You are on page 1of 28

La muerte

y sus ventajas

156
LA
CIENCIA
PARA
TODOS

VARIA

MARCELINO CEREIJIDO
FANNY BLANCK-CEREIJIDO

NUEVA EDICIN

LA MUERTE
Y SUS VENTAJAS

Comit de seleccin de obras


Dr. Antonio Alonso
Dr. Francisco Bolvar Zapata
Dr. Javier Bracho
Dr. Juan Luis Cifuentes
Dra. Rosalinda Contreras
Dra. Julieta Fierro
Dr. Jorge Flores Valds
Dr. Juan Ramn de la Fuente
Dr. Leopoldo Garca-Coln Scherer
Dr. Adolfo Guzmn Arenas
Dr. Gonzalo Halffter
Dr. Jaime Martuscelli
Dra. Isaura Meza
Dr. Jos Luis Morn
Dr. Hctor Nava Jaimes
Dr. Manuel Peimbert
Dr. Jos Antonio de la Pea
Dr. Ruy Prez Tamayo
Dr. Julio Rubio Oca
Dr. Jos Sarukhn
Dr. Guillermo Sobern
Dr. Elas Trabulse

La Ciencia
para Todos
Desde el nacimiento de la coleccin de divulgacin cientfica del
Fondo de Cultura Econmica en 1986, sta ha mantenido un ritmo
siempre ascendente que ha superado las aspiraciones de las personas e instituciones que la hicieron posible. Los cientficos siempre
han aportado material, con lo que han sumado a su trabajo la incursin en un campo nuevo: escribir de modo que los temas ms complejos y casi siempre inaccesibles puedan ser entendidos por los estudiantes y los lectores sin formacin cientfica.
A los diez aos de este fructfero trabajo se dio un paso adelante,
que consisti en abrir la coleccin a los creadores de la ciencia que se
piensa y crea en todos los mbitos de la lengua espaola y ahora
tambin del portugus, razn por la cual tom el nombre de La
Ciencia para Todos.
Del Ro Bravo al Cabo de Hornos y, a travs de la mar ocano, a la
Pennsula Ibrica, est en marcha un ejrcito integrado por un vasto
nmero de investigadores, cientficos y tcnicos, que extienden sus actividades por todos los campos de la ciencia moderna, la cual se encuentra en plena revolucin y continuamente va cambiando nuestra
forma de pensar y observar cuanto nos rodea.
La internacionalizacin de La Ciencia para Todos no es slo en
extensin sino en profundidad. Es necesario pensar una ciencia en nuestros idiomas que, de acuerdo con nuestra tradicin humanista, crezca
sin olvidar al hombre, que es, en ltima instancia, su fin. Y, en consecuencia, su propsito principal es poner el pensamiento cientfico en
manos de nuestros jvenes, quienes, al llegar su turno, crearn una
ciencia que, sin desdear a ninguna otra, lleve la impronta de nuestros pueblos.

Marcelino Cereijido
Fanny Blanck-Cereijido

LA MUERTE
Y SUS VENTAJAS

la

ciencia/156
para todos

Primera edicin (La Ciencia desde Mxico),


Segunda edicin (La Ciencia para Todos),
Tercera edicin,
Cuarta edicin,
Primera reimpresin,

1997
1999
2002
2011
2012

Cereijido, Marcelino, y Fanny Blanck-Cereijido


La muerte y sus ventajas / Marcelino Cereijido y Fanny Blanck-Cereijido. 4a ed.
Mxico : fce, sep, Conacyt, 2011
190 p.: ilus. ; 21 14 cm (Colec. La Ciencia para Todos ; 156)
Texto para nivel medio superior
ISBN 978-607-16-0645-7
1. Muerte 2. Biologa 3. Divulgacin cientfica I. Blanck-Cereijido, Fanny, coaut. II. Ser.
III. t.
LC BF789 .D4

Dewey 508.2 C569 V.156

Distribucin mundial
La Ciencia para Todos es proyecto y propiedad del Fondo de Cultura Econmica,
al que pertenecen tambin sus derechos. Se publica con los auspicios
de la Secretara de Educacin Pblica y del Consejo Nacional de Ciencia y Tecnologa.
D. R. 1997 Fondo de Cultura Econmica
Carretera Picacho-Ajusco 227, 14738, Mxico, D. F.
www.fondodeculturaeconomica.com
Empresa certificada iso 9001:2008
Diseo de portada: Paola lvarez Baldit y Fabiola Carrasco
Comentarios y sugerencias: editorial@fondodeculturaeconomica.com
Tel.: (55)5227-4672. Fax: (55)5227-4640

Se prohbe la reproduccin total o parcial de esta obra, sea cual fuere


el medio, sin la anuencia por escrito del titular de los derechos.

ISBN 978-607-16-0645-7
Impreso en Mxico Printed in Mexico

A Antoita, Ceci
y Luquitas

NDICE

Introduccin . . . . . . . . . . . . . . . . . . . . . . . . . . . .
I.
II.
III.
IV.
V.
VI.

La muerte de las clulas . . . . . . . . . .


La muerte de los organismos . . . . . . .
La muerte de los seres humanos . . . . .
Psicologa del envejecimiento . . . . . . .
El papel de la muerte en la vida psquica
Y t, qu edad tienes? . . . . . . . . . . .

Apndice I . . . . . . . . . . . . . . . .
Apndice II . . . . . . . . . . . . . . . .
Apndice III . . . . . . . . . . . . . . .
Apndice IV . . . . . . . . . . . . . . .
Apndice V . . . . . . . . . . . . . . . .
Apndice VI . . . . . . . . . . . . . . .
Apndice VII . . . . . . . . . . . . . . .
Apndice VIII . . . . . . . . . . . . . .
Apndice IX . . . . . . . . . . . . . . .
Eplogo . . . . . . . . . . . . . . . . . . .
Bibliografa y lecturas recomendadas

.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.

11

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

. 17
. 42
. 77
. 97
. 111
. 131

.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.

137
140
147
150
156
159
161
167
172
179
181

INTRODUCCIN

T morirs y en este libro trataremos de explicarte por qu y


cmo. Pero aun en el caso de que no te interese de manera personal, el tema de la muerte es tan imprescindible para comprender el funcionamiento de la vida, la mente y la sociedad, que
sera aconsejable que lo incorpores a tu visin del mundo. Permtenos justificar dicho consejo, a travs de algunos ejemplos:
Primer ejemplo. La diversidad de organismos que habitan el
planeta es exuberantemente exagerada: as, hay bichos que vuelan por los difanos aires tropicales y bichos que reptan por las
obscuridades del intestino de los cerdos, que viven a decenas de
grados bajo cero en los casquetes polares o a temperaturas cercanas a la ebullicin del agua en las bocas de fuentes termales,
que pesan menos de un miligramo o que desplazan ciento cincuenta toneladas, que atraviesan el Atlntico a nado o pasan su
existencia enclaustrados en la grieta de una roca, organismos
que tienen savia, hemolinfa o sangre, que observan con ojos una
realidad estereoscpica y a colores o que no tienen la menor
sensibilidad a la luz, que pueden consumir hidrocarburos de petrleo o que se intoxicaran con ellos, que siguen desde hace cientos de millones de aos sin cambiar casi su estructura o que
adoptaron la actual hace menos de un siglo, que son hembras o
11

machos, que celebran el Da de las Madres o que las devoran en


cuanto nacen, que meditan sobre metafsica o que no tienen siquiera una neurona. Pero, a pesar de esas diferencias tan extremas, todos ellos comparten la caracterstica de ser mortales.
Por eso a primera vista sorprende que la muerte, con ser uno
de los fenmenos biolgicos ms universales y sin duda el ms
drstico, pues tiene absoluta prioridad e interrumpe cualquier
otro proceso vital, sea uno de los temas menos estudiados por
la biologa. En comparacin, la produccin de seda, que slo
ocurre en ciertas clulas de ciertas glndulas de ciertos gusanos,
ha sido muchsimo ms investigada y comprendida por la biologa que la misma muerte.
En cambio, la muerte ha sido tratada frecuente, amplia e intensamente por la teologa y todas y cada una de las manifestaciones del arte, desde la dramaturgia a la plstica y desde el folclor ancestral hasta la literatura erudita. Pero la sorpresa pierde
su impacto si se tiene en cuenta que, precisamente, la muerte
ha sido siempre considerada como algo ajeno a esa vida de la
que se ocupa la biologa, y que ha sido tomada en cambio como
resultado de un designio divino, de una enfermedad circunstancial, de un contagio azaroso, de una contingencia blica o de
un accidente fortuito; es decir, de algo extravital que viene a
interrumpir el curso de una vida intrnsecamente eterna.
En los ltimos aos, como parte de ese proceso de biologizacin casi total del conocimiento, que tiende a considerar al
hombre poco menos que como una marioneta de la evolucin,
el estudio de la muerte por parte de la biologa ha cobrado un
mpetu notable y ha comenzado a describir un panorama inusitado, que nadie imaginaba, que tiene profundas implicaciones
tanto biolgicas como culturales, y que describiremos someramente en este libro.
Segundo ejemplo. La muerte te concierne porque t vas a morir a no ser que la observacin del escritor Jorge Luis Borges
12

te estimule a acariciar esperanzas: Las pruebas de la muerte


son estadsticas; luego nadie est a salvo de llegar a ser el primer
inmortal. Conviene que te enteres de que todas y cada una de
tus clulas llevan genes programados para matarla en cuanto
surja la necesidad, es decir, genes que se coordinan para matarla. Ahora bien, la evolucin tiende a eliminar los genes que
confieren cualidades negativas (las que hacen que el organismo
sea espstico, o no resista infecciones, o tenga un mecanismo de
coagulacin imperfecto). En cambio, los que son imprescindibles para vivir, u otorgan alguna ventaja en la lucha por la vida
tienden a conservarse. Ms an, algunos genes aparecieron tempranamente en la evolucin, cuando el organismo ms complejo de la Tierra constaba apenas de una clula y no existan
an las neuronas, y es tanta la ventaja que esos genes otorgaron a
los seres, que de ah en adelante todos los organismos vinieron
equipados con ellos (decimos: se conservaron). Pues bien: los
genes que participan en la muerte celular programada aparecieron muy tempranamente y se conservan hasta hoy en da.
Cabe entonces la pregunta: qu ventaja otorga la muerte? En
este libro trataremos de explicarte qu saben hoy los bilogos y
psiclogos de esa muerte determinada por los genes de la muerte, y si es cierto que los cientficos le estamos encontrando ventajas, o si es una manera impertinente y cursi de plantear las
cosas.
Tercer ejemplo. Al finalizar un siglo y sobre todo un milenio,
los historiadores miran hacia atrs y sealan peculiaridades
como: Los siglos vi al iv antes de Cristo se caracterizaron por
el apogeo de la cultura griega, que sent las bases de la filosofa; El xv estuvo marcado por el descubrimiento de Amrica; El xix fue el siglo de la dinmica. Luego, cuando tratan
de predecir cmo habrn de sealar dentro de mil aos el siglo
xx, afirman: Fue el siglo en el que comenz a desentraarse la
estructura del tomo, o Se descubri el cdigo secreto del ge13

noma. sos fueron logros trascendentales, qu duda cabe, pero


estamos seguros de que tambin se habr de sealar al presente
como el Siglo de la Muerte. Con eso queremos decir que, hasta
ahora, la muerte haba sido considerada como algo ajeno a la
vida, un misterio siniestro cuyo mismsimo nombre se eluda
recurriendo a eufemismos (La Parca, La Pelona, La Guadaa, El Sueo Eterno, El Ms All) y hasta se le negaba
(A las 8:25 Eva Duarte pas a la Inmortalidad), pero que de
ah en adelante se comenzaron a entender sus mecanismos y
ventajas. En este libro trataremos de justificar la tremenda importancia de dicho cambio.
Cuarto ejemplo. Si hay una especie que se llama Homo sapiens,
es porque hubo una larga evolucin biolgica que lo gener.
Son muchos los factores que se han investigado en la bsqueda del motor que impuls ese proceso evolutivo. Uno de los
ms plausibles es el que Richard Dawkins ha llamado el gen
egosta, sobre el cual podra decirse, con propsitos didcticos: todo gen busca perpetuarse, es decir, que a veces confiere ventajas al organismo que lo porta para que ste deje descendencia y con ello reproduzca el gen en cuestin. En esa
vena, se ha llegado a decir que la gallina no es ms que una
estrategia, un truco del huevo para hacer otro huevo. Con esta
ptica, los genes luchan por la vida como una forma de trascender a la muerte, y fue as como evolucionaron hasta generarnos a todos.
Por eso el hallazgo de los genes letales que hemos mencionado en el segundo ejemplo, es decir, genes cuya funcin
especfica es matar a la clula que los contiene, constituye uno
de los hallazgos cientficos ms trascendentales de todos los
tiempos pues, permtenos repetir, no se trata de que haya algunas clulas que los tengan, sino que todas las de tu organismo los tienen y en buena hora, pues sin ellos hoy no habra
personas.
14

Quinto ejemplo. El sentido temporal nos permite calcular qu


va a suceder en el futuro y adecuarnos para sobrevivir. Ese futuro puede estar tan prximo como el planteado cuando evaluamos si conviene cruzar la avenida ahora, o es prudente esperar a que pase aquel automvil blanco; o tan distante como el de
montar una cmara en un cohete que se dispara hoy, pero que
habr de tomar fotos a Saturno dentro de diez aos, o que dentro
de tantos millones de aos el Sol se convertir en una estrella
roja gigante que nos aniquilar. El ser humano tiene una capacidad tan grande de ver su propio futuro, que llega a convencerse de que tarde o temprano habr de morir. Este convencimiento lo angustia, y se apacigua inventando religiones. No hay
ni hubo civilizacin sin creencias msticas, y no hay ni hubo
religin que no reserve un lugar central y pormenorizado sobre
el destino post mortem. La muerte es por eso considerada como
uno de los motores de la civilizacin.
De modo que si t has de morir y la muerte es, junto con el
nacimiento, el fenmeno biolgico ms constante y generalizado de la vida, si la muerte codificada en esos genes ha impulsado
una evolucin que un da te gener a ti y si, por ltimo, esa
muerte te ha civilizado, es bueno que sepas qu se sabe hoy sobre ella. Por otra parte, t perteneces a una generacin que, tal
como exponemos en el cuarto ejemplo, ha de pasar a la historia como la que comenz a entender la biologa y la psicologa
de la muerte, y hasta es posible que maana te integres a la
comunidad de investigadores que la estudian cientficamente.
La muerte y el envejecimiento vertebran toda una industria
funeraria, una farmacutica, una cosmtica, hacen que corramos,
nademos y practiquemos deportes cada maana para mantenernos jvenes y sanos; nos hacen seleccionar cuidadosamente
los alimentos que tienen fibras no digeribles, vitaminas y elementos esenciales, que contienen poco colesterol; nos hacen
adquirir hbitos higinicos y hasta seleccionar cuidadosamente
nuestras ropas y el hbitat en que transcurre nuestra vida. La
15

muerte y el envejecimiento que la precede son elementos demasiado centrales de la ciencia y la cultura como para que slo
sean abordados por la biologa, la psicologa y la historia. Tambin se ocupan de ella las artes y quienes seleccionan nuestros
mitos religiosos y estrategias blicas. Esto nos lleva a la conclusin de que un libro sobre la muerte y la vejez es por fuerza incompleto, pues apenas puede abarcar una cantidad irrisoria de
la informacin disponible.
Esa certeza de incompletud nos llev a adoptar un hilo narrativo breve y sencillo, y relegar a los apndices conceptos o temas
tradicionalmente relacionados con la vida y la muerte, cuya inclusin dilatara o distraera una comprensin elemental.
Este libro es consecuencia de algunos anteriores,1 de artculos
y conferencias pronunciadas ante bilogos, mdicos, psiclogos,
filsofos y hasta de nios de menos de diez aos, que fueron discrepando hacindonos preguntas, a veces inslitas, de esas que
llevan a indagar por qu la gente pensar as de la muerte, trayendo a colacin nuevos aspectos, que ayudaron a detectar partes
oscuras, y a pulir nuestros puntos de vista. De modo que es demasiado grande el nmero de personas a quienes deberamos
expresar aqu nuestro agradecimiento. Con todo queremos reconocer la lectura de sucesivos manuscritos a Ana Barahona, Mario Bronfman, Margarita y Fabin Cereijido, Luis Covarrubias,
Rubn G. Contreras, Maxine Gonzlez Enloe, No Jitrik, Ana
Langer, Federico Ortiz Quesada, Alejandro Peralta Soler, Daniel
Piero, Laura Reinking, Diana Rozensfaig, Jaime Seplveda, Gabriela Simn y Jess Valds. En particular, queremos resaltar la
eficiente labor secretarial de Elizabeth del Oso y Yasmin de Lorenz, y el idneo manejo editorial del Fondo de Cultura Econmica de Mxico, que adems nos ha honrado incluyendo este
texto en La Ciencia para Todos, una coleccin lcida y eficiente
que est transformando la visin del mundo de los jvenes.
1

16

Blanck-Cereijido y Cereijido (1983, 1988).

I. La muerte de las clulas

Segn como se lo mire,


hay organismos inmortales
Hay organismos como las bacterias, levaduras y amebas, que
estn formados por una sola clula, y que son virtualmente inmortales. Por supuesto, podemos matarlos usando antibiticos,
hirviendo el caldo en que viven, o calentando a 200 o C las gasas
e instrumentos de ciruga en cuyos resquicios se podran haber
metido. Pero si bien puede morir por esas causas ajenas a su
funcionar biolgico, normalmente un organismo unicelular no
muere: cumplido su ciclo vital, simplemente se divide en dos
hijas que continan viviendo y no queda ningn cadver.
Algo as como si tu abuela no hubiera muerto, sino que se hubiera dividido en tu mam y tu ta. Cuando en cambio una clula forma parte de un organismo multicelular, su destino final
no es necesariamente el dividirse en dos hijas, sino que puede
morir programadamente.
Hace una generacin, la idea de que las clulas pudieran
llevar en su seno un programa para suicidarse habra sido considerada luntica; pero hace ya unos veinte aos se comenz a
aceptar y hoy ya es incontrovertible. Para describirla debemos
comenzar por introducir algunos conceptos elementales.

17

Los cdigos de la vida


Las clulas contienen largusimas molculas de ADN, enroscadas
una sobre otra como si se tratara de un collar de dos cadenas que
giran sobre ellas mismas, constituido por piedras preciosas. Para
seguir con la analoga, imaginemos que cada una de estas dos
cadenas es una secuencia de cuatro tipos de gemas distintas
(Amatista, Topacio, Crisoberita y Granate), de modo que si queremos especificar la secuencia de las piedras ensartadas en
cierto fragmento de una de esas dos cadenas escribimos:
ATCTAAGTACCTGATTGCCAAATGC
Y ya que estamos imaginando collares, supongamos que
ahora pedimos a un joyero que nos haga una segunda cadena,
para ponerla junto a la primera y enroscarlas. Pero no le permitimos que la ensarte en un hilo como mejor le parezca, sino que
se atenga a dos reglas: 1) que frente a cada gema A de la primera cadena enhebre una T en la complementaria (y viceversa, si
hay una T que le enfrente una A); y 2) que cuando en la primera cadena vea una C contraponga una G en la segunda (y viceversa, si ve una G, contraponga una C). La cadena que fabricar
este joyero ser entonces:
TAGATTCATGGACTAACGGTTTACG
As construido, el trozo de collar tendr dos cadenas complementarias, enfrentadas del siguiente modo:
ATCTAAGTACCTGATTGCCAAATGCcadena 1
TAGATTCATGGACTAACGGTTTACGcadena 2
Ahora conviene abandonar la analoga, porque el ADN no
contiene gemas preciosas, sino molculas llamadas Adenina,
18

Timina, Citocina y Guanina, pero que obedecen las mismas reglas de ensarte y complementariedad (A con T y C con G).
Tampoco hay joyeros moleculares, sino que la tarea est a cargo
de varias enzimas y de una hueste de molculas ayudantes,
en cuyo detalle no nos detendremos. Tambin conviene tener en
cuenta que en nuestro ejemplo nos hemos limitado a fragmentos
muy breves de una largusima doble cadena, y que si el ADN
estuviera hecho realmente de piedras preciosas llegara al cielo;
pero por suerte las ATCG son tan pequeas que todo el ADN
de una clula cabe enrollado en su ncleo.
Es fcil advertir que, si separamos las dos cadenas, se las
damos a dos joyeros, y les pedimos que hagan una cadena complementaria a la que le entregamos, obedeciendo siempre la regla de enfrentar A con T y C con G, el artesano al que le demos
la cadena 1 nos har la complementaria 2, y al que le entreguemos la 2 nos enhebrar la complementaria 1. Algo parecido hacen las clulas con sus cadenas de ADN cuando se dividen: separan sus dos cadenas de ADN y hacen una copia complementaria
de cada una, de modo que las dos clulas hijas reciben rplicas
exactas de las que tena la madre. Gracias a este legado de generacin celular en generacin celular, el huevo fecundado da
origen a todas las clulas del organismo, que tienen por eso
exactamente el mismo mensaje inscrito en el ADN.
De pronto, de una hebra de la largusima cadena de ADN,
se copia un fragmento, tambin complementariamente, pero
con un cdigo ligeramente distinto de molculas (en el cual en
lugar de gemas T hay gemas U), y se genera as una hebrita llamada ARN mensajero. Este fragmentito1 hecho de ARN sale
del ncleo y difunde hasta unos cmulos moleculares llamados
ribosomas. Los ribosomas tienen la propiedad de leer la secuencia de A, U, C y G del ARN, como t leeras la secuencia de
1
El diminutivo surge de la comparacin de la longitud del ADN con la del ARN
mensajero. Imagnate al ADN como el directorio telefnico, y al ARN como la notita
en la que transcribes el nombre y el nmero telefnico de una persona listada en l.

19

letras de la notita y, obedeciendo el mensaje que indica esa secuencia, van ensartando aminocidos, y forman as un tercer
tipo de hebra molecular llamada pptido. El segmento de ADN
que especific la secuencia de esta hebra de pptidos se llama
gen, y la coleccin de todos los genes de una clula se denomina genoma.
Resumiendo: el ADN tiene codificados los genes que especifican los pptidos que los ribosomas habrn de fabricar. La
clula tiene luego todo un aparato de organelos subcelulares y
enjambres de enzimas que actan sobre los diversos pptidos,
agregndoles y quitndoles azcares, lpidos, etc., y los convierten en protenas que controlan todas las reacciones qumicas de las que depende la vida y constituyen piezas clave del
andamiaje y maquinaria celular.

Cmo se identifica al gen que codifica


una protena determinada?
Los bilogos moleculares enfrentan bsicamente tres situaciones. A veces conocen una protena y necesitan encontrar el gen
que la codifica en la molcula de ADN; otras veces conocen
una caracterstica de un bicho o una planta (alas puntiagudas,
ojos azules, cuernos retorcidos, flores amarillas) y tambin necesitan encontrar al gen responsable. Pero hay una tercera situacin, en la que se las ingenian para anular un gen, para ver
qu funcin celular se pierde, como cuando jugamos con las
llaves de luz para ver si con ello encendemos un reflector de la
sala o apagamos el farol del jardn. De ah en adelante se lanzan
a buscar la protena codificada por el gen en cuestin y que tiene a su cargo dicha funcin.
Es fcil imaginar entonces la sorpresa de los bilogos cuando, encendiendo y apagando genes, encontraron unos que tienen como funcin matar a la clula. As de simple: hay genes
20

que han pasado a llamarse genes de la muerte. En la nomenclatura de la gnetica se llama mutacin letal a la que, por afectar
un gen esencial, no permite que se geste un individuo vivo. En
este caso, la mutacin es letal, pero el gen en cuestin no es un
gen de la muerte, porque reservamos este nombre para los que
intervienen en la muerte celular programada, cuya funcin especfica es indicarle a la clula cmo construir las armas moleculares necesarias para suicidarse.
Pero estos conceptos todava no nos permiten entender por
qu se deben suicidar esas clulas, de modo que tendremos que
introducir ms informacin acerca de los genes.

Por qu en un mismo organismo


hay clulas diferentes?
Como dijimos ms arriba, todas las clulas somticas de un organismo (las que no son gametas) tienen un genoma idntico, es
decir, todas tienen genes que codifican las mismas protenas. Entonces, por qu unas clulas se convirtieron en neuronas, otras
en osteocitos, otras en hepatocitos y otras en fibras musculares?
La explicacin es anloga a la que resultara de observar que, si
bien a varias personas les regalan el mismo manual de carpintera, unas eligen fabricarse mesas, otras camas, otras escaleras
y terminan as con un mobiliario diferente. Es decir, todas las
clulas somticas de un organismo como el nuestro tienen los genes para hacer hemoglobina, rodopsina, insulina, pero no todas
las expresan, porque unas eligen expresar el que codifica hemoglobina, otras el que expresa rodopsina y algunas el que especifica insulina. Y eso no es todo: algunos tipos de clulas leen
y sintetizan unas pocas molculas de la protena codificada por
un gen, y otras expresan ese mismo gen millones y millones de
veces. Tal es el caso del reticulocito que, entre las cosas que
hace para convertirse en eritrocito, expresa millones de veces el
21

gen de hacer hemoglobina, pero unas pocas veces, los genes


codificadores de la enzima Na+/K+-ATPasa, mientras que una
clula renal produce millones y millones de Na+/K+-ATPasas,
pero ninguna de hemoglobina. El resultado de expresar ciertos
genes y no otros, o de expresarlos un distinto nmero de veces,
produce una asombrosa diversidad de tipos celulares.
A decir verdad, a pesar de ser tan grande, el nmero de tipos celulares que se originan de la expresin genmica resulta
irrisorio comparado con la cantidad astronmica de tipos que
tericamente se podran construir. Esta restriccin del nmero de tipos celulares se explica porque los genes no tienen
libertad de expresin: hay repertorios, programas genticos,
en los que un gen slo se puede expresar a condicin de que
antes se hayan expresado algunos otros, y que, una vez que se
expresan, provocan la expresin de otros ms de la cascada programtica, como restaurantes que slo sirven mens fijos. De
lo contrario, no tendra sentido que se leyeran los genes para
fosforilar una protena si no se leen tambin los que ordenan
construir la protena que se ha de fosforilar, o que se han de pegar a tal subunidad, o que habrn de integrarse para formar cierto organelo. Hay tambin una coordinacin entre los genes que
expresa una clula con los que expresan las vecinas, pues tampoco tendra sentido construir los msculos de una pata si no
se han de expresar tambin los genes responsables de que otras
clulas fabriquen los huesos, vasos, nervios y tendones de esa
pata. Hacer una pata, un ojo o un ala implica desplegar temporal y espacialmente una combinacin impresionante de programas genticos.
Un tipo celular dado tampoco expresa montonamente el
mismo repertorio de genes a lo largo de toda su vida, pues
atraviesa edades, en las que recibe seales (hormonas, factores trficos, contactos excitatorios o inhibidores de sus vecinas, impulsos elctricos) que le activan o desactivan especficamente ciertos genes. Como resultado de dichas rdenes (o a
22

veces por su interrupcin), se sintetizan ciertas molculas o


se dejan de producir ciertas otras; as, dependiendo de su posicin en el organismo, se transforman en clulas epiteliales,
seas, neuroblastos, reticulocitos y luego en neuronas, eritrocitos, adipocitos o timocitos, y ms tarde reciben nuevas seales
que las estimulan para que se lancen a sintetizar rodopsina,
bilirrubina o miosina, y posteriormente vuelven a recibir
mensajes para que liberen al medio insulina, o cortisona, o paratohormona. Ese proceso por el que, a pesar de tener idntico
genoma, unas clulas slo leen aquellos genes que las transforman en clulas epiteliales del duodeno que apenas viven cuatro das, o en neuronas que viven ochenta aos, se llama diferenciacin.
Los bebs son pluripotentes, pero luego, al crecer, uno
puede elegir la carrera de derecho, su hermano dedicarse al levantamiento de pesas y su hermana consagrarse a la danza; eligen as destinos que implican paquetes coordinados de miles
de acciones, que al cabo de un tiempo los harn diferentes en
sus funciones y hasta en la estructura de sus cuerpos. Pero esas
diferenciaciones podran no ser finales, sino que a los cuarenta y cinco aos el que se recibi de abogado se embarca en una
carrera poltica, el forzudo se hace narcotraficante y la danzarina, ama de casa. Tambin las clulas pueden lanzarse a nuevas
ramas diferenciales, pero ya no conservan la pluripotencia que
tena el huevo fecundado del que derivan. A cierta altura de su
vida pueden activar genes de la muerte, por la accin de stos se
suicidan y aceptan dcilmente que otras clulas vengan a devorar su cadver, porque a todo el organismo le conviene que, a
cierta altura de su desarrollo, determinadas clulas se maten.
No se trata de algo inslito: es normal contar con estos suicidios y entonces se habla de una muerte celular programada. Estos
programas no parecen ser un paso final de toda diferenciacin,
sino programas alternativos (Gerschenson y Rotello, 1992; Ponzoni et al., 1995).
23

Pero estos nuevos conceptos, que ayudan a entender cmo


se programan eritrocitos o neuronas, todava no nos explican
por qu existen programas para matar a las clulas. Prosigamos.

Genes que se eliminan


y genes que se conservan
De pronto aparece un nuevo gen, en general por modificacin
o combinaciones de segmentos de genes preexistentes. Si ese
gen confiere una desventaja (imagnate un gen que codifica
una hemoglobina defectuosa que no puede llevar oxgeno a los
tejidos), el organismo que lo porta no est en condiciones de
sobrevivir en la lucha por la vida, no se reproduce, no lega esos
genes defectuosos a sus descendientes, y la novedad gentica
desaparece de la faz de la Tierra. Pero cuando, por el contrario,
confiere alguna ventaja, el organismo puede resultar victorioso,
tener hijos y nietos equipados con el nuevo gen, y de ah en
adelante este gen pasa a ser atesorado en el genoma de los descendientes (decimos: se conserva y se propaga).
El hecho de que se eliminen los genes adversos y se propaguen los que confieren ventajas nos deja ms sorprendidos de
lo que estbamos al principio, pues surge de nuevo la pregunta:
qu ventaja confieren los genes de la muerte como para haber
sido tan atesorados, en el sentido de que, desde que aparecieron por primera vez en la escala biolgica (la que va desde los
primitivos unicelulares al hombre actual), se hayan conservado
tan celosamente y hayan sido legados a todos los descendientes? Puesto en otras palabras: qu ventajas confiere la muerte?
A riesgo de irritarte, permtenos posponer nuevamente la respuesta, e introducir ms conceptos bsicos.

24

Cmo se construye
un complejsimo organismo
a partir de un huevo fertilizado?
Un primer requisito es, como ya discutimos, la diferenciacin
celular que provee los diversos tipos celulares que se necesitan.
Un segundo requisito es que haya un nmero adecuado de
cada tipo. As, no tenemos ni un hgado tan grande que ocupe
todo nuestro abdomen, ni uno tan pequeo que slo contenga
cuatro hepatocitos. El problema es: cmo saben2 las clulas
cul es el nmero ptimo? Y es seguro que lo saben, pues si
nos extirpan medio hgado, los hepatocitos restantes se darn a
la tarea de dividirse hasta restaurar todo el rgano. El estudio
de cmo hace el organismo para optimizar el nmero y tipo de
clulas que necesita es uno de los aspectos ms fascinantes de la
biologa moderna. Para complementar este concepto: si te mudas a residir a una meseta 2 000 metros ms alta del lugar donde vives actualmente, tu organismo incrementar el nmero
ptimo de glbulos rojos y tendrs poliglobulia. Pero cuando
regreses lo volver a disminuir. Si de pronto te enyesan una pierna, tu organismo, al ver que ya no usas ciertos msculos, comenzar a atrofiarlos; pero cuando te quiten el yeso, el ejercicio
le indicar que debe volverlos a restablecer. Ms an, si ahora te
haces ciclista desarrollars tus msculos a un nivel superior al
que tenas antes de enyesarte, y si en cambio te dedicas a la natacin, te los desarrollar tambin, pero de una manera distinta.
Imagina que te acaban de construir una casa pero, cuando
la vas a habitar, no puedes utilizar la cocina porque est llena
de albailes, ni el dormitorio por los electricistas, ni el bao
2

El antropomorfismo de los religiosos consiste en suponer que Dios tiene forma


de hombre. Pero el de los cientficos consiste en atribuirles criterios y deseos humanos a los animales, clulas, virus y genes, y usar expresiones como saben, necesitan,
buscan, dicen, obedecen, no tiene sentido que se exprese tal gen y otras que
los antropomorfizan abiertamente. Esperamos que esta prctica no te confunda, y
comprendas que slo la adoptamos para ayudarte a entender los diversos temas.

25

T morirs y en este libro trataremos de explicarte por qu y cmo.


Pero aun en el caso de que no te interese de manera personal,
el tema de la muerte es tan imprescindible para comprender
el funcionamiento de la vida, la mente y la sociedad, que sera
aconsejable que lo incorpores a tu visin del mundo. As nos
introducen los autores al tema, y en sus pginas encontramos
un estudio riguroso, pero no por ello exento de humor,
de los aspectos biolgicos, celulares y psicolgicos de los procesos
que caracterizan el envejecimiento y la muerte.
El lector es llevado paso a paso a entender el sentido del ttulo
de la obra, la idea de que la muerte tiene ventajas, y la naturaleza
de los llamados genes de la muerte, uno de los hallazgos cientficos
ms importantes de todos los tiempos.
Se trata, en suma, de una obra con interesantes referencias
sobre diferentes aspectos biolgicos, culturales e histricos
de la muerte y una extensa bibliografa sobre el tema.
Fanny Blanck-Cereijido se gradu en medicina en la Universidad de Buenos Aires
e hizo estudios de posgrado en la Boston Psychoanalytic Society de EUA.
Ha ejercido la docencia en diversas instituciones, y actualmente es miembro
de la Asociacin Psicoanaltica Mexicana.
Marcelino Cereijido se gradu de doctor en medicina en Argentina y fue profesor
de la Facultad de Farmacia y Bioqumica de la Universidad de Buenos Aires,
as como director del Departamento de Biofsica del Centro de Investigaciones Mdicas
Albert Einstein en su pas. Actualmente es investigador nacional en Mxico
y profesor de fisiologa y biofsica del Cinvestav.

www.fondodeculturaeconomica.com

LA
CIENCIA
PARA
TODOS

156