otros famosos paleontólogos como David Raup. que nos muestra cinco grandes eventos de extinción que se distinguen notoriamente de otros menores y que se han convenido en denominar extinciones en masa.De la Biología al Mito H. y durante la transición del Cretácico al Terciario. Azurduy-Ferreira deterioración del medio. transición Pérmico al Triásico. sino también de tratar de entender las causas de las fluctuaciones en la diversidad (extinciones) y los mecanismos que intervinieron en ellas. si se adaptan por cambios genéticos que mejoren suficientemente la progenie para reestablecer el crecimiento poblacional positivo. Luis Alvarez y el mismo Stephen Jay Gould quienes se dieron a la colosal labor no solo de cuantificar la diversidad del registro fósil en los diferentes periodos de la historia geológica. Daniel Simberloff. y que han sido registradas en periodos como el Ordovícico. Para entender mejor la idea. fin del Triásico. Emigraciones masivas de larga distancia en respuesta a la falta de recursos alimentarios es a veces visto en ciertos mamíferos y aves.

Nótese las coincidencias en las grandes crisis para los tres grupos biológicos fundamentalmente a fines del Paleozoico y fines del Mesozoico. Las líneas describen fluctuaciones en los niveles de diversidad biológica. Vertebrados e Invertebrados según el registro fósil. momentos en los cuales se registran inflexiones de diversidad notables producto de eventos de extinción globales en el planeta. Azurduy-Ferreira Periodos críticos de extinción en Plantas. Modificado de Taquet (1993b). 158 . según ascensos (periodos de diversificación) o descensos (periodos de extinción).De la Biología al Mito H. (La figura siguiente es una relación de extinciones combinada y que incluye o suma tanto plantas como animales).

Fin del Cretácico 2. en la que se dio la primera gran explosión faunística de invertebrados. entre ellas la diversificación del Vediano (V ) – Cámbrico (e). De esta manera muchos factores pudieron haber actuado juntos y haber causado por ejemplo la caída en el nivel del mar (regresión). Evento de Extinción 1. 1995). debido en parte a los cambios en la configuración de las masas continentales (recordemos la dinámica interna de este planeta). Nótese también los periodos de radiación. muchos factores han sido considerados como posibles. Fin del Pérmico 4. A continuación damos una relación de la proporción de familias.De la Biología al Mito H. este tipo de eventos acompañaron 159 . años) 65 208 245 367 439 Familias (%) 16 22 51 22 26 Géneros (%) 47 53 82 57 60 Especies (%) 76 ± 5 82 96 85 85 ± 3 En relación a las causas para las extinciones en masa. Fin del Triásico 3. reducen especialmente las áreas epicontinentales marinas poco profundas. es pues la mayor extinción en masa que se ha dado en este planeta. Nótese el efecto de la gran extinción permotriásica en la diversidad. Azurduy-Ferreira 900 N° Familias Radiación en el Mesozoico = Extinción en masa Radiación ordovícica 600 300 Radiación V. Fin del Ordovícico Edad (mill. Regresiones del nivel del mar. Devónico tardío 5. entre los mas aceptados están los cambios en el clima y/o el nivel del mar. esta. que implicaron una gran diversificación de la biota. géneros y especies extinguidas durante los cinco grandes eventos de extinción (de Jablonski.e 0 V e ? 600 S D C P 400 TR J K T 200 0 Tiempo geológico (Millones de años) “Momentos” en los que se dieron las cinco grandes extinciones en masa y su efecto en la diversidad de familias en la historia geológica.

un físico americano. lo que a su vez determinó el oscurecimiento del planeta y una baja paulatina en la temperatura. Azurduy-Ferreira a cada una de las cinco extinciones. La causa por la que los dinosaurios se extinguieron Las extinciones en masa cobraron gran vigencia científica cuando en 1980. aunque el estudio e investigación de un conjunto de evidencias desperdigadas en la corteza terrestre o en el Cosmos son las que generalmente quitan el sueño a quienes buscan respuestas de esta naturaleza. Walter Alvarez. F. V. usando lógicamente. Lo que sucede con este metal es que fue parte importante en las 160 . Sin embargo no todas las regresiones han sido acompañadas de tasas elevadas de extinción. en el incremento de las tasas de extinción. Para su sorpresa en una muestra proveniente de sedimentos que marcan el fin del Cretácico encontraron niveles inusualmente altos de un metal no reactivo y pesado llamado iridio. La hipótesis del gran impacto esta soportado por anomalías químicas y minerales encontradas en delgadas capas sedimentarias que separan el Cretácico del Terciario. Al respecto.De la Biología al Mito H. lo que sucedió en realidad (como muchas de esas anécdotas en ciencia) fue de que Luis Alvarez. Michel. Luis Alvarez. métodos químicos. En dicha publicación Luis Alvarez y sus colaboradores sugieren que la e xtinción de fines del Cretácico fue consecuencia del impacto de un cuerpo extraterrestre (un asteroide o gran meteoro) que se estrelló contra la tierra con una fuerza lo suficientemente fuerte como para que todo un manto de polvo sea arrojado a la atmósfera. y su equipo de trabajo se encontraban trabajando en la medición de tasas de deposición en varias formaciones sedimentarias. Asaro y H. afectando obviamente al funcionamiento de la cadena alimenticia e influyendo a su vez. publican en Science un artículo titulado: Extraterrestrial cause for the Cretaceous-Tertiary extinción (Causas extraterrestres para la extinción del Cretácico-Terciario). De una capa de Iridio al último dinosaurio Las extinciones producidas en la historia geológica pueden ser sujetas de diversas explicaciones. Esta situación impidió que el fitoplancton marino pueda desarrollar procesos de fotosíntesis normal.

tigres dientes de sable. al margen del proporcionado por Alvarez y su equipo. lo que causó la deposición de dicho mineral y la gran extinción de fines del Cretácico. se determinó que el meteorito medía mas de 11 Km de diámetro y que era billones de veces mas potente que la bomba atómica de Hiroshima. capacidad de un lenguaje característico y razonamiento abstracto con cualidades propias. se descubrió un colosal cráter (el famoso Chicxulub) en la Península de Yucatán que data justamente de hace 65 millones de años (edad del gran impacto). Pasados diez años del anuncio de Alvarez y colaboradores. y muchos otros. animales pequeños y plantas que habrán sido 161 .000 años. por ello hoy en día es muy raro poder encontrarlo en la corteza terrestre. ciertas cosas comenzaron a cambiar en el sistema. y de otras formas de vida. modificación en la estructura de manos y pies. microbios. Si las extinciones en masa fueron realmente periódicas es un problema aún sin resolver. este gran indicio evidencia que el meteorito cayó en dicha región y acompañado además de fragmentos de asteroides que produjeron otros cráteres menores al gran Chicxulub. bisontes gigantes. cóndores gigantes. Basados en mediciones del iridio presente. Hace 12. incluyendo.De la Biología al Mito H. Azurduy-Ferreira primeras fases de la formación de este planeta y cuando las rocas eran literalmente fundidas y eran incorporadas al interior del planeta. Hoy en día. de modo que desde su perspectiva la sexta extinción es algo que se está produciendo ahora. La sexta gran extinción Producido el “arribo” del hombre en este planeta. el acuerdo es generalizado entre los paleontólogos en sentido de que el impacto ocasionó la extinción del último dinosaurio. En todo caso no existe otra evidencia de extinción en masa por impacto de un cuerpo extraterrestre. Este. estaba dotado evolutivamente de un andar bípedo. Este recién llegado que irrumpe en el último segundo de la historia geológica. ello al margen de la capacidad de impactar de manera dramática a la diversidad. De esta manera y luego de varias mediciones e indagaciones en sedimentos de varias partes del mundo que marcan la frontera entre estratos geológicos Cretácicos y Terciarios. coincidiendo con la migración humana desde el Noreste de Asia hacia América vía Estrecho de Bering. Similares extinciones de grandes vertebrados ocurrieron luego de que el hombre colonizara regiones como Madagascar. rinocerontes lanudos. Nueva Zelanda y Australia. los humanos han causado la extinción de miles de especies. fueron enteramente extinguidos. aunque sí es un mineral importante en la composición de los meteoritos. es el único caso en toda la historia geológica. llegaron a la conclusión de que fue la colisión de un meteorito con nuestro planeta. Una pregunta controversial es si los eventos de extinción en masa en el Fanerozoico ocurrieron con una periodicidad regular. en el que una sola especie a decir de Leakey y Lewin (1995) causa una extinción en masa. producto de un ciclo astronómico aún desconocido. megaterios. Extinciones recientes En los últimos 200 últimos años. mamuts. la fauna pleistocénica de grandes mamíferos y aves como caballos. cerebración considerable en relación a otros animales.

Como estas aves viajaban en densas bandadas y anidaban en enormes congregaciones. El cuestionamiento en este sentido es cuanto tiempo mas C.De la Biología al Mito H. ¨castaña americana¨ (Castanea dentata). Antes de 1900. pueden ser aún encontrados pequeños árboles dispersos que han retoñado de raíces que han logrado sobrevivir. + Uno de los mejores casos documentados de extinciones locales recientes es el que se estudió en la Isla de Barro Colorado en Panamá. el número de especies que han desaparecido es de 50. dentata pero menos suceptibles. Durante la construcción del canal de Panamá. Algunos ejemplos de extinciones recientes bien documentados son los que describimos a continuación. pero desafortunadamente la enfermedad los mata antes de que lleguen. aunque posteriormente (1982) se estableció que desde que Barro Colorado fue convertido en Isla. En 1890 las palomas virtualmente desaparecieron y en 1914 la última paloma mensajera murió en el Zoológico de Cincinnati. Otras extinciones recientes Especie Capra pyrenaica pirenaica Cervus schomburki Equus quagga quagga Discoglossus nigriventer Uperoleia marmorata Geografía Europa Tailandia Sudáfrica Palestina Australia Año de Extinción 2000 1932 1883 1955 1841 Nombre común Cabra montés. el Río Chagres fue represado por lo que las aguas del lago Gatun inundaron las áreas adyacentes creando lo que hoy conocemos como Barro Colorado. la isla no existía y era solamente un cerro en el paisaje del terreno del bosque tropical panameño. Estimaciones del tamaño de la población indican que fueron billones. + En el caso de plantas podemos mencionar e l gran daño sufrido por la así denominada. Usando los datos de monitoreo de biodiversidad realizado a lo largo de muchos años se determinó (en 1974) de manera un tanto conservadora que 17 especies de aves se habían extinguido. En algunas áreas. Producto del seguimiento y monitoreo realizado por el Smithsonian Institution que instaló una estación biológica en el lugar. Azurduy-Ferreira extinguidas sin que siquiera lleguemos a tener conciencia de ellos. La enfermedad producida por este hongo se expandió rápidamente y en 40 años y C. vamos a decirlo así. una isla de 16 km². y 100 barriles de palomas por día podían ser enviados a la ciudad de Nueva York. la biota de Barro Colorado es bien conocida y algunas de las extinciones ocurridas están bien documentadas. ellas fueron muy vulnerables a los humanos. dentata evadirá su extinción absoluta. 2000 a 3000 palomas eran a menudo atrapadas con una sola red y en un solo día. En los 1870s. donde ataca a especies afines a C. En 1904 un hongo patógeno (Endothia parasitica) fue accidentalmente introducida aparentemente desde Asia. a la edad reproductiva. A pesar de su tamaño relativamente grande no pudo contener por mucho tiempo muchas de sus especies de aves originales. especie esta que fue muy abundante en la región oriental de Norte América. dentata fue virtualmente eliminada de su amplio rango de distribución. + La paloma mensajera (Ectopistes migratorius) fue increíblemente abundante en el Este de Norteamérica cuando el primer colono europeo arribó. bucardo Ciervo Quagga Rana Rana 162 .

estos extraños visitantes emitían sonidos raros y fuertes que no se podían entender. Entonces vio como lo observaban y gesticulaban sonidos fuertes que se asemejaban a crujido de ramas. pero no retrocedió pensando en que así como él quería verlos de cerca lo mismo sucedía con ellos.De la Biología al Mito H. se dedicaba a alimentarse y recorrer eso que él entendía era su hogar. tenían al cuerpo cubierto por cosas que en nada parecían plumas. a la luz del sol. Azurduy-Ferreira El dodo habitaba en una isla donde no conocía enemigo alguno. Desde una distancia prudente observó como sacaban enormes cosas desde esas estructuras gigantes que flotaban sobre el mar y las trasladaban a la playa donde eran amontonadas. El último canto del Dodo (Narración) 163 . aún así siguió avanzando. en ese momento pretendió cantar. se desplazaban en dos patas. Entonces con la lógica de no conocer enemigos se acercó a darles la bienvenida a su hogar y a ver de cerca esas cosas raras que descargaban constantemente. por ello no desarrolló la aptitud de volar. hasta que se ubicó muy cerca de ellos. a los pocos momentos se dio cuenta cómo uno de ellos se acercaba considerablemente y de manera muy lenta. llegó a ver sus ojos muy cerca y en ellos observó algo que desconocía. sacaba algo brillante que emitía centelleos de luce s que incluso molestaron su vista. Hasta que un día observó cómo unos seres extraños arribaban en estructuras gigantescas de las cuales descendían en grandes cantidades. cada vez que avanzaba se daba cuenta cuan grandes eran. éstos seres eran enormes. pero su voz se ahogó sintiendo ese algo brillante incrustado en su ser y el rostro que veía. vio que uno de ellos se percató de su presencia y dejó de hacer lo que estaba haciendo. se desplazó hasta el claro de la playa donde quedó expuesto a la vista de Redescubierta los recién llegados. Para él todos eran amigos. se tiñó de rojo. vio como de un costado el extraño ser. De forma un tanto dubitativa.

aunque quedan evidencias pictóricas de algunos especímenes que fueron llevados a Europa como una novedad exótica. es decir. En las pinturas generalmente aparece un Dodo gordo. Para salvar a esta especie se tuvo que experimentar con una serie de aves un tanto parecidas en hábitos alimentarios hasta que se tuvo éxito con los pavos. Su existencia real es aún un misterio) y la Isla Rodriguez en la que habitó Pezophaps solitaria (la especie de dodo más grande. los que hoy en día son utilizados como dispersores de semilla de Calvaria. Posteriormente llegaron los holandeses (1598) quienes instalaron una colonia penal. año en el que se supone. monos. Si no fuera el accionar de estas instituciones. La Isla Mauricio fue invadida por los portugueses en 1505. sino también introdujeron cerdos. en sentido de que el dodo era la única especie en la isla capaz de dispersar un árbol denominado Calvaria. rechoncho y obeso. Azurduy-Ferreira Crónicas de una isla El do do. y dados los hábitos del dodo de anidar en el suelo. desarrolló la incapacidad de volar. la Isla Reunión que fue habitada por Raphus solitarius (Dodo de color blanco. Los pintores de dodos mas famosos fueron: De Bry (1661). quienes al ver que esta ave no escapaba al ser asechada le dieron el nombre de “duodo” que quiere decir ¨estúpido¨. sino simplemente el producto de una sobrealimentación en su condición de individuos ya “domesticados”. ratas. al margen del aspecto educativo y la labor científica que tienen estos centros de investigación. producto de la ausencia de un predador importante. ¨necio¨. etc. como vimos anteriormente. Roelandt Savery (1626-28). muchos organismos hoy extintos no hubieran dejado testimonio de su existencia. que se convierten en repositorios de organismos para en el futuro tener un testimonio de los mismos. esto. fue una especie que comenzó a agonizar y no tenía salida. a partir de entonces. De este modo. aunque se piensa que esa no haya sido su forma natural. Huntnagel (1626) y Ruthardt (1666). por todo ello hoy en día a este árbol se lo conoce también con el nombre de árbol del Dodo. Del Dodo tampoco se conoce un esqueleto completo. Restos óseos fragmentarios existen en el Oxford Museum y el American Museum. Aunque no solo fue el dodo. es decir llevar dentro de sí las semillas luego de comer el fruto y depositarlas en otros lugares donde germinar. expiró el último individuo. es un caso típico de especiación insular. los portugueses se dieron a la tarea de cazarlos intensivamente y sin reparo alguno. Los dodos en la Isla Mauricio resistieron hasta 1681. perros. este árbol estuvo por ello a punto de extinguirse ya que el medio dispersor (el Dodo) desapareció.De la Biología al Mito H. por lo que el testimonio óseo es fragmentario aunque suficiente para reconstruirlo y tener una idea aproximada de como fue. ¨bobo¨. Los dodos fueron aves de la familia Raphidae que habitaron tres Islas pequeñas al este de Madagascar: la Isla Mauricio que fue habitada por Raphus cucullatus (el dodo mas conocido y de color grisáceo). 164 . sus huevos fueron un objetivo fácil para sus predadores. Sobre el Dodo no existen testimonios fotográficos. una vez instalados en la isla. En este sentido cabe resaltar la importancia del trabajo de los Museos de Historia Natural. 80 cm). de las 45 especies de aves existentes en la Isla Maurici o antes de la invasión por parte del hombre. Otro aspecto es el ecológico. en el acápite referido a la Teoría Biogeográfica de Islas. solo quedaron 21 y muchas de ellas en peligro de desaparecer. pero no solo trajeron criminales. es uno de los tantos casos dramáticos de extinción por la acción del hombre. ¨tonto¨. ya que su imposibilidad de volar hizo de que la isla se convierta en su propia jaula.

De la Biología al Mito H. Azurduy-Ferreira A B TESTIMONIOS ICONOGRAFICOS DEL DODO. 1626). B. C 165 . Raphus cucullatus (por Roelandt Savery. Raphus solitarius (por F. 1708). C. A. Frohawk). W. Pezophaps solitaria (por Francois Leguat.

lo que motivó que en 1918 se declarase el valle de Ordesa como parque nacional. hacia 1890. En la extinción del bucardo han participado muchos factores. dentro del Parque Nacional de Ordesa el último ejemplar de bucardo (foto). en el tamaño de sus cuernos y en el tamaño total.htm ) 166 . de otra subespecie. En 1914 Cabrera distinguió cuatro subespecies. Finalmente en 1999 se capturó el último ejemplar para tomar muestras de ADN. Sin embargo no fue hasta 1994 cuando se iniciaron los trabajos de campo. provenientes de Beceite.org/inicio/eventos/bucarda. la competencia con el sarrio. protegiendo también al bucardo. (Tomado de: www. Aunque la polémica sobre esta división subespecífica ha sido intensa. en 1997. y montañas cantábricas (Capra pyrenaica lusitanica). aunque existen serias dudas sobre dicha estimación. Posteriormente. Fruto de aquel estudio las poblaciones de cabra montes quedaron divididas en cuatro subespecies: el bucardo del Pirineo (Capra pyrenaica pyrenaica).De la Biología al Mito H. Dicha confirmación llegó cuando su extinción era ya inevitable. la cual murió al poco tiempo. El 6 de enero de 2000 apareció muerta en el paraje de la Faja de Pelay. hasta que el pasado 6 de enero de 2000 se la encontró muerta. ha sido históricamente objeto de polémica respecto al número de subespecies que podr ía incluir. la cabra del sur y este de la Península Ibérica (Capra pyrenaica hispanica) y la cabra montes que se extendía por el norte de Portugal.ecologistasenaccion. Aunque dicha muerte equivale al certificado de defunción de esta subespecie. la cabra montes de Gredos (Capra pyrenaica victoriae). las molestias causadas por la masificación turística. la realidad es que se encontraba en estado terminal desde hace décadas. liberándose posteriormente. el caso del Bucardo La cabra montes. Azurduy-Ferreira Cronología de una extinción anunciada. la caza ilegal. basándose en el diseño de las manchas negras en el pelaje de los machos adultos. no obteniéndose ningún resultado. La última evidencia de cría de esta especie data de 1987. especie endémica de la Península Ibérica. y en 1990 se cifró su población en diez ejemplares. Galicia. la endogamia. desde 1995 los análisis genéticos realizados sugieren la existencia de diferencias relativamente importantes entre el bucardo y el resto de las subespecies. en los que se detectaron sólo tres hembras. las enfermedades. se llevaron hasta Ordesa dos machos de cabra montes. capturándose una de ellas en enero de 1996. de avanzada edad. Desde principios de este siglo el bucardo estaba considerado como una especie en regresión. con el objetivo de cubrir a la última bucarda. Esta subespecie fue la primera en extinguirse. y especialmente la combinación de todas ellas.

ACTO DECIMO Presagios… .

De la Biología al Mito

XXII

H. Azurduy-Ferreira

TRAMAS PARA UN MISMO FINAL

Hemos visto que el ritmo de extinción se incrementó, en tanto y en cuanto los
europeos colonizaron diferentes sitios en el mundo. Faunas insulares (de islas) en
particular, sufrieron la introducción de animales como cabras, ratas, cerdos y
posteriormente mangostas, que destruyeron vegetación y depredaron aves nativas
y otros animales. Desde entonces la acción humana ha impactado progresivamente
sobre la diversidad biológica debido a dos factores fundamentales: una cada vez
más sofisticada tecnología y un crecimiento exponencial de la población humana, la
misma que se estima llegará a 11 billones de humanos el año 2035. Las tasas de
crecimiento poblacional son mayores en países tropicales y subtropicales pero el
impacto sobre el medio es mayor en países altamente industrializados. Por ejemplo
un americano promedio tiene quizás un impacto ambiental 13 veces mayor a un
brasilero promedio y 140 veces mayor a un nativo de Kenia en Africa, porque el
país del Norte es un consumidor comparativamente, algo desmedido en recursos y
energía.
El bosque tropical húmedo que por 1989 fue reducido a la mitad de su área
prehistórica, ha sido el más afectado en la pérdida de especies y su destrucción
avanza a razón de 1,8 % por año. En este sentido se ha estimado que en los
siguientes 30 años, 10 a 25 % de especies del bosque lluviosos tropical se
extinguirán (Wilson, 1992).
Hoy, la biodiversidad es muy inestable y los ritmos naturales han sido
alterados a ritmos que la evolución no puede resolver, aunque muchos organismos
(invertebrados fundamentalmente) hayan mostrado una gran flexibilidad genética
para elaborar respuestas evolutivas casi inmediatas, pero esa no es la regla sino la
excepción. Las tasas de extinción superan a las tasas de evolución ya que los ritmos
acelerados de la misma (producto de la acción y actividad humanas) son un evento
nuevo para los procesos naturales establecidos.

El ¨juego¨ de evolución versus
extinción es el que definirá la
diversidad futura de este planeta.
Esfuerzos destinados a salvar las
especies biológicas han instaurado
un sistema de acciones que
conocemos como Conservación
Biológica y de la que se han
desprendido una serie de líneas
metodológicas y educativas tratando
de difundir mensajes y conocimiento
unas veces más efectivas, que otras.

168

De la Biología al Mito

H. Azurduy-Ferreira

MAMIFEROS EXTINTOS
desde 1500 dC

Causas desconocidas
Extinción natural
Sobreexplotación
Alteración de hábitat
Especies introducidas

Redescubierta
Redescubierta

AVES EXTINTAS
desde 1500 dC

Extinción natural
Sobreexplotación
Alteración de hábitat
Especies introducidas

Redescubierta

Biogeografía de las causas de extinción en casos documentados para Aves y Mamíferos. Note
la alta incidencia de extinciones documentadas en medios insulares y la mayor cantidad de
casos en aves respecto a los mamíferos.

169

De la Biología al Mito

H. Azurduy-Ferreira

Patrón de deforestación en un sector (círculo en el mapa) del denominado Proyecto Tierras Bajas del Este, Santa Cruz -Bolivia
(Imagen Satelital LANDSAT-NASA, Agosto de 2000)

167

sectas religiosas. 1989. La Conservación. 1995. Estas ambivalencias que descansan en un sustrato genético-cultural influyen en una visión del hombre generalmente dirigida a él mismo o a su lado metafísico. que mientras unos se ocupan en diseñar mecanismos o tecnologías destructivas de efecto y uso son cuestionables. Karl y Bowen. En Latinoamérica el tema “evolución” es aún un elemento muy tangencial o inexistente en los sistemas académicos. 2000). Aquí. Las extinciones naturales ¿Hasta donde debemos intervenir?. de modo tal que su universo pareciera haberse reducido de tal forma. 1999. ¿es realmente conservar . que elementos foráneos a ese mundo le son difíciles de percibir o entender. ¿Qué es realmente Conservación?. puede ser muy complicado sin un previo concenso respecto a la definición de conservación y el reconocimiento de métodos para tal efecto. no estamos incidiendo en un proceso natural en el que se ve implicada la chance evolutiva de otras especies? Esto parecería contradictorio y hasta incongruente con una postura de conservación. ¿hasta donde debe llegar nuestra acción en este fenómeno ? ¿Si por nuestra acción determinamos la permanencia ¨forzada¨ de una especie. aunque aquí cabe esgrimir que toda extinción natural de una especie significa a la vez una oportunidad evolutiva para otras. . Meffert. Entendida una extinción natural como un evento posible y probable. lo fundamental de la labor taxonómica en la definición de las unidades de conservación. La Sistemática Filogenética mostró a través de los trabajos de Vane-Wright. 1959.Evolución y Conservación El hombre evidencia culturalmente tal nivel de aversión contra sí mismo que en este último tramo de su permanencia en el planeta. Definir lo antrópico o lo natural como una causa de extinción en marcha. Richards y Leberg (1996) y Gordon y Cornuet (1998). ¿qué postura tienen los conservacionistas tradicionales respecto a las extinciones naturales y los procesos evolutivos?.1992. cabe enfatizar el trabajo de John Avise de la Universidad de Georgia. Paradis y Williams. Azurduy. 1996. Los trabajos en evolución y conservación han sido impulsados en gran medida gracias a los avances en la biología molecular. 1993. quien focalizó muchos de sus trabajos a consolidar la Genética de la Conservación (Avise. aunque cabe también mencionar a Frankham (1995). otros se forman y trabajan para tratar de contrarrestar aquellos. et al. 1999. 1998. es un conjunto de respuestas a un conjunto de estímulos en forma de impactos nacidos de la acción humana y cuyo desarrollo en cierta medida han determinado una especie de coevolución memética. entre otros). ¿cuáles son los tiempos que maneja?. el tratar de mantener escenarios naturales incambiables? Son algunas de las preguntas que me he hecho (igual que otros) y sobre las cuales expongo algunas ideas. Avise y Johns. se la ha pasado desarrollando tecnologías. esta es una pregunta que parte del hecho de qua la extinción natural es una de las opciones naturales de cualquier especie en su historia evolutiva. no solo tecnológica sino también política y donde un paso de uno influye en el paso siguiente del otro. modelos sociales y económicos tan contradictorios. 1999. 1992. ideologías. 1989. pese a las diversas implicaciones de la Teoría Evolutiva sobre el pensamiento científico y filosófíco (Coollins.

Aquí. Las direcciones de la evolución son diversas y no siempre en congruencia con nuestra lógica convencional o limitado universo de conocimiento. cuyas implicaciones en los procesos actuales pueden ser vistos de manera mas clara por un paleontólogo. de modo que fundamentos conservacionistas tradicionales pueden ser algo limitados respecto a los megaprocesos en el tiempo geológico y su interpretación biológica en el estrato temporal actual. viene a mi memoria el argumento de la película Un día después de Mañana. poblaciones con demografía alta. La Paleontología La Paleontología es poco o nulamente considerada a la hora de hablar de Conservación. La situación se vuelve más adversa cuando modelos climatológicos basados en datos actuales contradicen la hipótesis del paleoclimatólogo que cae en el descrédito ante tal ambiente de incredulidad. La Viabilidad Evolutiva Tradicionalmente el parámetro de conservación al que se ha recurrido ha sido la demografía y la determinación de los Números Mínimos para que una población se mantenga viable. es ridiculizado en su intento por alertar a instancias políticas mundiales sobre tal posibilidad.De la Biología al Mito H. Si su cuenta bancaria es poca o nula (poca variabilidad genética) no podrán cumplir con sus necesidades. pese a su potencial labor como una línea científica que proporciona el marco referencial histórico para el análisis. diagnóstico y valoración de determinados grupos biológicos sujetos de conservación. expresada y contenida en su grado y niveles de variabilidad. La variabilidad genética en este contexto. plantea una situación en la que el tiempo es quizás el elemento central de la trama. La opción complementaria a la demografía. aunque hoy sabemos que el estado demográfico puede llegar a ser en ciertos casos el equivalente a una burbuja enorme cuya duración es muy efímera en el tiempo. lo que incidirá negativamente en sus posibilidades adaptativas a determinadas crisis ambientales. El clímax de la trama se da en la súbita manifestación de grandes catástrofes climatológicas que conducen progresivamente a grandes inundaciones. es la “salud genética¨ de una población. ciclones. tornados y una disminución de la temperatura cuyo efecto en las poblaciones 167 . o de preguntarnos si realmente vale la pena pensar en evolución ante un conjunto de organismos que quizás y dadas las circunstancias actuales estarían destinados a desaparecer. Puede haber poblaciones demográficamente saludables pero cuya variabilidad genética es muy pobre. Azurduy-Ferreira Los impactos del hombre sobre la biodiversidad actual puede que no nos de tiempo para analizar tales dimensiones temporales si en un micrométrico periodo no estamos seguros de tener éxito. Un paleoclimatólogo cuyos datos y modelo predictivo sugiere una súbita crisis climática en Norteamérica. que más allá de los condimentos extra-ciencia típico del mundo-Hollywood. pero baja o nula variabilidad genética pueden ser vistos como individuo s muy bien ataviados pero con una cuenta bancaria sin fondos. Así. es como una cuenta bancaria de la que las especies pueden “echar mano”. si su cuenta es razonablemente suficiente (alta variabilidad genética) tendrán la chance de ¨usar¨ en el futuro una variabilidad potencial que visto de otro modo puede significar una especie de seguro genético. en cambio. o de la interpretación de los grandes eventos sucedidos en la historia geológica.

Al respecto. las convierte en un grupo en estado crítico. et al. previa a la presencia del hombre y que en la actualidad simplemente estemos ante el tramo evolutivo final de los mismos. si dos aspectos fundamentales en la conservación de una especie son: conocer su identidad taxonómica y distribución biogeográfica. Más allá de ser solo una película. nos plantean interrogantes sobre su significado e importancia de tal hecho en la conservación de las especies actuales. 168 . lo que nos muestra una relación espacio-tiempo cuya interpretación en términos de conservación podría ser establecida si se integra el conocimiento actual con lo que nos dicen los fósiles. Roedores como la Pacarana (Dinomys branickii) es la última especie (taxón relictual) de un grupo de histricomorfos (Dinomyidae) muy diversos durante el parte del Terciario y parte del Pleistoceno (periodo en el que comienzan a declinar). Una de las grandes tragedias en Conservación sería el no acudir al conocimiento paleontológico. me hizo reflexionar sobre la perspectiva y valoración que la Conservación Biológica tiene sobre el tiempo geológico y quienes están implicados en su estudio e interpretación. Cochabamba. Lo opuesto sucede con el roedor fosorial Ctenomys cuya diversidad entre el Pleistoceno (1. Azurduy-Ferreira humanas pone al poder político en una situación de incertidumbre e indecisión entre la cuestión económica por un lado. cuestiones ligadas a la trayectoria geológica conocida del grupo biológico al que pertenece. pueden existir grupos biológicos cuya declinación poblacional se haya iniciado. puede ser considerado como su brazo de análisis histórico que con todas sus dificultades y limitaciones es por hoy. Plantas del género Polylepis cuya distribución relictual de la generalidad de sus especies. etc. 1998). y humana por otro. Una reliquia viviente Planta de Polylepis en la zona sur Parque Nacional Carrasco. Fósiles encontrados con una antigüedad de 10 millones de años de esta planta. Peces como los bentones (género Hoplias) o el pezpulmonado Lepidosiren los tenemos en el registro fósil boliviano desde hace más de 60 millones de años y sin grandes cambios morfológicos. que por ese su ¨empecinamiento¨ de esculcar en el pasado.De la Biología al Mito H. Así. una instancia que nos permite rastrear el pasado para tratar de definir ciertas decisiones y acciones sobre el futuro.5 millones) y el Holoceno (periodo actual) se ha incrementado explosivamente gracias a eventos genéticos y geográficos cada vez más entendidos. Bolivia. historia geográfica o filogenético. puede brindarnos un panorama sobre ciertos rasgos evolutivos que nos permita definir aspectos relacionados con su ancestralidad.. están presentes en el registro fósil boliviano (Paleoflora de Potosí) desde hace 10 millones de años (Gregory-Wodzicki.

000 años (o menos) se prevé el inicio de un nuevo periodo glacial. o cualquier crisis global previa. E n la siguiente glaciación..000 años y en aproximadamente 10. vivimos un periodo interglacial que comenzó hace 12. ¿Cómo nos imaginamos la diversidad en 200 años o más?. los resultados de la visión de conservación biológica de nuestra especie.De la Biología al Mito H. Azurduy-Ferreira En la actualidad. 169 . tendremos (si permanecemos aún aquí) la posibilidad de evaluar estas preguntas y consecuentemente. ¿Qué nivel de análisis le asigna la conservación a eventos futuros de esta naturaleza y que sobrepasan los 100 años?..

ACTO FINAL Elucubraciones desde un sótano. Cerrando el telón .

veo que se habrá producido no solo la extinción de una especie. Sus actores. formas biológicas que no tienen que ser precisamente similares a las que cono cemos en nuestro planeta. el sitio en el que me encuentro escribiendo estas líneas pudo haber estado ocupado por un individuo de naturaleza reptiloide como el que vemos abajo y cuya visión pudo haber dado como resultado un libro en el que de seguro Freud. o en otros. Azurduy-Ferreira Con la muerte del último hombre. de modo tal que no nos sorprendamos si de un vehículo espacial desciende un individuo con ventosas en sus miembros. han ido apareciendo progresivamente en escena y se han acoplado para establecer una trama teatral en la que el azar interviene como uno de los actores principales y cuyo final es parte de un guión sin autor ni tiempo. sino también la última posibilidad de búsqueda en el conocimiento humano. Proyección evolutiva hipotética del dinosaurio Troodon. considerado el más evolucionado y con capacidad de procesos cerebrales de mayor complejidad en relación a otros dinosaurios. en unos casos pueden ser simples bacterias u organoides virales muy primitivos. no estarían incluidos. ya que simplemente es parte de la diversidad biológica del Cosmos (igual que nosotros).De la Biología al Mito H. Nuestro curso evolutivo ha sido tan azaroso. Darwin o Dios. que si los dinosaurios no se hubieran extinguido. Nuestro conocimiento y nivel de exploración del Cosmos es tan limitado que no podemos descartar la existencia de otros escenarios donde el teatro de la vida se lleva a cabo . 177 . El planeta Tierra es un escenario de una obra teatral que se desarrolla en medio de la inmensidad del Cosmos desde hace más de 4000 millones de años.

Sino preguntemos sobre el nivel de dudas sin respuesta respecto a culturas como los Incas. La Tierra ha estado ausente 10. muchos eventos biológicos han podido desarrollarse en otros planetas.800. Este mismo libro. tiempo que alberga tal cantidad de eventos.000 millones de años. en la tradición oral. así: Las vasijas de cerámica antigua son para un arqueólogo. argumentos y procesos biológicos que son solo eso. lo que significa que como entidades biológicas del Cosmos. hemos recorrido apenas los últimos 100. asigna al tiempo un rasgo cualitativo de cuya abstracción se pueden generar varias interpretaciones. que unas veces vienen de la geología y otras de principios moleculares a los cuales acudimos confiados de una certidumbre razonable. Azurduy-Ferreira En estos 15. lo que los fósiles son para el paleontólogo o los quasares para un astrónomo que indaga en el tiempo cósmico. que pese al gran desarrollo material son desconocidas en otras facetas. que descifrarlos es un afán en el que nuestra especie no lleva más de 200 años. más que la escrita o el desarrollo de enormes íconos materiales.000 años. Las limitaciones y dificultades para tratar de conocer lo sucedido en tales magnitudes de tiempo son enormes. Para darnos idea tan solo veamos los grandes vacíos que existen en el entendimiento de las propias culturas humanas de no más de 5000 años o menos. la misma alberga un conjunto de elementos a los que llamamos comúnmente misterios o secretos. La indagación sobre un tiempo en el que no se ha estado presente requiere de un conjunto de datos y metodologías aún en proceso de desarrollo y cuya complejidad y dificultad aumenta cuanto más distante es el nivel temporal que queremos indagar. la envergadura de las preguntas supera en mucho a las respuestas. hemos estado ausentes alrededor de 50. y por hoy. los biólogos trabajamos con ¨tiempos prestados¨. no más (si queremos marcar una diferencia con dogmas o ideologías). de modo que imaginemos la complejidad que significa el tratar de entender grupos humanos cuya cultura se fundamentó en gran medida. Lo dicho. y cuyo descubrimiento y dilucidación puede despertar nuestros 178 .999.De la Biología al Mito H. Así. Mayas o Fenicios. en ciencia sabemos que nuestro conocimiento está condicionado por lo que podemos ver y a sabiendas que eso es solo una fracción de un todo sobre el cual nuestra ignorancia es aún descomunal La oscuridad es algo que existe en las fronteras del conocimiento. Los estudiosos de las culturas humanas identifican un patrón en el que las mismas históricamente deambulan entre un tiempo sagrado (entre dioses o demiurgos) y un tiempo profano (que trasciende lo espiritual).400 millones de años en la evolución cósmica y nosotros como especie.000 millones de años del Cosmos. recurre a datos que suponemos ciertos y que constituyen el sustrato desde donde proyectamos ideas. ¿Fue Kronos realmente el Dios del Tiempo? o es una simple abstracción en la que los mitógrafos han condensado o reducido una percepción que puede ser mucho mas compleja en su esencia órfica? Si de tiempo se trata.

de donde ha emergido por azar. por que en primera instancia. con un planteamiento cuyos matices filosóficos en Biología divide dos grandes visiones: la de los organicistas (holistas) y la de los reduccionistas. En tal ensayo. nuestro pasado. no manifiesta fatalidad ni tragedia (ya que es consciente que su búsqueda temporal agotó las posibilidades). y que así como se pueden generar teorías sólidas. adecuada o inadecuada. saber los factores que determinaron la extinción de los dinosaurios o desarrollar formas de tratar el cáncer. porque sabe que obtuvo un dato que le indica que debe seguir otra ruta de búsqueda. buscar barcos perdidos. el hombre sabe al fin que está solo en la inmensidad indiferente del Universo. él respondió: ¨NO. su deber no está escrito en ninguna parte¨. Al respecto recuerdo una ocasión en la que uno de los chicos del Museo me confesó su frustración al no poder registrar una especie de pájaro carpintero en una zona del subandino de Santa Cruz donde se esperaba que esté. Ante este panorama de logros y tiempos prestados. rescatemos la actitud de un buscador de barcos perdidos luego de una actividad exploratoria millonaria y que a la pregunta de si consideraba un fracaso su exploración. por que ahora sé que no está aquí¨. Igual que su destino. correcta o incorrecta. también se pueden elevar castillos de naipes que si se caen. Cualquiera que sea nuestra conclusión al respecto no será buena o mala. debemos asumirlos simplemente como un indicio de que el camino de indagación no había sido por esa dirección. Su argumento hilvana un argumento complejo alrededor del azar y la necesidad aspectos que considera los motores centrales en curso de la vida versus tiempo y que de algún modo se resume en su conocida sentencia: ¨La antigua alianza ya está rota. Lo que le hice notar al respecto es que el no encontrar algo bien buscado. Esta frase. es decir. la vida y el futuro. y tercero porque denota estar presto a continuar con su búsqueda pese al desaire o situación adversa aunque en el fondo que esa experiencia le ha proporcionado elementos nuevos para continuar con itinerante pasión. nos retrotrae a una frase que acuñó el griego Demócrito: ¨Todo lo que existe en el mundo es fruto del azar y de la necesidad¨. cualidades nacidas de la 179 . Azurduy-Ferreira sentidos hasta el borde del ¨morbo¨. Jaques Monod sintetiza y explica la esencia del desarrollo de la vida.De la Biología al Mito H. ¨El Azar y la Necesidad¨. El efecto de una aseveración de esa naturaleza en nuestro pensamiento puede de alguna manera cuestionarnos o hacernos repensar al menos una vez. cualquiera que indague en estos temas (evolucionista o nó). puede ser también un dato. segundo. título que usa Monod (1989) para su controvertido ensayo. quizás refleja la actitud con que un científico tendría que afrontar su actividad. sobre la perspectiva de nosotros mismos respectos a nuestro entorno. Sino. Aunque e s justamente ese ¨morbo¨ (que puede ser entendido como curiosidad o acuciosidad) el que nos ha empujado tratar de entender el lenguaje de las ballenas. debe estar consciente de que los dogmas no deberían existir en la ciencia.

porqué y para qué conservar? Cualquier respuesta al respecto nos daremos cuenta que nace de una razón que suponemos la mas adecuada o fuerte en nosotros y no de una ley. así. De este modo y bajo la cruda realidad de los elementos.De la Biología al Mito H.. Pero. nuestras acciones y pensamientos son guiadas según nuestra carga cultural. reflejan algo tan simple y sencillo que inspiran: Vida y quizás algo más que eso. moral o religioso. si el lector supone haber encontrado una verdad o una razón en nuestros argumentos. un pretexto ex profeso para además. Azurduy-Ferreira mente humana y según un determinado orden social.. 180 . la impronta de un hueso fósil o el desplazamiento de un caracol. etc. Fin. sus procesos. narrar y difundir facetas de algo que reposa en las pupilas de la musa inspiradora. Pese a ello hubo en este libro. A tiempo de cerrar el telón de una obra aún inconclusa. indicar que el conjunto de apreciaciones y argumentos expuestos en el presente libro son solo eso y no una prédica evolucionista o Mandamiento para conservar la vida (que no hubiera sido tan malo como Undécimo Mandamiento bíblico después de todo). debe considerarlas como apreciaciones que no dejan de ser parte de mis tendencias de pensamiento y quizás hasta de mis fobias (que de seguro eventualmente no han perdido la oportunidad de salir a relucir). un dogma o mandato divino. La conservación es una de esas tareas en la que nos involucramos por que amamos la vida. genética o la consecuencia voluntaria con intereses comunes. y que mas allá del complejo mundo que inventamos. sus manifestaciones.

Glosario

De la Biología al Mito

H. Azurduy-Ferreira

A
adaptación. 1: Proceso de adecuación de un organismo individual a la presión
ambiental. 2: Proceso de modificación evolutiva cuyo resultado es una eficacia
mayor de sobrevivencia y de las funciones reproductivas. 3: Cualquier carácter
morfológico, fisiológico de desarrollo o de comportamiento que amplía el éxito
reproductivo y de sobrevivencia de un organismo.
alelo. Cualquiera de las formas distintas de un gen que ocupa la misma posición en
cromosomas homólogos y que sufren apareamiento meiótico.
altruismo. Conferir un beneficio a otro individuo con un aparente costo para el
benefactor.
anastomosis. Unión de las ramas biológicas para formar una red.
año luz. Unidad de longitud utilizada para medir grandes distancias en el
Universo. La misma es igual a la distancia que recorre la luz en un año en un vacío,
es decir, 5,8786 billones de millas (un kilómetro es igual a 0,6214 millas).
alocrónico. Que no es contemporáneo; que existió en otros tiempos.
alopoliploide. Híbrido poliploide que posee conjuntos de cromosomas derivados de
dos especies o géneros diferentes.
apomixis. Reproducción sin fertilización donde la meiosis y la fusión de gametos se
suprimen parcial o totalmente.
árbol filogenético. Diagrama de ramificación en forma de árbol que representa las
líneas que se han deducido sobre la descendencia. Sinónimo de filograma, árbol
evolutivo, árbol filético.
ATP. Molécula encargada de transferir energía para que la célula realice sus
funciones biológicas. La misma está compuesta por una base nitrogenada de
adenina, azúcar ribosa y tres residuos de ácido fosfórico.

B
belemnoides. Invertebrados extintos que pertenecieron al grupo de los moluscos
cefalópodos, es decir que fue un grupo afín a los actuales pulpos, calamares, jibias,
nautilos, etc. Su endoesqueleto denota una forma de torpedo (fragmocono) cuya
punta se dirigían sentido opuesto a la proyección de los diez tentáculos que nacían
de la cabeza. En el registro fósil, aparecen en el Carbonífero inferior (Misissipiano,
350 millones de años aproximadamente), mientras que los últimos fósiles provienen
del Eoceno (50 millones de años).
Biología. Ciencia que se encarga de estudiar todo fenómeno que se relaciona con la
vida.
biología evolutiva. Ciencia integrada por la evolución, la ecología, el estudio del
comportamiento y la taxonomía.
bioluminiscencia. Luz producida por organismos vivos, y emisión de este tipo de
luz, producida biológicamente.
biota. El total de la fauna y flora de un área dada.
braquiópodos . Grupo polifilético de invertebrados marinos cuyo cuerpo blando es
protegido dentro de una concha constituida por dos partes, llamadas valvas, las
mismas que se asemejan a las que poseen el grupo de las almejas, ostras,
mejillones etc. Según el registro fósil, estos organismos se originan hace
aproximadamente 570 millones de años y aunque muchos grupos taxonómicos de

182

De la Biología al Mito

H. Azurduy-Ferreira

braquiópodos se extinguieron, hoy en día se evidencian representantes de cuatro
órdenes: Terebratulida, Thecideina, Rhynconellida, Acrotretida y Lingulida, siendo
los mas antiguos (desde el Cámbrico inferior) los dos últimos.

C
capacidad de carga. Límite de la capacidad de un hábitat para sostener una
población de organismos.
cariotipo. El complemento de cromosomas de una célula, individuo o grupo.
Características estructurales de los cromosomas.
cigoto. Gameto fertilizado; célula diploide formada por la fusión de dos gametos
haploides. Son sinónimos: zigoto, singameto.
cladogénesis. Ramificación de linajes durante la filogenia.
cladograma. Diagrama de ramificación que representa la relación entre caracteres
o estados de caracteres, a partir de los cuales se pueden hacer inferencias
filogenéticas.
clasificación. 1: proceso de establecimiento, definición y ordenamiento de taxones
dentro de series jerárquicas de grupos. 2: Serie jerárquica de grupos o taxones.
código genético. Base bioquímica de la herencia; sucesión de pares de bases
nucleotídicas en la cadena de DNA que codifica la información genética; dentro del
árbol de códigos, pares de bases nucleotídicas (codon) sucesivos que codifican a un
aminoácido simple.
codon. Unidad de codificación genética; triplete de nucleótidos adyacentes en el
DNA o RNA mensajero que especifica a un aminoácido en particular.
comensalismo. Relación ecológica entre dos especies en la que una es bene ficiada y
la otra ligeramente afectada.
competencia. Demanda simultánea por parte de dos o mas especies de un mismo
recurso.
correlación. En Geología, el proceso de relacionar capas sedimentarias y
formaciones geológicas de edad similar.
creacionismo. Doctrina según la cual cada especie de organismo fue creada
separadamente por un creador supernatural.
cromosomas homólogos. Cromosomas estructurales similares que tienen posiciones
genéticas idénticas en la misma secuencia y que se aparean durante la división
celular.
cromosoma X Cromosoma sexual cuya duplicidad determina el sexo femenino (XX)
y su coexistencia con el cromosoma Y (XY), el masculino. Aunque existen variantes
a esta regla, la misma es muy evidente en humanos y otros organismos.
cronoespecie. Segmento de un linaje preservado en el registro fósil y que difiere
morfológicamente lo suficiente de otros del mismo linaje, como para poder
asignársele un nombre binomial. No equivale a especie biológica.

D
diploide. Que posee un conjunto doble de cromosomas homólogos, común en la
mayoría de los organismos que se derivan de células-huevo fertilizadas.
disjunta. Separado en forma muy marcada; zona discontinua en la que una o mas
poblaciones están separadas de otras poblaciones de cruce potencial por una
distancia suficiente como para impedir el flujo de genes entre ellas.

183

estocástico. 2: Cualquier cambio acumulativo en las características de los organismos o poblaciones que se da de generación en generación. el Esperanto permite una comunicación con una base común. Acido desoxirribonucleico. L. dado que su diseño es mucho más simple y regular. Estudio comparado del comportamiento animal (incluido el hombre) y los factores culturales. que tienen a través del Esperanto la posibilidad de sobrevivir frente a 'lenguas absorbentes'. estrategia. L. genéticos. epistemología. Fue por primera vez publicado en 1887 por el Dr. Edad de Hielo. 1: Cualquier cambio direccional. endosimbiosis. También. con DNA como material genético y organelos citoplasmáticos definidos. Estudio de las interrelaciones entre organismos vivos y su ambiente. El Esperanto es considerablemente más sencillo que cualquier lengua nacional. Contiene típicamente dos cadenas polinucleotídicas en forma de hélice doble. El uso del Esperanto también protege a los idiomas minoritarios.De la Biología al Mito H. guanina. de ahí viene el nombre. electroforesis. Técnica de separación de mezclas de moléculas orgánicas basadas en las distintas velocidades de desplazamientos de las moléculas en un campo eléctrico. Esperanto. etología. método o estructura utilizados por un organismo o grupo de organismos para satisfacer un conjunto particular de condiciones. si no suplementarlos: el Esperanto es utilizado como un idioma neutral cuando se habla con alguien más que no hable la lengua propia. Nativo de una región geográfica particular y restringido a ella. El propósito del Esperanto no es reemplazar a ningún idioma. desplegado. descender o desarrollarse con modificación. los anastomosos de la red representan los lugares de hibridación. Esperanto". Capas de roca sedimentaria que fueron depositadas en diferentes tiempos. material genético básico de una célula. Evolución que depende del entrecruzamiento repetido entre un cierto número de linajes que originan una red de relaciones en una serie de especies alopoliploides relacionadas. Plan. Organismo cuyas células tienen un núcleo discreto separado del citoplasma por una membrana. Periodo de Cuaternario en el que la glaciación se hallaba mas extendida que en la actualidad. la sucesión de apareamientos de nucleótidos en las cadenas es la base del código genético. que significa 'el que tiene esperanza'. estrato. ecológicos y fisiológicos que influyen en su manifestación. Doctrina que versa sobre los fundamentos y métodos del conocimiento científico. citocina. evolución. Simbiosis en la que un simbionte (endosimbionte o simbionte morador) vive dentro del cuerpo de otro (simbionte habitado). E ecología. 184 . polímero de los siguientes nucleótidos: adenina. enzima. evolutivos. Catalizador proteínico formado dentro un organismo vivo y que acelera reacciones químicas específicas. timina. evolución reticulada. las moléculas de DNA son las moléculas mas largas biológicamente activas que se conocen. Azurduy-Ferreira DNA o ADN. Zamenhof (1859-1917) bajo el pseudónimo de "Dr. eucariótico (eucariota). El Esperanto es una lengua diseñada para facilitar la comunicación entre personas de diferentes países y culturas. endémico. a diferencia de las lenguas nacionales. Azaroso (azar). sin que ninguno tenga la ventaja de conocer la lengua como materna.

frecuencia génica (frecuencia alélica). la Luna y los planetas giraban alrededor de ella. Respuesta dirigida hacia (positivo) o alejándose de (negativo) de la dirección de la gravedad. La proporción de copias de un gen en una población determinada. geófilo. genoma. etc. Conjunto completo de factores hereditarios encerrados en un juego haploide de cromosomas. como la que planteaban Aristóteles y Ptolomeo. las formas alternas de un gen se denominan alelos. transmisión y expresión de la información hereditaria. geocéntrico. Unidad básica de la herencia. 2: El origen y la evolución de los taxones superiores. 185 . Constitución hereditaria o ge nética de un individuo. 2: Relativo a las plantas cuyo frutos nacen bajo la superficie de la tierra. Tiene forma de disco y nuestro Sol está a alrededor de 30. todo el material genético contenido en una célula. 1: La historia evolutiva de un grupo o linaje. Suma total de las propiedades estructurales y funcionales observables de un organismo. geotropismo . al que por lo general. En la visión geocéntrica del Universo. materia interestelar. Conjunto mínimo de cromosomas no homólogos necesarios para el funcionamiento adecuado de una célula. G galaxia. gen (gene). fenotipo.De la Biología al Mito H. nebulosas. Adjetivo que significa "centrado alrededor de la Tierra". genética del comportamiento. La galaxia espiral a la que pertenece nuestro sistema solar contiene alrededor de cien millones de estrellas. espirales e irregulares. Estudio de los componentes ambientales y genéticos del comportamiento y sus diferencias entre individuos que viven en el tiempo presente. También se la denomina "galaxia de la Vía Láctea".000 años luz de su centro. que existen dentro del Universo. gameto. se denomina material nuclear. una de las cuales es nuestro Sol. genética. 1: Que se desarrolla o crece en suelo. filogenia. Azurduy-Ferreira F fenograma. los gametos masculinos se denominan espermatozoides y os gametos femeninos óvulos. Las galaxias han sido clasificadas de acuerdo con su forma en tres tipos básicos: elípticas. Célula reproductiva madura (normalmente haploide) que se fusiona con otro gameto del sexo opuesto para formar un cigoto generalmente diploide. geotaxia. genotipo. es decir que la Tierra estaba en el centro y el Sol. Ciencia encargada de estudiar la estructura. Diagrama de ramificación que representa los grados similitud fenética global de los taxones a partir de los cuales se pueden inferir relaciones filogenéticas. Respuesta de orientación a la gravedad. comprende una sucesión específica de nucleótidos en la cadena de DNA que desarrolla una función específica y ocupa un lugar específico (locus) en un cromosoma. Cualquiera de los miles de millones de sistemas de estrellas.

perezosos. Individuo diploide formado mediante la fusión de gametos portadores de alelos diferentes en una posición dada. el Sol está en el centro. locus. pero número diferente de neutrones. Llegaban a medir cerca de 5 m de largo. homocigoto. 2: Comunidad que comprende taxones derivados de dos o mas comunidades separadas o distintas. gliptodontes. con la Tierra. osos hormigueros. teoría que establece que los cambios en el uso y desuso de un órgano en un organismo traen como resultado cambios en el tamaño y capacidad funcional y que tales caracteres modificados. heterocigoto. y que produce dos tipos de gametos que difieren con respecto al alelo en esa posición. híbrido. 186 . Hoy en día vivimos un período interglacial. Que solo posee un conjunto simple (la mitad) de cromosomas. poseían en la zona terminal de la cola. son transmitidos a la progenie. la Luna y los planetas que giran a su alrededor. con una duración estimada (junto con la Glaciación Iowana) de alrededor de 70. linaje. Mamíferos pleistocénicos extintos y perteneciente al Orden Xenarthra (al que también pertenecen los actuales armadillos. H haploide. plural de locus. adquiridos por los organismos como respuesta a factores ambientales. como lo estableció Copérnico. como Doedicurus.). Punto particular del cromosoma en el que se encuentra el gen que determina un rasgo determinado.De la Biología al Mito H. La glaciación mas reciente de la Edad de Hielo Cuaternaria en Norteamérica. 1: Progenie de un cruce entre individuos genéticamente diferentes . Su cola era muy robusta y provista de grandes placas que la circundaban a modo de anillos que decrecían hacia la punta. Loci. Forma alterna de un elemento que tiene el mismo número de protones y electrones. etc.000 años. heliocéntrico. I isótopo. glacial. masivas espinas que se proyectaban desde un punto central. Relativo a los intervalos geológicos caracterizados por condiciones climáticas frías y glaciares y mantos de hielos en extensión. Azurduy-Ferreira Glaciación Wisconsiniana (=Würm 3 en el área Alpina). Una serie de poblaciones ancestrales y descendientes a través del tiempo. en taxonomía. Adjetivo que significa "centrado alrededor del Sol". con frecuencia el nombre se restringe a la progenie resultado de cruces interespecíficos. Su característica principal fue la posesión de una enorme armadura o coraza protectora que resulta de la unión de pequeñas placas individuales (homólogas a la de los armadillos vivientes). eventualmente algunos megaterios. mismas que eran utilizadas como un elemento adicional de defensa. L lamarckismo. En la visión heliocéntrica del Universo. Individuo que tiene alelos idénticos en las dos posiciones homólogas de un par de cromosomas. Herencia de caracteres adquiridos.

saltamontes. monofilético. nucleótido. las dos divisiones sucesivas de un núcleo diploide que preceden a la formación de gametos haploides o meioesporas. algunas veces se utiliza erróneamente como el equivalente de microhábitat. meiosis. etc. produciendo células hijas de composición cromosómica equivalente a la célula madre. Sucesos o tendencias evolutivas importantes normalmente vistos a través de la perspectiva del tiempo geológico. Relación simbiótica en la que cada una de las dos especies se beneficia producto de la interacción. telofase. grupo que comparte el mismo antepasado común. Derivado del mismo taxón ancestral. Organela citoplasmática en la que se desarrollan procesos que se relacionan con la producción de ATP (adenosín trifosfato) que a su vez esta relacionado con la dotación de energía para diferentes procesos fisiológicos. que incluye tanto el espacio físico como el papel funcional de la misma. Proceso de división y separación cromosómica que tiene lugar en una célula que se divide. El curso de crecimiento y desarrollo de un individuo desde que el cigoto es fertilizado hasta la muerte del mismo. Azurduy-Ferreira M macroevolución. nicho ecológico. una base nitrogenada y un azúcar. cada uno de los cuales contiene uno de cada par de los cromosomas homólogos de la célula padre.De la Biología al Mito H. origen de las categorías taxonómicas mas altas. Edmundo Halley hizo ya una conjetura relativamente acertada en cuanto a la naturaleza de las nebulosas. monomórfico. Subunidad de las moléculas de DNA y RNA que comprende ácido fosfórico. 187 . las dimensiones de este espacio son los parámetros del nicho. metafase. Orthoptera (ortópteros). Concepto que se refiere al espacio ocupado por una especie. cucarachas. langostas. Sucesos evolutivo s observados generalmente durante un corto periodo de tiempo y que consisten en los cambios en las frecuencias genéticas. anafase. División de reducción. microevolución. conceptualizado como un hipervolumen multidimencional que define el espacio biológico ocupado por una especie y que es único para la misma. N nebulosa. O ontogenia. Población con respecto a la cual un alelo particular está presente en todos sus miembros. mucho antes del advenimiento del espectroscopio. mitocondria. generalmente se reconocen cuatro etapas principales de la mitosis: profase. En un artículo de 1715. en la estructura cromosómica o en el tamaño de una población a lo largo de unas cuantas generaciones. Ontogénesis. según la naturaleza y densidad de las nubes. que puede verse como un parche de luz difusa en una región de oscuridad relativa. Orden de Insectos al que pertenecen los. Nube polvo y gases en el espacio. mitosis. mutualismo.

1: Busca explicar el comportamiento humano basado en la combinación de la biología evolutiva. polimo rfismo fenotípico. parsimonia máxima. porqué los humanos actúan de la manera en que lo hacen. 2: Trata de explicar a través de mecanismos universales del comportamiento. Hipótesis que establece que la reconstrucción óptima de los estados característicos ancestrales es la que requiere el menor número de mutaciones en el árbol filogenético para explicar los estados característicos contemporáneos. grupo completo de los individuos o elementos bajo investigación. polimórfico. y como modelo de poblaciones distribuidas aleatoriamente en las que la presencia de un individuo en cualquier punto no incrementa o disminuye la probabilidad de que otro individuo se encuentre en las proximidades y de donde la varianza es aproximadamente igual a la media. parsimonia. Epoca geológica situada dentro del Periodo Terciario. poza génica (pool génico). 3: Busca reconstruir problemas que nuestros ancestros encararon en sus primitivos ambientes y los mecanismos que utilizaron para resolverlos. En sentido estricto. antropología y ciencia cognitiva. plasticidad fenotípica. neurociencia. Epoca geológica del periodo Cuaternario que se extendió entre 1. Ciencia que estudia la conducta y los procedimientos de adaptación de los organismos a su medio. Desarrollo de un individuo a partir de un gameto femenino sin que haya habido fertilización por parte de un gameto masculino. Azurduy-Ferreira P Paleoceno. polimorfismo pseudoestacional. 1: Grupo de organismos de una especie que ocupan un área definida y que normalmente están aislados. Ley que establece que la hipótesis suficiente mas simple debe preferirse. Poisson.6 y 0. Coexistencia de dos o mas formas segregantes discontinuas. de otros grupos similares. 188 . especie. estudio de la vida psíquica. determinada genéticamente.01 millones de años antes del presente. 2: En estadística.De la Biología al Mito H. polifilético. polimorfismo equilibrado. hasta cierto grado. en una población en donde la frecuencia del tipo mas raro no se mantiene solo por mutación. La capacidad de que se produzca una variación notable en el fenotipo como resultado de las influencias ambientales sobre el genotipo durante el desarrollo. población. partenogénesis. polimorfismo cromosómico. distribución de. grupo que comprende taxones derivados de dos a mas ancestros diferentes. polimorfismo transitorio. Término opuesto a especie poliándrica. ley de la. las diferentes manifestaciones del polimorfismo incluyen: polimorfismo críptico. psicología evolutiva. hipótesis de la. pleistoceno. Que se deriva de dos a mas linajes ancestrales. poligínica. Todos los genes presentes en una población. psicología. polimorfismo genético. aunque otras sean posibles. Distribución matemática empleada para describir o probar un proceso aleatorio. Especie en la que un macho se aparea con varias hembras. que duró entre 65 y 54 millones de años.

microsatélites. Son en este tipo de tocas donde pueden ser encontrados fósiles. lodo y otros materiales que resultan de su consolidación debido a procesos de sedimentación y agregación. Contemporáneo. relación entre dos organismos o poblaciones interactuantes. y que sirve de asilo a la biota anteriormente mas distribuida. madriguera. Grupo de organismos de la misma especie que tiene una estructura social y está formado por miembros repetidos o unidades modulares. sistemática. poniendo atención especial en sus relaciones filogenéticas. el término substitución de nucleótido usualmente significa el reemplazo completo de un par de nucleótidos por otro dentro un linaje en un tiempo evolutivo. Divergencia evolutiva de una línea filogenética en una variedad de diferentes formas adaptativas. refugio. sociobiología. roca. La vida en común de dos organismos. La clasificación de los organismos vivos en series jerárquicas de grupos. simbiosis. sincrónico. con frecuencia se le utiliza como equivalente de taxonomía. relicto. por lo que también se las conoce con el nombre de "rocas estratificadas". algunas veces restringida a aquellas asociaciones que son mutuamente beneficiosas. Espacio geográfico generalmente aislado y de extensión limitada. Rocas formadas de arena. 189 . escondite. secuenciación y RFLPs. Estudio de las comunidades o de los grupos organizados de animales (incluido el hombre) o plantas (caso de la fitosociología). Que existe o que ocurre al mismo tiempo. hibridación de DNA.De la Biología al Mito H. esto les proporciona esa características capas en su estructura. hábitat aislado que retiene las condiciones ambientales que una vez fueron generales. subespecie. y también para incluir asociaciones intraespecíficas. Estudio de las bases biológicas del comportamiento social. sistemática molecular. típicos de una región como un todo. El reemplazo completo de un alelo por otro dentro una poblac ión o especies. Estudio de los organismos y sus interrelaciones utilizando referencias bioquímicas y empleando técnicas como la electroforesis. estudio de las relaciones evolutivas usando datos moleculares comparativos. Azurduy-Ferreira R radiación adaptativa. substitución. usualmente los taxones difieren en el uso de sus recursos o hábitats. sobre el que se establece una comunidad vegetal que es la expresión y representación histórica de una extensión geográfica que en el pasado alcanzó dimensiones geográficas mucho mayores y que producto de factores físicos (clima. Una determinada raza geográfica. sociedad. geotectónica) ha sufrido una progresiva reducción que puede ser fragmentaria o nó. 1: Area en la que una presa puede escapar o evitar a un depredador. S sedimentaria. conjunto de poblaciones de la misma especie que comparten uno o mas rasgos distintivos y que ocupan áreas geográficas diferentes de otras subespecies. 2: Zona que ha escapado a los cambios climáticos importantes. sociología. comúnmente usada para describir todas las relaciones entre miembros de dos especies diferentes.

en particular de las características que no se atribuyen a diferencias en edad. biosistemática y genomia. lo que denota su gran diversidad biológica. Degenerado o desarrollado imperfectamente. que incluye a todos los grupos subordinados. Taxa: Plural de taxón. V variación. Poseían un céfalo. cualquier grupo de organismos. tórax y pigidio (región mas posterior). Han sido descritos mas de 1500 géneros. usualmente de la misma especie. 2: Distribución o dispersión de valores alrededor de la media. vicarianza. territorio. La existencia de taxones o biota estrechamente relacionados en áreas geográficas diferentes. muchos de los cuales contienen cientos de especies dentro de si. Un área o volumen de hábitat defendido por un grupo o grupo de organismos contra otros individuos. nombrar y clasificar organismos. 190 . Poseían un gran número de patas que en su desplazamiento dejaban huellas características que han sido evidenciadas en el registro fósil y a las que se denomina Cruziana. sexo o etapa de historia de vida. que han sido separados por la formación de una barrera natural (evento de vicarianza). vestigial. Grupo taxonómico de cualquier rango. La teoría y la práctica de describir. Azurduy-Ferreira T taxón. trilobites. dada su estrecha distribución vertical en la secuencia geológica.De la Biología al Mito H. son usados como indicadores para determinar edades relativas estratos sedimentarios paleozoicos. referente a las estructuras y funciones que se han disminuido o reducido durante el curso de la evolución u ontogenia. 1: Divergencia de las características estructurales y funcionales dentro de un grupo. poblaciones o taxones considerados lo suficientemente distintos de otros grupos semejantes como para ser considerados una unidad separada. Varias especies de trilobites. órgano. taxonomía. unidad taxonómica. Son sinónimos: sistemática. Grupo de invertebrados (artrópodos) marinos ya extintos y que se distribuyeron (según el registro fósil) en toda la Era Paleozoica (570 y 225 millones de años) y cuyo exoesqueleto evidenciaba tres lóbulos longitudinales claramente distinguibles (de ahí su nombre).

Literatura .

L. R. J. y H. Molecular Markers. H. Evolution.. Conservation Biology. Tesis presentada para optar al título de licenciado en ciencias biológicas. AZURDUY. A. BOWEN. Universidad Autónoma “Gabriel René Moreno”. J. provincia Aroma del departamento de La Paz. Bolivia. 89:377-382. Science 208:1095-1108. 1992. ed. Univ. Facultad de Humanidades. Y G. J. 511 pp. Trends in Ecology and Evolution. Santa Cruz de la Sierra.V. ALVAREZ. 291-297. W. Un nuevo género y especie de Toxodontidae (Notoungulata) proveniente de afloramientos cuaternarios de la localidad de ¨El Torno¨ Dpto. Estudio de la Subfamilia Calmoniinae (Trilobita) del Devónico medio e inferior de la localidad de Pujravi.. ________ 1998. de Santa Cruz. AVISE. 2000. JOHNS. Gen. Molecular population structure and the biogeographic history of a regional Fauna: A case history with lessons for Conservation Biology. Extraterrestrial cause for the Cretaceous-Tertiary extinction. 1999.). Psychiatry 48: 1089-1096. 1980. En: Revista Técnica de Yacimientos Petrolíferos Fiscales Bolivianos (SUÁREZ-SORUCO. A role for Molecular Genetics in the recognition and Conservation of endangered species. 1997. Pp. W. T. 2003. Proposal for a standarized temporal scheme of biological Classification for extant species.C. Santa Cruz. Bolivia. Molecular Biology Evolution. Oikos. 192 . 1991. 1989. Trabajos presentados al V Congreso Latinoamericano de Paleontología. Autónoma Gabriel Rene Moreno. 21:297 pp. ASARO. MICHEL. Boletín Prociencia. Mitochondrial DNA polimorphism and a connection between genetics and demography of relevance to Conservation. A genetic study of male sexual orientation.De la Biología al Mito H. Conservation Genetics in the Marine Realm. Arch. 9(3):457-473. AVISE. J. 9(3):686-690. BAILEY. H. y R. ________ 1995. B. PILLARD. Natural History and Evolution. AZURDUY. Darwinismo desde una perspectiva filosófica. International Thomson Publishing. H. The Journal of Heredity. LAMB. MEYLAN Y E. 2da Parte. 63:62-76. Santa Cruz. ________ 1992. 96:7358-7363. Agosto 2002. AZURDUY. AVISE. F. 4(9):279-281. 1:16-23. Bolivia. ________ 1993.. Azurduy-Ferreira ALVAREZ. BERMINGHAM. Mitochondrial DNA Evolution at a turtle’s pace: Evidence for low Genetic Variability and reduced Microevolutionary rate in the testudines.M.

TOOBY. California. 1999. BARNES 1987. Sinauer Associates. Barkow. Barcelona. 1977. eds. 97(24):12970–12975 193 . B. 1998. Inglaterra). New York. Biol. N.GOODMAN.H. Biogeography. CURTIS. y M. Bielefeld. Allyn and Bacon.K. CLARKSON. C. 2nd ed. N. Massachusetts. N. Editorial Paraninfo S. F. LOMOLINO. 2nd Ed.De la Biología al Mito H. 8: 155-184. INC. Essentials of Psichology. D. R. COSMIDES. CAMPBELL. J. 1986. 1959. B. Buenos Aires. T. J. 1871. El origen de las especies. M. Inc. Publishers. 1992. DARWIN. DARWIN. BERLIN. BARON. Editores Unidos.G. John Murray. BEGON. Perú.A. et al. London. 1ª ed. 1986. 1872. El origen del hombre. New York. J. E. RICE. 1990. R. Editorial Panamericana. 3-15. P.. origin and use. A. W. DAWKINS. Boston. A. 4ª ed. A. CIPA Edicones. BARKOW. New Jersey). DARWIN. A.A. FITCH. SPANDE and J. Molecular evolution of the ? ? -globin gene locus: Gibbon phylogeny and the hominoid slowdown. y J. Biology: Concepts and connections. Paleontología de invertebrados y su evolución. Praeger. and Selection in relation to Sex. México. Individuals populations and communities. DALY (2000) Batrachotoxin alkaloids from passerine birds: A second toxic bird genus (Ifrita kowaldi) from New Guinea. Invitación a la biología. C. Azurduy-Ferreira BAILEY. Introduction: Evolutionary Psychology and conceptual integration. C. L.V. Evol. y J. CZELUSNIAK. Mol. D. The descent of man. J. Knowledge of languaje: Its nature. L. Bruguera S. Darwin’s impact on Philosophy. (Reimpreso en 1965. Chicago). COSMIDES.. 1979. C. The Expression of the Emotion in Man and Animals. Princeton University Press. 1979.L. J.H. Blackwell Scientific Publications. 34:185-248. TAGLE. BROWN. 1994. 1994. DUMBACHER J. PNAS . (Reimpreso en 1981. In: CHÍRIF. DARWIN. 1991. En: The Adapted Mind (J. TOOBY. 2nd edition.B. H.) Oxford University Press. Thought. Bases empíricas de la Cosmología Botánica Aguaruna. SLIGHTOM. y S.) Etnicidad y Ecología. The Benjamin Cumming Publishing Company. y J. (comp. (Una versión modificada de la conferencia dada en la sesión plenaria sobre Sociobiología en la XV Conferencia Etológica Internacional. Pp. COLLINS.. University of Chicago Press. CHOMSKY.A. y M. MITCHEL. L. W. B.. J. Replicator selection and the extended phenotype. Madrid.

Reflexiones sobre Historia Natural. HU. S. Sinauer Associates. P. Y J. MCINTOSH y K. LAWTON y R. 1997. Azurduy-Ferreira DUMBACHER J. Extintion Rates. La formación de la humanidad. y M. Crítica. 29:305-327. D. 1991. New York. HAMER. 11(6):533-560. Enzyme polimorphism in man. where we are going. 1981. 5ta ed. HU. FRANKHAM. PATTATUCCI. 145:82-84. New Jersey. Richard Dawkins. HUMMEL. L. 1998. A linkage between DNA markers on the chromosome and male sexual orientation. CUMMINGS. VELASQUEZ. Soc. KLUG. S. MAGNUSON.H. 12(1):228-237. En: Homosexuality: Research Implications for Public Policy (J. Evolutionary Biology. Harper & Row. MAY (eds). Science. Proc. y A. HERRMANN. Extintions in the fossil record. Genetics. Bolivian Altiplano. y B. M. Empirical evaluation of a test for identifying recently Bottlenecked Populations from Allele Frecuency data. Pp. Springer-Verlag. M. 261: 321-327. GOULD. DALY (2004) Melyrid beetles ( Choresine): A putative source for the batrachotoxin alkaloids found in poison-dart frogs and toxic passerine birds. Our Kind: Who we are. Oxford University Press. 1995. SPANDE y J. GORDON. J. 101(45): 15857–15860. HALDEMAN.. H. Publishers. DERRICKSON. W. Newbury Park.. where we come from.D. pp. HERNÁNDEZ. 1998. S.J. Nueva York.M. FUTUYMA. D. Barcelona GREGORY-WODZICKI. Prentice Hall.. B. London. S.De la Biología al Mito H.W. Barcelona. Evolutionary significant units versus Geopolitical Taxonomy: Molecular Sistematics of an endangered sea turtle (genus Chelonia). Oxford. y S. Massachussetts.S. GONSORIEK y J. 1995. Roy. 1998. D. CORNUET. H. A. D. V. España. WEINRICH. 164: 298310. Climatic and tectonic implications of the Miocene Jakokkota flora. (1989). Journal of South American Earth Sciences. LEAKEY. K. Muy interesante. T. HARRIS.M. Conservation Biology. 1995. SAMUELSON. N. Editorial Optima. Inc. In: J. PNAS. Conservation Biology. W.R. HARRIS.M. L. R. WAKO. 1994.C. Ancient DNA. 1993. Sexual orientation conversion therapy for gay men and lesbians: A scientific examination. 194 . Conservation Genetics.R. 149-160.C. JABLONSKI.F. BOWEN. R. eds. California. 25-44. KARL. 1966. 1997. La Sonrisa del Flamenco. 13(5):990-999.C. 1999.) Sage. Concepts of Genetics. A. S.

Molecular Systematics: Context and Controversies. Montevideo. Biología General. E.. Ediciones Pai dos. The John Hopkins University Press. HILLIS. Pp. Sinauer Associates. COLBERT. Uruguay. 1966. Amounts of variation and degree of heterozygocity in natural populations of Drosophila pseudoobscura. MORITZ. Elica. Selecciones de American Scientist. (D. D. Doubleday. Azurduy-Ferreira LEAKEY. Englewood Cliffs. 1993.Z. 1989. 1967. Publishers. y J. CURRIE. 1971. LORENZ. LEWONTIN. Italia. Editorial Mir. Storia della Paleontologia.A. Montevideo. E. Neandertal. eds.. 1995. WILSON. N.). N. MARSHALL y R. y E. Montevideo.P. II. J. 2da Edición. 195 . E. de RIQLES.Z. K. MARSHALL. G. The Theory of Island Biogeography. LESSA. Estudio comparado de las conductas. Fundamentos de la Etología. LESSA. London. LESSA. Massachusetts.P. Cuadernos de marcha. 54: 595-609. How speciation experiments relate to conservation biology. J. The rise of fishes. Génesis de una nueva disciplina: La evolución molecular. Inc. y R. En: Sulle orme dei Dinosauri (BONAPARTE. R. MAMONTOV. eds. Hubby. MABLE. 1996. Roma. 1997. LORENZ. Cuadernos de marcha. MORITZ. & B. LESSA. S. C. 1996. H. 1995. 1986. New York. The sixth Extintion: Patterns of life and the future of humankind. K. Moscú.O. KIELAN-JAWOROWSKA. Uruguay. Sexual Behavior on Mangaia.P. Uruguay. Mac ARTHUR. R. A molecular approach to the study of genic heterozygocity in natural populations. K. El Azar y la Necesidad. Madrid.) Erizzo Editrice. 1993. Prentice-Hall. E. R. MONOD. Barcelona. LONG.). Evolución de la conducta. C. Tusquets Editores. Genetics. Z. M. LEWIN. N. Ph. y V. 500 million years of evolution. MORELLO. Montevideo. J. En: Human Sexual Behavior. MEFFERT.H. Elogio del cerdo fósil. En: Molecular Systematics.M. Darwin versus Lamarck. MORELLO y Ph. BioScience. L. 1958. 1994. eds. P. En: Biología y cultura. y D. ZAJAROV. España. SUGGS. 49(9):701-711. 1990.F. Cuadernos de Marcha. Uruguay.De la Biología al Mito H. Princeton University Press. E. (HILLIS. Introducción a la Antropología biológica y social. A. M. 23-46.C. D. Princeton. Divulgación.J. TAQUET. LEONARDI. 1999.

J. T. D. R.O. L. Azurduy-Ferreira NAG. and Human fertility: India and the United states. y S. R. Blackwell Science. 2nd edition. Temporal changes in Allele Frecuencies and a population’s history of severe bottlenecks. Ancient DNA. En: Fósiles y facies de Bolivia – Vol. H. PERKINS. F. PELAEZ. M. A. Editor.C. Santa Cruz. C. Fondo de Cultura Económica. Barcelona. F. D. 29:31-41 PRUM. Las Musas de Darwin. III.A. Pp. C. Madrid. Pipridae). R. SAGAN. PARADIS. Enciclopedia Ilustrada de los Dinosaurios. Intense natural selection caused a rapid morphological transition in a living marine snail. Dover Publications. V. S. En: Polémicas contemporáneas en Evolución. Y P. La coevolución. M.. 13:231-238. New York. FENTON. 1980. y MOSS. 1995.STANLEY. Ballentine Books. Evolution. SEELEY. ed) Revistas técnica de YPFB. Etología: Bases biológicas de la conducta animal y humana. ORTIZ. Evolution. Editores. Ethology. Massachusetts. A. Conservation Biology. PASCUAL. A kinetic model of Phanerozoic taxonomic diversity. 1990. P. A record of Prehistoric Life. SEPKOSKI. 1997. 1986. Phylogenetic Analysis of the evolution of display behavior in the neotropical manakins (Aves. Barcelona. J. Postpaleozoic families and mass extinctions. NORMAN. LEBERG. RAUP. R. RICHARDS. 1992. A. 84:202-231. (OLEA A. I Vertebrados (SUÁREZ SORUCO.. Cosmos. México.M. Huxley’s and Ethics with new essays on its Victorian and Sociobiological context. 559-574. T. SAGAN. M. J y G. 1984. SARUKHAN. M. 1988.H. The Fossil Book. 1996. C. Paleobiology. 10:246-267 196 . y E. Current Anthropology. 1989. culture. S. Ediciones Pirámide. New York. 1999. El ciclo Cochabambiano (Paleoceno temprano): su incidencia en la historia biogeográfica en los mamíferos sudamericanos. 1988. México D. 1993. F. 12 (3-4). K. RIDLEY. OYAMA. Susaeta.De la Biología al Mito H. 1996. 1991. 1972. Princeton University Press. FITZGERAL. G. Los dragones del Edén. 10(3):832839.H. y J. Bolivia.V. 83: 6897-6901.B. 1996. RICH. Sex. RICH. A. A comparison of LH secretion and brain stradiol receptors in heterosexual and homosexual rams and female sheep. Evolution and Ethics: T. G. American Scientist 87: 446-457. WILLIAMS. 1978. Principios de paleontología. compilador). BARO. Inc.. R.J. POINAR. Editorial Ariel. Madrid. FENTON y C. Hormone and Behaviour.

N. 1975. COLBERT.) Erizzo Editrice.F. J. STANFIELD. Universidad Federal de Sao Carlos. Harper Collins Publishrers. New Haven. M.. Eds. A. H. 1966. En: Sulle orme dei Dinosauri (BONAPARTE. W. Departamento de ciencias biológicas. New York. A. D. G. VANE-WRIGHT. Paleocology of the mammoth fauna in the eurasian arctic. Academic Press. 3a ed. TAQUET. WILSON.). Academic Press. The Meaning of Evolution. SIMPSON. CURRIE. México. N. 1988. Roma. 1999.) Erizzo Editrice.K. Annals Missouri Botanical Garden. What is a fish species? Reviews in Fish Biology and Fisheries 9: 281–297. Massachusetts. México D. de RIQLES. WALLACE. 77-85. 1966. O. G. G. N. I Dinosauri d´Africa. New York. Eds.D. LEONARDI. 197 . The Science Times Book of Fossils and Evolution. En: Sulle orme dei Dinosauri (BONAPARTE. E. N. The Lyons Press. et al. Ediciones Quinto Sol. VERESHCHAGIN. Yale University Press. Connecticut. J. Pensamiento y lenguaje. M. de RIQLES. México. Mc Graw -Hill. Author argues that everyone is born with a head for numbers. TURNER. 1999. STEBBINS. CURRIE. I. H. Roma. 1993b. Cambridge. Nascita e Morte dei Dinosauri. 1982. Ph. Ph. 1992. WADE. Inc. WALLACE. Giant Molecules and Evolution. SHERMAN. Ph. 49-59. Genética..De la Biología al Mito H. 1982. Norton & Company Inc. F. Ph. Azurduy-Ferreira SHEPHER. Italia. LEONARDI. Incest: A Biosocial View. Sociobiology: The New Sinthesys. 1992.G.J. American Scientist. Sistematics and the Conservation of Biological Diversity. M. 1993a. New York. 6th Edition. BARISHNIKOV. SIMPSON. Evolución y geografía. Z. TAQUET. TAQUET.G.. TAQUET.F. 1964. COLBERT. W. 1978. R. New York. Procesos de la Evolución Orgánica. B. 1998. Pp. P. R. VIGODSKY. KIELAN-JAWOROWSKA.A. TRINDADE. J. eds. Z. L. L. En: Paleocology of Berigia (HOPKINS. KIELAN-JAWOROWSKA. 1996. E. Universitaria de Buenos Aires.F. Biology. MORELLO y Ph. Introducao a Paleogeografía: Influencia dos fenómenos geológicos na formacao dos continentes.. W.F. 83:47-57. New York. Evolucao e Distribucao de Fauna e Flora fosseis e atuais. Chromosomes. y G. H. 1983. G. MORELLO y Ph. G. Italia. The World of Life. G. E. Pp. Harvard University Press. 87:458-461.

Molecular Disease. y H. E. M. Evolutionary divergence and convergence in proteins. E. & L. New York.) Academic Press.O. 1992.). New York. evolution and genetic heterogeneity. PAULING. ZUCKERLAND. eds. The Diversity of Life. VOGEL. Harvard University Press. Azurduy-Ferreira WILSON. En: Evolving Genes and Proteins (BRYSON V. ZUCKERLAND. eds.De la Biología al Mito H. E. Massachusetts. & L. 198 . PAULING. 1965. Cambridge. J. Academic Press. PULLMAN. En: Horizons in Biochemistry (KASHA. 1962. y B.