You are on page 1of 5

Nutrition 32 (2016) 486–490

Contents lists available at ScienceDirect

Nutrition
journal homepage: www.nutritionjrnl.com

Basic nutritional investigation

Kaffir lime leaves extract inhibits biofilm formation
by Streptococcus mutans
Nateelak Kooltheat M.Sc. a, Ludthawun Kamuthachad B.Sc. a,
Methinee Anthapanya B.Sc. a, Natthapon Samakchan B.Sc. a,
Rungnapa Pankla Sranujit Ph.D. a, b, Pachuen Potup Ph.D. a, Antonio Ferrante Ph.D. c,
Kanchana Usuwanthim Ph.D. a, *
a

Cellular and Molecular Immunology Research Unit, Faculty of Allied Health Sciences, Naresuan University, Phitsanulok, Thailand
Thai Traditional Medicine College, Rajamangala University of Technology Thanyaburi, Pathum Thani, Thailand
c
Department of Immunopathology, SA Pathology at Women’s and Children’s Hospital, Robinson Research Institute, University of Adelaide, South
Australia
b

a r t i c l e i n f o

a b s t r a c t

Article history:
Received 6 May 2015
Accepted 12 October 2015

Objectives: Although kaffir lime has been reported to exhibit antioxidant and antileukemic activity,
little is known about the antimicrobial effect of kaffir lime extract. Because Streptococcus mutans
has been known to cause biofilm formation, it has been considered the most important causative
pathogen of dental caries. Thus, the effective control of its effects on the oral biofilm is the key to
the prevention of dental caries. The aims of the present study were to investigate the effect of kaffir
lime leaves extract on biofilm formation and its antibacterial activity on S. mutans.
Methods: We examined the effect of kaffir lime leaves extract on growth and biofilm formation of S.
mutans. For the investigation we used a kaffir lime extract with high phenolic content. The minimum inhibitory concentration of the extract was determined by broth microdilution assay. The
inhibitory effect of the test substances on biofilm formation was also investigated by biofilm formation assay and qRT-PCR of biofilm formation–associated genes.
Results: Kaffir lime leaves extract inhibits the growth of S. mutans, corresponding to the activity of
an antibiotic, ampicillin. Formation of biofilm by S. mutans was also inhibited by the extract. These
results were confirmed by the down-regulation of genes associated with the biofilm formation.
Conclusions: The findings highlight the ability of kaffir lime leaves extract to inhibit S. mutans
activity, which may be beneficial in the prevention of biofilm formation on dental surface, reducing
dental plaque and decreasing the chance of dental carries.
Ó 2016 Elsevier Inc. All rights reserved.

Keywords:
Kaffir lime
Biofilm formation
Streptococcus mutans
Minimum inhibitory concentration

Introduction
Biofilm formation by Streptococcus mutans, a gram-positive
bacterium, on tooth enamel is the foremost cause of dental
plaque and dental carries [1,2]. S. mutans has the ability to use
sucrose from consumed food as a biofilm-forming factor. Many
enzymes are involved in the biofilm formed by S. mutans. This
includes sucrose phosphorylase, glucosyltransferase, and

This work was supported by Naresuan University (R2556 C074) and the National Research Council of Thailand (R2557 B035).
Conflicts of interest: The authors declare no conflicts of interest.
* Corresponding author. Tel.: þ66 5596 6411; fax: þ66 5596 6234.
E-mail address: ajkarn_9@hotmail.com (K. Usuwanthim).
http://dx.doi.org/10.1016/j.nut.2015.10.010
0899-9007/Ó 2016 Elsevier Inc. All rights reserved.

fructosyltransferase. These enzymes can use sucrose to synthesize water-insoluble glucan and fructan for the adherence and
formation of biofilm by S. mutans [3]. S. mutans in the oral cavity
is the main cariogenic agent. The bacterium synthesizes an
insoluble glucan layer, involving glucosyltransferase (GTFase),
which accumulates in dental plaque and promotes formation of
dental caries. The virulence factors of S. mutans associated with
cariogenicity are a set of gtf genes. GTFase synthesizes glucan
polymers from sucrose that provide binding sites for bacterial
adhesion on the tooth surface and contribute to the formation of
dental plaque [2].
The use of biofilm inhibitors such as sodium fluoride against
S. mutans can effectively prevent the formation of its biofilm [4],
but high levels of sodium fluoride can be toxic. Some new agents

Mumbai. MA. When the bacteria reached log-phase growth. One hundred grams of fresh kaffir lime leaves was homogenized with sterile deionized water at the proportion of 1:5.5 mL of EXPRESS SuperScript Mix for One-Step qPCR. MA. Bacterial cells from each experimental condition were lysed using 1. RNAs of bacterial conditions were converted to their complementary DNAs by reverse transcription followed by real-time PCR. Twofold serial dilution of test substances was prepared. and the degree of biofilm formation was determined [15]..4 mL of 10 mmol/ L reverse primer as shown in Table 1 [16. and 4. for example. USA). antimicrobial. Kooltheat et al. Total RNA of each sample was quantified by measuring absorbance at 260 and 280 nm using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific Inc. is primarily grown in South Asia and Southeast Asia.. Kaffir lime leaves contain various classes of phytochemical substances. Thailand) was used in this study. For the Table 1 Oligonucleotide primers used in this study Gene Forward primer (50 / 30 ) Reverse primer (50 / 30 ) Sucrose phosphorylase (gtfA) Glucosyltransferase B (gtfB) Glucosyltransferase-I (gtfD) Histidine kinase two-component regulatory system (vicR) Competence-stimulating system (comDE) Fructosyltransferase (ftf) Guanosine tetra (penta)-phosphatesynthetase (relA) Biofilm-regulation protein (brpA) 16 S ribosomal RNA. Bacterial strain and growth conditions S.21 to 250 000 mg/mL of kaffir lime leaves extract. Gene expression analysis Expression of genes associated with biofilm formation of S. Total phenolic content was then determined as mg Pyrogallol equivalent/g of the extract. The supernatant was collected. mutans. and the plate was washed twice with 500 mL of PBS and air-dried.7 mL of RNase-free water. a plant belonging to the citrus family. 100 mL of 2% sodium carbonate solution was added and then the mixture was incubated for 60 min at 50 C.N. An extract of the leaves was prepared with a modification of the method from Agwaramgbo et al. vortex mixed. USA). After 24 h of incubation at 37 C with 5% CO2. and antiproliferative activity against cancer cells [11]. mutans in MHI broth containing 0. Ministry of Public Health. Absorbance of each well was measured at 550 nm using the microplate reader. After vigorously mixing. samples were separated into aqueous colorless and organic fractions.. Determination of total phenolic content The total phenolic content of the kaffir lime leaves extract was measured using the Folin-Ciocalteu method. and centrifuged at 7500  g for 5 min at 4 C. Using a 96-well plate. mutans was analyzed by one-step qRT-PCR assay using EXPRESS One-Step SYBR GreenER kits according to the protocol described by the manufacturer (Life Technologies Corporation). Briefly. A single isolated colony was then harvested.17]. the RNA was resuspended in ribonucleases-free water. such as extracts of Aralia continentalis (spikenard). Extract of kaffir lime leaves displays antioxidant.24 to 500 mg/mL of ampicillin sodium. ampicillin. USA). Using 24-well plates. 0. Waltham. With CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories. mutans was grown onto the brainheart infusion (BHI) agar plate (HiMedia Laboratories. NY. Inc. India) after incubation at 37 C with 5% CO2 for 24 h. the absorbance of the samples was measured at 600 nm using the microplate reader.5 mL of the extract was diluted with 100 mL of deionized water. with the objective of providing an alternative approach to prevent biofilm formation by S. sodium fluoride. Then 100 mL/well of acid-alcohol solution was added to dissolve the crystal violet dye from stained cells. washed once with 1. Finally. and a biofilm inhibitor. 5 mL of 1 ng/mL of template RNA. 0.). and 25 mL of the Folin-Ciocalteu reagent was added. The absorbance of the reaction was measured at 750 nm using a microplate reader (PerkinElmer Inc. The minimum inhibitory concentration (MIC) was defined as the first concentration of test substances that can inhibit bacterial growth. along with quantitation of biofilm formation–associated genes using 16s rRNA as qPCR signal normalization. planktonic cells and culture media were removed [7]. The aims of the present study were to investigate the effect of kaffir lime leaves extract on biofilm formation and its antibacterial activity on S.5 mL of 75% ethanol. 300 mL of chloroform was added to the sample tubes. 50 mL of each concentration of the diluted substances was added into 1  105 cfu/mL of S. S. Biofilm-forming cells were stained with 100 mL/well of 0. modified from Chang et al. Bacterial RNA extraction Total RNA from S. The concentration of bacteria was adjusted with BHI broth before use in experiments. / Nutrition 32 (2016) 486–490 have been of interest because of their ability to inhibit biofilm formation of periodontal pathogens. After 24 h of incubation at 37 C with 5% CO2. Grand Island. Thailand. 0. mutans. Kaffir lime (Citrus hystrix). Using a 96well plate. qRT-PCR started with the cDNA synthesis at 50 C for 5 min followed by the denaturation of template cDNA at 95 C for 2 min. The use of natural products has also been proposed for inhibition of biofilm formation. For phase separation. the use of oxantel for the disruption of polymicrobial biofilm [5] or the use of the antimicrobial peptide Bac8c to control the formation of biofilm [6]. and centrifuged at 3000  g for 15 min. The plate was washed twice with 500 mL of PBS and taped on a paper towel to remove excess buffer. lyophilized using a freeze dryer (Thermo Fisher Scientific Inc. This was mixed with 750 mL of isopropanol. and Curcuma longa (turmeric) [7–9]. including terpenoids [10]. [13]. USA). Camellia sinensis (tea). mutans of each condition was extracted using TRIzol reagent. including 0. 0.49 to 1000 mg/mL of sodium fluoride. Materials and methods Preparation of kaffir lime leaves extract Fresh leaves of kaffir lime were collected in Phitsanulok. Then tubes were centrifuged at 12 000  g for 15 min. After 5 min of incubation at room temperature. followed by centrifugation at 12 000  g for 10 min at 4 C. normalizing internal standard (16s rRNA) AGGAAGTGAAGCGGCCAGT AGCAATGCAGCCAATCTACAAAT ACAGCAGACAGCAGCCAAGA TGACACGATTACAGCCTTTGATG ACAATTCCTTGAGTTCCATCCAAG AAATATGAAGGCGGCTACAACG ACAAAAAGGGTATCGTCCGTACAT GGAGGAGCTGCATCAGGATTC CCTACGGGAGGCAGCAGTAG TCAATACGGCCATCCAAATCA ACGAACTTTGCCGTTATTGTCA ACTGGGTTTGCTGCGTTTG CGTCTAGTTCTGGTAACATTAAGTCCAATA TGGTCTGCTGCCTGTTGC CTTCACCAGTCTTAGCATCCTGAA AATCACGCTTGGTATTGCTAATTG AACTCCAGCACATCCAGCAAG CAACAGAGCTTTACGATCCGAAA . Biofilm formation assay Inhibitory activity of kaffir lime leaves extract on the biofilm formation of S. the number of bacteria was estimated by optical density reading at 600 nm using a microplate reader (PerkinElmer Inc.5 mL of TRIzol reagent with several times of updown pipetting after incubation at room temperature for 5 min. mutans was examined along with a gram-positive antibiotic. Percentage of growth inhibition was calculated relative to the untreated control. and 12.1% sucrose was plated at the concentration of 5  105 cfu/mL in either the presence or absence of the test substances. mutans ATCC 25175 (Department of Medical Sciences. The precipitated RNA pellets were collected. 2. Kaffir lime leaves and fruit have been used for cooking and traditional medicine. antiinflammatory. and cultured in 3 mL of BHI broth under the same conditions. [12]. Then the staining solution was discarded. and stored at 20 C in an airtight container.). according to protocol described by the manufacturer (Life Technologies Corporation.1% crystal violet for 15 min. The extract was then filtered to remove the residue. 20 mL of reaction contains 10 mL of EXPRESS SuperScript qPCR SuperMix. mutans. and the aqueous phase was transferred to a new tube. planktonic culture of S. 487 Determination of minimum inhibitory concentrations The broth dilution antimicrobial test was performed according to the standard guidelines [14]. The extract was dissolved in deionized water to a concentration of 100 mg/mL.4 mL of 10 mmol/L forward primer.

2. sodium fluoride. Statistical analyses: * P < 0. Ampicillin sodium. as determined by biofilm formation assay.1 nt re at ed C Percentage of Growth Inhibition MIC 80 ns 120 Percentage of Growth Inhibition 100 50 0 Substance Concentration (μ g/ml) Fig. sodium fluoride. Gene expression was analyzed by normalized gene expression using the 2DDCT method [18]. Biofilm inhibitory concentration (BIC) and percentage of biofilm inhibition of ampicillin sodium. ns.488 N. CA. A Percentage of Biofilm Inhibition Experimental design and statistical analysis (Fig.01 by ANOVA. .01 by ANOVA. sodium fluoride. mutans..45  0. Percentage of Biofilm Inhibition amplification of the DNA. Sodium Fluoride on tr ol Kaffir lime leaves extract Ampicillin μg Results 100 62 . and 62 500 mg/mL for kaffir lime leaves extract BIC 60 /m MIC was determined by the broth microdilution method using 1  105 cfu/mL of S. The result showed that 250 mg/ mL of ampicillin sodium. Fig. presented as mean  SEM. and 7. compared with non-treated control. 1. Statistical analyses: *P < 0. Results were statistically analyzed for their significance using GraphPad Prism (GraphPad Software.50 mg/mL for ampicillin sodium. La Jolla. Cycle threshold (CT) of the reaction was measured by detecting the fluorescence intensity of SYBR Green dye at the end of polymerization steps.1% sucrose. Percentages of inhibition at the MIC of substances are shown in Figure 1B. The total phenolic content of the extract was 52.1 1 10 100 1000 10000 100000 Substance Concentration (μ g/ml) B ns 100 * 80 * 40 20 μg 25 00 62 50 lS /m Fl ci pi m od iu m lA ea te d uo r id e lK af fe rL im e lli n 0 nt r U * 60 C Inhibition of biofilm formation Inhibitory activity on bacterial biofilm was assessed by biofilm formation assay using S. All the values are expressed as mean  SEM. Results were calculated from triplicate data representing three independent experiments. 2A). 1A). not significant. Results were calculated from triplicate data representing three independent experiments. presented as mean  SEM. and kaffir lime leaves extract. and kaffir lime leaves extract. and kaffir lime leaves extract were used in the study for inhibitory activity. Kooltheat et al. The percentages of inhibition of these MIC concentrations are shown in Figure 2B. ns. 500 mg/mL for sodium fluoride. and 125 000 mg/mL of kaffir lime leaves extract inhibited the growth of S.5 All experiment conditions were performed in triplicate and three independent sets of experiment were conducted. One-way ANOVA was used for data comparison between experimental conditions. Minimum inhibitory concentration (MIC) and percentage of growth inhibition against Streptococcus mutans of ampicillin sodium. / Nutrition 32 (2016) 486–490 A B MIC 60 40 Ampicillin Sodium Fluoride * * 80 60 40 20 0 Kaffir Lime 20 * 100 on tr ol l μg A m /m p lS ic ill od in iu 12 m 50 Fl 0 uo μg r id /m e lK af fir Li m e MIC 10 100 1000 10000 100000 /m μg 25 0 1 U 0 0. mutans (Fig. Inc.35 g was recovered in the aqueous fraction. not significant. 40 cycles of denaturation at 95 C for 15 s and annealing-polymerization at 60 C for 1 min were performed. BIC 40 20 0 0.01). The result showed that the MIC was 62. compared with non-stimulated control. 500 mg/mL of sodium fluoride. as determined by the broth microdilution method. BIC μg Minimum inhibitory concentration Kaffir Lime 80 /m One hundred grams of fresh kaffir lime leaves was extracted with deionized water.41 mg Pyrogallol equivalent/g of dry extract. USA) with a confidence interval of 99% (P ¼ 0. mutans in MHI broth culture supplemented with 0. The total phenolic content of the extract was determined by the FolinCiocalteu method.

was significantly down regulated (P < 0. ftf gene families. or kaffir lime leaves extract. kaffir lime leaves extract contains naturally occurring substances with an anti–biofilm formation activity. Among numerous virulence factors.6-linked glucans and fructan from sucrose. a regulatory gene of the gtf gene family. Using biofilm inhibitors such as sodium fluoride against S. the increasing emergence of antibioticresistant strains presents a major burden to the community. a gene that encodes the quorum-sensing cascade-associated competence-stimulating peptides. Relative to Control * 1. gtfB.21]. and macromolecules [19].0 * 0. . but high levels of sodium fluoride can be toxic and cause skeletal fluorosis. gtfD. The results showed that the expression of gtfA. Results were from triplicates. Expression of genes. a-1. Glucosyltransferaseencoding genes. / Nutrition 32 (2016) 486–490 1. mutans that had been treated with ampicillin sodium. relA.01 by ANOVA. Our data suggest that the kaffir lime extract.6 * * * 0. brpA. phenolic compounds can inhibit bacterial adherence to the tooth surface by reducing hydrophobicity and inhibition of glucosyltransferase [20]. the gtfA gene. vicR. This result indicates that the extract can inhibit biofilm formation by S. The expression of gtf genes after kaffir lime treatment was of the order of fivefold relative to the untreated control. These results indicated that the inhibition of the biofilm formation of S. vicR. by inhibiting bacterial gtf genes.4 0.8 * 0. qRT-PCR was performed to evaluate the influence of the extract on the genes related to biofilm formation of S. relA. sodium fluoride. and this effect was comparable to that of both ampicillin sodium and sodium fluoride. as well as fructosyltransferaseencoding genes.2 Control 62. *P < 0. most likely through its high phenolic content.0 gtfA gtfB gtfD vicR comDE ftf relA brpA Fig. comDE. Here we demonstrate that fresh kaffir lime leave extract with high phenolic content inhibited the growth and biofilm formation of S. RelA. compared with non-treated control. was also depressed. Expression of genes associated with biofilm formation of S. ftf. Discussion Although antibiotics play a major role in combating many bacterial infections. These results indicate that kaffir lime leave extract can reduce the extracellular polysaccharide matrix necessary for biofilm formation [16. Polyphenol can interact with microbial membrane proteins. This has generated interest in the development of alternative antimicrobial agents.3-linked. A marked decrease in bacterium-induced bioflim formations by kaffir lime leave extract was seen at a twofold lower concentration of the bacterial growth MIC. This would affect the ability of S. gtfD.01) in S. resulting in the inhibition of biofilm formation [7]. Similarly. mutans. 3). The result suggests that antimicrobial activity of kaffir lime leave extract has potential clinical application for preventing and treating dental caries. second. were down regulated.N. Lastly. ions. ftf. and comDE was down regulated by kaffir lime leave extract. mutans through the inhibition of virulence factors. and comDE. mutans as determined by qRT-PCR. There was a similar inhibition of other genes by all substances (Fig. mutans by inhibited bacterial cell wall synthesis. which promotes bacterial accumulation to dental plaque and cariogenicity. was also down regulated. enzymes. Gene expression analysis Expression of genes associated with biofilm formation of S. was down regulated by kaffir lime leave extract. Kooltheat et al. Kaffir lime is a naturally occurring polyphenolic compound that is an alternative antimicrobial. mutans was determined by one-step qRT-PCR. which is likely to cause reduced use of sucrose for production of extracellular glucan and fructan polysaccharide in biofilm formation by S.2 * * * * * * * * * * ** ** * * ** 0. gtfB and gtfD. mutans by two mechanisms: first. mutans can prevent the formation of biofilm. Moreover. Thus. including gtfA. Ampicillin can kill S. mutans by the extract was through the regulatory genes and the quorum-sensing cascade [16]. a bacterium responsible for dental caries. a regulatory gene responsible for sucrose-dependent biofilm formation. and lipids altering cell permeability and cause loss of protons. To determine the effect of kaffir lime leave extract on bacterial virulence gene expression. brpA. by a direct antimicrobial effect and. prevents bioflim formation of S. such as GTFase required for the glucan layer formation. 3. a gene associated with the physiology of the bacteria.50 μ g/m l Am picillin 489 500 μ g/m l Sodium Fluoride 6250 μ g/m l Kaffer Lim e Extract Expression Fold Change. a sucrose phosphorylase gene. mutans to produce a-1. mutans [17]. The vicR gene. representing three independent experiments. and brpA. were also down regulated. gtfB. mutans.

Personal care composition containing “yeast/ resveratrol ferment” extract. Nguyen AH. Park BI. Mitchell H.58:378–85. [14] Clinical and Laboratory Standards Institute.6:3572–86. Supercritical fluid extraction and gas chromatographic-mass spectrometric analysis of terpenoids in fresh kaffir lime leaf oil. Huang P. Chen MW. Keum KS. Pinto G. Chiang Mai J Sci 2012. Steinberg D.52C:61–7. Song KY. Fan M. approved standarddninth edition.2012:984295.47:539–47. Accurate RT-qPCR gene expression analysis on cell culture lysates. Curcumin reduces Streptococcus mutans biofilm formation by inhibiting sortase A activity. Moreinos D. Molecules 2011. Lin CS. [2] Zhao W.320:110–7. However. biofilm formation and cell size of Streptococcus mutans. Evid Based Complement Alternat Med 2013. [4] Pandit S. [9] Hu P. Nutrients 2014. Pennsylvania: Clinical and Laboratory Standards Institute. mutans. [3] Bitoun JP. [20] Rao S. Pripdeevech P. Shemesh M. Jeon JG. Tima S.5:206–11. Kaurenoic acid from Aralia continentalis inhibits biofilm formation of Streptococcus mutans. Fan Y. Featherstone J. Chen Z. Okegbe T. Potential mechanisms for the effects of tea extracts on the attachment. [10] Norkaew O. [13] Chang CL. Evid Based Complement Alternat Med 2012. Rezapoor-Lactooyi A. Amato I. Kang SY. Vandesompele J. [21] Yousefi B. ShoaeHassani A. Hydroxy decenoic acid down regulates gtfB and gtfC expression and prevents Streptococcus mutans adherence to the cell surfaces. [11] Chueahongthong F. Genetic and physiological effects of noncoherent visible light combined with hydrogen peroxide on Streptococcus mutans in biofilm. Ogburie V. Okonogi S. [6] Ding Y. brpA. Pollio A. Jiang W. Pitija K.490 N. Gruber JV. Wen ZT. virulence factors. Li W. [19] Ferrazzano GF. Antimicrob Agents Chemother 2008. Tong Z. Peptides 2013. Biofouling 2013. J Med Plant Res 2011. has been widely used for daily cooking in South Asia and Southeast Asia. Phytochemical characteristics. Our findings suggest that kaffir lime leaves have high phenolic content. Effect of sucrose concentration on sucrose-dependent adhesion and glucosyltransferase expression of S.11:21. Role of sortase in Streptococcus mutans under the effect of nicotine. and comDE associated with biofilm formation and physiology of S. 2011:e2437. Dykes GA. Lai GH. Walsh K. Kim BS. Arch Oral Biol 2013. which acts as an antimicrobial substance and inhibits biofilm formation. Brooks GJ. Plant polyphenols and their anti-cariogenic properties: a review. Amiri N. Relationship between fluoride concentration and activity against virulence factors and viability of a cariogenic biofilm: in vitro study.40:240–7. Oxantel disrupts polymicrobial biofilm development of periodontal pathogens. Microbiology 2007. References [1] Li MY. J Vis Exp. Igwe S. Cytotoxic effects of crude kaffir lime (Citrus hystrix. / Nutrition 32 (2016) 486–490 Kaffir lime. relA. Caries Res 2013. Kooltheat et al. [16] Steinberg D. Ghaderi S. [18] Van Peer G. Lee KH. This is the first demonstration that a phenolic-rich kaffir lime leaves extract inhibits GTFase-encoding genes. mutans in children with severe early-childhood caries (S-ECC). Mod Chem Appl 2013. Int J Oral Sci 2013. Ingenito A. Zarrelli A. Burne RA. and regulatory genes vicR. [15] O’Toole GA. free radical scavenging activities. O’Brien-Simpson N.WO2010011885 A1. Conclusions The findings reveal the inhibitory activity of kaffir lime leaves extract on growth and biofilm formation of S. Kim HJ. the use of kaffir lime leaves extract may change the bacterial flora. Tam A. Thus. et al. Lee SM. [17] Shemesh M.29:307–18.52:2626–31. [8] Wang Y. DC.5:3097–105. Differential gene expression profiling of Streptococcus mutans cultured under biofilm and planktonic conditions. Ann Clin Microbiol Antimicrob 2012. FEMS Microbiol Lett 2011. and the consequence of this will need to be considered. Lin J.) leaf fractional extracts on leukemic cell lines. et al. Liu SW. Sci Rep 2012.S. Kuang R. U.153:1307–17. and neuroprotection of five medicinal plant extracts.2013:160592. Paolini R. Wright T. Feuerstein O. et al. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Antimicrob Agents Chemother 2014. especially in Thai and Malaysian recipes such as soups and curries. Huang RJ. a citrus fruit. Zhou XD. Wang W. [7] Jeong SI. Verdi J. Pat Appl Pub 2010. kaffir lime leaves may be used as an alternative treatment for biofilm formation on dental surface to reduce dental plaque and decrease the chance of dental carries. 2012. Mestdagh P. [5] Dashper S. Sookwong P. . Microtiter dish biofilm formation assay. Wo S.2:222. Antimicrobial and anti-biofilm effect of Bac8 c on major bacteria associated with dental caries and Streptococcus mutans biofilms.58:1343–8. Transcriptional repressor Rex is involved in regulation of oxidative stress response and biofilm formation by Streptococcus mutans. Inhibition of the oxidation of acetophenone by aqueous extracts of edible fruits and vegetables. Anuchapreeda S. Gregory RL. [12] Agwaramgbo L. Ampasavate C. Yu D. mutans.16:1486–507.1:105.