You are on page 1of 6

Diseo y Uso de sondas para identificar duplicaciones

gnicas.
Introduccin
En 1936, Bridges report una de las primeras observaciones de duplicacin gnica a
partir de la aparicin de dos bandas cromosmicas en una mutante de la mosca de la
fruta Drosophila melanogaster, quien presentaba una reduccin extrema de los ojos. El
rol potencial de la duplicacin gnica en la evolucin fue posteriormente sugerida y los
posibles escenarios de evolucin mediante este mecanismo fueron propuestos. Sin
embargo, no fue hasta finales de los noventas cuando muchas secuencias genmicas
fueron determinadas y analizadas, que la prevalencia e importancia de la duplicacin
gnica se demostr claramente. Mediante el anlisis de las secuencias, el modelaje de
poblaciones genticas y experimentaciones moleculares, el rpido progreso ha sido
logrado para entender los mecanismos por lo que los genes se duplican y logran
divergir en funcin para contribuir a la evolucin de las especies. (Bridges, 1936;
Zhang, 2003)
La duplicacin de genes puede ser resultado de cruce desigual, retroposition o
duplicacin del cromosoma (o genoma); de todos, los resultados son muy diferentes.
Un cruce desigual usualmente genera la duplicacin de genes en tndem; es decir, la
duplicacin de genes ligados en un cromosoma. Dependiendo de la posicin a cruzar,
la regin duplicada puede contener parte de un gen, un gen completo, o varios genes.
En los dos ltimos casos, si hay intrones presentes en los genes originales, estarn
tambin presentes en los genes duplicados. Esto est en marcado contraste con el
resultado de retroposition. La retroposition se produce cuando un ARNm se retro
transcribe a ADN complementario (ADNc) y luego es insertado en el genoma. Como
era de esperar de este proceso, hay varias caractersticas moleculares de retroposition:
prdida de intrones y secuencias reguladoras, la presencia de colas de poli-A y la
presencia de repeticiones directas cortas flanqueantes. La insercin del cDNA en el
genoma es ms o menos aleatoria. Tambin es imposible tener bloques de genes
duplicados entre s por retrotransposicin a menos que los genes involucrados estn
ubicados en operones. La duplicacin cromosmica o del genoma ocurre
probablemente por una falta de disyuncin entre las cromosomas hijas despus de la
replicacin del DNA. Existe evidencia de que este tipo de duplicacin ocurre con mayor
frecuencia en plantas y es muy poco visto en animales. (Long, 2001; Hughes, 1994;
Teichmann y Babu, 2004)
Todos los tipos de duplicaciones mencionados anteriormente, han trado mucha
informacin para las investigaciones de hoy en da. En la actualidad, las herramientas

bioinformticas han servido para determinar duplicaciones genticas y relaciones entre


organismos, aunque sea de una manera indirecta, se han podido predecir mltiples
genes homlogos y funciones distintas. En esta prctica, se buscar el gen de la
vasopresina en otros organismos homlogos con la ayuda de ciertas herramientas
bioinformticas y conocimientos previos acerca del gen de la vasopresina.

Objetivos
Disear una sonda que pueda funcionar para la bsqueda de genes de vasopresina
homlogos en otros organismos de inters cientfico.

Metodologa
1.
Se utilizan las secuencias correspondientes a los receptores de vasopresina otorgados
previamente
por
el
profesor.
2.
Se analizan las secuencias en el programa Bioedit y se realiz un alineamiento mltiple
con la herramienta Muscle de este mismo programa para detectar la homologa.
3.
Posteriormente, en el mismo programa se obtiene una secuencia consenso, misma que
servir de sonda. La sonda obtenida fue de 135 nucletidos, y es la siguiente:
GATCTGGCGGTGGCGTTTTTTCAGGTGCTGCCGCAGCTGGCCTGGGATGCGACCTATCGTTTTCGTGGCC
CGGATGCGCTGTGCCGTGCGGTGAAATATCTGCAGATGGTGGGCATGTATGCGAGCAGCTATATG
4.
sta sonda se utiliza para realizar un alineamiento en la herramienta Blast-n para
obtener secuencias de inters con alto nivel de homologa. Con 90% de identidad, se
obtuvieron secuencias de Equus asinus (Burro), Nannospalax galili (Spalax), Equus caballus
(Caballo), especies del gnero Macaca (Macacos), Sus scrofa (Jabal), Aotus nancymaae
(Mono nocturno), Cercocebus atys (Mangabey), Saimiri boliviensis (Mono), entre otros.

Resultados
Luego de realizar el alineamiento, se determin la siguiente secuencia de 135
nucletidos que se encontraba muy conservada, esa misma fue seleccionada como
sonda al realizar la secuencia consenso:

Figura 1.- Alineamiento generado y regin seleccionada para realizar la secuencia consenso que ser utilizada como sonda.

La
secuencia
consenso
es
la
siguiente:
GATCTGGCGGTGGCGTTTTTTCAGGTGCTGCCGCAGCTGGCCTGGGATGCGACCT

ATCGTTTTCGTGGCCCGGATGCGCTGTGCCGTGCGGTGAAATATCTGCAGATGGTG
GGCATGTATGCGAGCAGCTATATG.
Con la sonda obtenida se realiz un alineamiento con BLAST-n intentado encontrar
organismos de inters en donde se puedan buscar duplicaciones o protenas similares:

Figura 2.- Resultado de la bsqueda de homlogos con ayuda de la sonda realizada, se puede observar tambin la excelente
identidad y similitud que presentan, as mismo el E-value es de muy buena calidad.

Se obtuvieron secuencias de Equus asinus (Burro), Nannospalax galili (Spalax), Equus


caballus (Caballo), especies del gnero Macaca (Macacos), Sus scrofa (Jabal), Aotus
nancymaae (Mono nocturno), Cercocebus atys (Mangabey), Saimiri boliviensis (Mono),
entre otros.
Algunos otros organismos de inters son los manejables en el laboratorio, donde se
pueda extraer y purificar la protena u homlogos, por ejemplo en conejos, ratas y
ratones, sin embargo, la sonda probablemente result ser muy conservada, puesto que
en la mayora de los resultados se aline con Homo sapiens, gorilas y chimpancs.
Para qu se podra utilizar esta sonda?
Las sondas suelen ser utilizadas en la bsqueda de genes por el mtodo de Gene
fishing el cual consiste en partir de una secuencia conservada o secuencia consenso
para encontrar homlogos en las bases de datos, en el caso particular de esta sonda
(Por ser muy conservada) se esperan resultados de organismos muy similares entre s,
como lo es el humano con los gorilas, chimpancs y monos principalmente. Esta sonda
podra ser utilizada para analizar el punto de vista evolutivo de la secuencia de los
receptores de vasopresina, pero al utilizar una sonda un tanto ms verstil, podran
encontrarse secuencias homlogas en organismos fcilmente manipulables en los
laboratorios de investigacin para lograr aislar, purificar y caracterizar la protena en
cuestin, en caso de que este mtodo resulte exitoso, se podra investigar sobre su
aplicacin en otros organismos como el humano, para as remediar el dao causado
por enfermedades que son repercusiones de la falta o deficiencia de esta protena en el
organismo.

a) En el caso de las sondas muy degeneradas, presentan una mayor versatilidad para la
bsqueda de organismos diferentes al grupo seleccionado para hacer la sonda, si es
muy degenerada existir una mayor probabilidad de que otras especies sean
portadoras al menos en su mayora por el alineamiento realizado.
b) Para el caso de las sondas muy conservadas como la realizada en esta prctica, se
obtendrn excelentes resultados en cuanto a la bsqueda de portadores homlogos, de
manera que sera un mtodo viable para analizar las diferencias y los cambios
evolutivos que han surgido con el paso del tiempo de la divergencia de estas especies.

Discusin.
En esta prctica se utilizaron 9 secuencias de receptores de vasopresinas de animales
para crear con ellas una sonda, con el fin de buscar secuencias homlogas. Esta se
realiz mediante un alineamiento con la herramienta bioinformtica Bioedit.
La sonda de nucletidos construida es de una longitud de 135 pares de bases (bp), de
acuerdo a Lewins, 1994 una sonda se debe de construir de un mnimo de 50 bp, por lo
que la sonda elaborada cumple perfectamente con esta caracterstica.
Las vasopresinas son hormonas pptidas producidas en el hipotlamo en el caso del
humano. La mayora se almacenan en la parte posterior de la glndula pituitaria
(neurohipfisis) con el fin de ser liberadas en la corriente sangunea, siendo algunas de
ellas liberadas incluso directamente en el cerebro (Alcaraz, 2001).
La vasopresina se encuentra relacionada con la oxitocina, ya que ambas cuentan con
una estructura muy similar, la cual difiere solamente en dos aminocidos (Gruber,
2013), es por ello que si se disminuye la especificidad del BLASTn, se encontrarn
algunas oxitocinas.
Las vasopresinas se encuentran de manera amplia en los seres vivos, tanto en
vertebrados como en invertebrados y de acuerdo a los anlisis efectuados se ha
determinado que la superfamilia de la vasopresina/oxitocina, provienen de una forma
ancestral an desconocida, sin embargo se conoce que el precursor de estas
hormonas se encontr en una Archaemetazoa, grupo del que divergieron los
vertebrados de los invertebrados hace unos 600 millones de aos (Kesteren et al.,
1992). Esto indica que las vasopresinas estan altamente conservadas, por lo cual
obtener una sonda y organismos homlogos de esta, es tarea fcil.
Aunque se encuentre en la mayora de los seres vivos embargo no todos los animales
expresan estos pptidos, de manera ms especfica vasopresina (Gruber,2013), por
ello que en el BLAST realizado se encontraron mayoritariamente ciertas especies de
animales, como es el caso de los mamferos, de manera ms especfica se encontr un
gran nmero de homnidos relacionados con la sonda. A parte de la primer razn ya
expuesta, esto tambin se puede deber a que la sonda se fabric con secuencias de

vertebrados, sin considerar a los pptidos similares a vasopresinas en los artrpodos,


anlidos, moluscos y nemtodos (Gruber, 2013), lo cual afecta o beneficia segn el
caso.
De acuerdo a la bibliografa actualmente ya existe un mtodo para encontrar a la
vasopresina, este consiste en disear primers de PCR contra las regiones intrnicas
como exnicas del gen transcrito, para de esa manera cuantificar los cambios entre los
intrones y el pre-mRNA en respuesta al estmulo hiperosmtico (Ponzio et al., 2007).
Las mutaciones en la vasopresina pueden conducir a diabetes inspida, a hemorragias
por vrices esofgicas, entre muchas otras patologas. En dado caso de llevar esta
sonda a nivel diagnstico esta pudiera resultar en un tipo de medicina preventiva,
personalizada (Carrillo et al., 2004).

Conclusiones.

Se logr el diseo de una sonda para identificar los homlogos del gen de
vasopresina.
Para que la sonda abarque tanto vertebrados como invertebrados es necesario
poner una cantidad equilibrada tanto de unos como de otros, esto con el
proposito de gnerar una sonda confiable para identificar los homologos a este
gen.

Literatura consultada
Alcaraz V.M. 2001. Estructura y funcin del sistema nervioso: Recepcin sensorial y
estados del organismo. 2 ed. Manual Moderno
Bridges, C.B. (1936) The Bar gene a duplication. Science, 83, 210 211.
CarrilloEsper R., GonzlezSalazar J.A., CalvoCarrillo B. 2004. Uso de la
vasopresina en el estado de choque. Gac Md Mx. 140 (1): 71-76
Gruber, C. W. (2013). Physiology of invertebrate oxytocin and vasopressin
neuropeptides. Experimental Physiology, 99(1), 55-61.
Hughes, A. L. (1994). The evolution of functionally novel proteins after gene duplication.
Proceedings of the Royal Society of London B: Biological Sciences, 256(1346), 119124.
Kesteren, R. E., Smit, A. B., Dirks, R. W., With, N. D., Geraerts, W. P., & Joosse, J.
(1992). Evolution of the vasopressin/oxytocin superfamily: Characterization of a cDNA
encoding a vasopressin-related precursor, preproconopressin, from the mollusc
Lymnaea stagnalis. Proceedings of the National Academy of Sciences, 89(10), 45934597.
Lewin B. 1994. Genes V. Oxford: Oxford University Press

Long, M. (2001) Evolution of novel genes. Current Opinion in Genetics & Development.
11, 673 680.
Ponzio, T. A., Yue, C., & Gainer, H. (2007). An intron-based real-time PCR method for
measuring vasopressin gene transcription. Journal of Neuroscience Methods, 164(1),
149-154.
Teichmann, S. A., & Babu, M. M. (2004). Gene regulatory network growth by
duplication. Nature genetics, 36(5), 492-496.
Zhang, J. (2003). Evolution by gene duplication: an update. Trends in ecology &
evolution, 18(6), 292-298.