You are on page 1of 48

inti sel yang masih terikat pada sejumlah protein.

Dengan menambahkan enzim pemecah protein


ia dapat memperoleh inti sel saja dan dengan cara ekstraksi terhadap inti sel diperoleh suatu zat
yang larut dalam basa tetapi tidak larut dalam asam. kemudian zat ini dinamakan
nuclein
sekarang dikenal dengan nama
nucleoprotein. Selanjutnya dibuktikan bahwa asam nukleat
merupakan salah satu senyawa pembentuk sel dan jaringan normal.
Beberapa fungsi penting asam nukleat adalah menyimpan, menstransmisi, dan
mentranslasi informasi genetik; metabolisme antara(intermediary metabolism) dan reaksi-reaksi
informasi energi; koenzim pembawa energi; koenzim pemindah asam asetat, zat gula, senyawa
amino dan biomolekul lainnya; koenzim reaksi oksidasi reduksi.
Asam nukleat dalam sel ada dua jenis yaitu DNA (deoxyribonucleic
acid ) atau asam deoksiribonukleat dan RNA (ribonucleic acid )a ta u
asam ribonukleat. Baik DNA maupun RNA berupa anion dan pada umumnya terikat oleh protein
dan bersifat basa. Misalnya DNA dalam inti sel terikat pada histon. Senyawa gabungan antara
protein dan asam nukleat disebutnucleoprotein. Molekul asam nukleat merupakan polimer
seperti protein tetapi unit penyusunnya adalahnuk leotida . ATP adalah salah satu contoh
nukleotida asam nukleat bebas yang berperan sebagai pembawa energi.
Asam nukleat merupakan polimer besar dengan ukuran yang bervariasi antara 25.000 /
1.000.000 s/d 1 milyar. Asam nukleat baik DNA maupun RNA tersusun dari monomer nukleotida
. Nukleotida tersusun dari gugus fosfat, basa nitrogen dan gula pentosa. Basa nitrogen berasal
dari kolompok purin dan pirimidin.Purin utama asam nukleat adalahadenin dangua nin,
sedangkanpirimidinn ya adalah sitosin, timin danuras il.

Nukleotida merupakan nukleosida yang gugus gula pada posisi 5-nya mengikat asam
fosfat (gugus fosfat) dengan ikatan ester. Nukleosida terdiri atas pentosa ( deoksiribosa atau
ribosa) yang mengikat suatu basa (derivat purin atau pirimidin) melalui
ikatan glikosida.
Pentosa yang berasal dari DNA ialah deoksiribosa dan dari RNA ialah ribosa. Basa purin
dan pirimidin yang berasal dari DNA ialah adenin, guanin, sitosin dan timin. Sedangkan basa
RNA terdiri atas adenin, guanin, sitosin dan urasil. Dengan demikian nukleosida adalah
penyusun nukleotida dan dapat diberi nama trivial dan nama sistematis seperti terlihat pada tabel
berikut :
Tabel 10.1 Nukleosida Penyusun Asam Nukleat
Monomer Asam
Nukleat
Nama Trivial
Nama sistematis
Ribonukleosida
Ribosa + basa adenin
Ribosa + basa guanin
Ribosa + basa urasil
Ribosa + basa sitosin
Deoksiribonukleosida
Deoksiribosa+
basa
adenin
Deoksiribosa+
basa
guanin
Deoksiribosa
+
basa
sitosin
Deoksiribosa

+
basa
timin
Adenosin
Guanosin
Uridin
Sitidin
Deoksiadenosin
Deoksiguanosin
Deoksi- sitidin
Deoksi-timidin
Adenin nukleosida
Guanin nukleosida
urasil nukleosida
Sitosin nukleosida
Deoksi-Adenin
nukleosida
Deoksi-Guanin
nukleosida
DeoksiSitosin
nukleosida
Deoksi-Timin
nukleosida
Nukleosida dalam bentuk bebas ada memiliki fungsi penting bagi kesehatan contohnya,
puromisin yang berfungsi sebagai antibiotik yang menghambat sintesis protein ( dihasilkan oleh

streptomyces). Arabinosil sitosin dan arabinosil adenin sebagai anti


virus dan anti jamur.
Nukleotida terdapat sebagai molekul bebas atau berikatan dengan dengan sesama
nukleotida membentuk asam nukleat. Contohnya dapat dilihat dalam tabel berikut:
Tabel 10.2 Mononukleotida Penyusun Asam Nukleat DNA dan RNA
Basa
Nitrogen
Nama Ribonukleotida (RNA)
Nama deoksiribonukleotida (DNA)
Adenin (A)
Guanin (G)
Timin (T)
Sitosin (C)
Urasil (U)
Adenosin 5-monofosfat (AMP)
Guanosin 5-monofosfat (GMP)
------------------Sitidin 5-monofosfat (CMP)
Uridin 5-monofosfat (UMP)
Deoksi Adenosin 5-monofosfat (dAMP)
Deoksi Guanosin 5-monofosfat (dGMP)
Deoksi Timidin 5-monofosfat (dTMP)
Deoksi Sitidin 5-monofosfat (dCMP)
-----------------Beberapa nukleotida yang mempunyai fungsi penting dalam sel misalnya Adenosin 5
monofosfat (AMP), Adenosin 5 difosfat (ADP) dan Adenosin 5-trifosfat (ATP) yang berperan
penting dalam transfer gugus fosfat untuk menerima dan mengantar energi.
Gambar 10.1 Struktur AMP, ADP dan ATP

Nukleotida lain yang berbentuk siklik seperti Adenosin 3-5- siklik monofosfat ( AMPsiklik atau cAMP) berperan sebagai kurir sekunder dalm mengendalikan metabolisme hormon
adrenalin. Nukleotida bebas lain adalah guanosin siklik monofosfat ( GMP siklik

Gambar 10.2 Struktur Sebagian dari DNA


Molekul DNA yang panjang ini terbentuk oleh ikatan antara atom C nomor 3 dengan atom C
nomor 5 pada molekul deoksiribosa dengan perantaraan gugus fosfat.
Secara kimia DNA mengandung karakteri/sifat sebagai berikut:
1. Memiliki gugus gula deoksiribosa.
2. Basa nitrogennya guanin (G), sitosin (C), timin (T) dan
adenin (A).
3. Memiliki rantai heliks ganda anti paralel

4. Kandungan basa nitrogen antara kedua rantai sama banyak dan berpasangan spesifik satu
dengan lain. Guanin selalu berpasangan dengan sitosin ( G C), dan adenin berpasangan dengan
timin (A - T), sehingga jumlah guanin selalu sama dengan jumlah sitosin. Demikian pula adenin
dan timin.
2) Struktur Asam Ribonukleat (RNA)
Asam ribonukleat adalah suatu polimer yang terdiri atas
molekul-molekul ribonukleotida.
Seperti DNA asam ribonukleat terbentuk oleh
adanya ikatan antara atom C nomor 3 dengan atom C nomor 5 pada molekul ribosa dengan
perantaraan gugus fosfat. Rumus strukturnya sama dengan gambar 10.2 tetapi gulanya adalah
ribosa ( atom C nomor 2 mengikat gugus OH)
RNA memiliki sifat spesifik yang berbeda dengan sifat kimia
DNA, yakni dalam hal:
1. Gula pentosanya adalah ribosa
2. RNA memiliki ribonukleotida guanin(G), sitosin (C), adenin (A)
dan Urasil (U) pengganti Timin pada DNA.
3.Untai fosfodiesternya adalah untai tunggal yang bisa melipat
membentuk jepit rambut seperti untai ganda.Beda dengan
DNA bentuk molekulnya heliks ganda.

4. Prosentasi kandungan bas tidak harus sama, pasangan adenin tidak harus sama dengan urasil, dan
sitosin tidak harus sama dengan guanin.

Ada tiga jenis RNA yaitu tRNA (transfer RNA), mRNA ( messenger RNA ) dan rRNA
(ribosomal RNA). Ketiga macam RNA ini mempunyai fungsi yang berbeda-beda, tetapi
ketiganya secara bersama-sama mempunyai peranan penting dalam sintesis protein.
Struktur asam nukleat dapat dilihat/tertulis dalam bentuk struktur primer, sekunder, dan
tersier. Struktur primer terbentuk bila gugus fosfat satu nukleotida berikatan ester dengan gugus
hidroksil nukleotida lain melalui ikatan kovalen. Penggabungan berbagai nukleotida ini
membentuk rantai rantai panjang (polinukleotida). Dua ciri penting semua polinukleotida adalah:
1) Ikatan fosfodiester polinukleotida antara unit-unit monomer selalu antara karbon 3 dari satu
monomer dan karbon 5 dari yang berikutnya. Jadi 2 ujung DNA dari rantai polinukleotida linear
tersebut akan berlawanan. Satu ujung secara normal akan melakukan reaksi dengan fosfat 5 dan
yang lain bereaksi dengan gugus hidroksil 3.
2) Rantai polinukleotida mempunyai kekhasan, ditentukan
melalui urutan basanya.
A
C
G
T
T
3
3
3
3
3
P
P
P
P
OH
5
5
5
5
5
Gambar 10.3 A,G,T,C adalah jenis nukleotida; P=fosfor, 5 dan 3 ujung nukleotida; semua ikatan fosfodiester
adalah 3--- 5; molekul memiliki gugus P pada ujung 5 dan gugus OH pada ujung 3.

Penulisan sederhana DNA dan RNA dimulai ujung 5 fosfat bebas ke


ujung 3 OH bebas sebagai berikut :
DNA : 5A-G-T-C-A-G -T-T-C- G-G-T-C-A-G 3
RNA : 5U-C-A-G-U-C-A-A-G-C-C-A-G-U-C 3

Struktur sekunder DNA ditemukan oleh James D. Watson dan F.H.C Crick (1953).
Mereka menyusun pola difraksi sinar X yang menunjukkan model polideoksiribonukleotida
berbentuk heliks ganda.
A
B
C
Gambar 10.4 Model DNA heliks ganda (tiga dimensi) oleh J.Watson-Crick. Basa - basa (merah-hijau) dan
bagian tulang punggung gula-fosfat (biru-kuning)
Gambar 10.4 menjelaskan bahwa (A) pita pada diagram menunjukkan tulang belakang
gula-fosfat dari dua untai DNA. Heliks ini adalah heliks tangan kanan, berlekuk keatas dengan
arah kekanan. Kedua untaian diikat bersama oleh ikatan hidrogen (digambarkan garis titik-titik)
diantara basa nitrogen, yang berpasangan dibagian dalam heliks ganda. (B) menunjukkan
sebagian struktur kimia, dengan dua untai yang diuraikan, perhatikan bahwa untaian memiliki

orientasi arah yang berlawanan. (C) pasangan basa nitrogen yang terikat kuat tampak jelas pada
model komputer (tiga dimensi). Daya tarik menarik antara pasangan

basa yang berpotongan mempunyai peranan penting dalam


mempertahankan molekul.
Struktur sekunder RNA adalah kumparan acak tunggal dan beberapa bagian berbentuk heliks
yang menunjukkan pasangan basa. Struktur sekunder RNA bermacam-macam sesuai jenis RNAnya. Jenis mRNA dapat berbentuk heliks, tRNA berbentuk daun semanggi dan rRNA berbentuk
acak.
Banyak DNA secara alami mempunyai struktur tersier. Salah satu contohnya adalah
struktur sirkular yang dapat berbentuk acak (berlilitan) dan sirkular terbuka. Pelilitan merupakan
struktur DNA yang tertutup secara kovalen karena untai polinukleotidanya tetap utuh. Struktur
ini tidak mempunyai ujung 5 atau 3 bebas. Jika salah satu untai polinukleotida putus,
maka heliks ganda akan kembali kebentuk normalnya sebagai sirkulasi terbuka. Contoh DNA
tersier adalah DNA virus ST-40, DNA plasmid bakteri, dan lain-lain. Struktur DNA ini
mempunyai sifat sangat khas dan bermanfaat untuk rekayasa gen.

Gambar 10.5 Struktur DNA heliks ganda, basa nitogen


(berwarna), gugus fosfat dan gula ( warna
Pada gambar 10.5 terlihat antara basa-basa yang terdapat pada rantai molekul terbentuk
ikatan hidrogen, yakni ikatan antara atom-atom hidrogen dan nitrogen. Pasangan Adenin dengan
Timin terbentuk dengan dua ikatan hidrogen ( A=T), sedangkan Guanin dengan Sitosin terbentuk
dengan tiga ikatan hidrogen ( G C).
1. Replikasi DNA
Molekul DNA merupakan rantai polinukleotida yang mempunyai beberapa jenis basa
purin dan pirimidin, dan berbentuk heliks ganda. Antara rantai satu dengan pasangannya dalam
heliks ganda terdapat ikatan hidrogen. Molekul DNA yang berbentuk heliks ganda ini
mempunyai sifat dapat membelah diri dan masing-masing rantai polinukleotida mampu
membentuk rantai baru yang merupakan pasangannya. Terjadinya heliks ganda yang baru dan
proses terbentuknya molekul DNA baru ini disebutreplik as i.
Proses pembentukan DNA (penggandaan) membutuhkan
komponen-komponen sebagai berikut.
1.DNA
polimerase
(enzim
yang
mengkatalisis perpanjangan rantai
nukleotida satu dengan yang lainnya)
2.Deoksiribonukleosida trifosfat (dATP, dTTP, dGTP, dCTP
= monomer penyusun rantai polinukleotida).
3.Protein pembentang dan 20 protein enzim lainnya atau
sistem replikasi DNA atau replisoma (fungsi kompleks).
4.DNA ligase (menyambung fragmen-fragmen hasil
polimerasasi).
5.DNA cetakan (DNA induk untuk sintesis DNA baru
6.DNA primer (DNA pengawal untuk sintesis DNA baru)

Sintesis ini tejadi secara semi konservatif karena hanya satu untaian induk DNA dipertahankan
pada tiap DNA keturunan. Dengan demikian bila satu molekul DNA dengan dua rantai
antiparalel bereplikasi, mula-mula akan menghasilkan dua rantai DNA baru. Kemudian 4 rantai
DNA (yaitu 2 rantai DNA asli ditambah 2 rantai DNA yang terbentuk) yang ada bereplikasi lagi
menjadi 8 rantai DNA, delapan ini bereplikasi menjadi 16 dan seterusnya. Reaksi polimerasasi
(perpanjangan rantai nukleotida) mengikuti arah 5 ke arah 3.
Tahap-tahap reaksi sintesis DNA :
1. Tahap pembukaan DNA untai ganda superkoil
2. Sintesis oligonukleotida primer
3. Pemanjangan rantai DNA arah 5--- 3, pelepasan primer dan
4. Penyambungan fragmen DNA dan membentukan ikatan

fosfodiester.
Gambar 10.6 Ilustrasi Replikasi Semikonservatif DNA

Gambar 10.7 Replikasi DNA Dengan Berbagai Enzim yang terlibat


Sedangkan untai yang lain repilikasinya bersifat diskontinyu
dan menghasilkan untai potongan atau disebut jugafragmen
Okazaki. Sehingga pada tahap ini dihasilkan satu untai utuh DNA
anak mengikuti DNA induk dan satu untai lagi fragmen berupa DNA anak. Fragmen DNA anak
ini kemudian dirangkaikan menjadi satu untai utuh oleh enzim DNA ligase sehingga akhirnya
satu DNA double heliks menghasilkan 2 DNA anak helik ganda dan seterusnya.
Penyambungan
fragmen
okazaki
merupakan
pembentukan ikatan fosfodisester antara gugus 3-OH residu nukleosida dan 5-fosfat residu
yang berdekatan. Proses dengan katalisis DNA ligase ini pada E. Coli membutukan kofaktor
NAD dan pada eukariotik menggunakan kofaktor ATP.
2 Proses Transkripsi RNA

Proses transkripsi adalah pembentukan molekul RNA sesuai pesan yang diberikan oleh
DNA. Pada tahap ini informasi genetik diberikan kepada molekul RNA yang terbentuk selaku
perantara dalam sintesis protein.
Proses transkripsi membutuhkan rantai DNA tunggal sebagai cetakan, RNA polimerase
untuk pemanjangan rantai RNA, keempat ribonukleosida 5-trifosfat ( ATP, GTP, UTP, dan
CTP), serta berbagai enzim kompleks. Dalam proses ini terbentuk berbagai jenis RNA dari gen
DNA yang transkripsi. Gen adalah bagian tertentu dari DNA yang menyandi satu polipeptida
(protein) tertentu.

Tahap kedua: RNA polimerase mengkatalisis pemanjangan


(elongasi) ikatan fosfodiester antara ribonukleosida trifosfat dan ujung 3- fosfat melalui cara
seperti DNA polimerase I. Proses pemanjangan ini disertai dengan hidrolisis pirofoffat untuk
membantu menyediakan gaya pendorong untuk reaksi tersebut. Substrat reaksi RNA polimerase
adalah ATP, GTP, UTP, dan CTP sesuai dengan komplemennya pada urutan DNA.
Tahap ketiga: Komplemen DNA-RNA (hibrid) yang dihasilkan

membuka dengan melepaskan RNA yang terbentuk, diikuti hibridisasi ulang rantai DNA
membentuk untai DNA ganda. Pada ujung gen, terdapat urutan penghenti (terminasi). yang
menyebabkan proses transkripsi berhenti. Keadaan ini diikuti dengan pelepasan RNA polimerase
dari DNA.
Tahap keempat: Adalah tahap akhir dimana terjadi perubahan
secara kimia RNA yang terbentuk. Biasanya setelah proses pembentukan RNA, terjadi proses
lanjutan untuk membuat RNA menjadi aktif. rRNA dan tRNA dibuat dalam bentuk prekusor
yang lebih panjang, kemudian dimodifikasi dan dipecah untuk menghasilkan berbagai produk
akhir. Demikian juga mRNA.
Pada sel hewan yang terinfeksi virus dapat terjadi transkripsi
balik yaitu polimerisasi DNA dari RNA.
Dalam proses biosintesis protein molekul DNA berperan
sebagai cetakan bagi terbentuknya RNA, sedangkan molekul RNA
kemudian mengarahkan urutan asam amino dalam pembentukan molekul protein yang
berlangsung dalam ribosom. Dengan demikian aliran informasi genetika dalam sel sebagai
berikut:
Transkripsi
Translasi
DNA
RNA
PROTEIN
Untuk memahami lebih lanjut fungsi RNA dalam sintesis protein, berikut akan dibahas
tiga jenis RNA yaitu rRNA ( ribosomal RNA), mRNA (messenger RNA) dan tRNA (transfer
RNA).
rRNA bersama dengan protein merupakan komponen yang membentuk ribosom dalam
sel. Walaupun rRNA ini merupakan komponen utama ribosom, namun perananya dlam sintesis
protein yang berlangsung diribosom belum diketahui. rRNA ini merupakan RNA yang paling
banyak ( 80%) dibandingkan dua jenis RNA yang lain dari keselurahan RNA.

mRNA diproduksi dalam inti sel dan merupakan RNA paling


sedikit junlahnya
( 5%) dari keseluruhan RNA dalam sel. Pembentukan mRNA dalam inti sel menggunakan DNA
sebagai molekul cetakan dan susunan basa pada mRNA merupakan komplemen salah satu rantai
molekul DNA. Dengan demikian urutan basa purin dan pirimidin pada mRNA serupa dengan
uruten purin dan pirimidin salah satu rantai molekul DNA, dengan perbedaan basa timin diganti
urasil. mRNA yang
terbentuk dalam inti sel kemudian keluar dari inti sel dan masuk kesitoplasma dan
terikat pada ribosom.
5- GCGGCGACGCGCAGUUAAUCCC ACAGCCG-3- mRNA
3- CGCCGCT GCGCGTCAAT T AGGGTGTCGGC-5-untai cetakan DNA
5- GCGGCGACGCGCAGTTAATCCCACAGCCG-3-untai penyandi DNA
Kode genetika yang berupa urutan basa pada molekul DNA, disalin pada urutan basa
nukleotida molekul mRNA. Tiap tiga buah basa yang berurutan (triplet) disebutk odon. Sebagai
contoh AUG adalah kodon yang terbentuk dari kombinasi adenin-urasil-guanin,

A
Ile Ile Ile
Met
Thr Thr Thr Thr
Asn
Asn
Lys
Lys
Ser
Ser
Arg
Arg
UC
AG
G
Val Val Val Val
Ala Ala Ala Ala
Asp
Asp
Glu
Glu
Gly Gly Gly Gly
UC
AG

Gambar 10.10 Proses Biosintesis Protein (Translasi)


a.Tahap pertama asam amino dengan enzim dan AMP
membentuk kompleks aminoasil-AMP-enzim.
b. Kedua, terjadi reaksi antara kompleks aminoasil-AMP-enzim dengan tRNA. Pada reaksi ini
terbentuk kompleks tRNA-asam amino, sedangkan AMP dan enzim sintetase dilepaskan
kembali.
Reaksinya:
Enzim + Mg2+
asam amino + ATP
Enzim-aminoasil-AMP +
Ppi
Enzim + Mg2+
Aminoasil-AMP + tRNA

aminoasil- tRNA +
AMP
Pada kompleks amino asil tRNA , asam amino berikatan dengan nukleotida adenosin pada ujung
RNA, yaitu pada gugus OH atom C nomor 3.
2. Di dalam ribosom terdapat sebagian dari rantai nukleotida mRNA yang telah siap menerima tRNA
yang membawa asam amino. Tiap molekul aminoasil-tRNA masuk ke dalam ribosom secara
berurutan, membentuk pasangan kodon dan anti kodon yang sesuai. Untuk memulai biosintesis
protein, tRNA yang mempunyai antikodon UAC mengikat formil-metionin dan masuk ke dalam
ribosom menempati bagian dari mRNA yang
mempunyai kodon AUG. Formil metionin ini terbentuk setelah tRNA berikatan dengan metionin,
kemudian berikutnya dengan formil FH2 dengan bantuan enzim formilase
3. Selanjutnya tRNA kedua yang telah mengikat asam amino, misalnya tRNA-metionin, masuk
kedlam ribosom dan menempati kodon AUG berikutnya. Dengan cara ini formil metionin yang
menjadi asam amino awal membentuk ikatan peptida dengan metionin. Setelah terjadi ikatan
peptida, maka tRNA yang pertama dilepaskan dan keluar dari ribosom. Oleh karena dalam
ribosom hanya dapat ditempati oleh 2 tRNA, maka tRNA ketiga masuk setelah tRNA yang
pertama keluar dari ribosom. Misalnya tRNA yang ketiga ialah tRNA yang mempunyai antikodon CAC dan berpasangan dengan kodon ketiga pada mRNA yaitu GUG. tRNA ketiga ini
mengikat valin dan dengan masuknya tRNA-valin ke dalam ribosom, maka terjadi ikatan antara
metionin valin. Proses pembentukan ikatan peptida ini berlangsung terus sesuai dengan kode
genetika yang terdapat pada molekul mRNA. Reaksi pembentukan ikatan peptida antara molekul
asam-asam amino ini dapat berlangsung karena ikut sertanya guanosintrifosfat (GTP) yang
berubah menjadi guanosindifosfat (GDP), dengan melepaskan satu gugus fosfat dan energi
4. Proses biosintesis protein akan berhenti apabila pada mRNA terdapat kodon UAA, UAG atau
UGA, karena dalam sel normal tidak terdapat tRNA yang mempunyai antikodon komplementer
terhadap ketiga kodon tersebut. Ketiga kodon ini merupakan tanda berhenti (stop) pada proses
pembentikan ikatan peptida. Sebagai ganti tRNA, ada 2 jenis protein yang dapat mengikat ketiga

jenis kodon tersebut. Protein ini berlaku sebagai sebagai faktor-faktor pelepas (releasing factor =
RF), ikatan asam amino terakhir dengan tRNA. Kedua jenis protein ini diberi tanda RF1 dan
RF2. RF1 dapat mengadakan ikatan dengan kodon UAA dan UAG, sedangkan RF2 dengan UAA
dan UGA. Terbentuknya ikatan kedua protein tersebut dengan mRNA dapat mengaktifkan enzim
transferase peptidil, sehingga enzim ini dapat bekerja sebagai katalis dalam reaksi hidrolisis yang
mengakibatkan terlepasnya asam amino terakhir dari molekul tRNA.
5. Setelah tahap terminasi, dilanjutkan dengan tahap pelipatan dan pengolahan yang bertujuan untuk
memperoleh sifat aktif dari polipeptida (protein) yang terbentuk. Terbentuknya ikatan kedua
protein tersebut dengan mRNA dapat mengaktifkan enzim transferase peptidil, sehingga enzim
ini dapat bekerja sebagai katalis dalam reaksi hidrolisis yang mengakibatkan terlepasnya asam
amino terakhir dari molekul tRNA.
10.2.2
Latihan
Untuk memperdalam pemahaman anda tentang materi diatas,
kerjakan soal-soal latihan berikut:
1. Jelaskan beberapa persamaan dan perbedaan antara DNA dan
RNA
2. Mengapa struktur DNA berbentuk heliks ganda sedangkan
RNA tidak.
3. Jelaskan bagaimana proses biosintesis DNA (replikasi) yang
bersifat semikonservatif.
4. Terangkan pula tahapan mekanisme proses transkripsi RNA.
10.2.3 Petunjuk Jawaban Soal-soal latihan
1. a. Memiliki gugus gula deoksiribosa (DNA), ribosa (RNA)
b. Basa nitrogennya guanin (G), sitosin (C), timin (T) dan adenin (A) untuk DNA; sedangkan RNA
timin diganti Urasil (U)
c. Memiliki rantai heliks ganda anti paralel(DNA), RNA rantai
tunggal
d.Kandungan basa nitrogen antara kedua rantai sama banyak dan berpasangan spesifik satu dengan
lain. Guanin selalu berpasangan dengan sitosin ( G C), dan adenin

berpasangan dengan timin (A - T), sehingga jumlah guanin selalu sama dengan jumlah sitosin.
Demikian pula adenin dan timin. Untuk RNA pasangan urasil dengan Adenin (U-A) pengganti
timin pada DNA.
2. Struktur heliks ganda oleh DNA dipengaruhi oleh adanya ikatan hidrogen antara basa-basa
yang terikat pada gula yakni ikatan hidrogen dan nitrogen dari basa purin dan pirimidin. Contoh
adenin dapat membentuk dua ikatan hidrogen dengan timin, guanin 3 ikatan dengan sitosin.
Sedangkan rantai RNA berupa rantai tunggal yang terlipat sehingga menyerupai rantai ganda.
3. Biosintesis DNA yang terjadi secara semikonservatif karena hanya satu untaian induk DNA
dipertahankan pada tiap DNA keturunan . Artinya dengan satu molekul DNA dengan dua rantai
antiparalel bereplikasi, mula akan menghasilkan 2 rantai DNA baru, kemudian 4 (2 asli ditambah
2 yang terbentuk) dan bereplikasi lagi jadi 8, 16, 32 dan seterusnya. 4. Proses transkripsi yaitu
pembentukan molekul RNA sesuai pesan yang diberikan oleh DNA. Artinya informasi genetik
diberikan kepada molekul RNA yang terbentuk selaku perantara dalam sintesis protein.
(mekanismenya jelas diterangkan diatas)
10.2.4
Rangkuman
Asam nukleat dalam sel ada 2 macam yakni DNA dan RNA. Seperti halnya DNA, RNA
adalah merupakan polimer nukleotida. Monomer nukleotida tersusun atas tiga gugus molekul
yakni 1). Gula ribosa, 2) Posfat atau P, 3) basa-Nitrogen .
Sintesis molekul DNA (replikasi) terdiri atas beberapa reaksi
yaitu: tahap pembukaan DNA untai ganda superkoil; tahap sintesis
oligonukleotida primer; pemanjangan rantai DNA arah 53; pelepasan primer;
penyambungan fragmen DNA baru dan pembentukan ikatan fosfodiester. Yang melibatkan peran
berbagai enzim seperti ligase, DNA polimerase, DNA Helikase, Protein pengikat, DNA Girase.

Arus informasi genetik pada sel normal berawal dari DNA ke RNA terus ke protein.
Sintesis RNA berdasarkan suatu cetakan DNA disebut proses transkripsi. Sedangkan sintesis
protein berdasarkan suatu cetakan RNA disebut Translasi.
Proses sintesis RNA menyerupai pembentukan Dna tetapi ada perbedaan prinsip dimana
kalau sintesis DNA seluruh urutan nkleotida DNA digandakan seperti DNA induk, pada sintesis
RNA tidak semua DNA ditranskripsi menjadi RNA, hanya gen atau kolompok gen yang
ditarnskripsi. Produk yang terbentuk adalah RNA yang komplementer dengan salah satu rantai
DNA dupleks yang jadi cetakan.
Sintesis RNA (transkripsi) terdiri 4 tahap reaksi :pertama enzim RNA polimerase
mengikat urutan basa spesifik,k edua RNA polimerase mengkatalisis pemanjangan ikatan
fosfodiester antara ribonukleotia trifosfat dan ujung 3-fosfat melalui cara seperti DNA
polimerase I,ketiga, komplemen DNA-RNA (hibrid DNA-RNA) yang dihasilkan membuka
dengan melepaskan RNA yang terbentuk diikuti hibridisasi ulang rantai DNA membentuk untai
DNA ganda.
Keempat, terjadi pengubahan secara kimia RNA yang terbentuk.
Sintesis protein (translasi) yaitu molekul Rna yang terbentuk menerjemahkan informasi
genetik ke dalam proses pembentukan protein. Pada tahap ini asam-asam amino secara berurutan
diikat satu dengan yng lain, sesuai pesan yang diberikan DNA. Berlangsung diribosom dan
melalui 5 tahapan reaksi yakni aktivasi asam amino; inisiasi rantai polipetida, pemanjangan
(elongasi) rantai polipetida; terminasi dan pembebasan rantai polipeptida serta tahap pelipatan
dan pengolahan

Sekuens DNA menyandikan informasi yang diperlukan bagi makhluk hidup untuk
melangsungkan hidup dan berkembang biak. Dengan demikian, penentuan sekuens DNA
berguna di dalam ilmu pengetahuan 'murni' mengenai mengapa dan bagaimana makhluk hidup
dapat hidup, selain berguna dalam penerapan praktis. Karena DNA merupakan ciri kunci
makhluk hidup, pengetahuan akan sekuens DNA dapat berguna dalam penelitian biologi
manapun. Sebagai contoh, dalam ilmu pengobatan sekuensing DNA dapat digunakan untuk
mengidentifikasi, mendiagnosis, dan mengembangkan pengobatan penyakit genetik. Demikian
pula halnya, penelitian pada agen penyebab penyakit (patogen) dapat membuka jalan bagi
pengobatan penyakit menular. Bioteknologi, yang dapat pula memanfaatkan sekuensing DNA,
merupakan bidang yang berkembang pesat dan berpotensi menghasilkan banyak barang dan jasa
berguna.
Karena RNA dibentuk dengan transkripsi dari DNA, informasi yang dikandung RNA juga
terdapat di dalam DNA cetakannya sehingga sekuensing DNA cetakan tersebut sudah cukup
untuk membaca informasi pada RNA. Namun demikian, sekuensing RNA dibutuhkan khususnya
pada eukariota, karena molekul RNA eukariota tidak selalu sebanding dengan DNA cetakannya
karena pemotongan intron setelah proses transkripsi.
[sunting] Sekuensing DNA
Dewasa ini, hampir semua usaha sekuensing DNA dilakukan dengan menggunakan metode
terminasi rantai yang dikembangkan oleh Frederick Sanger dan rekan-rekannya [1]. Teknik
tersebut melibatkan terminasi atau penghentian reaksi sintesis DNA in vitro yang spesifik untuk
sekuens tertentu menggunakan substrat nukleotida yang telah dimodifikasi.
[sunting] Metode Sanger

Gel sekuensing metode Sanger yang telah dilabel radioaktif.


Pada metode terminasi rantai (metode Sanger), perpanjangan atau ekstensi rantai DNA dimulai
pada situs spesifik pada DNA cetakan dengan menggunakan oligonukleotida pendek yang
disebut primer yang komplementer terhadap DNA pada daerah situs tersebut. Primer tersebut
diperpanjang menggunakan DNA polimerase, enzim yang mereplikasi DNA. Bersama dengan
primer dan DNA polimerase, diikutsertakan pula empat jenis basa deoksinukleotida (satuan
pembentuk DNA), juga nukleotida pemutus atau penghenti rantai (terminator rantai) dalam
konsentrasi rendah (biasanya di-deoksinukleotida). Penggabungan nukleotida pemutus rantai
tersebut secara terbatas kepada rantai DNA oleh polimerase DNA menghasilkan fragmenfragmen DNA yang berhenti bertumbuh hanya pada posisi pada DNA tempat nukleotida tertentu
tersebut tergabungkan. Fragmen-fragmen DNA tersebut lalu dipisahkan menurut ukurannya
dengan elektroforesis gel poliakrilamida, atau sekarang semakin lazim dengan elektroforesis
menggunakan tabung gelas berjari-jari kecil (pipa kapiler) yang diisi dengan polimer kental.
Seiring dengan perkembangannya, kini terdapat beberapa macam metode sekuensing terminasi
rantai yang berbeda satu sama lain terutama dalam hal pendeteksian fragmen DNA hasil reaksi
sekuensing.
[sunting] Metode Sanger asli
Pada metode yang asli, urutan nukleotida DNA tertentu dapat disimpulkan dengan membuat
secara paralel empat reaksi perpanjangan rantai menggunakan salah satu dari empat jenis basa
pemutus rantai pada masing-masing reaksi. Fragmen-fragmen DNA yang kemudian terbentuk
dideteksi dengan menandai (labelling) primer yang digunakan dengan fosfor radioaktif sebelum
reaksi sekuensing dilangsungkan. Keempat hasil reaksi tersebut kemudian dielektroforesis pada
empat lajur yang saling bersebelahan pada gel poliakrilamida.
Hasil pengembangan metode ini menggunakan empat macam primer yang ditandai dengan
pewarna berpendar (fluorescent dye). Hal ini memiliki kelebihan karena tidak menggunakan
bahan radioaktif; selain menambah keamanan dan kecepatan, keempat hasil reaksi dapat
dicampur dan dielektroforesis pada satu lajur pada gel. Metode ini dikenal sebagai metode dye
primer sequencing.
[sunting] Sekuensing dye terminator

Contoh hasil bacaan suatu sekuensing metode dye terminator.


Cara lain pelabelan primer adalah dengan melabel pemutus rantainya, lazim disebut metode
sekuensing dye terminator. Keunggulan cara ini adalah bahwa seluruh proses sekuensing dapat
dilakukan dalam satu reaksi, dibandingkan dengan empat reaksi terpisah yang diperlukan pada

penggunaan primer berlabel. Pada cara tersebut, masing-masing dideoksinukleotida pemutus


rantai ditandai dengan pewarna fluoresens, yang berpendar pada panjang gelombang yang
berbeda-beda. Cara ini lebih mudah dan lebih cepat dibandingkan penggunaan primer berwarna,
namun dapat menimbulkan ketidaksamaan tinggi kurva atau puncak (peak) yang disebabkan oleh
ketidaksamaan penggabungan pemutus rantai berwarna berukuran besar pada pertumbuhan DNA
(ketidaksamaan tersebut bergantung pada DNA cetakan). Masalah tersebut telah dapat dikurangi
secara nyata dengan penggunaan macam-macam enzim dan pewarna baru yang meminimalkan
perbedaan dalam penggabungan.
Metode ini kini digunakan pada sebagian besar usaha reaksi sekuensing karena lebih sederhana
dan lebih murah. Primer-primer yang digunakan tidak perlu dilabel secara terpisah (yang bisa
jadi cukup mahal untuk primer yang dibuat untuk sekali pakai), walaupun hal tersebut tidak
terlalu bermasalah dalam penggunaan universal primer.
[sunting] Automatisasi dan penyiapan sampel
Mesin sekuensing DNA automatis modern mampu mengurutkan 384 sampel berlabel fluoresens
sekaligus dalam sekali batch (elektroforesis) yang dapat dilakukan sampai 24 kali sehari. Hal
tersebut hanya mencakup proses pemisahan dan proses pembacaan kurva; reaksi sekuensing,
pembersihan, dan pelarutan ulang dalam larutan penyangga yang sesuai harus dilakukan secara
terpisah.
Untuk memperoleh hasil reaksi berlabel yang dapat dideteksi dari DNA cetakan, metode
"sekuensing daur" (cycle sequencing) paling lazim dilakukan. Dalam metode ini dilakukan
berturut-turut penempelan primer (primer annealing), ekstensi oleh polimerase DNA, dan
denaturasi (peleburan atau melting) untai-untai DNA cetakan secara berulang-ulang (2540
putaran). Kelebihan utama sekuensing daur adalah lebih efisiennya penggunaan pereaksi
sekuensing yang mahal (BigDye) dan mampunya mengurutkan templat dengan struktur sekunder
tertentu seperti hairpin loop atau daerah kaya-GC. Setiap tahap pada sekuensing daur ditempuh
dengan mengubah temperatur reaksi menggunakan mesin pendaur panas (thermal cycler) PCR.
Cara tersebut didasarkan pada fakta bahwa dua untai DNA yang komplementer akan saling
menempel (berhibridisasi) pada temperatur rendah dan berpisah (terdenaturasi) pada temperatur
tinggi. Hal penting lain yang memungkinkan cara tersebut adalah penggunaan enzim DNA
polimerase dari organisme termofilik (organisme yang hidup di lingkungan bertemperatur
tinggi), yang tidak mudah terurai pada temperatur tinggi yang digunakan pada cara tersebut
(>95 C).
[sunting] Metode Maxam-Gilbert
Pada waktu yang kira-kira hampir bersamaan dengan dikenalkannya metode sekuensing Sanger,
Maxam dan Gilbert mengembangkan metode sekuensing DNA yang didasarkan pada modifikasi
kimiawi DNA yang dilanjutkan dengan pemotongan DNA [2]. Metode ini mulanya cukup
populer karena dapat langsung menggunakan DNA hasil pemurnian, sedangkan metode Sanger
pada waktu itu memerlukan kloning untuk membentuk DNA untai tunggal. Seiring dengan
dikembangkannya metode terminasi rantai, metode sekuensing Maxam-Gilbert menjadi tidak
populer karena kerumitan teknisnya, digunakannya bahan kimia berbahaya, dan kesulitan dalam
scale-up.

[sunting] Pyrosequencing
Artikel utama untuk bagian ini adalah: pyrosequencing
Pyrosequencing adalah adalah teknik pemetaan DNA yang berdasarkan deteksi terhadap
pirofosfat (PPi) yang dilepaskan selama sintesis DNA.[1] Teknik ini memanfaatkan reaksi
enzimatik yang dikatalisis oleh ATP sulfurilase dan luciferase untuk pirofosfat inorganik yang
dilepaskan selama penambahan nukleotida.[1]
[sunting] Sekuensing DNA skala besar
Metode sekuensing DNA yang kini ada hanya dapat merunut sepotong pendek DNA sekaligus.
Contohnya, mesin sekuensing modern yang menggunakan metode Sanger hanya dapat mencakup
paling banyak sekitar 1000 pasang basa setiap sekuensing [3]. Keterbatasan ini disebabkan oleh
probabilitas terminasi rantai yang menurun secara geometris seiring dengan bertambahnya
panjang rantai, selain keterbatasan fisik ukuran dan resolusi gel.
Sekuens DNA dengan ukuran jauh lebih besar kerap kali dibutuhkan. Sebagai contoh, genom
bakteri sederhana dapat mengandung jutaan pasang basa, sedangkan genom manusia terdiri atas
lebih dari 3 milyar pasang basa. Berbagai strategi telah dikembangkan untuk sekuensing DNA
skala besar, termasuk strategi primer walking dan shotgun sequencing. Kedua strategi tersebut
melibatkan pembacaan banyak bagian DNA dengan metode Sanger dan selanjutnya menyusun
hasil pembacaan tersebut menjadi sekuens yang runut. Masing-masing strategi memiliki
kelemahan sendiri dalam hal kecepatan dan ketepatan; sebagai contoh, metode shotgun
sequencing merupakan metode yang paling praktis untuk sekuensing genom ukuran besar,
namun proses penyusunannya rumit dan rentan kesalahan.
Data sekuens bermutu tinggi lebih mudah didapatkan bila DNA bersangkutan dimurnikan dari
pencemar yang mungkin terdapat pada sampel dan diamplifikasi. Hal ini dapat dilakukan dengan
metode reaksi berantai polimerase bila primer yang dibutuhkan untuk mencakup seluruh daerah
yang diinginkan cukup praktis dibuat. Cara lainnya adalah dengan kloning DNA sampel
menggunakan vektor bakteri, yaitu memanfaatkan bakteri untuk "menumbuhkan" salinan DNA
yang diinginkan sebanyak beberapa ribu pasang basa sekaligus. Biasanya proyek-proyek
sekuensing DNA skala besar memiliki persediaan pustaka hasil kloning semacam itu.
[sunting] Sekuensing RNA
RNA lebih tidak stabil daripada DNA di dalam sel dan lebih rentan terhadap penguraian oleh
enzim nuklease secara laboratorium. Seperti yang telah disebutkan di atas, kadang kala
sekuensing RNA diperlukan walaupun informasi yang dikandung RNA sudah terdapat di dalam
DNA, khususnya pada eukaryota. Dalam sekuensing RNA, metode yang umum digunakan
adalah mula-mula membentuk fragmen DNA dari RNA tersebut dengan enzim transkriptase
balik. Misalnya, DNA dapat disintesis dari cetakan mRNA dan disebut sebagai DNA
komplementer (cDNA). Fragmen DNA tersebut kemudian dapat disekuensing dengan cara-cara
seperti yang disebutkan di atas.

Sebuah partikel protein menular, atau prion, (diucapkan / pri n / (dengarkan).


Merupakan agen menular terutama terdiri dari protein, tidak seperti virus. Kata Prion,
diciptakan pada tahun 1982 oleh Dr Stanley B. Prusiner, adalah portmanteau berasal dari
kata-kata protein dan infeksi. Prion adalah penyebab sejumlah penyakit dalam varietas
mamalia, termasuk bovine spongiform encephalopathy (BSE, juga dikenal sebagai
"penyakit sapi gila") pada sapi dan penyakit Creutzfeldt-Jakob (CJD) pada manusia.
Dalam penggunaan umumnya, prion mengacu pada unit teoritis infeksi. Semua penyakit
prion diketahui mempengaruhi struktur otak atau jaringan syaraf lainnya dan saat ini
semua tidak dapat diobati dan fatal universal.
Prion Diseases (TSEs)
klasifikasi dan sumber daya eksternal

Mikroskopis"holes" merupakan salah satu ciri bagian jaringan yang terkena prion, menyebabkan
jaringan untuk mengembangkan suatu "spongy" arsitektur.
ICD-10
A81
ICD-9
046
Ketika prion memasuki suatu organisme yang sehat, bentuk protein prion yang menginduksi
bentuk normal yang sudah ada sebelumnya protein untuk mengkonversi ke dalam bentuk jahat.
Karena prion baru kemudian bisa melanjutkan untuk mengkonversi protein lebih sendiri, ini
memicu reaksi berantai yang menghasilkan sejumlah besar bentuk prion. Semua prion diketahui
menyebabkan pembentukan lipat amiloid, di mana polymerises protein menjadi agregat terdiri
dari lembaran beta dipadatkan. agregat Amyloid adalah fibril, tumbuh di ujungnya, dan
mereplikasi ketika kerusakan menyebabkan kedua ujung tumbuh menjadi empat berakhir
tumbuh. Masa inkubasi penyakit prion ditentukan oleh tingkat pertumbuhan eksponensial yang
berhubungan dengan replikasi prion, yang merupakan keseimbangan antara pertumbuhan linier
dan kerusakan agregat.
Struktur berubah sangat stabil dan terakumulasi dalam jaringan yang terinfeksi, menyebabkan
kerusakan jaringan dan kematian sel. Hal ini stabilitas struktural berarti bahwa prion tahan

terhadap denaturasi oleh agen kimia dan fisik, pembuangan pembuatan dan penahanan dari
partikel-partikel yang keras. Prion datang dalam strain yang berbeda, masing-masing dengan
struktur yang sedikit berbeda, dan sebagian besar waktu, strain berkembang biak benar. replikasi
Prion adalah tetap tunduk pada epimutation sesekali dan kemudian seleksi alam seperti bentuk
lain dari replikasi. Namun, jumlah kemungkinan strain prion yang berbeda mungkin jauh lebih
kecil dari jumlah sekuens DNA, sehingga evolusi terjadi dalam keterbatasan ruang.
Dalam notasi ilmiah, PrPC mengacu pada bentuk endogen protein prion (PrP), yang ditemukan
dalam banyak jaringan, sementara PrPSc mengacu pada bentuk gagal melipat dari PrP, yang
bertanggung jawab untuk pembentukan plak amiloid dan neurodegeneration. Struktur prion yang
tepat tidak diketahui, meskipun mereka dapat dibentuk dengan menggabungkan PrPC, asam
polyadenylic, dan lipid. Protein menunjukkan perilaku prion-jenis juga ditemukan di beberapa
jamur, yang telah bermanfaat dalam membantu untuk memahami prion mamalia. prion jamur,
bagaimanapun, tampaknya tidak menyebabkan penyakit pada host mereka dan bahkan mungkin
memberikan keuntungan evolusioner melalui bentuk warisan berbasis protein.
Penemuan
Radiasi biologi Tikvah Alper dan matematikawan John Stanley Griffith mengembangkan
hipotesis pada 1960-an bahwa beberapa encephalopathies spongiform menular disebabkan oleh
kuman penyakit yang terdiri hanya dari protein. Teori mereka dikembangkan untuk menjelaskan
penemuan bahwa agen menular misterius menyebabkan penyakit scrapie dan penyakit
Creutzfeldt-Jakob menolak radiasi pengion. Sebuah pengion tunggal "hit" biasanya
menghancurkan sebuah partikel menular, dan dosis yang dibutuhkan untuk mencapai setengah
partikel tergantung pada ukuran partikel. Data menunjukkan bahwa agen menular terlalu kecil
untuk menjadi virus.
Francis Crick mengakui pentingnya potensi hipotesis protein Griffith hanya untuk propagasi
scrapie dalam edisi kedua dari "Central dogma of molecular biology" nya: sementara
menyatakan bahwa aliran informasi urutan dari protein untuk protein, atau dari protein untuk
RNA dan DNA adalah "tidak memungkinkan". Dia mencatat bahwa hipotesis Griffith adalah
sebuah kontradiksi potensial (meskipun tidak begitu dipromosikan oleh Griffith). Hipotesis
direvisi kemudian dirumuskan, sebagian, untuk mengakomodasi penemuan transkripsi balik oleh
Howard Temin dan David Baltimore.
Stanley B. Prusiner dari University of California, San Francisco pada tahun 1982 mengumumkan
bahwa agen menular terutama terdiri dari protein tertentu - meskipun mereka tidak berhasil
mengisolasi protein sampai dua tahun setelah Pengumuman Prusiner. Prusiner menciptakan kata
"prion" sebagai nama untuk agen menular. Sedangkan agen infeksi diangkat menjadi prion,
protein spesifik yang prion itu terdiri dari juga dikenal sebagai Prion Protein (PrP), meskipun
protein ini dapat terjadi baik dalam bentuk menular dan tidak menular. Prusiner dianugerahi
Penghargaan Nobel dalam Fisiologi atau Kedokteran pada tahun 1997 untuk penelitian ke dalam
prion.
Struktur

Protein structure of the normal prion protein (PrP).


isoform
Protein yang terbuat dari prion (PrP) ditemukan di seluruh tubuh, bahkan pada orang sehat dan
binatang. Namun, PrP ditemukan dalam bahan infeksius memiliki struktur yang berbeda dan
tahan terhadap protease, enzim dalam tubuh yang biasanya dapat memecah protein. Bentuk
normal protein disebut PrPC, sedangkan bentuk infeksi disebut PrPSc. C mengacu pada 'cellular'
atau 'common' PrP, sedangkan Sc mengacu pada 'scrapie', penyakit prion yang terjadi pada
domba. Sementara PrPC secara struktural yang terdefinisi dengan baik, PrPSc tentu polydisperse
dan ditetapkan pada tingkat yang relatif miskin. PrP dapat didorong untuk lipat ke isoform lebihatau-kurang-didefinisikan lainnya in vitro, dan hubungannya dengan bentuk (s) yang bersifat
patogen in vivo belum jelas.
PrPC
PrPC adalah protein yang biasa ditemukan di membran sel. Memiliki 209 asam amino (pada
manusia), salah satu ikatan disulfida, berat molekul 35-36 kDa dan struktur terutama alphaheliks. bentuk topologi Beberapa ada; satu sel bentuk permukaan berlabuh melalui glikolipid dan
dua bentuk transmembran. Protein normal tidak sedimentable;. yang berarti tidak dapat
dipisahkan dengan teknik pemusingan. Fungsinya adalah masalah yang kompleks yang terus
diselidiki. . PrPC mengikat tembaga (II) ion dengan afinitas yang tinggi. Arti penting dari temuan
ini tidak jelas, tetapi diduga berkaitan dengan struktur PrP atau fungsi. PrPC ini mudah dicerna
oleh proteinase K dan dapat dibebaskan dari permukaan sel in vitro oleh phosphoinositide
fosfolipase enzim C (PI-PLC), yang memotong yang glycophosphatidylinositol (GPI) jangkar
glikolipid. PrP telah dilaporkan untuk memainkan peran penting adhesi pada sel-sel dan sinyal
intraseluler in vivo, dan karena itu mungkin terlibat dalam komunikasi sel-sel di otak.
PrPSc
Para isoform menular dari PrP, yang dikenal sebagai PrPSc, dapat mengkonversi protein normal
PrPC ke isoform menular dengan mengubah konformasi mereka, atau bentuk; ini, pada
gilirannya, mengubah cara protein interkoneksi. Meskipun struktur 3D PrPSc tepat tidak
diketahui, ia memiliki proporsi yang lebih tinggi struktur -sheet di tempat struktur -heliks
normal. Aggregations. Isoform ini abnormal bentuk yang sangat terstruktur serat amiloid, yang
menumpuk membentuk plak . Tidak jelas apakah agregat tersebut penyebab kerusakan sel atau
hanya merupakan efek samping dari proses penyakit yang mendasarinya. Akhir serat masingmasing bertindak sebagai template ke yang bebas molekul protein dapat melampirkan,

memungkinkan serat untuk tumbuh. Hanya PrP molekul dengan urutan asam amino identik
dengan PrPSc menular yang dimasukkan ke dalam serat tumbuh. Namun, properti ini tidak
sepenuhnya dimiliki oleh protein lain dianggap prion. sup35p ini terbukti dapat dimasukkan ke
dalam agregasi yang ada bahkan ketika tiga dari lima oligopeptide mengulangi biasanya hadir
telah dihapus.
Mekanisme replikasi prion

Heterodimer model propagasi prion


Hipotesis pertama yang mencoba menjelaskan bagaimana prion mereplikasi secara proteinsatunya adalah model heterodimer. Model diasumsikan bahwa sebuah molekul tunggal PrPSc
mengikat ke molekul PrPC tunggal dan mengkatalisis konversi menjadi PrPSc. Kedua PrPSc
molekul kemudian datang terpisah dan dapat melanjutkan untuk mengkonversi PrPC lebih.
Namun, Manfred Eigen menunjukkan bahwa sejak PrPC memiliki tingkat yang sangat rendah
konversi spontan menjadi PrPSc, model heterodimer membutuhkan PrPSc menjadi katalis luar
biasa yang efektif, meningkatkan laju reaksi konversi dengan faktor sekitar 1015. Apa lebih,
meskipun banyak upaya, PrPSc monomer menular tidak pernah terisolasi. Teori dan eksperimen
kedua menunjukkan bahwa PrPSc ada hanya dalam bentuk agregat seperti amiloid, dan bahwa
replikasi prion melibatkan kooperatititas.

Prion nucleation is rare, but can be bypassed by infection. Either nucleation or infection can
initiate a replication cycle of fibril growth and breakage.

Model alternatif mengasumsikan bahwa PrPSc ada hanya sebagai fibril, dan urat saraf yang
berakhir mengikat PrPC dan mengubahnya menjadi PrPSc. Jika ini semua, maka jumlah prion
akan meningkat secara linear, membentuk fibril lagi. Namun pertumbuhan eksponensial dari
kedua PrPSc dan kuantitas partikel infeksi yang diamati selama penyakit prion. Hal ini dapat
dijelaskan dengan memperhatikan kerusakan akun fibril. Sebuah solusi matematika untuk tingkat
pertumbuhan eksponensial hasil dari kombinasi pertumbuhan urat saraf dan kerusakan urat saraf
telah ditemukan. Tingkat pertumbuhan eksponensial tergantung pada akar kuadrat dari
konsentrasi PrPC. Masa inkubasi. ditentukan oleh tingkat pertumbuhan eksponensial, dan dalam
data vivo tentang penyakit prion pada tikus transgenik pertandingan prediksi ini. Ketergantungan
akar kuadrat yang sama juga terlihat in vitro dalam percobaan dengan berbagai protein amiloid
yang berbeda.
Mekanisme replikasi prion memiliki implikasi untuk merancang obat-obatan. Karena masa
inkubasi penyakit prion yang begitu lama, sebuah obat yang efektif tidak perlu menghilangkan
semua prion, tetapi hanya perlu memperlambat laju pertumbuhan eksponensial. Model
memprediksi bahwa cara yang paling efektif untuk mencapai hal ini, menggunakan obat dengan
dosis serendah mungkin, adalah untuk menemukan obat yang mengikat urat saraf terakhir dan
blok mereka dari tumbuh lebih lanjut.
Fungsi PrP
Telah diusulkan bahwa neurodegeneration disebabkan oleh prion mungkin berhubungan dengan
fungsi abnormal PrP. Namun, fungsi fisiologis dari protein prion tetap menjadi masalah
kontroversial. Sedangkan data dari percobaan in vitro menunjukkan peran berbeda banyak, studi
tentang tikus KO PrP telah memberikan informasi terbatas hanya karena binatang ini hanya
menunjukkan kelainan kecil. Dalam penelitian terbaru yang dilakukan pada tikus, ditemukan
bahwa pembelahan prion pada saraf tepi menyebabkan aktivasi perbaikan myelin di Sel Schwann
dan bahwa kurangnya prion menyebabkan demielinasi dalam sel-sel.
PrP dan memori jangka panjang
Ada bukti bahwa PrP mungkin memiliki fungsi normal dalam pemeliharaan memori jangka
panjang. Maglio dan rekan. Telah menunjukkan bahwa tikus tanpa gen untuk protein PrP normal
seluler telah mengubah potensiasi jangka panjang hipokampus.
PrP dan batang pembaharuan sel
Sebuah artikel 2006 dari Whitehead Institute for Biomedical Research menunjukkan bahwa
ekspresi PrP pada sel-sel induk diperlukan untuk pembaharuan diri organisme-dari sumsum
tulang. Hasil penelitian menunjukkan bahwa semua sel jangka panjang stem hematopoietik
disajikan PrP pada membran sel mereka dan bahwa jaringan dengan sel induk hematopoietik
PrP-null menunjukkan peningkatan sensitivitas terhadap deplesi sel.

engertian DNA dan RNA


DNA dan RNA
Asam nukleat adalah polinukleotida yang terdiri dari unit-unit mononukleotida, jika unit-unit
pembangunnya dioksinukleotida maka asam nukleat itu disebut dioksiribonukleat(DNA) dan jika
terdiri dari unit-unit mononukleotida disebut asam ribonukleat(RNA).
DNA dan RNA mempunyai sejumlah sifat kimia dan fisika yang sama sebab antara unit-unit
mononukleotida terdapat ikatan yang sama yaitu melalui jembatan fosfodiester antara posisi 3
suatu mononukleotida dan posisi 5 pada mononukleotida lainnya(Harpet, 1980).
Asam-asam nukleat seperti asam dioksiribosa nukleat (DNA) dan asam ribonukleat (RNA)
memberikan dasar kimia bagi pemindahan keterangan di dalam semua sel. Asam nukleat
merupakan molekul makro yang memberi keterangan tiap asam nukleat mempunyai urutan
nukleotida yang unik sama seperti urutan asam amino yang unik dari suatu protein tertentu
karena asam nukleat merupakan rantai polimer yang tersusun dari satuan monomer yang disebut
nukleotida(Dage, 1992).
Dua tipe utama asam nukleat adalah asam dioksiribonukleat(DNA) dan asam ribonukleat(RNA).
DNA terutama ditemui dalam inti sel, asam ini merupakan pengemban kode genetik dan dapat
memproduksi atau mereplikasi dirinya dengan tujuan membentuk sel-sel baru untuk
memproduksi organisme itu dalam sebagian besar organisme, DNA suatu sel mengerahkan
sintesis molekul RNA, satu tipe RNA, yaitu messenger RNA(mRNA), meninggalkan inti sel dan
mengarahkan tiosintesis dari berbagai tipe protein dalam organisme itu sesuai dengan kode
DNA-nya(fessenden, 1990).
Meskipun banyak memiliki persamaan dengan DNA, RNA memiliki perbedaan dengan DNA,
antara lain yaitu(Poedjiati, 1994):
1. Bagian pentosa RNA adalah ribosa, sedangkan bagian pentosa DNA adalah dioksiribosa.
2. Bentuk molekul DNA adalah heliks ganda, bentuk molekul RNA berupa rantai tunggal yang
terlipat, sehingga menyerupai rantai ganda.
3. RNA mengandung basa adenin, guanin dan sitosin seperti DNA tetapi tidak mengandung
timin, sebagai gantinya RNA mengandung urasil.
4. Jumlah guanin dalam molekul RNA tidak perlu sama dengan sitosin, demikian pula jumlah
adenin, tidak perlu sama dengan urasil.
Selain itu perbedaan RNA dengan DNA yang lain adalah dalam hal(Suryo, 1992):
1. Ukuran dan bentuk
Pada umumnya molekul RNA lebih pendek dari molekul DNA. DNA berbentuk double helix,
sedangkan RNA berbentuk pita tunggal. Meskipun demikian pada beberapa virus tanaman, RNA
merupakan pita double namun tidak terpilih sebagai spiral.
2. Susunan kimia
Molekul RNA juga merupakan polimer nukleotida, perbedaannya dengan DNA yaitu:
a. Gula yang menyusunnya bukan dioksiribosa, melainkan ribosa.
b. Basa pirimidin yang menyusunnya bukan timin seperti DNA, tetapi urasil.

3. Lokasi
DNA pada umumnya terdapat di kromosom, sedangkan RNA tergantung dari macamnya, yaitu:
a. RNA d(RNA duta), terdapat dalam nukleus, RNA d dicetak oleh salah satu pita DNA yang
berlangsung didalam nukleus.
b. RNA p(RNA pemindah) atau RNA t(RNA transfer), terdapat di sitoplasma.
c. RNA r(RNA ribosom), terdapat didalam ribosom.
4. Fungsinya
DNA berfungsi memberikan informasi atau keterangan genetik, sedangkan fungsi RNA
tergantung dari macamnya, yaitu:
a. RNA d, menerima informasi genetik dari DNA, prosesnya dinamakan transkripsi, berlangsung
didalam inti sel.
b. RNA t, mengikat asam amino yang ada di sitoplasma.
c. RNA r, mensintesa protein dengan menggunakan bahan asam amino, proses ini berlangsung di
ribosom dan hasil akhir berupa polipeptida.
Ada beberapa cara untuk menentukan DNA dan RNA, yaitu(Frutan and Sofia, 1968):
1. Jaringan hewan dan alkali hangat
RNA akan terpecah menjadi komponen-komponen nukleotida yang larut dalam asam. DNA sulit
dipecah atau dirusak oleh alkali.
2. Metode Schnider
Jaringan dan asam trikloro asetat panas dan diperkirakan DNA dapat diuji oleh reaksi kalorimetri
dengan difenilanin, yang mana akan bereaksi dengan purin dioksiribosa dan tidak bereaksi
dengan purin ribosa.
3. Metode Feligen
Fuchsin sulfurous acid akan berwarna merah dengan DNA, dan tidak dengan RNA. Reaksi ini
diterapkan untuk mempelajari distribusi RNA dan DNA didalam bagian-bagian sel.
4. Secara Spektroskopi
Pengaukuran absorbsi cahaya oleh RNA dan DNA pada 260nm dimana spektra cincin purin dan
pirimidin asam nukleat menunjukkan maksimal.
Tiga bentuk utama RNA yang terdapat didalam sel adalah mRNA(messenger RNA),
rRNA(ribosa RNA), dan tRNA(transfer RNA). Tiap bentuk RNA ini mempunyai berat molekul
dan komposisi yang berlainan, tetapi khas untuk tiap macam bentuk RNA.
Semua RNA terdiri dari rantai tunggal poliribonukleotida. Pada sel bakteri, hampir semua RNA
ada di dalam sitoplasma. Disel hati kira-kira 11% terdapat dalam nukleus(terutama mRNA),
sekitar 15% dalam mitokondria, lebih dari 50% dalam ribosom, dan kira-kira 24% dalam strosol

Asam deoksiribonukleat
Struktur molekul DNA. Atom karbon berwarna hitam, oksigen merah, nitrogen biru,
fosfor hijau, dan hidrogen putih. Asam deoksiribonukleat, lebih dikenal dengan DNA (bahasa
Inggris: deoxyribonucleic acid), adalah sejenis asam nukleat yang tergolong biomolekul utama
penyusun berat kering setiap organisme. Di dalam sel, DNA umumnya terletak di dalam inti sel.
Secara garis besar, peran DNA di dalam sebuah sel adalah sebagai materi genetik; artinya, DNA
menyimpan cetak biru bagi segala aktivitas sel. Ini berlaku umum bagi setiap organisme. Di
antara perkecualian yang menonjol adalah beberapa jenis virus (dan virus tidak termasuk
organisme) seperti HIV (Human Immunodeficiency Virus).
Struktur DNA
DNA merupakan polimer yang terdiri dari tiga komponen utama, yaitu gugus fosfat, gula
deoksiribosa, dan basa nitrogen. Sebuah unit monomer DNA yang terdiri dari ketiga komponen
tersebut dinamakan nukleotida, sehingga DNA tergolong sebagaipolinukleotida. Rantai DNA
memiliki lebar 2224 , sementara panjang satu unit nukleotida 3,3 . Walaupun unit monomer
ini sangatlah kecil, DNA dapat memiliki jutaan nukleotida yang terangkai seperti rantai.
Misalnya, kromosom terbesar pada manusia terdiri atas 220 juta nukleotida.
Struktur untai komplementer DNA menunjukkan pasangan basa (adenin dengan timin dan
guanin dengan sitosin) yang membentuk DNA beruntai ganda. Rangka utama untai DNA terdiri
dari gugus fosfat dan gula yang berselang-seling. Gula pada DNA adalah gula pentosa
(berkarbon lima), yaitu 2-deoksiribosa. Dua gugus gula terhubung dengan fosfat melalui ikatan
fosfodiester antara atom karbon ketiga pada cincin satu gula dan atom karbon kelima pada gula
lainnya. Salah satu perbedaan utama DNA dan RNA adalah gula penyusunnya; gula RNA adalah
ribosa.
DNA terdiri atas dua untai yang berpilin membentuk struktur heliks ganda. Pada struktur
heliks ganda, orientasi rantai nukleotida pada satu untai berlawanan dengan orientasi nukleotida
untai lainnya. Hal ini disebut sebagaianti paralel. Masing-masing untai terdiri dari rangka utama,
sebagai struktur utama, dan basa nitrogen, yang berinteraksi dengan untai DNA satunya pada
heliks. Kedua untai pada heliks ganda DNA disatukan oleh ikatan hidrogen antara basa-basa
yang terdapat pada kedua untai tersebut. Empat basa yang ditemukan pada DNA adalah adenin
(dilambangkan A), sitosin (C, daricytosine), guanin (G), dan timin (T). Adenin berikatan
hidrogen dengan timin, sedangkan guanin berikatan dengan sitosin.
Fungsi biologis
Pada replikasi DNA, rantai DNA baru dibentuk berdasarkan urutan nukleotida pada DNA yang
digandakan. Replikasi merupakan proses pelipatgandaan DNA. Proses replikasi ini diperlukan
ketika sel akan membelah diri. Pada setiap sel, kecuali sel gamet, pembelahan diri harus disertai
dengan replikasi DNA supaya semua sel turunan memiliki informasi genetik yang sama. Pada
dasarnya, proses replikasi memanfaatkan fakta bahwa DNA terdiri dari dua rantai dan rantai

yang satu merupakan "konjugat" dari rantai pasangannya. Dengan kata lain, dengan mengetahui
susunan satu rantai, maka susunan rantai pasangan dapat dengan mudah dibentuk. Ada beberapa
teori yang mencoba menjelaskan bagaimana proses replikasi DNA ini terjadi. Salah satu teori
yang paling populer menyatakan bahwa pada masing-masing DNA baru yang diperoleh pada
akhir proses replikasi; satu rantai tunggal merupakan rantai DNA dari rantai DNA sebelumnya,
sedangkan rantai pasangannya merupakan rantai yang baru disintesis. Rantai tunggal yang
diperoleh dari DNA sebelumnya tersebut bertindak sebagai "cetakan" untuk membuat rantai
pasangannya.
Proses replikasi memerlukan protein atau enzim pembantu; salah satu yang terpenting
dikenal dengan nama DNA polimerase, yang merupakan enzim pembantu pembentukan rantai
DNA baru yang merupakan suatu polimer. Proses replikasi diawali dengan pembukaan untaian
ganda DNA pada titik-titik tertentu di sepanjang rantai DNA. Proses pembukaan rantai DNA ini
dibantu oleh beberapa jenis protein yang dapat mengenali titik-titik tersebut, dan juga protein
yang
mampu membuka pilinan rantai DNA. Setelah cukup ruang terbentuk akibat pembukaan untaian
ganda ini, DNA polimerase masuk dan mengikat diri pada kedua rantai DNA yang sudah terbuka
secara lokal tersebut. Proses pembukaan rantai ganda tersebut berlangsung disertai dengan
pergeseran DNA polimerase mengikuti arah membukanya rantai ganda. Monomer DNA
ditambahkan di kedua sisi rantai yang membuka setiap kali DNA polimerase bergeser. Hal ini
berlanjut sampai seluruh rantai telah benar-benar terpisah.
Proses replikasi DNA ini merupakan proses yang rumit namun teliti. Proses sintesis rantai
DNA baru memiliki suatu mekanisme yang mencegah terjadinya kesalahan pemasukan monomer
yang dapat berakibat fatal. Karena mekanisme inilah kemungkinan terjadinya kesalahan sintesis
amatlah kecil.

Asam ribonukleat
Asam ribonukleat (bahasa Inggris:ribonucleic acid, RNA) senyawa yang merupakan
bahan genetik dan memainkan peran utama dalam ekspresi genetik. Dalam dogma pokok
(central dogma) genetika molekular, RNA menjadi perantara antara informasi yang dibawa
DNA dan ekspresi fenotipik yang diwujudkan dalam bentuk protein.

Struktur RNA
Struktur dasar RNA mirip dengan DNA. RNA merupakan polimer yang tersusun dari
sejumlah nukleotida. Setiap nukleotida memiliki satu gugus fosfat, satu gugus gula ribosa,
dan satu gugus basa nitrogen (basa N). Polimer tersusun dari ikatan berselang-seling antara
gugus fosfat dari satu nukleotida dengan gugus gula ribosa dari nukleotida yang lain.
Perbedaan RNA dengan DNA terletak pada satu gugus hidroksil tambahan pada cincin gula
ribosa (sehingga dinamakan ribosa). Basa nitrogen pada RNA sama dengan DNA, kecuali
basa timin pada DNA diganti dengan urasil pada RNA. Jadi tetap ada empat pilihan: adenin,

guanin, sitosin, atau urasil untuk suatu nukleotida. Selain itu, bentuk konformasi RNA tidak
berupa pilin ganda sebagaimana DNA, tetapi bervariasi sesuai dengan tipe dan fungsinya.

Tipe-tipe RNA
RNA hadir di alam dalam berbagai macam/tipe. Sebagai bahan genetik, RNA berwujud
sepasang pita (Inggris double-stranded RNA, dsRNA
). Genetika molekular klasik mengajarkan
adanya tiga tipe RNA yang terlibat dalam proses sintesis protein:
1. RNA-kurir (bahasa Inggris:messenger-RNA, mRNA),
2. RNA-ribosom (bahasa Inggris:ribos omal-RNA, rRNA),
3. RNA-transfer (bahasa Inggris:trans fer-RNA, tRNA).
Pada akhir abad ke-20 dan awal abad ke-21 diketahui bahwa RNA hadir dalam berbagai
macam bentuk dan terlibat dalam proses pascatranslasi. Dalam pengaturan ekspresi genetik
orang sekarang mengenal RNA-mikro (miRNA) yang terlibat dalam "peredaman gen"
ataugene
silencingdan small-interfering RNA

(siRNA) yang terlibat dalam proses pertahanan terhadap

serangan virus.

Fungsi RNA
Peran penting RNA terletak pada fungsinya sebagai perantara antara DNA dan protein
dalam proses ekspresi genetik karena ini berlaku untuk semua organisme hidup. Dalam peran
ini, RNA diproduksi sebagai salinan kode urutan basa nitrogen DNA dalam proses
transkripsi. Kode urutan basa ini tersusun dalam bentuk 'triplet', tiga urutan basa N, yang
dikenal dengan nama kodon. Setiap kodon berelasi dengan satu asam amino (atau kode untuk
berhenti), monomer yang menyusun protein. Lihat ekspresi genetik untuk keterangan lebih
lanjut. Penelitian mutakhir atas fungsi RNA menunjukkan bukti yang mendukung atas teori
'dunia RNA', yang

Transkripsi
Penyalinan kode genetik dari DNA menjadi RNA dalam proses ekspresi genetik. Proses ini
terutama dikendalikan oleh enzim RNA polimerase

Replikasi DNAReplikasi DNA bersifat s em i ko n se rva t i f, yaitu kedua untai tunggal


DNA bertindak sebagai cetakan untuk pembuatan untai-untai DNA baru; seluruh untai
tunggal cetakan dipertahankan dan untai yang baru dibuat dari nukleotida-nukleotida.
Replikasi DNA

adalah proses penggandaan molekul DNA untai

ganda. Pada sel, replikasi DNA terjadi sebelum pembelahan sel. Prokariota terus-menerus
melakukan replikasi DNA. Pada eukariota, waktu terjadinya replikasi DNA sangatlah diatur,

yaitu pada fase S daur sel, sebelum mitosis atau meiosis I. Penggandaan tersebut
memanfaatkan enzim DNA polimerase yang membantu pembentukan ikatan antara nukleotidanukleotida penyusun polimer DNA. Proses replikasi DNA dapat pula dilakukan in vitro dalam
proses yang disebut reaksi berantai polimerase (PCR).

Garpu replikasi
Garpu replikasi atau cabang replikasi (replication fork) ialah struktur yang terbentuk ketika
DNA bereplikasi. Garpu replikasi ini dibentuk akibat enzim helikase yang memutus ikatanikatan hidrogen yang menyatukan kedua untaian DNA, membuat terbukanya untaian ganda
tersebut menjadi dua cabang yang masing-masing terdiri dari sebuah untaian tunggal DNA.
Masing- masing cabang tersebut menjadi "cetakan" untuk pembentukan dua untaian DNA
baru berdasarkan urutan nukleotida komplementernya. DNA polimerase membentuk untaian
DNA baru dengan memperpanjang oligonukleotida (RNA
) yang dibentuk oleh enzimprimase dan
disebutprimer.
DNA polimerase membentuk untaian DNA baru dengan menambahkan nukleotida dalam
hal
ini, deoksiribonukleotidake ujung 3'-hidroksil bebas nukleotida rantai DNA yang sedang

tumbuh. Dengan kata lain, rantai DNA baru (DNA "anak") disintesis dari arah 5'3', sedangkan DNA polimerase
bergerak pada DNA "induk" dengan arah 3'5'. Namun demikian, salah satu untaian DNA induk pada garpu
replikasi berorientasi 3'5', sementara untaian lainnya berorientasi 5'3', dan helikase bergerak membuka
untaian rangkap DNA dengan arah 5'3'.

Oleh karena itu, replikasi harus berlangsung pada kedua arah berlawanan tersebut.
Replikasi DNA. Mula-mula, heliks ganda DNA (merah) dibuka menjadi dua untai tunggal
oleh enzim helikase (9) dengan bantuan topoisomerase (11) yang mengurangi tegangan untai
DNA. Untaian DNA tunggal dilekati oleh protein-protein pengikat untaian tunggal (10)
untuk mencegahnya membentuk heliks ganda kembali. Primase (6) membentuk
oligonukleotida RNA yang disebutprimer (5) dan molekul DNA polimerase (3 & 8) melekat
pada seuntai tunggal DNA dan bergerak sepanjang untai tersebut memperpanjang primer,
membentuk untaian tunggal DNA baru yang disebut leading strand (2) dan lagging strand (1).
DNA polimerase yang membentuk lagging strand harus mensintesis segmen-segmen
polinukleotida diskontinu (disebut fragmen Okazaki (7)). Enzim DNA ligase (4) kemudian
menyambungkan potongan-potongan
lagging strandtersebut.

Pembentukan leading strand

Pada replikasi DNA, untaian pengawal (leading strand) ialah untaian DNA yang disintesis
dengan arah 5'3' secara berkesinambungan. Pada untaian ini, DNA polimerase mampu

membentuk DNA menggunakan ujung 3'-OH bebas dari sebuah primer RNA dan sintesis
DNA
berlangsung secara berkesinambungan, searah dengan arah pergerakan garpu replikasi.
Pembentukan lagging strand

ialah untaian DNA yang terletak pada sisi yang berseberangan dengan leading
strand pada garpu replikasi. Untaian ini disintesis dalam segmen-segmen yang disebut fragmen
Okazaki. Pada untaian ini, primase membentuk primer RNA. DNA polimerase dengan
demikian
Lagging strand

dapat menggunakan gugus OH 3' bebas pada primer RNA tersebut untuk mensintesis DNA
dengan arah 5'3'. Fragmen primer RNA tersebut lalu disingkirkan (misalnya dengan RNase H

dan DNA Polimerase I) dan deoksiribonukleotida baru ditambahkan untuk mengisi celah
yang tadinya ditempati oleh RNA. DNA ligase lalu menyambungkan fragmen-fragmen
Okazaki tersebut sehingga sintesis lagging strand menjadi lengkap.

DNA
DNA (deoxyribonucleic acid) atau asam deoksiribosa nukleat (ADN) merupakan tempat
penyimpanan informasi genetik.
Struktur DNA
Pada tahun 1953, Frances Crick dan James Watson menemukan model molekul DNA sebagai
suatu struktur heliks beruntai ganda, atau yang lebih dikenal dengan heliks ganda WatsonCrick.DNA merupakan makromolekul polinukleotida yang tersusun atas polimer nukleotida yang
berulang-ulang, tersusun rangkap, membentuk DNA haliks ganda dan berpilin ke kanan.Setiap
nukleotida terdiri dari tiga gugus molekul, yaitu :
- Gula 5 karbon (2-deoksiribosa)
- basa nitrogen yang terdiri golongan purin yaitu adenin (Adenin = A) dan guanin (guanini = G),
serta golongan pirimidin, yaitu sitosin (cytosine = C) dan timin (thymine = T)
- gugus fosfat
Berikut susunan struktur kimia komponen penyusun DNA :
Baik purin ataupun pirimidin yang berkaitan dengan deoksiribosa membentuk suatu molekul
yang dinamakan nukleosida atau deoksiribonukleosida yang merupakan prekursor elementer
untuk sintesis DNA.Prekursor merupakan suatu unsur awal pembentukan senyawa
deoksiribonukleosida yang berkaitan dengan gugus fosfat.DNA tersusun dari empat jenis
monomer nukleotida.
Keempat basa nitrogen nukleotida di dalam DNA tidak berjumlah sama rata.Akan tetapi, pada
setiap molekul DNA, jumlah adenin (A) selalu sama dengan jumlah timin (T).Demikian pula

jumlah guanin (G) dengan sitisin(C) selalu sama.Fenomena ini dinamakan ketentuan
Chargaff.Adenin (A) selalu berpasangan dengan timin (T) dan membentuk dua ikatan hidrogen
(A=T), sedagkan sitosin (C) selalu berpasangan dengan guanin (G) dan membentuk 3 ikatan
hirogen (C = G).
Stabilitas DNA heliks ganda ditentukan oleh susunan basa dan ikatan hidrogen yang terbentuk
sepanjang rantai tersebut.karean perubahan jumlah hidrogen ini, tidak mengehrankan bahwa
ikatan C=G memerlukan tenaga yang lebih besar untuk memisahkannya.
DNA merupakan makromolekul yang struktur primernya adalah polinukleotida rantai rangkap
berpilin.Sturktur ini diibaratkan sebagai sebuah tangga.Anak tangganya adalah susunan basa
nitrogen, dengan ikatan A-T dan G-C.Kedua tulang punggung tangganya adalah gula
ribosa.Antara mononukleotida satu dengan yang lainnya berhubungan secara kimia melalui
ikatan fosfodiester.
DNA heliks ganda yang panjangnya juga memiliki suatu polaritas.Polaritas heliks ganda
berlawanan orientasi satu sama lain.Kedua rantai polinukleotida DNA yang membentuk heliks
ganda berjajar secara antipararel.Jika digambarkan sebagai berikut :
Replikasi DNA
Replikasi adalah peristiwa sintesis DNA.Saat suatu sel membelah secara mitosis, tiap-tiap sel
hasila pembelahan mengandung DNA penuh dan identik seperti induknya.Dengan demikian,
DNA harus secara tepat direplikasi sebelum pembelahan dimulai.Replikasi DNA dapat terjadi
dengan adanya sintesis rantai nukleotida baru dari rantai nukleotida lama.Proses komplementasi
pasangan basa menghasilkan suatu molekul DNA baru yang sama dengan molekul DNA lama
sebagai cetakan.Kemungkinan terjadinya replikasi dapat melalui tiga model.
Model pertama adalah model konservatif, yaitu dua rantai DNA lama tetap tidak berubah,
berfungsi sebagai cetakan untuk dua dua rantai DNA baru.
Model kedua disebut model semikonservatif, yaitu dua rantai DNA lama terpisah dan rantai baru
disintesis dengan prinsip komplementasi pada masing-masing rantai DNA lama tersebut.Model
ketiga adalah model dispersif, yaitu beberapa bagian dari kedua rantai DNA lama digunakan
sebgai cetakan untuk sintesis rantai DNA baru.
Berikut adalah gambaran replikasi yang terjadi terhadap DNA :
Dari ketiga model replikasi tersebut, model semikonservatif merupakan model yang tepat untuk
proses replikasi DNA.Replikasi DNA semikonservatif ini berlaku bagi organisme prokariot
maupun eukariot.Perbedaan replikasi antara organisme prokariot dengan eukariot adalah dalam
hal jenis dan jumlah enzim yang terlibat, serta kecepatan dan kompleksitas replkasi DNA.Pada
organisme eukariot, peristiwa replikasi terjadi sebelum pembelahan mitosis, tepatnya pada fase
sintsis dalam siklus pembelahan sel.
RNA

rna
RNA ( ribonucleic acid ) atau asam ribonukleat merupakan makromolekul yang berfungsi
sebagai penyimpan dan penyalur informasi genetik.RNA sebagai penyimpan informasi genetik
misalnya pada materi genetik virus, terutama golongan retrovirus.RNA sebagai penyalur
informasi genetik misalnya pada proses translasi untuk sintesis protein.RNA juga dapat berfungsi
sebagai enzim ( ribozim ) yang dapat mengkalis formasi RNA-nya sendiri atau molekul RNA
lain.
Struktur RNA
RNA merupakan rantai tungga polinukleotida.Setiap ribonukleotida terdiri dari tiga gugus
molekul, yaitu :
- 5 karbon
- basa nitrogen yang terdiri dari golongan purin (yang sama dengan DNA) dan golongan
pirimidin yang berbeda yaitu sitosin (C) dan Urasil (U)
- gugus fosfat
Purin dan pirimidin yang berkaitan dengan ribosa membentuk suatu molekul yang dinamakan
nukleosida atau ribonukleosida, yang merupakan prekursor dasar untuk sintesis
DNA.Ribonukleosida yang berkaitan dengan gugus fosfat membentuk suatu nukleotida atau
ribonukleotida.RNA merupakan hasil transkripsi dari suatu fragmen DNA, sehingga RNA
merupakan polimer yang jauh lebih pendek dibandingkan DNA.
Tipe RNA
RNA terdiri dari tiga tipe, yaitu mRNA ( messenger RNA ) atau RNAd ( RNA duta ), tRNA
( transfer RNA ) atau RNAt ( RNA transfer ), dan rRNA ( ribosomal RNA ) atau RNAr ( RNA
ribosomal ).

RNAd
RNAd merupakan RNA yang urutan basanya komplementer dengan salah satu urutan basa rantai
DNA.RNAd membawa pesan atau kode genetik (kodon) dari kromosom (di dalam inti sel) ke
ribosom (di sitoplasma).Kode genetik RNAd tersebut kemudian menjadi cetakan utnuk
menetukan spesifitas urutan asam amino pada rantai polipeptida.RNAd berupa rantai tunggal
yang relatif panjang.Berikut gambarnya :
RNAr
RNAr merupakan komponen struktural yang utama di dalam ribosom.Setiap subunit ribosom
terdiri dari 30 46% molekul RNAr dan 70 80% protein.
RNAt
RNAt merupakan RNA yang membawa asam amino satu per satu ke ribosom.Pada salah satu
ujung RNAt terdapat tiga rangkaian baa pendek ( disebut antikodon ).Suatu asam amino akan
melekat pada ujung RNAt yang berseberangan dengan ujung antikodon.Pelekatan ini merupakan
cara berfungsinya RNAt, yaitu membawa asam amino spesifik yang nantinya berguna dalam
sintesis protein yaitu pengurutan asam amino sesuai urutan kodonnya pada RNAd.
Perbedaan antara DNA dan RNA
Berdasarkan penjelasan sebelumnya kita dapat menyimpulkan beberapa perbedaan antara DNA
dengan RNA sebagai berikut :
- komponen :
Gula pada DNA deoksiribosa , sedangkan RNA adalah ribosa
Basa nitrogen : purin DNA adalah Adenin dan Guanin, pada RNA adalah Adenin dan
Guanin
- Pirimidin DNA adalah Timin dan sitosin, pada RNA adalah Urasil dan sitosin
- Bentuk : DNA berbentuk rantai panjang , ganda, dan berpilin (double heliks)
RNA berbentuk rantai pendek, tunggal, dan tidak berpilin
- Letak : DNA terletak di dalam nukleus, kloroplas, mitokondria
RNA terletak di dalam nukleus, sitoplasma, kloroplas, mitokondria
- Kadar : DNA tetap
RNA tidak tetap