You are on page 1of 2

Universidade Federal de Santa Catarina

Departamento de Ciências Biológicas


Introdução à Biologia Molecular

Alunas: Camila Konell


Joice de Souza
Luana da Costa
Paula Monteiro

Grupo de Estudos nº 04

1) Porque quando ocorre algum erro na síntese do RNA, o máximo que pode
acontecer (e isso nem sempre acontece) é que uma proteína sairá defeituosa –
esse erro, no entanto, não se perpetua para as operações futuras, pois após a
tradução, o RNAm é degradado. Como também existe mais de uma sequência
que codifica o mesmo aminoácido em alguns casos, o erro pode passar
despercebido (como na troca de UUU para UUC, ambos codificando a
fenilalanina). Por outro lado, erros no DNA se perpetuam para gerações futuras
na forma de mutações, e portanto a replicação de DNA emprega uma maior
maquinaria celular para corrigir erros.

2) Os fragmentos de tamanho crescente são pedaços de RNA sendo transcritos. A


transcrição ocorre da direita para a esquerda.

3) RNA polimerase I: localizada no nucléolo e transcreve as regiões do DNA que


contém os genes para RNA ribossômico – ou seja, sintetiza apenas RNAr.
RNA polimerase II: é a que sintetiza o RNAm citoplasmático, e está localizada
no nucleoplasma.
RNA polimerase II: é a que sintetiza o RNAt, e também se localiza no
nucleoplasma.
Todas as RNA polimerases tem varias subunidades e requerem fatores de
transcrição como proteínas auxiliares na síntese de RNA.

4) A alfa-amanitina é um peptídeo cíclico, uma das toxinas do grupo amatoxinas


mais letais. Ela tem uma atração forte e especifica pela TNA polimerase II. Essa
enzima tem hélices flexíveis, e essa flexibilidade é necessária para sua
translocação pela fita de DNA. A alfa-amanitina liga-se à RNA polimerase II e
confere a molécula uma certa rigidez, o que diminui a velocidade de
translocação e conseqüentemente a síntese de RNAm e novas proteínas.
A actinomicina-D é usada em biologia molecular para inibir a transcrição,
pois liga-se ao DNA no complexo de iniciação da transcrição e impede a ação da
RNA polimerase. Também pode se unir a fita dupla de DNA e impedir sua
replicação, evitando a abertura da fita. Em altas concentrações pode bloquear o
crescimento de algumas células, sendo então um forte agente terapêutico no
tratamento de alguns cânceres.
5) Levando-se em conta que não ocorre erros durante a inserção de aa e nenhum
passo é mudado e desperdiçado:
Para cada aa incorporado (exceto o primeiro)
Ativação dos RNSt = 2ATP
Ligação do RNAt ao sitio A = 1ATP
Translocação do peptídeo – RNAt = 1ATP / 4ATP (para cada aa)

Para cada molécula sintetizada


Iniciação = 1GTP
Terminação = 1GTP / 2ATP

Total para um peptídeo qualquer de tamanho n > 2+4x(n-1) ATP

a) 798 ligações fosfato de alta energia


b) 798-200= 598 ligações fosfato de alta energia

6) a) Puramicina: interrompe a tradução prematuramente. A puramicina mimetiza


um RNAt carregando um aa, e ao se ligar ao sítio A dos ribossomos, liga-se ao
término do peptídio nascente provoca sua liberação premaura. Age sobre
procariotos e eucariotos.
b) estreptomicina: em baixas concentrações causa erro de leitura e em altas
concentrações inibe a iniciação da síntese protéica. Ela liga-se a subunidade 30S
do ribossoma (proteína S12 e o RNAr 16S) e impede o início da síntese protéica
ao prevenir sua ligação com a subunidade maior. Age sobre procariotos.
c) Cloranfenicol: liga-se à subunidade ribossomal 50S e inibe a ligação do RNAt
e da peptidil transferase (que faz as ligações peptídicas), inibindo assim a
elongação. Age sobre procariotos.
d) tetraciclina: liga-se a subunidade ribossomal 30S (no sítio A) e impede a
ligação do RNAt ao complexo ribossômico de RNAm. Age sobre procariontes.
e) Toxina diftérica: é uma proteína que pode ser clivada em 2 fragmentos. O
menos contém a mono (ADP-ribose) transferase, que transfere a ADPribose ao
fator 2 de elongação de peptídeos, inibindo-o e, desse modo, inibindo a síntese
protéica.

7) GTATAAACTGGACAACCAGTTCGAGCTGGTGTTCGTGGTCGGTTTTCA
GAAGATCCCTAACGCTGACGTACGTAGACAAGTTGATAGATGATGTGCATC
GGCTGTTTCGAGACAAGTA.