G R EG G BRADEN

T ^ A N R I’N I N

Ş İF R E S İ

GREGG BRADEN

Telif Hakkı © 2004 Gregg Braden
2007 Mİ.ABasım Yayın ve Tanıtım Hizmetleri Tic. Lcd. Şti.
Bu kitabın tüm yayın hakları Türkiye'de MİA Yayınlan’na aittir.
Tanıtım için yapılacak kısa alıntılar dışında
yayıncının izni olmaksızın hiçbir yolla çoğaltılamaz.
Eserin Orijinal ismi
“The God Code"
olup eser birebir olarak çevrilmiştir.

Editör: Pantha Nirvano
Türkçeye Çeviren: Zeynep Esin

Bu kitap
Ajans Plna Tanıtımve iletişim Hizmetleri Ltd. Şti.
tarafından hazırlanmış ve basılmıştır.
Davutpıı.şa Cad. Emintaş KazımDinçol San. Sit. No: 81/67
Topkapı-istanbul Tel: 0.212.612 85 22

MİA Basım Yayın ve T^M^tun Hizmetleri Tic. Ltd. Şti.
Bebek Yokuşu Bebek Bağı Sokak No: 13/2 Gülistan Apt. Dükkan: 5-6
Etiler 34340 İstanbul
Tel: 0.212.287 99 09 Fax: 0.212.287 38 15 e-posta: birol@owo.com.tr

l Ç İ N D E K İL E R
Giriş......................................................................................... 7
BÖLÜM l ...................................................................................21
Biz Kimiz? Gizemin Kendisinden İpuçları
1. TARİH: Farkîhkiarımızın Hikayesi.................................23
2. KEMİKLER, KİTAPLAR VE HÜCRELER:........................ -41
Kanıt ve Teoriler Çarpıştığı Zaman
3. Y^^DILIŞIN KAYIP KİTAPLARINDAN:....................... 61
Yeryüzündeki Bedenlerde Cennetin Güçleri
BÖLÜM 2 .......................................
81
Keşif: Bütün Yaşam Tanrı’nın Adındandır
4. KAİNATI YAPAN: Başka Bir Zamanın Sözlerinde..... 83
5. KEŞİF: Harfler Elementlere Dönüştüğü Zam an......... 104
6. ŞİFRENİN İÇİNDE ŞİFRE:............................................. 131
Tüm Yaşamın Her Hücresinde, Tanrı’nın Adı
BÖLÜM 3 :................................................................................ 161
Anlam: Mesajı Yaşamlarımıza Uyarlamak
7. İLK GÜNDEN MESAJ: Tann’nın Dilini Okumak........ 163
8. NE ÖĞRENDİK?.............................................................189
Geçmişimizin Dersleriyle Geleceğimizi Kurtarmak
9. TANRENIN ŞİFRESİ: İnanmak İçin Bir N eden.......... 224
EK A - Arap Alfabesinin Gizli Şifreleri................................. 261
EK B - Elementlerin Periyodik Tablosu................................263
EK C - Dört DNA Esasının Herbirindeki Hidrojen ............ 265
Nitrojen, Oksijen ve Karbon Atomlarının Sayısı
EK D - İbrani Harfier Ölarak Eşdeğerleri Gösterilen..........266
Her DNA Esasındaki Hidrojen, Nitrojen, Oksijen
ve Karbon Atomlarının Genişletilmiş Örneği
NOTLAR....................................................................
268

E) yıl ‘T ’ den bugüne kadar olan tarihler.Y a z a rm N o tu nrı’nın cinsiyetine dair: “Tanrı" ilkesi eninde sonun­ la hem erkek hem de dişiyi ve dolayısıyla cinsiyetsiz olduğunu işaret etmekteyse de. .D.E. Tarihleme kuralı: Arkeologlar ve tarihçiler arasında Before Common Era (B.yaşam ın ikiliğini yaratmak için “Toprak Ana”nın kabul eden dişi ilkesi ile birleşenin Cennetteki Tanrı’nın aktif erkek ilkesi olduğunu ileri sür­ mektedir. İnsanoğlu terimi: Bu kitapta başvurulmuş olan eski yazı­ ların. bu kitaptaki “Odların yaradılışı hare­ kete geçiren Tanrı’nın sadece erkek ilkesi olduğu anlaşılmalıdır. ve da­ ha önceleri kullanılmış olan Before Christ (B.C) ile Anno Domini .E.C. ve Common Era (C. yıl “1” den önceki tarihler.) gibi tarihsel zamanları gösteren kayıtlarla il­ gili tartışmalar devam etmektedir. tarihi başvuru dayanakları bedenlerimizde birleşmiş olan. bu geleneğe Tanrı’nın Şifresi'nde de saygı gösterilmiştir. Bu kitapta tutarlılık ve netlik açısından günüm üzde kullanılan ve çoğunluğun ka­ bul ettiği B. (A. Açıktır ki. Metinlerin dili ile tutarlı olabilmek çabasıyla. m odern çevirilerin ve geleneklerin pek çoğunda in­ sandan bu şekilde söz edilmektedir.C.E). kullanılmıştır. bu terim hem erkek hem de kadını olduğu kadar onların çocuklarını da kastetmektedir ve insanın var oluşunu temsil etmektedir. ve C. Bu nedenle.

.

Öte yandan. Hepsi sesin kaynağını bulma­ da başarısız oldu! Yakındaki Princeton Üniversitesinden bir başka bilim . aşikar olan gizli olanın kendisinde ortaya çıkar. 1960 yılında. “orman ağaçlar tarafından saklanmıştı. Labs’dan iki çalışan. anlaşılması en zor yanıtların aslında başından beri orada olduğunu sadece far­ kına varılmadığını anlamak çok da seyrek rastlanan bir olay değildir. Büyük Patlamaya kanıt aranması . Her ne kadar bu sı­ kıcı ses daha önceki araştırmacılar tarafından da farkedilmiş olsa da.tamamen böyle bir keşfe örnektir. Arno Penzias ve Robert Wilson anteni uzak galaksiler arasındaki za­ yıf radyo sinyallerini ölçmek için kullanmak istediler.G ir iş ^ a z e n . yeni teknoloji antenin modası geç­ miş olduğunu gösterdi ve böylece anten araştırmalar için bir radyo teleskopuna dönüştü. Araştırmacılar anteni kullanmaya başladıklarında. Holmdel. Bu örneklerde.kozmik patlamanın evrenimizi harekete geçirdi­ ğine inanılır . tıpkı atasözünde denildiği gibi. yaşamın en derin gizemlerinin çözümü en B m ü m k ü n olmayan yerlerde bulunabiliyor.” Örneğin. Donanımı sesin kaynağı olmaktan çıka­ ran dikkatli denetim lerden sonra. bunun antenin kendi yan ürünü olduğuna inanılmış ve gözardı edilmişti. aradık­ ları zayıf sinyalleri ortaya çıkarmayı zorlaştıran radyo para­ zitine benzer bir ses ürettiğini farkettiler. New Jersey’deki Jjell Telephone Laboratories Echo adı verilen bir uydu iletişim projesinin bir parçası ■olarak geniş bir çanak anten üretti. 1962 yılına gelindiğinde. Keşifler ya­ pıldıktan ve gizemler çözüldükten sonra. Penzias ve Wilson 1962’deki yerin üzerinde yapılan nükleer test ve hatta ante­ nin içinde yaşayan güvercin ailesi dahil tüm diğer olasılıkla­ rı metodik olarak denetlediler.

heıyerde keşfettikleri “parazit” aslında eski bir patlamanın devam eden ekosuydu! “Başlangıcın” ilk anlarından kendi­ lerini kurtararak.tercüme edilebilir bir . Bell Laboratuarlarındaki . Penzias ve Wilson galaksiler arası sinyalleri araştırarak evrenimiz hakkında daha fazla şey öğrenmeye eğimliyken. ona yaradılışın standart modeli adı verildi.benzer bir ironi ile ortaya çıkabilir. ” diyerek buluşun önemi hakkında yorum yaptı (1).. Yaradılışımızın en derin gizeminin yanıtının görm ezden gelinmiş olan kendi dünyam ızda her yerde ola­ bileceği mümkün müdür? Mukaddes Kitaplar’a ait İbrani ve Arap alfabelerini mo­ dern kimya ile BİRBİRİNE BAĞLAYAN OLAĞANÜSTÜ BİR KEŞİF yaşamımız boyunca içimizde varolmuş olan kökleri­ mizin gizemine dair kayıp bir şifreyi .insan birliğinin benzeri görülmemiş bir il­ kesi olarak yararlı olabilecek bir kanıt . böylesine bü­ yük bir enerjinin açığa çıkışı gerçekleşmişse.kuramını oluşturmuştu. Princeton Ü niversitesinden astrofizikçi John Bahcall. teori öylesine geniş kitleler tarafından kabul gördü ki.keşfin ironisi. Robert Dicke evrenin hayal edilemeyecek boyutta bir asli patlama şeklinde uzak bir geçmişte başlamış olduğunu öne süren teoriler araştırıyordu. parazitin kaynağını ve ne keşfetmiş olduklarını anladılar. o zaman olayın ekolarının mikrodalga radyasyonu şeklinde varolması gerek­ tiği .bugün evreni yıkamaya devam eden sürekli bir fon se­ si . Eğer.. yaradılışın en bü­ yük gizemlerinden birinin anahtarını elinde tutan kanıtın'' her yerde olması ve hiç beklenm edik bir şekilde. bilmeden yaradılışın Büyük Patlama teori­ sinin kanıtım bulmuşlardı. Penzias ve Wilson çalış­ malarından dolayı 1978 yılında Nobel Ö dülü kazandılar.Tanrı 'nın Şifresi adamı. iki yıl bo­ yunca görm ezden gelinmiş olan ve önem senm eyen bir olaydan ortaya çıkmasıdır. Belki de. aslında. 1970lerde. Bu üç bilim adamı bir araya ge­ lip de bulmuş oldukları şeyleri birbirleri ile paylaştıklarında. "Kozmik mikrodalga fon radyasyonu kozmo­ lojinin doğasını sonsuza dek değiştirdi. köklerimiz hakkında ipuçları arama .

Gregg Braden

alfabeyi - ve bir ipucunu ortaya çıkarıyor. Bu keşfi yaşamın
diline uygulayarak, DNAmızı oluşturan tanıdık hidrojen, nit­
rojen, oksijen ve karbon elementleri belki de artık eski dil­
lerin anahtar harfleri ile yer değiştirebilir. Bunu yaparak,
tüm yaşamın şifresi ebedi bir mesajın kelimelerine dönüştü­
rülebilir. Tercüme edildi, mesaj Tanrı'nın kadim isminin tam
harflerinin her bir hücrede, her yaşamda genetik bilgi ola­
rak kodlanmış olduğunu ortaya çıkardı.
Mesaj okunur: “Bedenin içindeki Tanrı/Sonsuz”
Anlamı: İnsanoğlu bir ailedir, ortak bir miras ile birleş­
miştir ve yaradılışın kasıtlı bir hareketinin sonucudur!
Dünyamızdaki yaklaşık 6 milyar sakinin her bir hücresin­
de korunan mesaj, varoluşumuzun yapı bloklarını oluşturmak
için sürekli tekrarlanmaktadır. Köklerimizden bugüne gelen
bu kadim mesaj - aynı mesaj - bugün ırk, din, miras, yaşam
tarzı ya da inanç gözetmeksizin, her birimizin içindedir. Bö­
lüm 9-da göreceğimiz gibi, şifre öylesine evrenseldir ki, ister
İbrani ister Arap diline çevrilsin aynı mesajı vermektedir!
Tüm yaşamın özündeki Tanrı’nın isminin keşfi bizlerin sa­
dece birbirimize değil aynı zamanda yaşamın kendisine de,
hayal edebileceğ iniz en derin şekilde bağlı olduğumuzu gös­
termektedir. İnce uzun tek bir çim parçasından balta girme­
miş yağmur olmanlarının büyüklüğüne, Bileşik gözlerinden
minicik bir tanesiyle bize dikkatle bakan bir tatarcıktan en
yakın primat akrabalarımızın delip geçen bakışlarına - fark­
lılıklarımızın sorun yarattığı her türlü düşünce tüın yaşamın
tek bir ismin kimyasal eşdeğerinden yapılmış olduğunun ka­
nıtlanması ile eninde sonunda çözüme ulaşacaktır. Ortak bir
esaretin böylesine somut bir delili ile bizlere, geçmişte bizi
birbirimizden ayırmış olan olayların ötesine bakmak için bir
neden ve farklılıklarımız üstesinden gelinemez gibi göründü­
ğünde yeniden başlamak için bir yer verilmiş oluyor.
Tarihte tüm çalışmalar kendi zamanının bir ürünüdür, bu
kitap dünyamızın 21. yüzyılın başlangıcında yaşadığı olağanüs­
tü koşullardan etkilenmiştir. Zamanımızın eşsizliğini belki de

Tamı ’rnn Şifresi

en net anlatan, devrim yaratan string field teorisini bulanlar­
dan biri olan ve City College of New York’da kuramsal fizik
profesörü olan Dr. Michio Kaku>dur. “İnsan tarihinin büyük
bölümünde, Doğanın güzelim dansına sadece seyirci olarak
bakabildik.” Öte yandan 20. yüzyılın yakın zamanlarını taki­
ben, doğa ile olan ilişkimiz yeni bir anlam kazanmıştır. Dr.
Kaku bu değişimi anlatarak devam eder, “Bilimdeki Keşif
Çağı Ustalık Çağı’nın başlangıcına yaklaşıyor. .. bugün, bir
çağ yaratma değiş iminin zirvesinde bulunuyoru z, Doğa’ya
karşı pasif seyirciler olmaktan Doğanın aktif koreografları
olma yolundayız.” (2)
Son yüzyıl içinde, aslında, yaradılıştan m addenin, başlan­
gıç, yaşam ve ölüm ün değişmeyen sırlarını talıhkla elde et­
tik. Yeni edindiğimiz anlayış geçmişte bilinmeyen yeni bir
yetenek elde etmemize neden oldu. Emrimizdeki doğa güç­
leri ile birlikte kendimizi, genetik kodlarımızı yeniden tasa­
rımlama, havanın seyrini özelleştirme ve yeni yaşam form­
ları yaratma - tarihte Tanrı’ya ve doğaya bırakılmış güçler yeteneğine sahip olur bulduk. Aynı zamanda, artık gelece­
ğimiz yeni bulduğum uz bu yetenekleri bilge bir şekilde kul­
lanmamıza dayalıdır.
Bugün, bilim ve teknolojideki yeni buluşlar sevdiğimiz
ve gözettiğimiz herşeyi koruma ya da yok etme gücünü par­
maklarımızın ucuna bağlamıştır. Kaydedilmiş tarihte ilk kez,
tüm türüm üzün hayatta kalması tek bir kuşağın seçimlerine
bağlıdır. Belki de, tam olarak böyle bir gücün varlığı bizleri, gördüğüm üz herşeyin bir parçası oldu ğumu zu ve bundan
çok daha yüce bir şeyin varlığını farketmeye zorlamaktadır.
Zamanımızın görülmemiş meydan okumaları ile karşı
karşıya iken, dünyamızdaki barışın - ve belki de hayatta
kalmamızın - anahtarının her birimizin içinde olduğu, be­
denlerimizdeki her bir hücreye mükemmel bir şekilde kay­
dedildiği ortaya çıkmaktadır. Belki de, bir 'tür olarak başarı­
mızın bir vasiyetnamesi olarak, küresel ailemizin her bir
üyesi varoluşum uzun ilk günü kaydedilmiş olan mirasımızın

Gregg Braden

sessiz birer hatırlayıcısı olarak aynı mesajı taşımaktadır. Şif­
resi çözüldüğünde, mesaj aşağıdaki inkar edilemez gerçek­
leri göstermektedir:
• DNA’nın temel elementleri - hidrojen, nitrojen, oksijen
ve karbon - İbrani ve Arap alfabelerinin temel -harflerini
doğrudan tercüme etmektedir.
• Bu dillerde, genetik kodlarımız Tanrı’nın kadim ismini
harflemektedir. Aynı isim tüm insanlarda, inançlarına,
davranışlarına, yaşam tarzlarına, dinlerine ya da mirasına
bakılmaksızın yaşamaktadır.
• Bu. ilişki, İbrani Sepher Yetzirah gibi kutsal metinlerde,
m odern bilimin böyle bir ilişkiyi doğrulamasından en az
1.000 yıl önce anlatılmıştı.
• Bu ilişkinin “şans eseri” oluşma ihtimali yaklaşık
200.000’de l ’dir.
Tanrı’nın Şifresi, 12 yıllık bir araştırmanın ve son derece
derin ve ■somut olan ve dolayısıyla da inkar edilem eyen in­
san birliğinin bir ilkesinin kişisel olarak incelenmesinin so­
nucudur. 1986 yılından beri, araştırmam beni bazıları bugün
yeryüzünün en bozulmamış,. en izole ve en uzak yerlerinde
saklı olan tapınaklara, köylere ve manastırlara götürdü. Bu
yerlerde, türüm üzün hatıralarını ve dünyamızın tarihini ko­
rumayı hayattaki görevleri ve aynı zamanda bir şeref oldu­
ğunu düşünen adanmış insanlarla tanıştım.
Eski efsanelere, geleneksel danslara, gizli dillere ve saklı
kayıtlara baktığımızda, en çok yaşattığımız geleneklerin kül­
türel, coğrafi ve dini bölünmeler karşısında dikkat çekecek
kadar benzer bir tema taşıdığını görürüz. Gelenekler yüzey­
den bakıldığında ne kadar farklı göriilse de, temelde' yatan te­
ma bizlere, insanoğlunun ailesi olarak, bizi bölmüş olan tüm
farklılıklardan çok daha yüce olduğumuzu hatırlatmaktadır.

Tanrı!nm Şifresi

. Birliğin böylesine güçlü bir mesajının bugün, milenyumun ilk yıllarında ortaya çıkmış olması tesadüf olmayabilir.
İstatistikler göstermektedir ki, 20. yüzyıl insan tarihinin en
kanlı 100 yılı idi, aynı zaman dilimi içinde olmuş olan tüm
doğal felaketler sonucu ölen insanlardan çok daha fazlası
şiddet, etnik temizlik, savaş ve katliamlar sonucu öldürül­
müştür (bkz. Bölüm 1, şekil 1.2). 21. yüzyılın ilk yıllarında,
şiddet devam etmekte ve dünya uluslarının yaklaşık üçte bi­
ri silahlı çatışmalarla meşgul olmaktadır.(3) Kazanç ve kay­
naklar için savaşmaya ek olarak, düşmanlıkların çoğu din,
ırk ve sınır farklılıklarına dayanmaktadır.
Bugün, bilim adamları, araştırmacılar ve dini liderler in­
sanoğlunu tek başına geleceğimizin en büyük tehdidi olarak
görmektedir. İnsan ürünü çaresiz hastalık ve ortaçağa daya­
nan Y e^nzünün eko sistemlerindeki çöküş gerçekleri zama­
nın en büyük tehditlerini bizlere göstermektedir. Böylesine
küresel tehlikelerin varlığı içinde, İkinci Dünya Savaşı'ndan
beri silahların ve askesi güçlerin korkunç birikimi, bugün
benzeri görülmemiş büyüklükte bir çatışma durum unda yer­
yüzünü yok etme riski taşımaktadır. İşte böyle bir konum
içinde günümüzü yaşamakta, çocuklarımızı büyütmekte ve
hayatımızda huzuru aramaktayız.
Belki de, durumumuz daha çok birlikte vakit geçirmeye
çok fazla alışmış bir ailenin gerçek yaşam bağlarının ne ka­
dar derin olduğunu unutması gibidir. Sevdiklerinin beklen­
medik bir kaybına kadar ailelerinin ve onlarla geçirdikleri
zamanların aslında ne kadar kıymetli olduğunu akıllarına
getirmezler. Hayatta kalanlar için, “kaybedilen” -hayata tek
bir açıdan bakma konusunda onları uyandıran bir kataüzatöre dönüşür ve onları yeni bir bakış açısıyla sarsar.
Bir kaybın aileyi değişime uğratması gibi, benzeri görül­
memiş acılar, dünyamızın kötüye doğru gidişi ve tüm kül­
türleri yok etme teşebbüsleri, geniş ölçekte, küresel ailemi­
zin - ve birlikte geçirdiğimiz zamanın - aslında ne kadar de­
ğerli olduğu gerçeğine biraz uyandıran bir katalizatöre dö­
nüşmüştür.

Gregg Braden

Öte yan d a n , verdiğimiz aile örneğinden farklt olarak,
insanların tüm ü uyanış gerçekleşmeden önce böylesine
aşırılıklar ve trajedilerle acı çekmek zorunda değildir.
Ailelerin ve ulusların çeşitliliği kutladıkları ve barış için­
de yaşadıkları bir dünya yaratmak, öte yandan, bugün toplumlarımızın pek çoğunda eksik olan bir şeyin - kendimizin
ve diğerlerinin yaşamını saygy göstermek ve çok daha yüce
bir şeyin parçası olduğum uza inanmak için bir nedenin gerekliliğini ortaya çıkarmaktadır. Bu tür nitelikler sadece
doğrudan deneyimlendiklerinde farkedilirler. Her kadının,
çocuğun ve erkeğin - geçmişte ve şimdi - bedeninde bulu­
nan Tanrı'nın adının yaşayan kanıtının böylesi bir deneyimi
sunmakta olduğunu keşfedebiliriz!
TANRI'NIN ŞİFRESİ NİHAYETİNDE bir barış çalışmasıdır.
Bilimin, dinin ve tarihin geleneksel sınırlarını aşarak, geçmi­
şimiz ile ilgili bildiklerimizle şu anda inanmakta oldukları­
mızı tek bir birleştirici ilkede kaynaştırmaktadır. Pek çok in­
san çok daha yüksek bir gücün dünyamızdaki rolüne şüp­
heyle bakarken, bedenlerimizde varolan Tanrı’nın adının
son derece derin, kişisel ama aynı zamanda bir o kadar da
evrensel bir farkındalık sunmakta olduğunu bilmek, yaşam­
larımızda çok daha yüce bir anlamı deneyimlemeye dönüş­
mektedir. Bu deneyim sayesinde bizlere, barışı bulm ak için
bir neden ve farklılıklarımızı çözmeye başlayabileceğimiz
benzeri görülmemiş ortak bir görüş verilmektedir.

Kitap Hakkında
1990 ilkbaharında, tüın zamanımı bu gibi birlik ilkeleri
geliştirmeye ve tanıtmaya adayabilmek için havacılık ve sa­
vunma endüstrisinde kıdemli bilgisayar sistemleri tasarımcısı

kendimiz farklılıklarımızla tanımladık. Araştırma­ lar devam ederken. hep birlikte. Tüm okuyucular için. bu eski el yazmalarını yazanların nasıl da keşfettikleri şeyleri gelecek . Eziyetler ve engizisyonlardan kutsal savaşlar ve katliamlara. bireysel tercihlerinine bağlı olarak bu kitapta yolculuk yap­ manıza yardımcı olmak üzere verilmiştir. Son yüzyılda meydana gelen mucizevi teknolojik ilerleme­ lerle bile. Gizemli “kayıp” Adem’in Kitabı’ndan Gnostik Nag Hammadi Kütüphanesi’ne kadar.■ tılı kısıma ayırdım: Kısım I bedenimizdeki mesajın yaşamı­ mızda neden bu kadar önemli olduğuna dair b ir tarihçe ve içerik sunmaktadır.önemlidir.. Bazı insanlar için. Aşağıdaki yönergeler. nasıl yerleştiğimizi anlamak için yap­ tığımız araştırmalarda ortak göz ve kulaklarımızı güneş sis­ temimizin sınırlarına ve şimdi de daha ötesine götürmüştür. Kısım . Herkes kitapları biraz farklı okur.Tanrı’nın Şifresi olarak sürdürdüğüm başarılı kariyerimi terkettim. geçmişimizin bazı en eski kayıtlarının nasıl va­ roluşumuzu n en eski somlarına yanıt bulmayı denediğini detaylandırmaktadır. Aynı za­ manda.sonuç bölümü . ve Kıs ım III ail elerim izi ve dünyamızı bölen fark­ lılıkları iyileştirmek için mesajın nasıl müthiş bir fırsat sun­ makta olduğunu tartışmaktadır. Kısım I kim olduğumuzu bilmeye olan özlemimizin dünyamız tarihinde nasıl şekillendiğini an­ la tmaktadır. yavaş yavaş açığa çıkmasına izin vermeyi tercih ederler. kim olduğum uzu hala tam olarak çözememiş ol­ mamız günüm üzün iron isidir. Diğerleri. sonunda onlara yararlı bir şeyler kazandıracağına inanarak. tarihinin en ge lişmiş dönem inde bilim.II şifrenin keşfini ve çevirisi ni verm ekted ir. oku­ m adan önce zamanlarını ve e nerjilerini harcayacakları kita­ bın özünü bilmek . yaradılış pla­ nı içinde. bu sayfalarda anlatılan keşifler eksiksiz ve anlamlı bir bilgi kümesi olarak kendi başlarına yer al­ maktadır. yazarın fikirlerinin tıpkı bir yolculuk gibi. Kitabı birbirinden üç farklı ama aslında birbiri ile bağlan. Bölüm 3.

Bölüm 6 Tanrı’nın eski ve kişisel adının . DNA molekülünün tercüme edilebilir bir dil olarak nasıl okunabileceğini kesin olarak anlamaya ilgi duyan okuyucu­ lar için. ortak bir geleceğin paylaşılan vizyo­ nuna dayanan zıtlık çözümüne özgü bir m etoddan bahset­ mektedir. Bölüm 8 ve 9 böyle bir mesajın ha­ yatta kalmamızı tehdit eden farklılıklar arasında köprü' kur­ mada oynayabileceği rolü anlatmaktadır.nasıl DNA’larımızın en temelini oluşturduğunu ortaya çıkarmaktadır! Tek bir mesajın günüm üz dünyasında nasıl bir farklılık yaratabileceğini soranları bu sonı ile ilgili olan Kısım III’e doğrudan geçmeye devat ediyorum. Hava ve Su ele­ mentleri arasındaki saklı bağı ve günümüz kimya dilindeki eşdeğerlerini . Harfleri ve elementleri ortak bir sayılar paydasına indirge­ yen olağanüstü buluş “elmalarla elmaları” karşılaştırmamıza ve Genesis’in en eski hikayelerini günümüz bilimi arasında ilişki kurmamıza olanak tanımaktadır. Bölüm 4 eski ve m odern inançlar arasında köprü kuran saklı ilişkiyi açığa çıkarırken. Kısım II keşfin arka planını. 8 ve 9 mesajın hayatımızdaki anlamına değinmektedir. Bölüm 9.zamanımızdan 3500 yıl­ dan çok daha önce kaydedilmiş isminin . Bölüm 7. Sepher Yetzitah. örneğin. İbrani geleneklerin kitabı. tarihini ve özelliklerini detaylandırmaktadır. bi­ lim ve hücrelerimizdeki mesajın çevirisini takiben. Bunu yaparak. vizyon ortak bir görüşe farklılıkları insanlar arasındaki ilişkileri etkilediği zaman başla­ nılan ya da geri dönülen bir yere . Bölüm 5..Gregg Braden kuşaklarla paylaşmaya can attıkları açıktır.şaşırtıcı sonuçları olan bir ilişki .dönüşür. "Keşif. ya da Yaradılışın Kitabı’nın tanımı ile bitiyor. Kısım Il’deki tarih. Bu tür geleneklerde. Bölüm bilinen en es­ ki ve aynı zamanda en gizemli olan.” bu güçlü bağı uygulamaya sokmakta ve yolculuğumuza alfabe­ lerin ve saklı harf şifrelerinin gizeminde devam etmektedir. Bölüm 4 eski Ateş. Bölüm 7 Tanrı’nın adının bedenlerimizde olan saklı anlam­ larını bize gösterirken.ortaya çı­ karmak için Sepher Yetzirah’da bulunan ipuçlarını uygula­ maktadır. Çözüm noktası .

Herkes nihayetinde aynı soruyu sormaktadır: . katılımcıların vizyonu tarafından inkar edilem eyecek kadar birleştirici bir deneyim olmasıdır.. Eski bir atasözü vardır.getirmek amacıyle mesajın gü­ cüne odaklanmayı seçtim. pek çok de­ rinlemesine ele alınmış ve son derece kişisel inançlara de­ ğinmektedir. bizleri bireyler. seçimler netleşir ve nasıl bir. Gittikçe artan miktarda kanıtlar bunun günüm üzün en tar­ tışmalı komısu olduğunu ileri sürmektedir. Eninde sonunda. günüm üz krizlerinin çok daha de­ rin ve temel bir endişenin semptomları olduğunu keşfede­ ceğiz.ve seçimler her zamankinden çok daha zordur.Tanrı ’rnn Şifresi paylaşılan vizyonun. dinler ve uluslar olarak bölen konular karşı konula­ maz oranlara varmıştır .daya­ lı çatışmalar için yararlı olabilir. bedenlerimizdeki Tanrı'nın adının tanınması deneyiminin daha geniş çaptaki bir çatışmanın çözümlen­ mesi için benzer bir amaca hizmet edebileceğini öngörm ek­ tedir. Bu nedenle. bunun nedeni genellikle ihtiyacımız olan bilginin ' hepsine sahip olaınayışımızdır — birşeyler eksiktir. yanıtlar bulanık ve konum lar çö­ zülmesi zor ise. Bu kısım. özellikle dini ve etnik farklılıklara. Bu yaklaşım.davranış içinde olunacağı açıktır. Hücrelerimizdeki şifrenin her bir anlamının hakkını vermek şimdiki koşulların çok ötesinde bir şeydir. İyi Araştırılmış bir Kitap ya da Teknik Yazı: N eden Bu Yaklaşım? Bu kitap herkesin de kabul edebileceği gibi. yaşamlarımızdaki farklılıklar arasında köprü kurm ak ve dünyamıza barış . aileler. Etrafımızdaki terörizm karmaşası ve Orta Doğu toprakları için 4000 yıldır yapılan savaşlardan dünyanın ekosisteminin çökeceği öngörüsüne ve kitle imha silahlarının gittikçe artan stoklanışına kadar. Tüm bilgiler var­ ken.

Doğası gereği teknik ola n herhangi bir keşifte oldu ğu gi­ bi. Köklerimizin en eski tanımlarından en gelişmiş bilimsel anlayışlarımıza ka­ dar. böyle yapmak her geçen gün artan bulguları ortaya çıkarmak anlamına ge­ lirdi ki bu da nihai basımı ve mesajın gücünü aylar ve hat­ ta yıllarca erteyebilirdi.gele­ ceğimizi hazırlayan politikalarda . 1990 yılında.Gregg Braden Geleceğimizin dünyasını inşa ederken bilimsel ve siyasi seçimlerimizin insani maliyetini hangi “ölçü standardını” kullanarak ölçüyoruz? Yaşamın en temelindeki bir mesajın somut. (Örneğin. Öte yandan. Çizimlerin. . O zeka ile' olan ilişkimiz. diğerleri çok daha az bir akademik yaklaşım içimde olmam için beni cesaretlendirdi. emsaller ve bilirkişiler tarafından yapı­ lan değerlendirm eler yüzünden altı yıl gecikmişti. Aynı zamanda. Me­ sajın bizim yapıldığımız “m adde” olması gerçeği bize çok daha büyük bir planın parçası olduğumuzu anlatır. bu kitabın konusu bilim ve ruhaniyetin geleneksel sınırlarının üzerine çıkmaktadır. zamanımızın tehlikelerini ortadan kaldırmak için. bazı uzmanlar bana malzemeyi bilimsel bir açıyla sunmamı öğütlemişlerdi. günümüz sorunlarını çözmek için yeni güçlü araçlar yaratmaktayız. bilim. Tevrat’taki sayısal şifrele­ rin sınırtaşı çalışması. onla­ ra tanımlar getiren düşü ncel erin ötesinde arayışımızı sürdür­ memiz gerektiği çok açıktır. savaş ve barış politikalarında . Doğası gereği. gerçekliği ka­ nıtlanabilir ve evrensel işareti varoluşumuzun altında yatan çok daha yüce bir zekanın su götürmez kanıtını sunar. kendi yarad dışımızın gizemine benzeri görülmemiş bir pencere de açmaktayız. Geçmişimizin bilgeliğini gelece­ ğimizin bilimi ile birleştirerek.göz önüne alınması ge­ reken bir etkendir. bu projeye başladığımda. zorluk bilgiy i bir şekilde yanlışsız ve anlamlı bir şek ilde geniş hedef kitlelerine iletmekti. (4)) Aynı süre zarfında.

yapısal bir rapordan ziyade akıcı bir hikaye tadında bir ke­ şif sunarak okuyucuma saygımı gösterebileceğimi hissettim. detaylı olarak araştırmaktadır. gerek­ tiğine inandılar. Bölüm 4 ve 5. Bu çalışmayı oluşturan sayısız incelemenin tanıtımında. hem anlamlı hem de okuması eğlenceli bir kitap yaratmışımdır! Böyle düşünürken bile. Derinlikleri yüzünde bu bölümleri es geçmek isteyen okur­ lar için. Tanrı’nın Şifreşi’nin Gücü Gelecek nesiller için madde ve yaşam anlayışımızı arıtma­ ya devam ederken. noktaların bir özeti her bölüm ün sonuna eklenmiştir. örneğin. bu kitapta şüphesiz diğer çok da­ ha “sözü fazla uzatan” ve diğerlerine göre çok daha teknik olan bölümlerle karşılaşacaksınız. Aynı zamanda. Gücümüzü yanlış kullanmanın geri dö­ nülemez sonuçları sonucu acı çekmeden önce doğanın güç­ leri ile bilim hakkında bildiklerimizi dengelemek için bilgelik kazanacak ınıyız? Öğrenme sürecimizi devam ettirecek miyiz? . her iki yaklaşımın da en iyilerine almayı ve “ortada bir yerde’’ olan bir kitap sunmayı seçtim.Tanrı ’nm Şifresi \ oo] J grafiklerin. böyle yaparak. onun yerine mesaji en çabuk şekilde daha geniş kitlelerle paylaşma fırsatının çok daha değerli bir de­ ğiş tokuştu. Hikaye formatında. dipnotların ve kaynakların çoğunu atmam. Böylesine dürüst ve samimi tavsiyeler nedeniy­ le. bedenlerimizin kimyasının ve eski İbranice dilinin nasıl bir­ biri ile bağlantılı olduğunu . bugün yüzleştiğimiz soru bilgelik ve güç arasındaki dengedir. anahtar. bu kitabı m üm kün kılan araştırmamın kaynaklarını da ekledim. Umarım. ritmi kaçırmamak ve karşı taraftaki geniş okuyucu kitlesi için cazibesini yitirme­ mesi için anlaşılması güç teknik terimleri ve uzun açıklamaları en aza indirmeye çalıştım. Bu yaklaşım benim keşifi uygun bir şekle sokarken aynı anda da ona olan sommluluğumu paylaşmamı da sağladı.

“bu. bir şeyden emin olabiliriz: son yüzyılın savaşlar. Yeni bulduğumuz güçlerimizi tam olarak nasıl kullana­ cağımızla ilgili olarak her ne kadar bilinmeyen bir bölgeye müdahale etmiş olsak da. herşeyi tek bir öncelikli konuya indirgeyebiliriz. gelecekçi ve sosyal mimar Barbara Marx Hubbard durumumuzu şöyle özetliyor.Dr. en derin sağduyu ve sevecenlik kaynaklarımızı deneyecektir. enerji ve yaşam hakkında yorum ya parken. Pagels bizlerin bu güçle­ ri yerleştirecek ahlaki ve siyasi bir düzen bulmamız gerekti­ ğini. doğanın güçlerini ve Tanrı’yı planlayıp düzenler­ ken bize yol gösteren net modeller olmadığı ortaya çıkmak­ tadır.(6) Bu kitap bir seçimimiz olduğuna inanmamız /^T \ Gregg Braden . Böyle yapma isteğimizin mey­ vesi kalıcı barışın anahtarından ve kendi varlığımızın muci­ zesinin idarecileri olarak rolümüzü yakıştırmaya bir davet­ ten daha azını ortaya çıkarmayacaktır. Yirminci yüzyıl başlarında keşfedilen ışık. “bu­ gün bilinçli evrim ve güçlerimizi yanlış kullanmamız sonu­ cu olmakta olan neslimizin tükenişi arasında bir seçim yap­ malıyız.”. güçlendirici ve belki de bazıları için fazladır. DNAmızı daha yüksek bir güçten bir mesaj olarak gör­ menin gerekleri çok geniş. Bu malzemenin öne sürebileceği pek çok imkanın ışığında. ünlü kitabı Hyperspace’de tarihteki son fi­ zikçi Heinz Pagles'iri günümüz hakkındaki bakış açısını paylaşır. Tanrı’nın Şifresi ak­ lımdaki tek bir amaç için yazılmıştır: insanlık ailesini farklı­ lıklarımıza ■dayalı olarak bölen herşeyden çok daha üstün olan tek bir birlik ilkesini net ve basit bir şekilde gözler önü­ ne sermek. Her biri bize yaşamın .tüm yaşam­ ların . ” (5) Burada. öngörülü. aksi halde yok olacağımızı vurgulamıştır. nefret ve acılarla bize öğrettiği derslerden. Öğrendiklerimizi sadık kaldığımız ve yaptığımız her seçimde yaşam ilkesine saygı duyduğumuz sürece yanlış yapmayız. çevresel felaketler.kutsal ve birbirine bağlı doğasının heryerde olduğu­ nu hatırlatmaktadır. hastalıklar. Michio Kaku. Tek bir cümleyle. tartışmaya açık.

■ V io^/ — G regg B ra d e n Taos. Farklılıklarımızla ilgili bu derece vurgulamaların ya­ şandığı günüm üzde. New Mexico Aralık. teknolojinin ve barışın varlığının türüm üz tarihindeki bu en büyük sorgula­ masına girerken Tanrı’nın Şifresi bir çözüm olma niyetinde değildir. Bilimin. bu kitap sadece bir başlangıç noktası olmayı amaçlamaktadır.Tanrı ’nın Şifresi için bir neden olduğunun ve bir zamanlar üstesinden gelinilemez olan global ailemiz içindeki farklılıkları birleştiren tek bir ismin gücünün hikayesidir. 2003 .

BÖLÜM - 1 - Biz Kimiz? Gizemin Kendisinden İpuçları .

özellikle de ken d im iz hakkındaki cehaletimizdir. ” — CARL SAGAN "The Dem on-Haunted World” ve “Science as a Candle in the Dark”m yazarı .“İn sanın sefaletine neden olan çoğu za m a n aptallık değil. cehalettir.

Aynı zamanda. dünyamızda birlik ve yaşamlarımızda daha derin bir an­ lam arıyoruz.- 1 - T ^ A R İH : Farklılıklarımızın Hikayesi g i z l e r aşırılıkların ve çelişkilerin gizemli bir türüyüz. bildiğimiz dünya artık as­ la aynı olamazdı. .O D en ir ki.kanıtlanabilir delil keşketmek ne anlama gelirdi? Her kadının. bizler en güzel rüyaları görme ve en karanlık kabusları barındırma yeteneğine de sahibiz. erkeğin ve çocu­ ğun her bir hücresinde yaşamın kendisinin kimyasal bir şif­ resi olarak saklı olan Tanrı’nın kadim isminin varlığına tanık olsaydık yaşamlarımız ve dünyamız ne kadar farklı olurdu? Böyle bir mesaj paylaşıldığı anda. Belki de şimdi­ ye kadar tarihin hiç bir döneminde dünyamızı kendimizi böylesine ayrı ve yalnız hissederken bu kadar da çeşitlilik içinde paylaşmamıştık. . İşte bu aşırılıkların bağlamın­ da. Türüm üzün yaradılışın kasti bir hareketi olarak varoldu­ ğunun inkar edilemez bir kanıtını . geleceğimizin ola­ nakları asla bu kadar um ut verici ama aynı zamanda bir o kadar da korkutucu olmamıştı. her bir vizyonumuzu yaşama geçirme gücü­ ne sahipken.

Hindu geleneklerinin Yüce Tanrı’sının ve Amerikan yerlilerinin Ulu R uhu’nun . Son 2000 yıl boyunca. varolan şeyler gizemimizin çözüm ünün ipuçlarıydı ve bu ipuçları geçmişi­ mizin yazılı kayıtlarının eksik olduğunu ve sadece görünen­ den çok daha yüce bir şeyin sadece bir bölüm ünü ortaya çı­ kardığını söylüyordu. dini savaşların ve engizisyonun ay­ nı edebi mesajın yanlış anlaşılmış olm asından dolayı yapıl­ dığını bilmenin eski yaralan iyileştirebileceğini düşünün! Böyle bir keşfin ortaya çıkışıyla. bir kerede tek bir harfin çevrilebildiği bezdirici elyazmalan parçalarında arar­ larken. buldukları şeyler ilginç ama araştırmacıların beklen­ tilerini karşılamaya çok uzaktı. Tanrı adına çatışma sadece çatışma yaratma seçiminden ortaya çıkacaktır. O andan sona. Böyle bir an­ da. Yahudi-Hıristiyan inançlarının Lord’unun.İslam'ın Allah’ının. etnik temizliklerin. Öte yandan. Kahala'mn kadim Yaradılışın Kitabı. Tanrı adına yapılan zulüm ­ lerin. yaradılışımızın şafağından beri keşfedilmeyi beklemiş olabilir mi? 4000 yıldan fazla süredir. İnsan ırkının ortak mirasının inkar edilemez delili sayesinde.Tanrı ’m n Şifresi Dualarımızdaki Tanrı’nın . bilginler biz­ den önce gelenlerin . farklılıklarımıza dayanan gaddarlıklar­ da cehalet kullanılamayacaktır. bizler yeniden başlayabiliriz. Uzak manastırlardaki kütüphanelerde. geçmişimizin korkunç­ luklarını haklı gösteren nedenler artık kullanılamaz hale ge­ lirler.yazılmış tomarların. kalemle oyulmuş duvarların ve ilk çağların parçalanmış metinlerinin .aslında aynı Tanrı olduğunu keşfetmenin ardında yatan anlamı h a ­ yal edin. Sepher Yetzirah’da yazılı olan gizem dolu pasajlardan Delfi’deki Apollo’nun . Doğru Yanıtları Yanlış Yerlerde A ram ak Böylesine güçlü bir delil var mı? İnsanlığın en kutsal so­ rum luluğunun bir kaydı zam ana ve m edeniyetin tahribatla­ rına direnmiş.yıllan­ mış kayıtlarında ipuçları ararken özellikle bu soruları sordu­ lar.

Kavramsal olarak. yaşamımız boyunca kazanacağımız deneyimler sayesinde en kadim bilgeliği kazanacağımızı düşünerek bu tür yazıları mecazi olarak gördüler.bil­ ginin bir zaman kapsü 1üne . ev aletlerinde. Yaratıcımızın kimliği ve türüm üzün başlangıcı hakkında uzun zamandır unutulmuş olan yanıtı taşıyan evrensel bir anahtardan . Birkaçı. Ö te yandan. Bu anahtar aracı­ lığıyla. Kırık dökük tapınaklardan ve harap olmuş el yazmalarından geriye kalanlardan incele­ n eceğine. en derin gizemim izin anahtarı yaşamın kendisinin ifadesinde saklı tutuluyor olabilir. Çok uzun zamandır kabul edilen özgün geleneklerde bulunan güçlü ve etkin bir dille. .olarak görülüp harfi harfine alınabilir ve d oğrudan okunabilir mi? Eski çağrıların yeni. Arabalarda. bizi şu ana kadar bölen inanç. Bu tür paragrafların konusu aldatıcı bir biçimde basittir. “içine bak” davetinin daha fazla bir anlamı olabilir mi? Bu tür yazı la r. Karmaşık elektronik biliminden bir sanatçının tuvalinin sadeliğine kadar başarılarımızın baş­ kaları tarafından bilinmesi arzusu insan doğasının bir parça­ sı olarak görülmektedir. Tanrı ’nın yarattığının tamamlanmış eserinden yani biyo­ lojimizden bahseden en kutsal saydığımız geleneklerde bu­ lunabileceğini öne sürmektedir. yaradılışımızın ipuçla­ rını bulabileceğimiz birer direktif . en derin gizemlerimize yanıt bulmak için “Kendini tanı”maya ve “İçinde ara”maya davet edildik. içimizi harekete geçiren müzikten hiç ses çıkarmadan bize esin kaynağı olan heykellere kadar. Bilginler. bir yorumu gizemlerimizin anahtarı­ nın.hakiki talimatlar .bahsediliyor. m odern dünya­ mızda varolan felaketler ve sorgulamaların aslında ke nd i iç­ lerinde ve kendilerinin önemli öğretmenleri haline geldiğini tartışmışlardır. onu yapanın imzasını bul­ mak için sadece o çalışmanın kendisine bakmamız gerekir. yaratıcısının kanıtı için yarattığı bir şe­ yin için içine bakma fikri bugün yaygın olan bir uygulama­ dan çok da farklı değildir. kalıt ya da tarihsel farklılıklar arasında köprü kuran bir neden verilmektedir.Gregg Braden Tapınağı'nın girişindeki orjina! yazıtlara kadar.

” dem iştir. Tarih bize ay­ aca kendi zamanlarının kabul edilmiş inançlarını paylaşm a­ da başarısız olmuş kişilerin ve tüm bir halkın deneyim lem iş olduğu sonuçları da hatırlatır. kimlik arayışımızın. kiın olduğum uzu sorgulamamızın ve özellikle de yaradılış planına nasıl uyduğum uzun yaşayan bir kaydım kaleme aldık. Böyle yaparak. Afrika’nın Olduvai Gorge bölgesinde ilk dönem hominidlerini bulmasıyla alkışlanan antropolog Louis Leakey bir kere­ sinde “Kim olduğumuzu ve nereden geldiğimizi bilm eden gerçekten ilerleyebileceğimizi düşünm üyorum . yaşamın kütüphanesine yönlendiren bir katalizör ol­ duğunu anlayabiliriz. Zam anın sayfaları ara­ sında.Tanrı ’nm Şifresi Eğer bizim Yaratıcımızın bir "imzası”. gerçekte. Geleceğimizin anahtarının geçmişimizde yattığı söylenir. aileleri. Louis Leakey’in oğlu antropolog Richard Leakey babasının duygularının önem ini tekrarlamış. Daha sonra. Mısır'ın çöllerinde­ ki heybetli tapınaklar.” demiştir. Böyle bir imzayı açığa çıkarmanın sırrı öncelikle bizi dünyamız ve belki de daha da önemlisi birbirimiz ile bağla­ yan evrensel ilkeleri tanımamız gerektiğidir. Toplu olarak. . “Bugün nerede olduğumuza bir anlam verm ek için nereden geldiğimize bakmamız gerekir. zaman ve doğa elementlerinden sağ kurtulmayı başarmışsa. savaçları ve başarıları olarak saklandı. (1) Tarih yolculuğumuzun hikayesidir.ulusları. Yukatan’ın balta girm em iş ■orm anla­ rında gizlenmiş gözlemevi eri >Peru dağlarındaki m abetler ve Avnı p a ’daki büyük kate dral ler Tanrı h akkında asl a değişm e­ yen fikrimizi memnun etmek ve ona daha yakın olm ak için tarih boyunca gösterdiğimiz çabalan hatırlatır. geçmişi arayışımızın bizi sabırla varoluşun en eski bilgi kay­ nağına. o zaman işaretin bedenlerimizin içinde kalmış olması çok mantıklıdır. kendim izi tanıma ça­ basında duyularımız ve inançlarımızın en son sınırlarını sor­ gularken geride çevirmediğimiz bir kaç kapalı taş bıraktık. Mirasımız bizden önce gelenlerin geçmişimizin yapı taşlarının . 20. Tarihimizin büyük bölümü çok daha yüce bir gücün var­ lığında lütuf bulma girişimimizi yansıtır. yüzyılda.

en yakm insan atalarımız sadece 250000 yıl önce ortaya çıkmış­ tır. toplumlarımızın serveti ve teknolojimizin ileri oluşu ile tanımlanan bir türün hikayesidir. Carer H ü­ kümetin altında çalışan eski ulusal güvenlik danışmanı Zbiginew Brzezinski. Bu sınırlara dayalı olarak. besleyen sınıf ve toplu­ mun görünm ez sınırlan içinde ikiye katlamayı başardık. hastalıklarla savaşmamıza ve hayatlarımızı daha uzun yaşamamıza olanak tanıyan mucizevi teknolojiye kor­ ku ve merakla karışık bir saygıyla bakmaktayız. 1993 yılında farklılıklarımıza.dayalı şiddetin . Bilimadamlarının dün­ yamızın var oldugunu tahmin ettiği 4. bir çok insanın korumak için savaştığı yaşamlarının "insanın insan yaptığı insanlık dışı davranış” dediğimiz zu­ lüm ve şiddetle rutin bir şekilde yok edildiği bir dünyada buluyom z kendimizi. Geçt iğimiz yüzyılda yapılan ve tek bir günde çok büyük sayıda yaşamı yok edebilecek yüksek tek­ nolojik silahlar geliştirilirken.5 milyar yıl içinde. derinıizi n rengi. küresel ailemizin sayısız üyes'i m an­ tıklı ve sevecen insanların düşünemeyeceği ve hatta hayal bile e demeyeceği şekillerde acı çekmiştir. tarihçi Eric H obsbaw n’ın “bili­ nen tarihin en öldürücü yüzyılı” olarak adlandırdığı dönemi yaratmada tarih çok daha derin birşeyin varolduğunu gös­ termektedir. •Bizimki din. farklılıklarımızı bul­ mayı ve onları ayrı olma duyumu. Birlikte. bizi birleştirecek ilkelere odaklanmak yerine bizi bölen farklılıklara odaklanmak ço­ ğu zaman çok daha kolay olmuştur. Bugün. (2) Onun “siyasi olarak harekete geçirilmiş katliam” dediği şey tarafından alınan ücret değerlendirmesinde. Bu göreceli zaman parçası boyunca. engizisyonlarla.Gregg B a d en Farklılıklarımız Tarafından Tanım lanan Bir Tür Çeşitliliğin olduğu dünyamızda. Aynı za­ manda. eziyetler­ le. kölelikle ve yeıyüzünden tüm bir soyu yok etme girişimleriyle noktalanan bir tarihin karanlığını paylaşmaktayız.

1948 BM Soykırım Konvan­ siyonunun II.8 milyonu bulmaktadır (12).toprak ve doğal kaynakların sahiplenmesinin ötesinde prensiplere dayanan toplumları acımasızca “temiz­ leme” çabaları.Vüy Tanrı ’ntn Şifresi 20. . geçen yüzyıl felaketlerin farklı bir şekilde yükselişine tanık oldu . 3. on­ larla birlikte 4. Şekil 1. yüzyılda 167 ila 175 milyon yaşama malolacağmı . 2.1: Engizisyonlardan ve soykırımlardan ölenlerin tahmini sayısı. Balkanların istatistiği belgelenmemiş sivil ölümleri içermemektedir. Tahminler tarihi kayıtlardan alınmıştır. 1948 yılında. “tüm bir insan grubunun varolma hak­ kının inkar edilmesi” olarak tanımlamak amacıyla soykırım terimini kullanmaya karar verdi. Toplum üyelerine ciddi bedensel ve zihinsel zararlar vermek. Tüm den ya da bölüm bölüm o toplumun fiziksel yıkımını gerçekleştirmek için tasarlanmış yaşam koşullarını bilerek zorlamak. Toplum üyelerini öldürmek. Maddesinde insan nüfusuna bakılarak soykı­ rım beş kategoride tanımlandı ve açıklandı: 1. Fransa ve İtalya’nın toplam nüfuslarına eşit! tahmin etmiştir. (3) Sınırlar ve kaynaklar boyunca devam eden savaşlarla be­ raber. Birleşmiş Milletler Genel Top­ luluğu bu tür şiddeti.ka­ baca İngiltere. karşılaştırmaya eklenmişlerdir. Her ne kadar Haçlı Seferleri metinde tartışılan zaman aralığından önce olmuş olsa da.

Afrika ve Tibet’de meydana gelen etnik' temizlikler dahil yapılan tüm gaddarlıklar sonucu bu sayı 53 milyonu geçin iştir. son yüzyıl kanlı savaşları yüzünden. yüzyıl a kadar sü­ ren Amerikan yerlilerinin soykırımı arasında.1). Dünya Savaşı dırasında Hıristiyanların ve Katoliklerin Polonyalı soykırımı. Amerikan yerlilerini toprakların­ dan sürmek ve günümüz trendi haline gelen yaşam şekille­ rini yoketmek 300 yıllık bir soykı rım çabası gerektirmiştir ve bu günüm üze kadar gelmiştir (bkz. ve Balkan bölgesi. Doğal felaketlere kuraklık ve kıtlık gibi olaylar dahil edilmemiştir. din ve miras farklılıklarına. Vietnam. dayalı soykırım şekli Brzezinski ve diğerlerinin etnik temizlik olarak belgeledikleri bü­ yük ölüm lerden soru mludu r. Laos. yüzyılda din ve inanç farklılıkları. Her ne kadar bu tür zulimlerin tarihi m odern çağımızdan çok önceleri başlamışsa da.2: 20. Kamboçya. 5. yaklaşık 40 milyon insan din. Irk. yüzyılın Avrupa’da­ ki 2. AIDS ve doğal felaketler yüzünden ölen­ lerin tahmini sayısı. yüzyıldan 19.Gregg Braden 4. 20. 2. Şekil 1. Afrikalıların Atlantik köle ticareti ve 17. Şekil 1. Toplumun çocuklarım zorla başka bir topluma nakletmek. Toplum iç inde doğumları engellemeye yönelik önlemler a lmak. Dünya Savaşı’ndaki Yahudi soykırımı. son yüzyılın dehşetinden önce. aynı . ırk ve mi­ ras farklılıkları yüzünden ölümüştür. insanı böylesine sersemleten sayıları bir perspektif içine koyduğumuzda.

Çatışmaların çaresini bulmak için siyasi girişimler her zam an Şekil L3: 2002 yılında Aktif Birleşmiş Milletler Barışgücü Öze! Görevleri. Hindistan. yüzyılı tarihin kaydettiği en şiddet dolu yüzyıl olarak öğrenecekler. Belki de. (16) V3o^y Barış. din i ve felsefi çatışmalara dayalı şiddet sonucu yokolduğu görülmektedir (bkz. sivil savaş ve dini farklılıklarıdan gelen tehlike. yüzyılın ilk yıllarında. geçen yüzyılı bozan şiddet ve acının yeni milenyumun ilk yıllarına miras kalaca­ ğı ile ilgili küçük bir şüphe doğurmaktadır. Şekil 1. 21. geçen yüzyılın ABD ve Sovyetler Birliği arasındaki Soğuk Savaşa benzer silah yarışları ye­ ni m ilenyım da sahnedeki yerini aldı. Pakistan.2).etnik. kadın ve erkek . Gelecek kuşaklar 20. (17) . sayıların kedisi anlattıkları hi­ kayenin büyüklüğü yanında çok daha az önemlidir.her yaştan 80 milyon çocuk. böylesine va hşi bir tanımlamanın devam etmesi için düşün­ celerin çoğu sorumludur. İran ve G ü­ ney Kore gibi ülkelerdeki nükleer silah program larının artı­ şının yeniden canlanmasıyla. Tarihçiler genelde bu sayılar üzerimde anlaşmış olsalar da.Tanrı ’mn Şifresi dönem içinde ortaya çıkan tüm önemli doğal felaketler ve AIDS salgınında kaybedilenlerden beş kat daha fazla yaşa­ mın . Terörizm. bu nedenle son yüzyıl aynı zamanda “barışın öldürüldü­ ğü” yüzyıl olarak bilinir.

askeri arabuluculuk geçici bir . kabul ettirilmiş bir barış genellikle et­ kisizdir.3). dünyanın bir bölüm ündeki acı ve öfkeden kaynaklanan şiddeti bastır­ m ak çatışmanın sona ermesini sağlamaz. BM güçlerinin amacı belli bir coğrafi bögede barış ve is­ tikrarı sağlamak olmasına rağmen. bir güç şovu ile çatışma­ yı dindirdikleri yerlerde sağladıkları barış zorla kabul ettiril­ miş bir barış olmaktan öteye gidemedi. Bunlar özellikle Bosna ve Herzegovina’dan Sierra Leone ve Doğu Timor’a kadar kend ilerin i değişik yerlerde kanıtlamış olan güçlerdir. Buna ek olarak. ateşkes yaklaşımı geniş bir askeri girişim olmuş­ tur: zorbalığın güçlerini ek bir zorbalığı önlemeye yönelik daha büyük bir güç ile yenmek. İçi su dolu bir balona parmağınızla bastırdığınızı ve ba­ lonun başka bir yere doğru esnediğini düşünün. 21. Öte yandan tarih göstermiş­ tir ki. BM barışgücü görevlerinin büyük bölümü Doğu Avrupa. Açıkça. Afrika ve Or­ ta Doğu’ya odaklanmış durumdadır. böylece kurulduğu 1945 yılından bu yana sürdürdüğü özel görevlerin toplam sayısı 54’e çıkmış oldu (bkz. Birleşmiş Milletler bu tür 15 barışgücü özel görevine daha girişti. uzun dönem de. BM güçlerinin uluslararası doğası. bugün. bu tür girişimler işe yarama­ dığı zaman. durumu düzeltmek için çok daha büyük bir as­ keri gücü sağlamayı vaadedebileceklerini hatırlatan bir güç olarak hizmet vermeye başladı. “resm i” bir konumdan.Gregg Braden en çok tercih edilenler olsa da. dünyanın çoğunluğunun ba­ rış güçlerinin arkasında olduğu ve eğer istenirse. Bu açıdan bakıldığında. yüzyılın ikinci yılında. bu tür görevlerin sayısı ve süresi bize önemli bir ders vermektedir. Askeri birlikler ve yaptırımlar belli bir bölgede şiddetin dışa vurumunu zorlaş­ tırarak çok iyi bir iş başarırken şiddetin kökünde yatan ge­ rilim devam eder. Gücün şiddetin yoğunlaştığı bölgelerdeki isyanı bastırmak için kullanımını takiben. Şekil 1. gerilimin belli bir bölgede anında çok daha büyük bir oranda ortaya çıktığını görmek şaşırtıcı olmamalı.

bu tür karşılıklar kısa dönem de hayat kurtarm a anla­ mında adına anlamlı olabilir. Roma’nın d ü ­ şüşünden eski Sovyetler Birliği’nin parçalanm asına kadar. Devamlı barış. Her bir çatışma. davranışlarımız bu inançlara yansır. . isterse de tüm dünyadan. yenilen­ miş bir şiddet dalgası oluşmuş ve gücün devamlı bir barış getiremeyeceği gerçeğini gözler önüne sermiştir. Tarih göstermiştir ki. birbirimize ve yaşamın ilkesine saygı­ sızlık etmeyi seçtiğimizde. Bu sorunun yanıtı sadece geleceğimizle ortaya çıkabile­ cekken. bir konuda emin olabiliriz: geçmişimizden ders ala­ biliriz. Örneğin.Tann'nm Şifresi çözüm. Dünyada barışı korum a çaba­ ları şiddetin kısa süreli engellenmesinin anahtarı olsa da ve herhangi bir çatışmanın barışçıl bir çözüm üne doğru çok önemli bir adım sağlasa da. Askeri gücün varlığına rağm en. İster akşam yemeği için bir araya gelmiş bir aileden bah­ sedelim. İsrail ve Filistin halkı arasında devam eden çatışma ise yeni milenyumun ilk yıllarında tırm anm a­ ya devam etmiştir. Som. gerçek barış basitçe ça­ tışmanın olmamasıdır. sonuçta değerli zamanı satın al­ madan biraz fazlasını yapmış olurlar sadece. Yaşamı önem verdiğimiz v e küresel bir ailenin bir üyesi ve Yeryüzünün yöneticileri o la­ rak gördüğümüz zaman. bu süre zarfında bizleri bölen konuları çözm ede başka bir yol bul­ mak için gerekli bilgeliğe acaba sahipmiyizdir. varolan çok daha derin bir krize hızlı bir çözünı ola­ rak görülebilir. bu basit gerçeği unutmak en güçlü uluslardan bazılarını ta ­ rihten tamamen silmiştir. her savaş ve etnik tem izlem e girişi­ mi bizlerin Yaratıcı ve yaradılışın kendisi ile olan ilişkimizin bir yansıması olarak görülebilir. şiddetli bir rekabet ve saldırının aşağı doğru çeken girdabını deneyimliyoruz. sadece barışgüçlerinin durum a el koym a­ sı ile eski Yugoslavya’nın tüm köylerinin ve halklarının yok edilmesi önlenmiştir. devletler ve uluslar arasında meydana gelm eden önce insanların zihinlerinde ve kalplerinde gerçekleşmelidir. 1999 yılındaki Kosova krizi sırasında. Günümüz dünya şartlarının genel durum u içinde.

etnik temizliklerin ve güç kavga­ larının yoğunluğu bir ipucu verebilir. ne yarattığımız ve ne olduğumuzla ilgili bize bir anlam ve­ recek birşeyler arıyonız. Akşam haberlerinde kısa bir değinme dı­ şında.Gregg Braden Yeni bir yüzyılın doğum unda kendimizi nasıl görüyoruz? Son yüzyıldaki savaşların. yaşamın deviniminin içinden geçiyoruz ve bir işaret. 10:27’de Madrid. o günün erken saatlerinde meydana gelmiş olan olay çoğunluk tarafından farkedilmedi bile. Pioneer’in işi yolculuğu sırasında bilgi yollamak ve bilimadamlarına manyetik alanlar. Uzun bir süredir dolaşıp duran bir kabilenin yolculuğunun nedenini unutm a­ sı gibi. 2 Mart 1972’de. . Pasifik gündüz saa­ tiyle. yaklaşık otuz yıl önce Dünya’dan fırlatılan bir insansız uzay aracı olan Pioneer 1O’un varlığına yeni bir inanç da gelmişti. Gün­ lük yaşama şeklimiz yaşamlarımızda çok daha yüce bir an­ lamın özlemini çektiğimizi göstermektedir. Pioneer 10 m uhtemelen bir süre sonra güneş sisteminin sınırlarına ve daha ötesine ulaşacak benze­ ri görülmemiş yolculuğuna başladı. Ispanya’da duyarlı bir radyo teleskobu çalıştıran bilimadamları güneş sistemimizi terk etmesi için tarihteki ilk insan yapımı nesneden bir sinyal almışlar­ dı. Işık hızıyla hareket eden bu sinyal Madrid teleskobu tarafından geri döndürülm üş ve yakalanmıştı. kozmosdaki yerimiz anlamak için ya­ pılan araştırmada bir kilometre taşı gösterişli küçük bir laf olarak gelip gitti. kendimizi tanıma arayışı devam etmektedir. Bugün. Böylece de dünyamız bu tür krizlere karşılık verebilir. Yaradılışın İçindeki Yerimizi Aram ak 28 Nisan 2001'de. Ağustoş 2000’den beri gemi ile olan bağlantı kesikti ve Ulusal Havacılık ve Uzay İdaresi (NASA) bilimadamları onunla bağlantı başlatmak için bir gün önce yapmış olduk­ ları çalışmada. geniş uzay boşluğuna bir sinyal göndermiş­ lerdi. Sinyalle birlik­ te.

Cad Sagan ve Dr.. Bu diyagram P io n eer’in G ünçş’ten üçüncü uzaklıktaki gezegenden geldiğini ve ga laksinin m er­ kezi ile olan bağlantısını gösteriyordu.kim olduğum uzu bilmek için yaptığım ız araştırmalar­ da bize yardımcı olabilecek ipuçları . Şekil 1. Pioneer’a bizim yıldızlararası yolculuk yapan ilk “arama kartı­ mız” yerleştirildi. bir kadın ve bir erkeğin tasviri.. Bilgiye ek olarak.yeni görüşler kazan­ dırmaktı. Frank D rake tarafından tasarlanan dokuza altı inç boyutlarındaki altın plaka onu yapanlar ve başladığı yer hakkındaki tem el bilgileri içeriyordu ve küçük geminin üzerine iliştirilmişti.4: Pioneer 10 uzak aracı tarafından taşman altın plakanın şematik bir görünümü. Şekil 1. Dr.Tanrı ’nın Şifresi yerçekimi ve yakın kom şu gezegenlerin hava şartları ile il­ gili .4).: ti ve kainattaki en bol elem ent olan hidrojeni tanıdığımızı gösteren kimyasal sem boller gösterilm ekteydi (bkz. . Pioneer uzay aracının bir silue. tek gidişli yolculuğu sırasında gem inin belli bir yerde zeki bir yaşam ile karşılaşabileceğini varsayarak. Plakanın yüzeyine dikkatlice bir diyagram oyulm uştu.

rasyasyon fırtınalarından ka­ çarak ve dipsiz uzayın sıfırın altındaki dondurucu soğuğuna dayanarak. Pioneer pekala ki. Ziyareti boyunca bazı noktalarda. Sadece B iz mi Varız? 1969 yılında aya ayak basışının ardından. dolayısıyla sinyali yollamak 11 saat. tek başına Pioneer’in varlığı konuşacaktır. olaylar zeka­ nın başka yerde olayı tercih ettiğini kabul etmektedir. başka bir yaşamın m uhtemelen oralarda bir yerde .güneş sistemimizin ve ötesinin bi­ linmeyen bölgelerine ulaşarak . Pioneer “hayatta kalmayı” başarmıştı ve cihazla­ rı hala çalışıyordu. dolaşmış oldu­ ğu uzaklıklar yavaş yavaş böylesi bir bağlantıyı imkansızlaştıracaktır.teyecek kadar değer verdiğimizin bir işareti olmalıdır.ve belki de pek çok yerde . tarihte başka bir dünyaya adım atmış ilk insan olan Neil Armstrong. bizlerin hayata “oralarda bir yerde” başkaları olup olmadığını bilmek için . tıp­ kı bizim gibi kökleri hakkında ya da kendileri gibi olanlar hakkında araştırmalar yapan zeki yaşam formları ile karşılaş­ mış olabilir. yaymış olduğumuz aynı sinyaldi. Her ne kadar uzay aracının görevi gele­ cekte yüzlerce yıl daha sürebilecek olsa da.olduğu sonucuna varmamız gere­ kir. ve sinyalin geri dönmesi bir diğer 11 saat sürmüştü).” (18) . onu bulanlar için bu. 29 yıl boyunca uzay çöplüklerinden.Grereg Braden 2001 yılının o günü Yeryüzüne dönen sinyal 22 saat ön­ ce (Pioneer 10 yaklaşık 11 ışık yılı uzaklıktaydı. bu­ luşmak için herhangi bir delilimiz olmazken. O gün.teknolojimizi kullanmayı is. varlığımızın kanıtıyla evimizden o kadar uzaklarda seyahat ettikten sonra. “Eğer elimizde olan en iyi bilgiye dayalı olarak tahminde bulunur­ sak. Aslında tek görevi araştırma yapmak olsa da. Onu keşfedenler sembolleri anlaınasalar bile. 1972 ilkbaharında dünya­ mızı terkeclen 570 pound agırl ıgındakı uzay aracı bizim ilk uzay büyükelçimiz olacak.

5).” diyor Berkeley. Not: Bu örnekte. astronom Frank D rake kainatımızın başka yerlerinde varolma olasılığı olan zeki m edeniyetlerin sayısı­ nı tahm in edebilecek bir denklem öne sürecek kadar ileri gitti. Dolayısıyla sadece bizim var olm am ız gerçekten tu­ haf olur. Yıllık yıldız oluşu­ mu oranı ve yaşam için uygun gezegenler üreten bu yıldız­ ların sayısı gibi eğitimli tahm inler kullanılan D rake’in denk­ lemi kainatta 10.000 kadar zeki m edeniyetin varolabileceğini öne sürm ektedir (bkz. . Xharfi çarpma işleminin sembolüdür. Şekil 1.Tanrının Şifresi Armstrong’un sezgisi kendi alanlarında son derece say­ gın olan diğer bilimadamları ve araştırm acılardan da yankı buldu. California Üniversitesinden fizikçi Dan Werthimer.Kainatın yaşamla dolu olması çok daha olası bir du­ rum dur. (20) Şekil 1.5: Kainatımızda varolması mümkün olan zeki medeniyetlerin sayısını tahmin et­ mek için kullanılan radyo astronom Frank Dı'ake'in denklemi. “Başka yıldızların etrafında d ö n en gezegenler oldu­ ğunu biliyoruz ve bu gezegenlerden bazılarında uygun ya­ şan koşullarının bulunm asının m uhtem el olduğunu da NHyonız. Drake’s equation (D rake’in denklem i) olarak bilinen formül bilim adam lannın zeki bir yaşam için gerekli olduğu­ na inandıkları yedi etkeni tem el almıştır. 1961 yılında.

Somut bir bilginin yokluğunda. dünya dışındaki zekayı aramak kendimizi aramak dem ek­ tir. Tüm olasılıklarda. pek çok insan sadece “bilme” olarak tarif edi­ len derin bir önsezi ile yalnız olmadığımız duygusuna sahip­ tir. uçsuz bucaksız kozmosun içinde tek başımızayız gibi görünüyor. öte yan­ dan Samanyolu galaksisi tek başına 100. Her ne kadar. Başka bir yaşam aramamızın değerini yorumlarken. bu­ lunduğumuz kainatın bir ucundan diğerine yaklaşık 17 mil­ yar ışık yılı uzunluğunda olduğuna inanmaktalar.Gregg Braden Öte yandan. Böyle bir varlığın “bir” Tanrı ol­ madığını anlasak bile. Bilimadamları bugün. h er bir galaksi bizimkinin de içinde olduğu 200 ile 500 m ilyar yıldızın aynı komşulu k b ölg esinde bir yerde bu­ lunmaktadır. başka bir yaşam bularak kendi esası­ mızın gize mini çözmeye daha yaklaşacak olmanın um udu­ nu taşırız. Sagan’ın düşüncesinin temeli. Tanrı ile bağlantılı çok daha yüce bir evren­ sel varlığın duygusu vardır. “En derin anlamda. Eşsizliğimizin ışığında. Hatta bazı araştır­ macılar bir ya da bir kaç form ile bağlantıya halihazırda gir­ miş olduğum uzdan şüphelenmektedir. Bu bilm ede. Dünyamızın ötesinde yaşayan bir varlık bulu­ nursa ve açıkça teyid edilse bile bize benzem em e olasılığı mevcuttur. tahmini galaksi sayısı 200 milyardır. Böylesine ürkütücü istatistikler karşısında “orada bir yer­ lerde" zekanın varlığı ihtimali yüksektir. şu an için. şimdilik ins an ailesi yaradılışta eşsiz gibi gö­ rünmektedir. bizi birbirimizden bu kadar faklı yapan şeyin kesinlikle özelliklerimiz olduğu­ nu görebiliriz ve bu aynı zamanda geleceğimizin en büyük tehditlerinden kurtulmak için bir anahtar tutuyoruz anlamına .’’ (21) Belki de. bizim tek tür form ol du ğumu z değişmemektedir. Cari Sagan şöyle bir gözlem yapmaktadır.000 ışık yılı büyüklüğündedir. zekanın kainatta başka bir yerde bulunm a ihtimali olsa da. köklerimi­ zi aramanın bizi eninde sonunda yaşamın gizinin en büyük kanıtına götürme ihtimalidir: insanoğlunun gizemi. Tüm kainat içinde.

Tanrı'nm Şifresi

gelmektedir. Öte yandan, böyle bir anahtarı bulm ak için
belki d e , öncelikle herşeyin en eski ve en zor bilmecesini
hesaba katmalıyız... içimize bakarak kim olduğumuzu keşfetmeliyiz.

\»y

BÖLÜM 1 Ö Z E T
• 21. yüzyılın ilk yıllarında, insanoğlu tarihinin en bü­
yük tehlikesi ile karşılaştı. Üçüncü bir dünya savaşı ih­
timali, ilaca dayanıklı hastalıklar ve insan klonlama gi­
bi biyolojik teknolojilerin belirsiz sonuçları bugün tü­
rümüzün geleceğini tehdit etmektedir.
• Tarihin en gelişmiş bilminin varlığında, varlığımızın
belki de en temel olan sorusuna yanıt vermeliyiz: Biz,
kimiz?
"
• Tarih kendimizi bilmek iç!n yaptığımız araştırmanın
hikayesidir. Yolculuğumuz ırk, inanç, miras ve yaşam
tarzının farklılıklarının nasıl “insanın insana yaptığı in­
saniyetsizlik” olarak tanımlanan zulümlerin temeli ola­
rak kullanıldığı örneklerle noktalanmıştır.
• Tarihçiler 20. yüzyılı tarihteki tek kanlı yüzyıl olarak
tanımlarlar. Aynı dönem de doğal felaketler ve AIDS
salgınında ölenlerden çok daha fazla yaşam soykırım
ve etnik temizlikler sonucu sona ermiştir.
• Son yüzyılın şiddetinin kökünde gelen pek çok konu
bugün hala clevam etmektedir. Çözülmemiş olan bu
konular bölgesel boyuta çıkmıştır ve bugün dünya ba­
rışını tehdit etmektedir.

Grereg Braden

• Son 50 yılın teknolojisi, güneş sistemimizin ve bugün da­
ha ötesinin en uzak bölgelerini tanımak için araştırmala­
rd ı genişletmiştir. Pioneer 10 uzayın derinliklerindeki
kaydedilmiş yolculuğuna dokuza altı inç boyutlarında
tasarlanmış plakası ile yıldızlararası yolculuk yapan ilk
“arama kartımız” olarak devam etmektedir.
• Eninde sonunda, köklerimizi araştırmamız bizi ipuçla­
rının en önemlisine götürecek gibi görünmektedir: ya­
şamın kendisi. Yaşamı ve özellikle de kim olduğum u­
zu genel olarak anlama yoluyla, varlığımızı . tehdit
eden farklılıkları yenmenin anahtarını keşfedebiliriz.

“Kim o ld u ğ u m u zu
ve nereden geldiğim izi bilmeden
gerçekten ilerleyebileceğimizi
düşünm üyorum . ”

— LOUIS B. LEAKEY

-

2

-

K E M İK L E R , K İT A P ^ IA R
V E H

ÜC R E L E R :

K a n ıt ve. T e o r ile r Ç a rp ış tığ ı Z a m a n

2 i yüzyılın ilk yıllarında, tek ve gösterişsiz bir gerçek i JLle yüzleştik. İronilerin en büyüğünde ne olursa ol­
sun, türüm üzün tarihinin en ilerlemiş bilimi ile kendimizi
bulurken, hala yaşamımızın en temel sorusuna yanıt vermek
zorundayız: Biz tam olarak kimiz? Varlığımızı elementlerin
ve evrimin tesadüfi birleşimine mi borçluyuz yoksa bundan
daha fazlası mı var yaşamımızda?

Köklerimizi Ararken
Yakın zamana kadar, insanın kökleri ile ilgili bilimsel tar­
tışmalar genel olarak atalarımız olduğuna inanılan fosilleş­
miş artıkların keşfine dayalıydı. İlk kez 1859 yılında Means
of Natural Selection olarak yayınlanan Charles Darwin'in ev­
rim teorisinin ayak seslerinde, genel fikir, türün her bir ye­
ni neslin ailesinden gelen hayatta kalmasını sağlayacak özel­
likleri seçip ayırarak, uzun zaman aralıkları içinde gelişmiş
olduğu idi. Bu yolla, bireylere dayanıklılık ve farklılık getiren

Tann'nm Şifresi

özellikler korundu ve cesaretlendirildi. Darwin’in teorisinin
büyük bölüm ü Galapagos Adalarında vahşi hayatı araştırırken
yolculuğu sırasında yaptığı gözlemlere ve dünya tarafından
bilinmeyen fosilleşmiş yaratıkların bulgularına dayanıyordu.
Darwin’in çalışmasının yayınlanm asından önce, dünya­
mızın bu haline nasıl geldiği ile ilgili yaygın görüş İncildeki
Genesis hikayesinin harfi harfine yorumlanışının sonucu idi.
Bu görüş günüm üzde halen popülerdir ve en çok, kökleri
1701 yılında Anglikan papaz Jam es Ussher tarafından öne
sürülen dini öğretiye dayanan "creationism(yaradılış) teori­
si” olarak bilinmektedir. Kendi zamanının İncilinde kayde­
dilmiş tarihi doğum lar ve ölümlerle Akdeniz ve Orta Doğu
tarihini birleştiren Papaz Ussher yaradılışın ilk gününden
beri m eydana gelen kutsal kitaba ait olayların yanlışsız ol­
duğuna inandığı bir kronoloji oluşturdu.
Kendi hesaplarına dayanarak, Ussher 23 Ekim 4004
B.C.E. tarihinin "Başlangıç” günü olduğunu ilan etti, . böylece Dünyanın yaşı 6000 yıl olarak ortaya çıkıyordu (1). Bu
kronolojiden, Ussher daha sonra incildeki ana olayların ta­
rihlerini hesapladı, örneğin Adem ve Havva’nın Cennetten
kovuldukları gün 4 Kasım 4004 B.C.E. ‘e geliyordu. James
Ussher’in karşılıklı kurduğu bu ilişkiler Incil’in yetkilendiril­
miş versiyonlarında yayınlandı ve pek çok kişi tarafından
sorgulanmadan kabul gördü.
Dünya’nın yaşının bilimsel yoıum u ve bugün kabul edilen
jeolojik kayıtlar ile birlikte olasılıklar creationsizmin, Başlan­
gıç dönem i boyunca yaşamın Tanrı’mn gücü tarafından bir
kerede yaratıldığını ifade ettiğini gösteriyor. Buna ek olarak,
teori bulunan yeni bir .tür olmadığını da vurguluyor. Şu an ve
geçmişte varolan tüm yaşamlar - insan yaşamı dahil - asıl ya­
radılışın sonucudur ve sabit ve değişmez olarak kalmıştır.
Bugün Dünyamızı oluşturan fiziksel özellikleri anlatmak
için, creationistler geçmiş olayların en yıkıcı bölümlerine
bakarlar. Katastrofizm olarak bilinen bu kavram bugün gör­
düğümüz dağların, okyanusların ve kıtaların oluşmasına

dünyamı­ zın sürekli olarak değiştiğini ve her zaman varolmuş olan doğal süreçlerin sonucu olarak evrim geçirdiğini öne sür­ mektedir.” . Günümüz araştırmacıların geçmişe bir pencere aç­ masını sağlayan işte bu değişimlerin devam eden şeklidir.Gregg Braden neden olduğuna inan ır. Güney Amerika’nın yerlilerinin da ğıl ım ındaki ve o kıtanın şu anki ve geçmişteki yerlilerinin jeografik ilişkilerindeki bazı gerçeklerden çok daha fazla etki­ lenmiştim.en büyük filozoflarımızdan birinin de de diği gibi. Darwin kendi zamanın­ daki biliın adamlarının gördüklerinden son derece daha faz­ la çeşitte bitki ve hayvan gözlemlemişti. 1859 tarihinde. (3) ve onların fikirleri 1831 ile 1836 yılları ara­ sında yaptığı ünlü ^MS Beagle yolculuğu sırasında Darwin’in gördüklerine bir açıklama sağlayarak evrim te ofisine katkıda bulunmuşlardı. Hutton’un ve diğer bilim adamlarının çalışmaları­ nı biliyordu. Creationism ve katastrofizın teorile­ rine dayalı dünya görüşü James Hutton adlı bir İskoç bilim adamı tarafından 1785 yılında yayınlanan bir paramparça eden çekim örneği çalışmasına kadar rakipsiz kaldı. gizem­ lerin gizemine . ' Modern jeolojinin babası ol arak tanınan Hutton’un The Theory of Earth adlı kitabı başlangıç zamanında meydana gelen ilahi bir müdahale ile tek bir kerede değil. Darwin. Bu basit kavram aracılığıyla.ışık tutmak gibi gelmişti. Bu gerçekler türümüzün köklerine . Hutton’un teorileri aynı zamanda gezegenimizin tarihinin ilk zamanlarında çalışan güçlerin halen faaliyette olduğunu ve süreçlerin günüm üzde devam ettiğini iddia et­ mektedir. seya­ hatini tekrar gündem e getiren bir gazete yapmış olduğ u se­ yahatin Danyin’in kişiliğinde yarattığı etkileri yazmıştı: “Bir doğa bilimci ola rak HMS Beagle’a geldiğim za­ man. Yolculuğu boyunca. Her ne kadar bu il kel er bugün bizlere apa­ çık görünse de. Hutton’nunkiler gibi teoriler yaşadıkları dö­ nem için radikaldi. şu an geçmişin anahtarı haline gelmektedir (2).

Bilimsel gibi görünen metodlar kullanarak. bu canlılardaki değişim yepyeni türlerin ortaya çıkmasına neden oldu. Her ne kadar daha büyük olsalar da. özellikleri olanlar. Büyük cevizleri yem ek için büyük gagalar ya da korunm ak için kamuflaja benzeyen renklenm e gibi yaşamlarını destekleyen özelliklere sahip üyeler ve on­ ların çoluk çocukları. Darwin tıpkı diğer yaşam formları gibi. . Zaman geçtikçe ve şartlar değiştikçe. Darwin’in karşılaştığı gizeme eklenmişti. günüm üz hayvanları­ na benzeyen yaratıkların fosilleşmiş artıklarının bulunması da. bu çalışmanın so­ nucunu doğal seçmeler ve evrim teorileri olarak biliyoruz. bu “tür özelliklere sahip olmayan ken­ di türlerinden diğer üyelere karşı bir üstünlüğe sahiptirler. Son­ raları yazdığı The Descent of Man adlı kitabında. bu teoriler basitçe her bir halkın içinde farklılıklar olduğunu söylemektedir. bu tür bir sürecin sonucu olduğu inancını belirtmiştir. insan türünün de kesinlikle son derece uzun zaman aralıkları sonucu meydana gelen evrimsel bir seçme ile. bu tür özelliklere sahip olmayanların karşısında hayatta kal­ ma mücadelesini kazanacaklardı. ha fazla çocuk doğurmalarıdır. Yavaş yavaş. Darwin tarihi yolculuğu sırasında keşfetmiş olduklarını anlatmak için za­ manının en iyi teorisini' kullandı.Tcmn’nın Şifresi Darwin'in buluşlarının merkezi Galapagos Adalarındaki çeşitli türlerdeki kuşlar üzerine gözlemleriydi. Bunun nedeni o üyelerin daha uzun süre yaşamaları ve istenilen özelliklere sahip dq:. Bugün. Aslında. farklı adalarda birbirlerin­ den ayrı bir şekilde gelişmiş olan ispinozların arasında gaga şekli ve büyüklüğü gibi farklılıkları nasıl açıklayacağı idi. Darwin’in karşılaştığı soru. Londra’ya dö­ nene kadar ispinozların farklı ailelerinden toplanmış örnek­ lerin aslında aynı ailenin vaıyasyonları olduğunu düşünm e­ mişti.

Her ne kadar Daıwin’in çalışması iyi düşünülmüş. aslında bu sadece görünüşlerin-. Bedenleri basitçe dünyalarında varolan çevre koşullarına uyuın göstermişlerdir. daha iyi uyum sağlama yeteneği bu tür gruplarda gözlemlenmiş olanı daha iyi tanımlamaktadır. Bu tür kabilelerin üyeleri kutup bölgelerinin sert koşulla­ rına kendilerini adapte ettiler ve en az 10. Darwin bulduklarını benzer sonuçlara varmış olan ama bunları des­ tekleyecek bir kanıta sahip olmayan bilim adamı Alfred Wallace'a sundu. bugün gittikçe büyüyen bir dizi delil bunun insan kök­ lerinin hikayesini tamamen anlatmadığını ya da bizlerin ev­ rimin bir sonucu olduğumuzu kanıtlamadığını öne sürm ek­ tedir. bir evrim sürecinden ziyade. Bir gazete ekinde. Genetik olarak. zira çevrelerine uyum sağlamak için insan gruplarına gereken özellikler bilinmektedir ve çok iyi belge­ lenmiştir. Kuzey Kutbu ve Sibirya’daki yerli kabileler göz­ lerinin etrafına fazladan bir deri geliştirmişlerdir. Böylece Daıwir). Her ne kadar bu özelliğe çevrelerine uyum sağlamanın doğrudan bir karşılı­ ğı olarak inanılıyor olsa da. deki bir değişikliktir. bu her gün dışarıda ve evlerinde kar ve buzdan dik açı yaparak yansı­ yan güneş ışığından onları korumaktadır. Örneğin.'in teorisinin tüm hikayesi The Origin of Species’de yayınlandı ve dünyanın dört bir yanın­ dan bilim adamları tarafından yürekten onaylandı. yeni insan türleri geliştirmediler ve geliştireceklerine dair bir kanıt da yoktur. Öte yandan. o zaman diliminde. bu insanlar hala Homo sapiens sapiens tü­ rüne dahiller. Bu. Belki.000 yıl orada ya­ şadılar. m etodlann ışığında yapılmış olsa da. . titizlik­ le belgelenmiş ve bilimsel. Evrim ve Doğal Seçme Teorisi Londra'nın Linnean Topluluğuna sunuldu. bulduklarını halkın dikkatine sunması 20 yıl sonra olmuştur.Gregg Braden Evrim m i Uyarlama mı? Charles Darwin tarihi seyahatinden 1836 yılında dönm e­ sine rağmen. bir evrim formunun meydana gelmemiş olduğu demek değildir.

Çalışmalar. düşük nem ve oksijen koşullarında hayatta kalmak için değiştirir­ ler. aile ağacımızın eksik dallarını doldurm ak amacıyla Doğu Af­ rika Rift Vadisinin uzak bölgelerinde çalıştılar. kazılar başladığı zaman. 1950'lerde. (5) Genel olarak. yeryüzünün denizden en yüksek yerle­ rinde yaşayan insanların bedenlerinin hayatta kalma olası­ lıklarını değiştirecek özellikler geliştirdikleri belgelenmiştir. köklerimizin araş­ tırmasını m odern insanlar ile ilk zamanlardaki atalarımız arasında köprü kuracak fiziksel bir kanıta odaklanılması ge­ rekir. uluslararası ekiplerden birkaçı insa­ ni özellikler taşıdığı izlenimi veren kemik parçalan. Yarım asırdan fazla bir sürede. Bu ve buna benzer çalışmalar insan nüfusunun bulun'::. 150 yıldan beri gittikçe aıtan sayıda derlenen kanıtlar. dişler. Leakey’ler ve Tim White ve Donald Johanson gibi bilim dünyasından meslektaşları. şartlan aşırı olan yerlerde yaşayan insanlar bedenlerinin işleyişlerini atmosferdeki soğuk hava. fosil kayıtları hakkındaki bu tür tartışmalar Kenya’da­ ki Leakey ailesinin çalışmasına derinde etki etmiştir. atalarımızın aslında daha az gelişmişlikten gittikçe daha kar­ maşık yaşam formlarına doğm giden uzun zaman dilimleri boyunca değişmiş olduğunu ile sürmektedir. Dünyanın en yüksek sıradağları Güney Peru'daki And Dağ­ lan ve Nepal ile Tibet arasında göğe uzanan Himalayalardır. Kararlı bir bi­ çimde. dukları ortama uyum gösterme yeteneklerini açıkça belge­ lerken. yüksek kesimlerde sürekli olarak yaşayan' insan­ ların alyuvar hücrelerinin sayısının deniz seviyesinde yaşa­ yanlardan %30 daha fazla olduğunu göstermiştir. . Alyuvar hücrelerindeki artış kanın oksijen taşıma yete­ neğini arttırır ve böylece dokulara giden oksijen oranı da ar­ tar.Tanrı nın Şifresi Benzer şekilde. K anıt Evrimi Destekler mi? Darwin’in teorilerini aklımızda tutarak. köklerimiz ve tarihimiz açısından evrimsel bir süreç tanımlamada eksik kalırlar.

) Daha evvel bilinenden dört milyon yıl öncesine götürülen atala rımızın köklerinin kabul edilmiş tarihine ek olarak.Gregg Braderı Şekil 2. Araştırma bugün devam etmektedir ve evrim basamakla­ rı boyunca gelişen insanın çeşitli evrelerini tanıttığına inanı­ lan fosilleşmiş artıkların sayısız örneği ortaya konmaktadır.* (* Bu buluş adı­ nı keşfin yapıldığı vadiden almıştır: Neanderthal.1 ’de gösterilmektedir. sınıflarda öğretilen bu eski hominid atalarımızın örnekleri genellikle “Kro-Magnon insan” ve “Neanderthal insan” gibi isimlerle anılır. Batı Al­ manya. Dünyanın dört bir yanında. yüzyılın sonlarındaki bu­ luşlar geçmişimizle ilgili yeni sorulara neden olmuşlardır ve . 12 Tem­ muz 2001). 20. Bunlar ve benzeri etkileyici bulgular ve köklerimizin bil­ gisine yapabildikleri katkılar. Bu özet yaklaşıktır. İnsan gelişiminin kabul edilmiş diziliminin bir uyarlaması Şekil 2. bugün insan köklerinin kabul edilmiş tarihini yaklaşık altı milyon yıl geri iten geçen yarım asır boyunca yapılan araştırmaları son derece güzel bir şekilde belgelemiştir (Nature. National Geographic’in pek çok sayısı. Do­ ğu Afrika'da yakın zamanda yapılan keşifler “buradan” “ora­ ya” nasıl gittiğimizi anlamamız konusunda önemli bilgiler elde etmiştir. taş aletler ve bazen de bütün bir iskelet kesiti bulmak için gevşek toprak ve toz parçacıkları arasında dikkatle incele­ meler yaptılar. zira ilk atalarımızın yaşlarını belirten tarihleri değiştiren ye­ ni keşifler devam etmektedir.1: Fosilleşmiş kanıtlardan yorumlanan atalarımızın çoğunlukla kabul edilen kro­ nolojisi. Her iki vaıyasyon da doğrudur ve tercihe bağlıdır.

kayıp insanları teşhis etm ek ve kişiler ile b e l­ li bir suç arasında bağ kurm ak için DNA’nın bölüm lerini karşılaştırma bilimi suçun işlendiği yerdeki analizlerde ve adli vakalarda kilit taşı görevini görm eye başlamıştır. bu tür soruşturmalarda . bizi iki ayak üzerinde yürümeye sevk eden ne oldu? 20. o zaman neden mo dern in­ sanın şekil ve beyin kapasitesi son 160. eğer değişim süreci devam ediyorsa. eşsiz genetik özelliklerine dayanarak kişileri tanımlama bilimine bir kapı açılmış oldu. Rusya ve İsveç’teki çalışma arkadaşları ile b irl ikte. Örneğin. Genetik Gizem Yaşamın yapı taşlarını anlatan ilk haritayı 1953 yılın da Ja­ mes Watson ve Francis Crick yaptı.Tanrı ’nm Şifresi bazı durumlarda gizemi derinleştirmişlerdir.bugün e n y ü k sek mahkemelerce tanınan sonuçlar . 1987 yılında bilim adamları Kuzey C aucasus’daki b ir . Watson ve Crick’in keşfinden bu y an a. Göz ve saç rengin­ den cinsiyete ve belli sağlık ve hastalık durum larına karşı eğilimlerine kadar. bedenlerimizin nasıl ortaya çıktığı ve iş­ lediğini belirleyen kodlar genetik kodum uzun elkitabında bulunuyordu.kullanılan aynı tek n ik lere tarihte sadece ikinci kez insanın köklerini öğren m ek için başvurulmuştur. Bugün ünlü o lan çift h e ­ lezonlu ve DNA moleküllerinde bulunan bilgi kalıpları m o­ deli sayesinde. 2000 yılında. o zaman bizlerin aynı zaman dilimi boyunca bu formlarla yaşadığımızı göste­ ren fosil kayıtlarını nasıl izah ederiz? Diyelim ki insan türü çağlar boyunca yavaş yavaş gel işti.000 yıl içinde hem en hem en aynı kalmıştır? Eğer bizler prim atların az evrimleşmiş formlarından gelişmişsek.000 ile 200. yüzyılın sonlarındaki iki keşif bu sorunların neden varolduğuna ve tarihimizle ilgili ne gibi cevaplar verebilineceğine ışık tutmaya başlayabilir. b a b a ­ lığı saptamak. Saygın Nature (10) gazetesinde y ay ın lan an bir raporda Glasgow Üniversitesi İnsan Tanım lam a M erkezi’nin araştırmacıları muhtemel atalarımızın genetik m a d d e ­ leri ile m odern insanınkini karşılaştıran in celem elerin d en bahsettiler.

türümüzün her bir üyesi­ nin kemik yapıları. tıp­ kı donmuş kutup bölgelerinde bulunanlar gibi. Sonuçlar. Neanderthal ve m odern insanlar arasındaki genetik bir köprünün varolma ihtimalinin az olduğu ortaya çıkarmıştır. bu da bize toplamda sadece 46 verir! Her ne kadar en yakın akrabalarımızla karşılaştırdığımızda bizim bir set krom ozom um uzun eksik olduğu görülüyorsa da. Çocuğun bedeninin olağandışı durumu da başlı başına bir hikaye ve gizemdir. genetik karşılaştırma bilimi ata­ larımızın gizemini çözmesi gerekiyorsa da. İnsanların 23 çift vardır. Karbon tarihli bir bedenden gerçekleşen böylesi test­ ler üstelik ilk defa yapılıyordu.” gerçeğini gösterm ektedir.000 yıl yaşında DNA alınabili­ yordu. Maymun gibi daha yüksek primatların onlara eşsizliklerini veren 24 çift ya da toplam 48 kromozomu vardır. sonuçlar daha fazla soruya ve evrimsel neslimiz köklerimiz hakkında “ya­ sak” bölgeye kapı açmaya neden olmaktadır. Gen havuzumuzda eksikmiş gibi görünen kromozomlara yakından bir bakış insan kromozomu 2’nin şem panzenin kromozom 12 ve 13 ile dikkate değer bir şekilde benzer . Normalde. çalışma. öylesine yüksek derece­ de bir. "modern insan aslında NeanderthaPlerden gelmemiştir. Her ne kadar bilim adamlarının kafaları halen raporun anlattıklarından karışmış olsa da. türümüzü diğerle­ rinden ayıran kromozom sayısı hakkında da yeni bir gizem ortaya çıktı. beyin büyüklüğü. gene­ tik haritalarımızın karşılaştırıcı bir çalışması ilginç bir merak uyandırmaktadır.Gregg Braden damla taş mağarasında bulunan olağandışı bir şekilde ko­ runm uş olan bir Neanderthal bebeğin bedenindeki DNA’yı test ettiler. Biyolojik yönergeler. metabolik süreçler gi­ bi şeylere karar veren kromozomlarında bulunmaktadır. Genetik kodun bulunuşundan sonra. korunm a sadece dokular donduğu zaman oluşur.(ll) Teoride. Bu ise ola­ ğandışı bir şekilde korunm uştu ve günüm üz insanı ile kar­ şılaştırıldığında bebekten 30.

b e d e ­ nin kürküne karşı saçın uzaması gibi yetenekleri gibi özel­ liklerinin bir karşılaştırılması bu teoriye güvenirlilik katm ak­ tadır. ya da eski bir m elezleş­ tirmenin böyle bir genetik karışımı yaratmış olm ası olası d e ­ ğildir. ilk bilinen Homo sapienlere ait fosilleşmiş kafataslarının keşfini ortaya çıkaran bir yazı yayınlandı. öte yandan her iki creationism v e ev rim teorisinin y an ­ daşla rı arasındaki tartışmaları ateşlem ektedir.(15)Bu buluşlar bugün bir soruyu gündem e getirmiştir: Uzak geçmişimizde yaşamlarımızın tem el kodundaki böylesi değişimlerin gerçekleşmesi için ne olm uş olabilir? İnsan fizyolojisi ile diğer prim atlar arasındaki karşılaştır­ maya dayalı olarak. o zaman neden böylesine uzun bir z a m a n içinde bu ka­ dar az değiştik? Bu tür bulgular bugün yanıtlarından ç o k d a h a fazla soru üretmekteyken.ı ol arak alm aktadır. kainattaki yerim izi ve^ yaradılıştaki . insan ve şem panze genleri arasındaki d iğer bir kaç özellik hem e n hem en aynı aına ters yüz edilmiş olarak ortaya çıkm aktadır. Primat gen haritalarına yapılan daha ileri araştırmalar.Tcmrı :nın Şifresi olduğunu ve aslında onunla “uyuştuğunu” gösterm ektedir.13. bu “ayrılmış insan krom ozom u 2”nin goril ve orangutanda da olduğunu göstermiştir. Etiyopya’n ın O rta Aw ash b ö lg e­ sinde bulunan kalıntılar günüm üzden 160. Prim at­ ları ilk formla rından doğrudan inen b ü y ü k bir gelişim in p ar­ çası olmaktansa. Kromozom 2’deki bu tür gizem lere ek olarak. Bu krom ozom farklıl ıklarından dolayı. bu teori ilk prim atlardan geliştiğim iz yakla­ şımını bip çeşit paralel evrirr. Hoıno sap ienler olarak bizlerin eşsiz bir tür olduğum uzu öngören kanıt gittikçe artm aktadır. terlem e. (12. İngiliz Nature gazetesinde (12 H aziran 2003).000 yıl ön cesin e dayanm aktadır ve aynısı ol masa bile m o d e rn insanınkilere son derece benzemektedir! Eğer evrim sü reci d evam ediyor­ sa.14). Prim at ve in­ sanın kemik yoğunluğu ve gözyaşı dökm e. her incelem e aşam ası k e n d im iz h ak k ın d a bildiklerimize bir yenisini. doğal süreçlerin. sanki tek bir büyük DNA parçasında birleştirilmiş (eritilmiş) gibi.

bir kaç bilimsel gazete. Eğer durum bu ise.tamamen mo­ dern insan iskeletleri . daha sonra insana benzeyen ka­ lıntıların' en eski örnekleri olarak ortaya konulacak olan bir bulguyu tanıttı. Reck’in bulgusunun hikayeleri ilk yayınlandığı zaman. tamamen m odern insan iskeleti gibi görünen Örnekler keşfetti. Daha eski kalıntılar olarak. (16) Olduvai Gorge’da çalışan Dr. Genellikle birbirine bağlı gömülü nesneleri tarihleme metodu olarak kabul edilen bu tür prosedürlerden çıka rabildiğimiz sonuç. daha az evrimleşnıiş yaşam formları ile DNA paylaşmış olabilirken aynı zamanda da kendi genetik zaman dilimimizde eşsiz ve beklenmedik bir şekilde geliş­ miş olabileceğimizi öngören genetik araştırmalara güvenirli­ liği arttırmıştır. Daha derin katmanlar daha önde tortu bırakmışsa. daha sonraki bir zamanda evrimleşmiş 'olamazlar. aynı yer katmanları içindeki modern bir iskeletin fiziksel yeri bugünkü geleneksel evrim teorisi için bir sorun teşkil etmektedir: eğer bir yaşam formu diğerinden geçiyorsa. ev­ rimsel merdivenin çok daha altı basamaklarındaki eski ho~ minidlerin ilk fosillerinin bulunduğu aynı yer katmanları içinde normal olmayan insan kalıntılarının . bu­ gün meşhur olan “Peking m an” ve “Java m an in eski kalıt­ larını üretmiş olan aynı jeolojik oluşumlardan kazılmış tama­ :men gelişmiş. aralarında bulunmuş olanlar mantıksal olarak daha sonrala­ rı oluşmuş üstte olanlardan çok daha eski olmalıdır. Hans Reck Afrika’nın ayn ı bölgesinde elde ettiği.G re g g Em den rolümüze daha fazla tanımlamayı eklemektedir. Fosil Kaydtndaki Anomaliler DNA çalışmalarına ek ola ra k. m odern görünüşlü iskeletlerin çok daha ilke l insanlar ile aynı zaman diliminde yaşayıp ölmüş olmalarıdır.keşfini rapor etti. 1913’de yayınlanan raporda. Louis Laekey’in çağdaşı Dr. Fosil kaydındaki ek kanıt. Reck. . aynı zaman dilimi içinde birlikte varolamazlar.

Bizlerin. Eğer m odern insanlar. Bu fikirler: • yaşam cansız m addeden kendiliğinden başlam ıştır ve • bizleri eşsiz kılan özellikler tek başına h a re k e t e d e n evrimsel güçlerdir. Tarihteki creationizm v e evrim in ta­ nıtıldığı dönem boyunca. Amonyak bulutları ve bitkilerdeki klorofil ü re te n yapı taşları ve hayvanlardaki hem oglobinler (porfirinler) gibi ki­ mi yaşam işaretlerinin uzayın derinliklerinde v a ro ld u ğ u ile . insanın k ö k lerin e dair te ­ orinin anahtarı olan iki varsayımdan yola çıkar. H er biri gözlemlenmiş kanıtları son derece farklı bir p ersp e k tifte n hesaplamaya yöneliktir. o za­ man bir sonraki soruyu sormalıyız: O nlar/bizler n e re d e n ge­ liyoruz? Köklerimizin Teorilerini Birleştirmek Teori kelimesi “belli bir olayın doğasını analiz etm ek ya da açıklamak için yapılan varsayımlar” olarak ifade edilir. Yaradılış ve evrimin tarih ileri süren yaşamın başlangıcına nasıl sebebiyet verdiği teorileri kesinlikle teoridir. hem creationizm hem de evrim için. bizim ilkel atalarımız o ld u k ­ ları varsayılanlarla aynı anda yeıyüzünde varoldularsa. Açıkça. Evrim ile ilgili başlıca sorular. aslında. h er ikisi de o zam anlar v aro lan bilgiye dayalı olarak mantıksal açıklamalar o larak g ö rü lü ­ yordu. eğer meydana geliyorsa. benzer durumların keşfi (17) bulguların bizlere çok daha önemli bir şeyler gösteriyor olabilir. Her ne kadar bu tür şartlar. bilgi kaynakları halen gelişmektedir ve yeni bilgiler g ü n ışığına çıkması bu teorileri bir daha gözden geçirm ek için y o ru m a açık hale getirmektedir. sır perdesini kesinlikle açıklıyorsa da. D arw in’in ispi­ nozlarında görülen gibi net bir evrim sürecinin ürünleri ol­ mayabileceğimizi ileri süren bir dizi kanıt daha eklediler.Tanrı ’rnn Şifresi o günün kuşkucuları m odern iskeletlerin yıkanmış o ld u ğ u ­ nu ya da daha sonraki bir zaman katmanında bir şekilde tu ­ tulduğunu ileri sürdüler.

her ne kadar bugün yaşamın kendi kendine yaradılışını görm e­ sek de. Evrimciler bu ironiyi.Gregg Braden ilgili güçlü kanıtlar varken. yaradılış teorisi Papaz Ussher’in hesapla­ malarını.(18) Öte yandan. Bu güç Darwîn.in zamanındaki teorilerde ya da günü­ müz törel bilgeliğinde hesaba katılmamış gibi gözüküyor. bildiğimiz kadarıyla yaşamın can­ sız bir maddelerden ne doğal ne de laboratuar ortamında başladığı asla gözlemlenmemiştir. kaynaklarını ve iddialarının sertliğini dahil eden sorunlarla istila edilmişti. Günümüzün en iyi bilginleri. kendiliğinden yaşam için ısı. Daha evvel de söylediğimiz gibi. bunlara dahil olan fikirler şunlardı: • İncil’e ait yaradılışın kayıtları doğrudur ve • İncil’e ait yaradılış kayıtları kendi tanımlarına göre tamdır. bu tür süreçler için şartların geçmişte bir zaınan va­ rolmuş olabileceğini ve daha. Benzer şekilde. doğrusal bir gelişim olarak ortaya çıkışmış olmaları olasılığını azalt­ maktadır. Evrim teorisi konusunda olduğu gibi. sonra da yaşamın kendi gelişi­ mi ile yok edildiğini varsayarak savunmaktadırlar. yaradılışın öğelerine yaşamı üfleyen kimyevi özelliklerin ötesinde bir güç varolduğu görülmekte­ dir. daha önceleri inanılan türlerin zamanla birbirinden evrimleşmiş olduğunu öne sü­ ren gelişmekte olan fosil kaydının aynı zaman dilimi içinde birbiri ardına yaşamış olduğu izlenimini vermesi. Öte yandan. eğer türler gerçekten de zamana adapte olmak yerine yeni genetik özelliklerden ev­ rim geçiriyorsa. bu sorunlar teorilerin temel alındığı varsayımlardan ge­ liyordu. o zaman fosil kaydında görmeyi bekleyebi­ leceğimiz bir olasılık da bir yaşam formundan bir sonrakine doğrusal bir gelişimdir. nem ve kimya şartlan uygun bile olsa. İncil’e ait metinlerin gele­ neksel ve tarihi olaylar hakkında ne kadar iyi olurlarsa ol­ sunlar fiziksel olarak tamamlanmamış oldukları konusunda .

yaşa­ mın tanımı k imyasa l bir bakış açısı ile su n u lu r: “Yaşam kim­ yasal sistemlerin belli bir karm aşıklık tü rü n e ve seviyesine ulaştıkları zaman sergiledikleri davranış şekilleridir. Her ne kadar hem creationizm hem d e evrim teorisi kök­ lerimizin doğası hakkında yararlı görüşler sunm aktaysa da. her iki teorinin kilit kavramlarını birleştirm enin şu ana ka­ dar incelenmiş kanıtların en iyi açıklam asını sunacağını keş­ fedebiliriz.Jantı nın şyresi \ J hemfikirdirler. hem creationizm den h e m d e evrim teori­ si nden alınmış elem entleri birleştiren bir te o ri yaşam ın gize­ minin ve mucizesinin en iyi açıklam ası o larak ortaya çık­ maktadır. Buna ek olarak. bir teori verilmiş bir olayı açıklamada en iyi yanıttır. b u g ü n yaşa­ yan hiçbir şey yaradılışın başladığı anı d o ğ m d a n gözlemlememiştir. Yaşam: Tasanm Olarak Kimya. Madde ve Kainat konulu okul k itaplarında. G erçek şu ki. Yaradılışın böyle bir m elez teorisi dünyam ızın eski olduğunu ve jeolojik oluşum ların aslında u zu n zaman dilinıle rinde oluştu ğunu ifade eden evrim teorisinin gözlem ­ lerini hesaba katar. İmparator K onstantin’in em i deriyle en az 45 Eski ve Yeni Ahit’in M. Doğrudan bir gözlemin eksi kliğinde.325 ’d e (19) yol edildiği dördüncü yüzyılı takiben. Şimdilik. . Tarihleme için keşfedilm iş fiziksel kanıtları kabul ederken. bizim “yaşam’’ olarak g ö rd ü ğ ü m ü z kıvılcım­ dan ve yaşamın devam' etm esine ned en o lan şartl arı harekete geçirmekten sonım lu özel bir gücünü de dahil eder. aynı zam anda da dünyam ızdaki insanların büyük çoğunluğu tarafından içgüdüsel olarak h issed ilen çok daha yüce bir şeyin parçası olduğum uz d u y g u su n a da yer ver­ mektedir.S. creationistlerin görüşü olan günüm üz geleneksel bilimin kabul ettiğinin ötesinde özel bir gücün.”(20) her ne kadar bu tanım aslında yaşam ın bir y ü z ü n ü ta nımlasa da. Papaz Ussher'in hesaplam alarım yaptığı İn­ cilin doğru ilan edilen versiyonu da tam am lanm am ıştı.

yaşamın tesadüfi olaylar zinciri sonucu ortaya çıkına olasılığı sorulduğunda. özgürce . ya da hangi kuvvet böylesi muazzam bir güç.derecesinden nasıl tek başına sorumlu olamayacağının altı­ nı çizmiştir. bir anlamda. Benzer şekilde. “Bir gözü ele aldığımızda. “şu an elimizdeki tünı bilgilerle donanmış dürüst bir insan. belki de ilk defa işte bu so­ ruların yanıtında dünyamız bir anlam kazanmaya. yaşamın başlangıcının şu an için sadece bir mucize olarak belirdiğini. ve onu ilerletebilmek için tat­ min edilmiş olması gereken pek çok koşul olduğunu dile getirir. farklı uzaklıklara odaklanmayı ayarlamada taklit edilemez bir be­ ceriye sahip olması.itiraf ediyorum. Tek bir gözün karmaşıklığını örnek olarak ala­ rak. sanki bir şeyler eksiktir.” (22) Charles Darwin ilk 1830larda gözlemlerini yap­ tı. Darwin bizleri kesinlikle ek bir güç ya da güçlerin yaşamın karmaşıklığına ne tür bir katkı­ da bulunduğu konusunda kendi sonuçlarımızla başbaşa bı­ rakıyor. in­ san yaşamı eski ve amaçlı bir hareketin sonucu ise.Cregg Braden bizi bir boşluk duygusu ile başbaşa bırakır. Darwin’in kendisi bu doğal seçmenin organlarda ve dokularda gördüğümüz uzmanlık . bu müthiş saçma görünü­ yor. başlayabilir ve bizde yaşamlarımızın çok daha yüce anlamını bulabiliriz. bilgelik ve vizyon gösterisinden so­ rumlu? Çok uzun zaman sonra. o zaman bir sonraki soruyu sormalıyız: Kim.”^ ) Bu tür gözlemlerle.. Crick ben­ zer sonuçlara varıyordu. Francis Crick bir kere­ sinde. The Origin of Spieces’da. 100 yıldan daha uzun bir süre sonra. . . insanlığın en eski geleneklerinin söylediği gibi. şöyle ifade etmiştir. bu doğal bir seçme sonucu oluşabilir mi. Bizler kabaca çağlar boyunca gelişen ve değişen kimyevi birleşimlerin rastgele ürünleri miyiz? Ya da bundan daha fazla bir şey miyiz? Bizler aslında çok iyi düşünülmüş ve mükemmel bir şekilde zamanlaması yapılmış olaylar se­ risi yani yaradılışın kasıtlı bir hareketi miyiz? Eğer. inanılmaz derecede gelişmiş bilim ve deneysel metodların yardımıyla.

Böyle bir d ü n y a d a y aşa m a nın verdiği zorluklar ışığında.Tanrı ’nın Şifresi x vo\ J Zamanımızın en iyi fikirlerinden bazıları bugün geniş zaman dilimine ve tanınmış olan doğan ın sürecine ek ola­ rak yaşamın tasarım olarak olduğu gib i göründüğünden şüphe duymaktadır. kendim izi hangi kelim elerle ta­ nımladığımıza bakmaksızın. günüm üz d ü n y a s ın d a s o n derece derin. İşte. Yaşa'mın temelindeki bugün aşikar olan d ü z e n derecesine ek olarak. Şimdilik. yaradılışımızın altında çok d ah a y ü ce b ir zekanın gücünün varolduğunu öne süren deliller gitgide çoğalm aktadır. aileler büyütüyoruz. kan dökm e ve araştırm anın asırlar süren bir yolculu­ ğuna götürmüştür. bizlerin hayal bile ede­ meyeceğimizden çok daha fazlası o ld u ğ u m u z u ve belki de hayal etmiş olduğum uz her şeyi gerçek leştirecek güçte ol­ duğumuzu söyleyebiliriz. son derece gü çlü ve inkar e d ile m e y e c e k k a d a r k işisel tek bir birleştirici mesajın h e r bir insanın y a ş a m ın a d o k undu ğu bir ilke bulmak ne anlama gelirdi? Aileler. En şü p h eci bilim adam ı için bile. bu tek so ru n u n yanıtını a ram ak bizi gi­ zem. Tanrı 'nın bir M esajını Ne Anlam a Gelirdi? K e ş fe tm e k Tarihimizin en büyük nüfusuna s a h ip o la ra k uluslar ya­ ratıyoruz. Bugün. o rd u la r to p lu y o n ız ve şimdi­ ye kadar varolmadığına inandığım ız e n g elişm iş bilimle ile­ ri doğru yarışıyoruz. bu kitabı n odaklandığı şey d a h a s o n ra çok daha yüce bir büyüklüğün düzenin i . bu düzenin daha yüksek boyutu v a ro lu şu m u z u n altınd a ya­ tan daha yüce bir zekanın varlığını ö n e sürm ektedir. ismi bedenim izdeki h er bir hücreye h a r f i h a rfin e şifrelenmiş . u lu s la r ve dinler ola­ rak bölen dışsal farklılıklar aracılığıyla a y rılm ış olan bizler.y aşam ın k en d isin in elem ent­ leri olarak şifrelenmiş alfabetik bir dil — tarif edecektir. mantıklı bir kesinlikle. bizim ki ortaya çıkan ama bit­ m eyen bir gizemdir. Bölüm şu som yu sorara k başlar: Biz ki­ miz? Bir tür olarak.

Tanri’nın ismini tüm yaşamdan açığa çı­ karmak. geçmişimizdeki tüm farklılıkların üstesinden gelebilir. şu anki inanç sistemimizi ye­ ni keşfettiğimiz bilgiyi birleştiren bilgi ile değiştirmeye davet edecektir. .şansa gerçekleşen kimye­ vi birleşimlerden ve evrimden çok daha başka bir şeyin bu­ rada olmamizdan sorumlu olduğunu öne süren kanıtlara ek­ lenmelidir.tıpkı sevilen birinin kay­ bını kabullenmek gibi. Dinine. Yakın zamanda yapılan çalışmalar böyle bir keşfin etkisi­ nin. burada belli bir nedenle. daha çok bizi ayıran ne­ denler olarak görüldüğü bir zamanda um udun en çok ihti­ yaç duyulan mihenk . En gerçek anlamda. ırkına ya da inancına bakmaksızın. doğası . yaşamlarımızı dramatik ve beklenmedik bir şekilde de­ ğiştiren bir haber aldığımız zaman deneyimlediğimiz şoka benzer olabileceğini söylemektedir. En azından. her bedenin kimyasının içinde keşfedilmiş olan bir mesaj doğal olarak öylesine ev­ rensel bir işaret olabilir ki. . kaybın kabullenil­ mesi aşamaları . kabullenme .20. Böyle bir ilke. Belki.. Tanrı'nın yaşam kodundaki eski isminin evrensel. farklılıklarımızın bizi kuv­ vetlendiren bir çeşitlilik değil de. kasıtlı yaradılı­ şın ürünleri olduğumuz bilgisi.şok. dünyamızı tek bir aile gi­ bi paylaş mak için olduğumuz gibi son derece güçlü yeni bir kanıt vermektedir. böyle bir keşif birbirimizle ve dünyamızla olan ilişkimizi açıklayan yeni bir çağın değerlendirmesi ola­ bilir.böyle bir farkındalığın ne kadar da derinden yaşamlarımıza dokunabildiği hakkında ipucu vermektedir. inkar. öfke ve kesinlikle.Gregg Braden bir Yaratıcı’dan gelen varlığımızın bilgisine güvenerek hayatlarımızı yaşamanın ve dünyamızı inşa etmenin ne ka­ dar farklı ola cağını ancak hayal edebiliriz. Böyle bir senaryoda. Yaradılıştaki rolümüzü yeniden tanımladığımızda eski inançlarımızın kaybından dolayı doğm su kendimiz yas tutarken bulabiliriz. yüzyıl bilimi sayesinde teyit edilmiş bir isim .taşını sunabilir. reddetme. En basit deyimle. böyle bit haberi kademe kademe kaynaştırabiliriz. yaşam tarzına. Böyle bir mesaj kesin olarak yaradılışın Tann’sının kim olduğunu tanımlamada umulanı veremez.

tüm yaşamların esasına doğru götüreceği anı b e k le ­ mişti. • Eski gelenekler insanlığın en derin gizem lerinin. . Başlangıcımızdan beri e n derini­ mize saklanmış olan şifre arayışımızın yolculuğum uzu içe doğru. evrim ve creationizm in el ementlerini birleştirme. doğru zamanda olması ve yaşam ın şans eseri ortaya çıktığı için mucizelerle sınırlandığım öne sürm ektedir­ ler. • Yaradıl ışın Hibrid teorileri.yaşam ım ızın başlan g ı­ cından kilit rol oynamış olabileceğini ö n e sü rm ek te­ dir.yaşam ın k en d isin d e .Taun 'nın Şifresi Takip eden olağanüstü keşif şöyle bir birlik ilkesini n et olarak tarif eder: T ann’nın eski ismi. varlığımızın en derin dokusunda şifrelenmiştir. Tanrı ile paylaştığımız sırrı v e yaşam ın birbiri­ mizin varlığında bile zamanımıza yeni bir anlam kattığını keşfetmek bizi şaşırtmamalıdır. ekl enm iş bîr etkenin . Belki.b u lu n a bileceğini öne^ sürerler. bir güç . ipuç­ larının ve barış ve hayatta kalm am ızın an a h ta rın ın Tanrı'nın tam am lanan eserinde .n e d e n i daha açıklanamamış. Her iki teoride d e bazı şeyler eksik gibidir. BÖLÜM 2 Ö Z E T • Evrim ve creationizm teorileri kendi içlerinde bizlerin geçmişimiz olarak gördüğüm üz kanıtları açıklam ada yetersiz kalmaktadırlar. • DNA yapısının kaşifleri tüın etm enlerin d o ğ n ı yerde.

teknolojik ve bilimsel seçimle­ rinde daha yüksek bir güç ile ilişkimizi yeniden dü­ şünmeliyiz.evrensel bir dilin kadim bir şifresi olduğu keşfi benzeri görülmemiş bir insan birliği ilkesi sunar. .Gregg Braden • Yaşam kimyasının . geleceğimizin sosyal. • “Kim” olduğum uzun keşfi eninde sonunda dünyamı­ zın barışı ve hayatta kalmamız için anahtar olabilir.DNA’mızın . Böyle bir mesajın varlığında.

" — ALBERT EINSTEIN 1936’DA KENDİSİNE BİLİM ADAMLARININ DUA EDİP ETMEDİĞİNİ SORAN ÖĞRENCİSİ PHYLLIS ^WRIGHT'A .insanınkinden çok daha üstün bir ruh kendini gösterdiğine ikna olur.“B ilim in uğraştıklarıyla ciddi olarak ilgilenen herkes bir ruhun kainatın kanunlarında .

aileler. toplumlar ve ulusların evriminde uzun zamandır rol oynarken. Bu ve buna benzer istatistikler günüm üzün sorusunun belki de daha az Tanrı’nın varlığına inanıp inanmadığımız ve daha çok böyle bir varlığın yaşamlarımızdaki anlamının net ola­ rak ne olduğuna işaret etmektedir. geleceğimiz belki de bugün bizlerin rastgele moleküllerin şans eseri birleşiminden çok daha fazla . Bu sayının yaklaşık %95’i. / Daha Yüksek bir Gücün İfade Edilmesi Ruhsallık. yani 5.9 milyarı daha yüksek bir güce ya da Yüce Varlığa inanmaktadır.-3 - Y ^ ^ D IL IŞ IN K A Y IP K İT A P ^ L A R IN D M : Yeııyüzündeki Bedenlerde Cennetin Güçleri yılındaki nüfus sayımı istatistiklerinin tarihin 2 0 0 0 en kesin nüfus istatistikleri olduğuna inanılır ve dünyayı türüm üzden 6. Bu kişile­ rin yarısından çoğu bu gücü “Tanrı” olarak adlandırıyor.2 milyar insan ile paylaştığımızı gösterir.

Eğer bunlardan sadece küçük bir bölüm ünün gezegenleri varsa ve bu gezegenlerden sadece küçük bir bölümünde zeki bir yaşam mevcutsa. d ah a özel bir k o ­ nuşma sırasında. Pa!mer. 20.Ellie’nin küçükken babasından duyduğu kelim elerin aynısını söyler. Bir anlık sessizlikten so n ra. ana karakter Dr. Carl Sagan'ın aynı adlı eserinden uyar­ lanan 1998 yapımı Contact adlı film bilim ve din arasındaki günüm üz ikilemini yansıtarak. m ilyonlarca ınedeniyet varolmakta olabilir! Geceleyin gökyüzüne sürekli bakarak. Ellie Tan rı ’yı duyım sam aınızın yaşam ları­ mıza bir “anlam” katma ihtiyacının sonucu olup olm adığını merak ettiğini söyler. daha yüksek bir güç ile iliş­ kimizin çok farklı iki perspektifini anlatm aktadır.Tanrı ‘nm Şifresi bir şey olduğumuzu fark etme yeteneğim ize bağlıdır. A rrow ay’i v e Palm er Joss’u arasındaki ruhani gerginlik bizlerin bu g ü n k ü bakışı­ mızı tarif etmektedir. çok farklı bakış açılarından. Sadece bizim galaksimizde 400 milyar yıldız vardır. Eğer bir tek biz varsak. bir ilahiyatçı ve yazar olan Palmer Joss karakterine ka inatın herhangi bir yerinde zeki yaşamla r oldu ğu olasılığını a nl a tır. Karşılık olarak. Filmin başında. daha yüce bir zekayı arayışımız teması dünyanın dört bir yanında sanatta.. Pek çok bakımdan. Palmer duygularını “T anrı”n ın varlığı . Da ha sonra. Palmer’in bakış açısına göre. Porto Riko'nun dağlarında yer alan dünyanın en büyük tek antenli radyo teleskopunun yapındaki bir sıraya oturarak. O basitçe “odur”. Contact'ın Dr. yüzyılın ortalarından beri. uzay boşunadır dem ektir. d ah a son ra da bir­ birlerinin gözlerine. Ellie A rrow ay kendini hayatının tutkusunu kovalayacağı m ükem m el bir yerde bu­ lur: Yeıyüzünün ötesindeki zekayı bilimsel olarak araştırma. diye yo­ rum yapar. daha yüksek bir güce olan yaygın inanç Tanrı’nın varlığını kolek­ tif olarak deneyimlememizdir. böyle bir güce olan inancının zihinsel ola­ rak düşünm e yeteneğinin üzerinde bir şey olduğunu itiraf eder. yalnız ol­ madıklarını hissederler. edebiyatta ve filmlerde işlenmiştir.

Ellie’nin uyanışı uzay-zaman aracılığı ile uzun ve maceralı bir yolculuk yapması ve sonra da geri dönmesiyle sonuçlanır. yüzyılda bilim gözü pek bir şekilde dar bir yalanda hızla yol alıyor olsa da. Palmer’ın uyanışı başkaları­ na' 'gösteremediği ve kendisinin de asla görmediği bir güce inanışından ortaya çıkar. “Başlangıcın” Eski İpuçları Bilimimiz ne kadar ileri görünürse görünsün. Aynı zamanda. günüm ü­ zün en büyük beyinleri bugünkü anlayışlarımızın eksik ol­ duğunu itiraf etmektedirler. Einstein’ın enerji ve madde denklemleri ve internet iletişiminin mucizesi içinde. bilimin daha tanımlayamadığı bir gücün duygusunu kabul etmektedir. Genetik kodun netliği. Her iki bakış açısı da evrensel bir varlığın.G rereg Emden olarak yorumlayarak. 21. “her şey nasıl başladı" sorumuzun yanıtı . en hafif deneyimle. Ortak bir gözlemden alıntı yapmak gerekirse: Ne kadar çok keşfedersek aslında ne kadar az şey bildiğimizi o kadar çok anlıyoruz. ve eninde sonunda deneyimlenmesi gerek­ tiğini keşfederler. deneyimini başkalarıyla paylaşabile­ ceği somut hiçbir delili yoktur. kim olduğu­ muzu bilmiyor olmamızın ironisi çok daha büyük bir anlam içermektedir. yaradılışa bilimsel olarak bakışımızda içleri doldurnlmadan kalan boşluklar vardır. daha küçük yaştayken babası tarafından cesaretlendirilen bilme olan tutkusu daha yüce bir zeka duygusunu başka dünya­ lardaki istatistiki yaşam olasılıkları olarak biçimlendirmekte­ dir. Her ikisi de. daha yüce bir gücün deneyimini ken­ di dini eğitiminin gözlerinden görmektedir. Ellie’nin. şu an için bizler tek başınayız gibi görünmektir. o varlığın mutlak kanıtının anlaşılması için. Dünya tarihinin en yoğun nüfusuna sahip ol­ mamıza rağmen. nasıl varolduğumuzu net ola­ nak :anlamaya hala ihtiyacımız var. “yalnızlık” duygumuz içinde. nay Her ne kadar kanıtlar kainatta daha yüksek bir zekanın varlığına işaret etse de.

bizden önce gelenler.Tann ’mn Şifresi insanın ve doğanın sınavını devam ettiren bir form da halen varolabilir. Buna ek olarak. yaradılışın gizemlerini anlatan ilkeler haliha­ zırda vardı.köklerimiz. bugün bizim sorduğum uz aynı somların . Tarih boyunca. Eski efsanelerin . Güney Amerika’nın yerli halkının buharlı lokomotifi ilk gördükleri zam an kendi dillerinde “demir at" olarak tarif etmeleri gibi. Daha yüksek boyutlar ve kuantum hologramları terimleri m oda olmadan önce. m ürek­ keple yazılmış mektuplardaki lekeler ve böyle bir tarihi ko­ ruyan ufalanmış parşömenler yeteneklerimizin ve kaderimi­ zin sırrını da taşımaktadır. O zamanların kelimeleriyle. Örneğin. Böyle bir sözcük dağarcığında. Heinrich Schliemann’ın 1870 yılında Troya şeh ­ rini bulması H om er’in edebi klasiği İliada’nın tarihi olayların gerçeklere dayanan bir hikayesi olduğuna inanm asına daya­ lıydı. İliada’yı sözel bir harita olarak kullanarak. Toprağın ve Havanın Melekleri halini alırken. Rüzgarın. Bildikleri tek dilde. “boyutlar” “cennetler” olmuştur örneğin ve bilinç de Tanrı’ntn nefesi. kaynağı başlangıcımızın m eydana geldiği tarih olduğu söylenen böyle ileriyi gören deneyim leri koru­ yan bilginin dedikoduları yapılmıştır. geçmişimizin sırlarını ta­ nımlayacak anahtar da başka bir zamanın düşünceleri ve fi­ kirleri olarak kaydedilmiştir. Schliemann metindeki ipuçlarını takip etmiş ve 19. Eski efsaneleri incele­ diğimiz zaman. eski bilginler yaşamlarına anlam katmaya yardımcı olan vizyonları ve vahiyleri tarif et­ tiler. yüzyılın en büyük ar­ keolojik keşiflerinden birini gerçekleştirmiştir. bazıları binlerce yıl süren hikayelerin ve mit­ lerin altında yatan gerçekleri keşfetm enin yaygın olduğunu görürüz. doğanın güçleri G üne­ şin. yaşamın a n ­ lamı ve bu dünyanın acılarından nasıl kurtulacağımız hak­ kında sorular . Yeıyüzünün çukurlarında saklı ve yüzyıllık çöl kumları altına gömülü geçmişimizin yazılı'kayıtlan da kök­ lerimizin kayıtlarını içermektedir.yanıtını nasıl aldıklarını anlatmışlardır.

yüzyıl gibi yakın zamana kadar de­ vam etmiştir. Adem ve Havva’yı Cen­ netin Bahçesindeyken tanıtan bilgeliğin eski bir kitabı hakkındaki ısrarlı dedikodular. onu ancak sembollerinden anlam çıkaracak kadar spiritüel olarak olgunlaşmış kişilerin anlaya­ cağı şekilde yapılmıştı. yaradılışın sırlan ve insanlığın kökleri harfle­ rin kendisine gizlenmişti. O zamana kadar. (1) Efsane. Yuşa ve Süleyman. daha sonraları Chassidut Yahudiliğinin babası olarak bilinen İsrail ben Eliezer’in sa­ hipliğinde olmuştur. yüzyılın sonlarına doğru da Türkiye’deki Ağrı Dağı’nda Nuh’un Gemisi’ni bulmasıdır. renk tonu ve özellik­ leri sayesinde. Adem ’in Kitabı sade­ ce altı kişi tarafından sahiplenilmişti: Adem. esrarengiz bir m adde ile doldu­ rulmuş olan harfler sayfaların kopyalanmasını ya da yeniden üretilmesini engellemişti. Adem’in Kitabı olarak bilinen kitabın de­ tayları geçen zaman boyunca solup gitmiş olsa da. varoldu­ ğuna dair söylentiler 18. A d em }in Kayıp Kitabi: İnsanın D ünyasında Meleklerin Bilgeliği Troy şehri olayında olduğu gibi. Bu zaman boyunca. bu ef­ sanenin gizemi asla çözülmemiştir. Kitabın içindekileri yanlış kulla­ nımlardan konınıak için. Öte yandan. Musa. Her ne kadar. Yusuf. Diğerleri için. Kitabın sadece bir kop­ yasının varolduğu söylenir. efsane kitabın içindekilerinin anlamsız olduğunu işaret eder ve sırlarını yanlış kullanmaya yönelik herhangi bir girişim o kişileri hayatların­ da mutsuzluğa götürecektir. orada bir haham yaşarmış ve kitaba sahip olmasa bile . bu efsanenin aslında tarihsel bir olaya dayalı olduğunu ileri sürmektedir. Metnin şekli.Gregg Brctden ve m itle rin araştırılması ile doğaldan sonuçlanan keşiflerle ilgili başka örneklerden biri de Hiram Bingham’ın 1911 yı­ lında İnkaların Kayıp Şehri Machu Picchu'yu ve 20. İsrail ben Eliezer’den biraz uzaktaki bir şehri an­ latır.

anlamı Kutsal İsmin Üstadı . Yoğun ışığın samanı tutuşturmuş bir m um dan gel­ miş olabileceğinden endişelenerek pencered en bakar ve sa­ dece İsrail’in bedeninden yayılan parlak bir ışık görür. bir ahırda yaşayan İsrail'i nasıl bulduğuyla ve gece yarılarına kadar orada kalıp Yahudilerin Kutsal Kitabı Torah’ın sözlerini nasıl öğrendiğiyle devam eder. İsrail’in Torah’ın sözlerini okurken aldığı ilhamdır. Sonısu. İsrail ben Eliezer. Yaşamının sonu na yaklaştığını hisse­ dince. kapının arkasından gelen bir ışık süzmesini araştırırken. Hahamın oğlu ona İsrail’in nihayetinde sırların kitabını almaya layık olduğuna ikna eden bir m ucizeye ta­ nık olur. Ertesi gün. ' Bir gece. Adem'in Kitab ı’na dayalı öğretileri sayesinde. Haham Adam’ın oğlu babasının son dileğini yerine getirir ve mistik kitabı İsrail’e verir. yüzyıl insanlık tarihinin en önemli ve ilgi çeken ka­ yıtlarından bazılarının bulunm asına tanık oldu. Kayıp Ölü D eniz Yazmalarının İncile ait metinleri ve Sümerlere ait .Tanrı :nm Şifresi yü . Adem’in Kitap’ından söz edilen en son söz edi­ len efsane budur. Haham Adam oğlundan genç İsrail ben Eliezer’in yerini öğrenmesini ve kitabı şahsen ona vermesini istedi. Efsane Haham Adaın’m oğlunun. İn c ilin Kayıp Kitaptan 20. ölm eden önce Ademin Kitabı’nı kime vermesi gerektiğiydi. Işığın kaynağı yanan sam andan gelen ateş değil. insanlığın hakikatinin devamından emin olmak için.olarak anılmaya başlanır. Haham Adam Tzaddik dünyayı terk etm eden önce iyiliğinin son bir hare keti olarak rüyasında bir soru için yar­ dım istedi. basitçe söylemek gerekirse.o j J onun varlığını bilirmiş. Baal Shem Tov . Mağarada Ademin Kitabı’nı buldu. Edebiyatta. Gecenin ilerle­ yen saatlerinde uyandı ve geçmiş zamanın pek çok aile bü­ yüğünün mezarı bulunan Kutsal Topraklardaki bir m ağara­ ya gitti.

Bazı örnek­ lerde. Şu anımıza bakışımızın büyük bölümü geçmişimizin ta­ mamlanmamış anlayışına dayalıdır. dünya tarihimizin en güçlü ve tartış­ malı kitaplarından biri haline gelmiştir. bilgi zincirimizin en önemli kırılmalarından biri dördüncü yüzyıldaki ilk Hıristiyan Kilisesi’nin İncile ait ba­ sımlarının sonucudur.’de Kilise öğretisini yerleştirmek için toplanılan bir panelde ilk Hıristiyan metinlerinin üzerinden geçildiği ve bazı maddelerin silindiğini bilmektedir. bu nedenle de bilimsel ilkelerimizin.da tamamlanmamış olarak kalması şaşırtıcı değildir. Mısır’ın Nag Hanımadi Kütüphanesi’nin Gnostik ve Yeni Ahit keşiflerine kadar bir do­ lu kanıt.ve de onların bize nasıl hizmet ettiği . Kutsal İncil. Konsey üyeleri tarafından arkalarında bıraktıkları mek­ tuplardan açıkça görülmektedir ki. Geride kalan. ruhban sınıfı ve tarihçilere tamamen farklı asırlık dini çalışmaları o zamanın insanlarının anlayabilece­ ği bir şekilde tek bir belgeye dönüştürmeleri gibi korkutucu bir görev verildi. tıbbi uygulamalarımızın. eski zamanların bilgeliği ile modern dünyanınkini birbirine bağlayan bilgi zincirinin aslında birden fazla olay­ la kırılmış olduğunu göstermektedir. onların herhangi bir uygulama değeri olmadığına karar verdi.E. Çabalarının sonucunda. ruhani anlayışlarımı­ zın ve tarihi olaylarımızın .Gregg Braden binlerce tabletin çeviriminden. saklanışında ya da yeniden ifade edilişinde. 325 C. Geçmişimizle ilgili her­ hangi bir kaydın her silinişinde. Bilginler. öğretiler ve tarihi belgelerin da­ ğınık bir bileşkesini dikkate alarak. Meseller. (2) Ro­ ma İmparatoru Constantin’in emriyle. Enoch’un Kitabı bunlardan biridir. Konsey en azından 45 belgenin çıkartılması gerektiğini önerdi. Konsey metinleri öylesine mistik buldu ki. üzerinde çalıştıkları pek çok kitap üst üste binen versiyonlar ve tekrarlanan hikaye­ lerle gereksizce ve sağlıksız bir şekilde yazıldı. kim olduğumuzun gizemi daha karmaşıklaşmıştı r. orijinal yayınlar çok iyi . Belki de. Nice Konseyi’ni oluş­ turan papazlar.

“Çünkü bu gibi yazıların herkes tarafından. dördüncü yüzyıldaki düzeltm eler sıra­ sında elenen pek çok kitap yeniden ele geçirilmiş. yüzyılın başlarında yayınlanan İncil in kayıp kitaplarının bir derlemesi gibi zam an zaman okunması m üm kün olan tercüme grupları olm uştur. şu an yaşamakta olan herhangi birinin yazacağından çok daha genel ve önyargısız kabul edileceğini um uyorum . Herod ve Pılate’nin Mektupları Trallians Romalılar Polycarp Philidelphians Paul ve T h ed a Paul ve Seneca Nicodemus Magnesians Meryem I Çocukluk II Çocukluk Efesliler I H erm as-Ö ngörüler II Hermas-Emirler III Hermas-Benzerlikler İsa ve Abgaru s I Clem ent II Clement Barnabas Yukarıda listelenen kitapların çoğu çıkarılmalarını takiben karanlığa karışmışlarsa da.” (3) Nice Konseyinin üyeleri riasıl olur da oluşturdukları kitabın yavaş yavaş dünyanın en büyük dinlerinden birinin' temeli haline geleceğini ve dünya nüfusunun üçte biri ta rafından en kutsal kitap olarak sayılacağını bilemezler? Yakın zamanlarda. metinlerin hepsinin orijinal bir sıraya konulduğu tek bir derlem e bulunmamaktadır. bir kaçında bu gerçekleşmemiştir.(4) Aşağıda. Kendi çağdaş çalışmaları yerine böylesine es­ ki metinleri tercüme e dip yayınlamayı neden seçtiği sorul­ duğunda. 20. örneğin Canterbuıy W ake’in B aşpiskopos’u şöyle cevap vermiştir. bugün Nice Konseyi tarafından düzeltm eler sırasında kaldırıldığı bi­ linen kitapların bir bölüm ünün listesini bulacaksınız. Bildiğim kada­ rıyla. tercüme edilmiş ve insanların okum ası sağlanmıştır. Öte yandan. zira tercüm eler farklı yazarla­ rın yüzyıllar boyunca farklı dillerde çalışmasının sonucudur.Tanrı 'nm Şifresi tasarlanmıştı. .

Gregg Braden İkincil olarak ya da destekleyici belgeler olarak bakılan aşa­ ğıdaki liste bilginler için korunan metinlerin listesinin bir bölümüdür.” demiştir. 1946 ve 1956 yıllan arasında. son yüzyılın en önemli arkeolojik bulgula­ rından biri Ölü Deniz kıyılarının yukarısında -mağaralarda saklı bulunan bir kütüphanenin keşfidir . 22. bazı bilginlere göre. Adem ve Havva’nın İlk Kitabı Adeın ve Havva’nın İkinci Kitabı Enoch’un Kitabı Süleyman'ın . bakır ve papirus elyazması parçaları bir araya getirilmiş.Ölü Deniz Yazma­ ları. zira mağaralar­ da bulunan belgelerden bazıları bugün dördüncü yüzyılda­ ki düzeltmeler sırasında “kaybolan" kitaplar olarak tanın­ maktadır. (5) .İlahileri Süleyman’ın Şiirleri Maccabeeİerin Dördüncü Kitabı Ahikar’ın Hikayesi Reuben’ın Ahit’i Asher Sitneon Levi Yahuda Issachar Zebulum Dan Napthali Gad Bünyamin Daha Yüce bir Bilgeliğin Parçalan Muhtemelen. Isaiah ve Mu­ sa'nın sözleri gibi Eski Ahit kitaplarının orijinal versiyonları ortaya çıkarılmıştır. 'Kumran Mağaralarında 200’den fazla İncile ait elyazması saklanmıştır. Ölü Deniz’in yu­ karısındaki 11 mağaradaki belgeler kütüphanesi tarihi bel­ gelemek için keşfedilmiş İncile ait belgelerin en önemli de­ posunu oluşturmaktadır. yaklaşık 900 belge elde edilmiş ve Genesis. Öncü gazete Biblical Archeological Review’un editörü Hershel Shanks keşfin önemine değinerek. bazıları Incil’deki hikayelerden dramatik bir bi­ çimde farklıdır.00’den fazla hayvan de­ risi. Her ne kadar bulunması gereken daha pek çok ki­ tap olmasına rağmen. Bu keşif büyük tartışmalara yol açmıştır.

1991 yılında. daha evvel yayın­ lanmamış yazmalar dahil. Öte yandan Nag Hammadi Kü­ tüphanesi olarak bilinen kalan yazmalar inanılmaz şekilde iyi konınm uşlardı ve eski Gnostic ve ilk Hıristiyan gelenek­ leri hakkında yeni ve bazı konularda şaşırtıcı görüşler sun­ maktadır. tüm fotoğraflarına serbestçe ve şartsız girişi” (6) ilan etti.12 bütün el yazması ve bir 13. Böylesi bir bilgeliğin açığa çıkması geleneksel kutsal kitabın boşluk­ larını ve tutarsızlıklarını tam amlamada inanılmaz derecede yararlı olacaktı. Ölü Deniz Yazmalarının yeraltından çıkarılmasından iki yıl önce. en çok bağlı . Ölü Deniz Kütüphanesine giriş sadece sekiz bilginle sınırlıydı. 1990’larda yazmaların içeriği hal­ ka tanıtıldı. Aralık 1945’de. (7) Hepsi birlikte ele alındığında.nün sekiz sayfa­ sını içeren . iki kardeş Mı­ sır’ın Nag Hamnıadi bölgesindeki Nil Nehri yakınında m ü­ hürlenmiş bir testinin içine göm ülü bir yazma koleksiyonu buldu.Tanrı nm Şifresi Yazmaların düzeltilmesi. Daha tamamlanmış bir tarihle.inanılmaz sayıda insanın elinden geçti. Siyasi ve akademik baskılar sonucu. kadim bilgeliğin bir başka kütüphanesi keşfedilmiş ve ilk Hıristiyanlık hakkındaki düşünce şeklimizi halihazır­ da değiştirmeye başlamıştı. tercümesi. yüzyılın son on yılına kadar. derlenmesi ve yayın­ lanması bulundukları günden beri inanılmaz bir tartışma ko­ nusu olmuştur. 20. Kahire'deki yetkililerin dikkatine sunulm adan önce. Da­ vayı takip eden yasal yazmalar takımının başkanı aynı yılın Kasım ayında “Ölü Deniz Yazmalarının. Şu an­ da Kahire'de Kıpti M üze'de saklanm aktadır ve 4 Ekini 1946‘da belgelenip müzeye kayıtlarına geçm eden önce kaç yazmanın yerel ocaklarda yakılarak imha edildiğini kesin olarak kimse bilmemektedir. G üney California’daki Huntington Kütüphanesi yazmalarının fotoğraflarının tamamını elde etti ve onları halkın da görm esinin sağlanacağı duyuruldu.' koleksiyon . bu iki kütüphane belki de bugüne kadar bulunm uş eski dünya ve ilk Hıristiyanlık ge­ leneklerine en bütünlük içeren bakışı sunmaktadır.

C ennetin Meleklerinden: Ö lüm ün Enstrümanları ve Savaşın Başlangıcı Son 200 yıl içinde bulunmuş en önemli ve gizemli belge­ lerin arasında kayıp incii Enoch'un Kitabı vardır. zira kitap Irenaeus.1: Gnostik "kayıp" Thomas'ın İncili'nden iki sayfa. Her ne kadar bu kısa tartışma bu metinleri bütünlüklerinde doğru lamamaktaysa da. (Fotoğraf Melissa E.) olduğum uz inançların bazıları ile ilgili gizem hakk ında yeni bir bakışa sahip oluruz. Sherman tarafından çekilmiştir. İskenderiyeli Clement ve Celsus gibi saygın bilginler tarafından Hıristiyan açıklamaları olarak tavsiye edilmiştir.Gregg Braden Şekil 3. İlk Katolik Kilisesinin tarihçileri Enoch’un Kitabı’na büyük önem ver­ mişlerdir. bu ve bu­ na benzer bilgilerin kaybolmasıyla m odem dünyamıza an­ lam kazandıran evrensel ilkelerin unutulacağı gerçeğini gös­ termektedir. Örneğin. ikinci yüzyılda tarihçi . Yazma Yunancadır ve Mısır’da­ ki Nag Hammacli Kütüphanesinde bulunan metinler arasındadır.

Ç oğu z a m a n . “P aris’teki k ü tü p h aneye teslim ettiğim parçalar arasında. o ğ lu M e th u se la h ’a ona Barışın Meleği tarafından indirilmiş o la n in sa n ırkının saklı tarihini yazdırdığı bir hikaye ile başlar.” (10) diye n ° t et­ miştir. Enoch’un Kitabı k ah in in . y a z ın ın v e simyanın sırlarının insanlık tarafından nasıl o rta y a ç ık a rılıp sonradan savaş ve . “E noch T anrı gibi aynı kutAh kitapta konuştuğundan ve ‘h er İslaha u y g u n h er kutsa1 kkap» tanrısa l olarak esinlenmiş' o ld u ğ u n d a n bize ait olm ayan hiç­ bir şeyi kabul etmemezlik y ap m ayalım . Enoch’u n kutsal yazındaki eşsiz yAhni anlatır. e sk i kahinlerin görüle­ rine eşlik etıne olarak g ö rü le n b n iirsiz ve genel bilgilerin ötesinde. Bilginin sorum luluğunu k u lla n m a olgunluğu olmaksı­ zın. aynı y e rd e 1821 yılında hard Lawrence tarafından te k ra r keşfedilm iş ve s o n r a d a tercüm e edilmiştir. onların yine de üahi olarak verildiği ve tıpkı Isaiah ve Psalm s'ın Kitapları gibi di­ ğer ru ha ni belgelere verilen aynı in anırl ığı n verilm esi geıektigini kabul ederek. Enoch onun ve M e th u s e la h ’ın ken d i zam an1arında şahit olduk lan acının kayna ğı n ı ve inSanlığın kötüye gidiŞi­ nin nedenlerini anlatır. Özellikle. İbrani Hıristiyan Kilisesi yasalarınca Eski Ahit m kahininin sözlerinin kabul etm ezken. Enoch deneyim ini k u r n a z o lm ay an bir ani^ım H açıklar. Enoch bazı m e le k le rin tü rü m ü z ü n bu tür güç­ leri akıllıca kullanm ak için g e re k li b ilg eliğ i kazanm ada n ön­ ce nasıl yaradılışın sırlarını in s a n i ığa nasıl açıkladıklarını an­ latır. cennetten bir düş” gördüğü şeklinde kaydeder. M eth u selah babasının sözle­ rini Enoch’un “gözleri tam am en a ç ık k e n .(8) Tertullian özellikle. E n o c h ’u n kehanetlerinin çok güzel ve görkemli kopyaları da v a rd ı. (1 1 ) u y a n ık am a d e ğişmiŞ bir biçim de..Tanrı ’nın Şifresi Tertullian. Bu elyazmasının bir k o p y ası O x fo rd ’daki BAhteian K ütüphanesinden tanıtılmıştır.” dem iştir.(9) Yakl aşık 1500 yıl kayıp o lan E n o c h ’u n m etn in d en ilk kez 1773 yılında James Bruce tarafından b u lu n d u ğ u n d a sö z edil­ miştir. İskoç bir kaşif olan B ruce. b itk ileri n ve otların. d ilin .

. cenne tteki meleklerin insanlığın böyle bir bilgiyi almaya hazır olup ol madiğim sor­ guladıklarını öne sürer. mistik İbrani Haggadah’ın Kitabı insanın nasıl “hem /^? T \ Gregg Braden . kalkanı ve kılıcı keşfeder. (12) Her birine ait melekl e rden ve sırlardan se çip bir ta ne sini alarak Enoch melek Azazyel'. “Bilgelik insanın oğulları arasında yaşaması için verildi ama oturacak hiçbir ev elde ede medi. dolayısıyla onun yaşamı cennettedir. “Gizlenmiş olan her şeyin” kendisine gösterilmesi isteğine cevap olarak. "insanoğlunun çocukları için kan dökmek amacıyla ölüm enstrümanlarırn.in “yeryüzündeki her türe kö­ tülüğü nasıl öğrettiğini ve cennet yapılan gizli şeyleri dün­ yaya nasıl bildirdiğini”(13). Ö rne­ ğin.” ( 16) Yeryüzündeki Bedenlerde Cennetin Güçleri Ek metinlerin keşfi ve tercümesi Cennet’in bilgisinin yer­ yüzü ile paylaşılmasından bil e önce. orada toprağın tozuyla doyınılm uş oldukları yeri algıladı m . Orada da.. Enoch Cennetin sırlarının nasıl yavaş yavaş insanın egemenliğinde yok olduğunu an­ latır.güç amaclyla nasıl yanlış kullanıldığını gösterir.” (15) Yaşamlarımıza uyguladığımız bilgiden gelen bilgelik ve bilgi arasında bir ayırım yaparak. zırhı. gö zlerim şimşek ve gökgürültüsünün sır­ larını gördü ." (14) ' Bu tür rahatsız edici açıklamalara ek olarak. dünyan m yaratılmasından önce yeryüzünün üzerinde dolaşmaya deva m eden bulutun kendisini.” Görüşünün bu bölü­ münü şöyle tamamlar. Enoch yara­ dılışın gizemlerinin esin veren kaynakl arını ve güzelliğini de gösterir.. Enoch daha sonra "Cennetten yeryüzüne inen ve insanoğlu­ na sırları veren ve insanoğlu nu güna h işi emesi için baştan çıkaran meleklerin” isimlerini bilmesine izin verir... Melek Gadrel. “Bilgelik yeryüzünde oturacak hiçbir yer bulamadı.. orada gö rdüm. insan ırkına Tanrı’nın meleklerinin gö­ zünde zaten eşi görülmemiş bir statü bahşedilmişti. diye devam eder. Meleklerin özellikleri ile fiziki bir bedeni birleştirerek.

benzer şekilde varoluşum uzun altında yatan so n su z bir zekanın günümüz kanıtını anlatmaktadır. Görkemli tapınakların. “Ben (Tanrı) insanı ikinin birleşi mi olsun di­ ye yaratacağım. T anrı’nın dünyamızda ve yaşamlarımızda oynadığına inandıkları ro lü n büyüklüğü hakkında bir parça şüphe duymamıza n e d e n ol­ makta. zamanım ızın en ü stü n bilim i onun anlamını ve gereklerini çözm eye çalışmaktadır. B una ek olarak. Sırlarındaki bilgi öylesine evrensel ve aynı zam anda ö y lesi­ ne karmaşıktı ki. kaba ve kötü davrandığında ölüm onu y enecek. ama günahtan kaçındı­ ğında. kozm os ve birbirim izle olan ilişkimizi bu gü nk ü yaygın olan dünya g ö rüşünden so n derece farklı bir ışıkta görmüştür. kolektif geçmişimizdeki en eski görüşler.Tanrı’nın tavsiyesi arasında büyük bir uyuş­ mazlığa neden olurdu.Tann!nm Şifresi Cennetsel hem de dünyevi özellikleri içinde birleştirdiğini” anlatır. Haggadah gibi kitaplar yaradılışımızın eski hikayelerinde varolan bir temanın sadece bir örneğini temsil eder. (17) metin daha sonra Tanrı’nın bizi yaratm asındaki nedeni açıklar. Tek bir türü böyle bir sorum luluğu üstlenm ek için gerekli olan bilgeliği daha kazanm adan Cennet ve Y eıyüzü’n ü n bir­ leşimi sırları ile güçlendirm enin anlamı ve sonuçları ayrı bir sorundu.» (18) Gnostik ve Hıristiyan Kilisesinin yasalarına aykırı olan metinlere göre. g elen ek le­ rinde son derece açık olan bir bir bakış açısını oıtaya koyar: Bizden önce gelmiş olanlar Tanrı. bugün bile.koru maya ve iletmeye adadılar. geniş k ü tü p ­ hanelerin ve mistik yazıl arın bıraktıkları sayesinde esk i to p lumların üyeleri yaşamlarını bu tür yaradılış sırlarını — ilk­ çağda bile eski olan sırları . böylece günah işlediğinde. gizemli piramitlerin. . Haggadah yazısı şöyle devam eder: “Meleklerin hepsi aynı fikirde değildi. Yazmış oldukları.» (19) diyerek Sevgi ve Adaletin melekleri Tanrı’nın planının ya nındayken G erçeğin ve Barışın Meleklerinin nasıl buna karşı olduklarını anlatır. cennette . insanoğlunu cennetin sırları ile güçlendir­ mek. sonsuza dek yaşayacak.

Tarihçiler genellikle bu çalışmalar içinde Sepher Yetzirah'ın en eski ve belki de en gizemli bölümü olduğunu söy­ lerler. Çalış­ maların her biri Tanrı'mn.g Brctden Gizemli Sepher Yetzirah: Yaradılışın Kitabı Köklerimizin en tam ve detaylı kayıtlarından bazıları es­ ki İbranice ve geleneklerinde korunmuş görünmektedir. İbrani bilginin herkes tarafından en çok bilinen kaynağı belki de Kabala olarak bilinen mistik yazı­ lar koleksiyonudur. geleneksel Yahudi bilginleri metnin doğrudan İbra­ him Peygam ber'den alındığına inanırlar. Bu ona eski Hindistan'ın Vedaları gibi diğer geleneklerin daha eski mistik yazılarının bazılarını tamamla­ yıcı bir nitelik kazandırır. o zaman Sepher Yetzirah'ın ilk çevirileri yaklaşık 3800 yıl önce olmalıdır.. Bu sözler sayesinde. İbrani bilgilerin 5 milenyumdan daha eski bir zamanda mü­ rekkepli kalemle yazdıkları sözleri okuyabilmekteyiz. kainatın yaradılışı. Her ne kadar tek bir isim olarak bilinse de. Kabala aslın­ da İbrani saklı geleneğinin büyük kısmını oluşturan bir ça­ lışmalar koleksiyonudur . insanoğlunun ve yaradılışın son derece farklı ama aynı zamanda bütünleyici yollarla kap­ samlı olarak anlaşılmasına katkıda bulunmaktadır. yeryüzünün oluşumu ve en nihayetinde bedenlerimizin başlangıcı hakkında fikir sahibi olmaktayız.bazılarının başlangıcı ilk çağlar­ dan beri kayıptır. Genelde.yaygın bir . Her ne kadar Sepher Yetzirah’daki ilkeler bu tür gelenek­ lerden kuşaktan kuşağa devredilmiş olsa da. Kabala’nın en önemli çalışmala­ rının Zohar (Parlaklık Kitabı). Eğer bu doğruysa.Grer. Midrash (Aydınlatma Kitabı) ve Sepher Yetzirah (Oluşum Kitabı) olduğuna inanılır. Her ne kadar asıl başlangıcının ne olduğunu bilinme­ se de. iddiaları des­ tekleyecek doğnıdan bir kanıt olmadıkça kitabın kendisinin birinci yüzyıl içinde bir dönem de yazılmış olduğu. 5000 yıldan daha uzun bir süredir devam eden bir tarihle.

bu kapılardan biri sayesinde hücrelerimizdeki mesaj hakkın­ da görüş sahibi olmaktayız. olasılıkları bağlayan 231 hat oluşmaktadır. sayı (Sephar) ve iletişim (Sippur). "yu (22) oluşturan İbrani Alfabesinin geri kalan harflerinin şek­ line kadar. Sepher Yetzirah bu hatları 231 “kapı” olarak tanımlar.” diyen bi­ rinci yüzyıl Hahamı Yehoshua’ya mal edilmiştir. çalışmaları çoğu zaman sırlarını bağlı olarak al­ dıkları yaklaşıma göre sınıflandırılırlar: Kurumsal. Sepher Yetzirah. Tanrı’nın çalışmalarının mucizesini adım adım anlatan eski bir gözlemcinin bakış açısından yazılmış­ tır. Tanrı'’n ın eski ismi İbrani harflerle temsil edilen Kaina­ tın ilk elementinin oluşum undan “Onların hepsi oluştu. "Kabakları ve tatlı sukabaklarım alabilir ve Sepher Yetzirah ile birlikte onlardan güzel ağaçlar yapabilirim. Harflerin tüm birleşimleri ele alındığında ve bir çem ber şeklinde grafiksel olarak dizimi yapıldığında. Bu tür ifadelerin en eski lerinden bi­ ri.” (21) Sepher Yetzirah’ın geri kalanında. Her ne kadar Kabala’nın bilgeliği pek çok şekilde yorum lanabilse de. zira okuyucuyu spiritüel konuların . kozmosun doğuşu ve nihayetinde bedenlerim izin doğuşu dahil pek çok olayın canlı bir anlatımını sunm akta­ dır. (20) Paralel olmayan bir detayla. sihirli ve meditatif Sepher Yetzirah genellikle kategorilerden ikisine eşzamanlı olarak dahil görünmektedir. Diğer yaradılış hi­ kayelerinden farklı olan bir detay boyu tunda. Bu üç kitaptan yazı devam eder: “O (Tanrı) Kainatı yarattı. Bölüm altı’da göreceğiniz gibi. hikaye Tanrı’nın yara­ dılış hareketini her bölüm de daha fazla detaylandırarak an­ latır. dünyamızı oluşturan “şeyleri" yaratm ak için 22 harfin nasıl birbirini etkilediğinin n et bilgisini sunmaktadır. sadece 1500 sat ırl ık bu az ve öz yazı. İlk bölüm dünyamızın üç farklı kısımda kaydedilmiş üç bilgi türünün sonucu olduğunu söyleyerek başlar: Yazı (Sepher). Kainat her harf-elementlerin eşsiz birleşimleri olarak gözlerimizin önüne serilmektedir. Öncelikle ıneditatif bir metin olarak ele alınır.Tann’nın Şifresi fikir olarak kalmaktadır. Tüm metin.

da. (24) Öte yandan bu mistik yazıyı daha yakından incelemek bize bir sembol ve mecaz masalından çok daha fazlasını su­ nar. son Haham Aryeh Kaplan bu görüşü şöyle netleştirin “Bu duruş (Sepher Yetzirah’ın güçlü sihirli aromatik seslerle bir­ likte meditatif bir metin oluşu) onun canlı varlıklar yaratma­ da kullanılabileceğine işaret eden ilk Talmudik gelenekler tarafından desteklenmiştir.söylenmektedir. dünya dinleri hakkında son derece önemli ve tanınmış bir uzman olan Ka­ ren Armstrong’dur.” şeklinde açıklamıştır. Bu adım adım . Kabala'nın en eski ve en gizemli çalışmalarının saklan­ masına ek olarak.Gregg Braden en derin sırlarına doğnı düşünmeye zorlar. genelde yaradılışın gizemleri açısından bir mecaz niteliğindedir. Sepher Yetzirah’ın aslında yaradılışın kasıtlı hareketi­ nin en eski ve en zengin hikayesini gösterir. san­ ki bir kitap yazıyormuş gibi bir dille dünyayı yaratışını an­ latmaktadır. bu geleneksel bakış açısını en iyi özetleyen kişi. Kabala’nın bu boyutunu çalışmış ve uygulamış olanlar onun sırlarının öylesine güçlü olduğunu söylerler ki. hikaye son derece semboliktir ve Tanrı. A Histoıy of God adlı olay yaratan ve büyük takdir gören kitabında. Arınstrong Sepher Yetzirah aracılığıyla. Buna ek olarak. Belki de. Sepher Yetzirah şüphesiz ki içlerinde en tartışmalı olanıdır. Sepher Yetzirah’ın iyi olduğu bilinen bir tercümesinde. Bu tür yazıların bazı bölümleri günümüze kadar gelmiş olsa da. metinler asla tümüyle yayınlanmamıştır." (23) Bir golem olarak adlandırı­ lan böyle bir varlığın yaratılması ve yok edilmesinin İbrani gizemleri içinde en yüksek ustalık seviyelerini gösterdiği . İbrani alfabe ile günüm üz elementlerini birleştiren bu­ luşlar. “yaratıcı süreci gerçekçi bir şekilde anlatan bir girişim yoktur. meditasyon sonucu elde edilen bilgiyi fiziksel dünyaya da taşımak için gerekli yönerge ve teknikleri eğitimli bir uygu­ lamacıda ortaya çıkaran eski “sihir” dedikleri şeyle güçlü bir bağ oluşturur. Düzyazı şeklindeki çalışmanın popüler görüntüsü her ne kadar ilginç olsa.

bilginler Sepher Yetzirah’ın gücünü küçük bir ö ğ ­ renci grubuyla sınırlamak için bir girişimde bulundular. sahte versiyonlar yayınlamışlardır. ilk öğretilerle örtüşen p e k çok versiyonun bir birleşimini m uhtem elen yapm ış o lan lar Ka­ balistlerin kendileriydi. “b ö y lece onların gizlerini yaymayı am açlayanların kafalarını karıştır­ mışlardır. Her ne' kadar -kullanılan isiın gelenekten g e le n e ğ e fark ­ lı olsa da. yazının en az d ö rt ana versiyonu ve n ered ey ­ se sayısız ara versiyonu olduğunu görürüz. Bölüm 5) d in ve spiritüelliğin dünyadaki en derinden korunm uş g e le n e k le rin yansından çoğuna bir anlam vermektedir. doğnıluğu ve yonım ları ile il­ gili tartışmalar ve gizem bugün hala güncelliğini k o n m a k ­ tadır. Bu a çıda n bakıldığında S e p h e r .” (25) Haham Kaplan’a göre. 18. m uhtem elen bilerek. yüzyıl biliminin keşifleri ile yakın bir paralellik göstermektedir! Sepher Yetzirah'ın kökleri. Eğer yıllar boyunca ortaya çıkan tüm çeşitlem eleri göz önüne alırsak.” diye ileri sürm ektedir H aham . Ha ham Kaplan bu kadar çok çeşitl il iğin olm asının n e ­ deninin gizliliğin bu tür öğretileri saklı tutm ayı gerektirm e­ sinden kaynaklandığını söylemektedir. ve 10. 1300 kelim elik Kısa Versiyonundan 2500 kelim elik Uzun Versiyonuna k a ­ dar. 6. yüzyıllar arasında. Orijinali 16. yüzyılda yaratılm ış o lan bu versiyon daha sonra. Hıristiyan ve İslaıni geleneklerin ortak tarihi. yüzyılda Gra Versiyon (G ra H a­ ham Eliahu’ya dayanarak) olarak tasfiye edildi. 20. Pey g a m b e r İb ra ­ him aracılığıyla uzman olanların bilgi sahibi oldukları M u se­ vi. h e r bir inançtaki Tanrı’nın aslında aynı Tanrı o lduğunu o rtay a k o ­ yar. “bu okulların liderleri. Yaşamdan sorumlu elem entler ile eski İbrani ve A rap dil­ leri arasındaki doğrudan bağın keşfi (bkz. (26) Bu yazm ın geri k ala­ nında sık sık başvurulacak olan işte bu versiyondur. her din kainatımızı o T ann’nın arzu do lu v e k a s­ ti davranışı olarak tarif eder.Tanrı ’nm Şifresi süreç. Bu v ersiyon' Sepher Yetzirah: The Book of Creation kitabı ile so n u ç la n a n muazzam bir çabanın temelidir.

Genetik kodun. kayıp parçaların yeri doldunılabilir ve geçmişimizin pek çok hika­ yesi ile bazen hiç beklenmedik yollarla köprü kurabiliriz. yaradılış hakkındaki bilimsek bakışımızda bü­ yük boşluklar halen mevcuttur. en eski geleneklerimizde varolmaktadır. günümüz en büyük beyinleri. BÖLÜM 3 ÖZET • Dünya nüfusunun yaklaşık %95’i farklı tariflerle. . diğer daha az bütünlük içeren hikayeleri anlamada bir çatı görevi görmektedir. isminin harflerini (kimyasal elementlerimiz) kulla­ narak kainatı. en eski geleneklerimizi modern dünya ile bağla­ yan bilgi zincirinin bir ya da daha fazla nedenden do­ layı kırılmış olduğunu kabul etmektedir. • Bilginler. Einstein’in enerji ve madde eşitle­ meleri ve m uhteşem Internet iletişiminin netliğine rağ­ men. • Bilimin ortaya çıkışıyla. Bölüm 2’de incelediğimiz evrim ve creationizm gibi bilimsel teoriler da­ hil. bu tür büyük sır­ ların yanıtlan belki de halihazırda bizim daha fark edemediğimiz bir şekilde. şu anki anlayışımızın eksik olduğunu öne sürmüşler­ dir. Her ne kadar Sepher Yetzirah bu ilişkileri anlatan tek me­ tin değilse de. bu güçlü hikayeden azar azar toplanan anlayışlar. daha yüksek bir gücün ya da Yüce Varlığın varlığına inan­ maktadır. Tanrı’nın aslını genetik kodlarımızın temelinde kullanmaktayız. kasti düzeltmeler ve doğal süreçler yüzün­ den. Bu anlayış sayesinde. dünyayı ve bedenlerimizi yaratmada Tanrı’nın asıl hikayesi olarak görülebilir. Bu tür görüşler sayesinde.Cregg Braden Yetzirah. e Yaşamı. Bütünlüğünde. yaradılışı ve kainatı açıklamak için bilimin muazzam çabalarını kabul ederken. en bütünlük arz edenidir. Bu sayının yansından fazlası bu gücü “Tan­ rı” olarak adlandırmaktadır.

dünyayı ve bedenlerimizi yaratm ada T an n ’n ın asıl hikayesi olduğunu öne sürmektedir. • İbrani harflerle yaşamın elementleri arasındaki doğru­ dan bir bağın keşfi. yüzyıldaki keşifler (yazı ve kütüphaneler) yaklaşık 2000 yıldır genel okuyuculuktan saklanm ış olan bilgiyi açığa çıkarmıştır. . en mistik ve en tartışılan boyutu olan eski Sepher Yetzirah. is­ minin harflerini (kimyasal elem entlerim iz) kullanarak kainatı. bugün eski Sepher Yetzirah’ın.Tanrı ’nm Şifresi e Ölü Deniz Yazmaları ve Nag Ham m adi K ütüphanesi gibi 20. • Kabala’nın en eski. bilginler tarafından yaradı­ lış sürecini soyut terimlerle ve mecazi bir biçim de ge­ leneksel olarak an latan bir koleksiyon olarak görül­ müştür.

BÖLÜM Keşif Bütün Yaşam Tanrı ’nın Adındandır .

." — TORA " Sizi to zd a n y a ra ttık ..." — KURAN .“ Tanrı İnsana y e r y ü z ü n ü n to zu n d a n şekil verdi ..

“Cennetin Bilgeliği” ve yaşamın acılarına üstün gelmenin anahtarının sunulmasına ek olarak. Bu çok rastlanan bir durum olduğun­ dan. ruhani ve maddi dünya arasında köprü kurmak için sunul mu ş olduğunu öne sürer. be­ denlerimizi iyileştirme ve yaşamlarımıza huzuru getirme gü­ cü bizlere verilmiştir. Bu bilgi sayesinde. Gücün bir kutsama ya da bir lanet haline gelip gelmeyeceği bilgi­ nin varislerine bağlıydı. o zaman . Bir medeniyet olarak odunla yanan ocaklardan mikrodal­ ga fırınlara uzanan ilerleyişimizin bir yerinde bir şeyleri ge­ ride bırakmış olabilir miyiz? Varoluşumuzun en büyük tehli­ kelerinden kurtulmanın ipuçları geçmişimizin en eski kayıt­ larına gömülü kalmış olabilir mi? Eğer öyleyse. Cennet ve Yer­ yüzü arasında köprü kurma yetisinin aynı zamanda insanlı­ ğın ulaşmak için çok büyük çaba sarf etmiş olduğu her şe­ yi yok etme gücünü d e elinde tuttuğuna inandılar.-4 - ^ K A İN A T I Y A P A N B a ş k a B ir Z a m a n ın S ö z le r in d e ^ e p h e r Yetzirah gibi gizemli metinlerde teyit edilmiş S o la n eski gelenekler Yaratıcımızın kimliğinin ve bilgi­ nin bize. eski bilginler bu tür sırları iki ucu keskin kılıç olarak gördüler.

Midrash ve ilk K abala’nın sözlü g e­ lenekleri Yaratan’ın meleklerine nasıl “gidin ve d ü nyanın dört bir yanından bana toz toplayın ve b en onunla insanı yaratacağım.” (2) Öte yandan.” dediğini anlatmaktadır. ayetleri daha y ak ın d an inceleyince sır perdesi aralanmaktadır. herhangi bir k işiy e . Örneğin. sonra bir topak etten. Adem ’in “toz" olarak b a ş ­ lamasının ardından. “t o ­ zun” nasıl ete dönüştüğünün detaylarını anlatarak A dem ’in geleneksel betimlemelerine eklem e yapm aktadır. K uran”ın başka bir y e ­ rinde.. yaşama benzer biçimleri gittikçe g elişe­ rek bir biçimlenme sürecinin başlam asını ortaya çıkarm ak­ tadır. Kutsal Kur’an Tanrı’nın insanlığı yaratışını doğal elem entlerle ilişkilenclirnıektedir: “Si­ zi tozdan yarattık. bizden ö n ­ ce gelmiş olanlar tarafından bırakılan mesajları anlamaktır. Bu tür hika­ yelerde dokunm uş ortak iplikler sayesinde. Batılı geleneklerde. Ortak Bir Geçmişin Paylaşılmış iplikleri \ 001 y Eski yaradılış hikayelerinin tekrarlanıp duran konuları arasında insanın köklerinin tarifi de mevcuttur. Kur’an.»(3) diy erek insanlığın doğuşunu Tanrı’nın sıvı aracılığı ile yapm ış o ld u ­ ğu bir hareketten olduğuna yormuştur. bu dünyada n a ­ sıl “var” olduğum uzun en eski hatıralarını azar azar bir ara­ ya getirebiliriz. “toz” ile başlayan Adem ’in hikayesi ilk y aşa­ mı ortaya çıkaran olaylar zincirini tarif eden çok daha g en iş bir sıralamanın parçasıdır. İlk tanımda. Betimleme tozdan “küçük bir yaşam -başlangıcı.. (1) Son derece benzer bir şekilde.Tamı ’m n Şifresi bilimin ve teknolojinin keşiflerinin yeniden ele geçirilen bu tür eski kayıtlar ile birleştirilmesi. Bu şekilde. Ayetler. çok uzun zam andan son­ ra ilk defa cennetlerin bilgeliğinin ulaşılabilecek bir y erd e ol­ masını sağlamaktadır. Şimdi yapm am ız gereken. tam ve tam o lm a ­ yan. H er ne kadar bu iki tanım birbiri ile çelişiyor gözükse de. “O’dur (Tanrı) insanı sudan yaratmış olan. ”(4) oluşmuş olduğunu anlatır. so n ra bir pıhtıdan. Benzer şekilde.

Genesis’deki ilk insanın tanımı çeviri yaparken bu tür bir hassaslığın kesin olarak kaybolduğuna başka bir örnektir. Örneğin eski Sanskrit dilinde. yaşayan sistemleri n hassas ene rjis ini anlamamı­ zı sağlamaktadır. çoğunlukla Genesis’deki yaradılış hikaye­ sine başvururuz. su ve hava. bir gelenekte anlatılan has­ sas ilişkilerin başka bir dile tercüme edil diği zaman kaybol­ duğu örnekler vardır. ya­ nıt genellikle bizlerin dünyan ile aynı ma ddel erden yapılmış olduğumuzdur . Bu tür yaklaşımları desteklemek için. iki kelimenin birbirinden bağımsız tanımının prana kelimesi ile hiçbir iliş­ kisi olmasa da.Gregg Braden yeryüzünde ilk insanın nasıl ortaya çıktığı soıulduğunda. Her ne kadar. yen i bir dilde o k el imenin tam karş ılı ğının çevirisi yapılamayabilmektedir. . İngilizce’de. İnsanı yanılgıya düşü­ recek kadar basit bir biçimde. Genesis insanın yaradılışının mucizesini son derece basit kelimelerle anl atı r: "Yüce Tanrı insanı toprağın tozundan yarattı. k endileri bile asıl fikir ile doğnıdan ilişkisi olmayan kelimel eri ku Ilanmak zom ndayız. yaşayan enerji kavramı tarihsel olarak gözden kaçırılmıştır. tek bir kelime olan prana tüm yaşamı saran ve ona nüfuz eden canlı enerji alanını ta­ rif etmektedir.mineraller. yaşayan sistemlerden bahsettiğimizi göstermek için yaşam kelimesiyle sistemin kendisinden gelen enerjik bir alanı ima etmek için güç kelimesini birleştirmek “yaşam gücü” cümlesi ile sonuçlanır. Böyle bir kavramı iletmek için. Yaklaşık iki milyar İbrani ve Hıristiyan kişi tarafından paylaşılan Adem’in hikayes i insanın başlangıcının en temel b etimlemesin i sunmaktadır. Örneğin. Prana kelimesini tamı tamına an­ latan İngilizce bir kelime yoktur. onun yerine geçen yaşam gücü cü m les i ken­ di dilimizde.” (5) F a r k lı K e l i m e l e r / A y n ı A n l a m Kültür nüanslarından dolayı. Orijinal yorum tek bir kelime ile bir fikri konıyabilirken.

simya ilmi bir d o ğ a fe lse ­ fesi olarak tarif edilebilir. k en d i za m a­ nının dilinde . A d em ’den H e'm es’e: Yasaklanmış Sırların Hikayeleri 20.köklerim izin kesin tarifi b e lk i d e en iyi kendi orijinal şeklinde saklıdır. “toprağın to zundan” yapılm ış o ld u ğ u m u z fikri. T o­ ra ’da anlatılan kilit olayların nüanslarına gölge düşm üştür. insanlık ve toprak arasındaki İn cilse 1 ilişki bizlere “to zd an ” ya p ılmı ş o la ­ rak anlatılmaktadır. Adam ve dünyamız ile çok daha doğrudan ve kişisel b ir ilişkiyi işaret eden “topra k ” ya da “y er” anlam ına da g e lın e k te dir. Bu ilişkiyi anlatan en eski gelenekler belki d e esk i sim y a ilm i­ ne ait olanlardır.Tanrı 'nm Şifresi \ ooj / Hıristiyanlığın Eski Ahit’inin ilk bölüm ü T ora’nın ilk b e ş ki­ tabından elde edilmiştir. insan kelimesi adam ah kelim esinin k ö k ü n ­ den türemiş olan “Adam” (ADM)dır. İlginçtir ki a d a m a h .bizlerin doğal elem entlerden yapılm ış ol­ duğum uzu anlatmaktadır . Bu betim lem e genel terim ler a ç ısın d a n yaygın olsa da . İngilizce tercümelerinde not ettiğimiz gibi.eski ya da Hndlsel" İbranice . Adamah’dan Adanı kelimesini türeterek. . İbrani gelenek M usa’nın bizlerin Genesis. aslında b iz le re ilk insanın yeıyüzünün elem entleri olarak varolduğu g ö ste ­ rilmektedir. insan anlayışının en tem el ilkesi olarak kalm ıştır. Aynı zam anda felsefenin m a d d e y i bir şekilde diğerine değiştirmek ya da d ö n ü ş tü rm e k için kullanmak olarak da tanımlanabilir. Exodüs.500 yıl önce. yüzyılda ınoleküler biyolojinin doğu m una k a d a r. e n basit elementten. İbranicede. in s a n ve toprağın ortak bir başlangıcı paylaşm ış olduğu b iz le re g ö s­ terilmektedir. En basit şekilde. Leviticus. Orijinal dilin bu tür hassaslıkları sayesinde. Num bers ve D euteronom y o la ­ rak bildiğimiz kitapları yaklaşık 3.aldığını sö y ­ ler. Eski İbraniceden m odern İngilizce’ye tercüm esinde. Harfi harfine yapılan bir çeviri A dam ’ın “y e r­ d en ” yapılınış bir insan ya da kişi olduğunu işaret e d iy o r olabilir.

melek insanoğlu bu “ilham veren sanatların” b ilge liğ inde ustalaştığında yasak elma nı n laneti­ nin ortadan kalkacağı ve insanın “Tanrı’nın Bahçesi”ne geri dönebileceği sözünü vermiştir. Bu öğrenim boyınca. Bu tür efsanelerden. Yaradılışına neden olan süreci anlatırken. Thoth’un sırların ın bilgeliğinin daha sonraları ayrı metin­ lerde birleştirilmiş Eınerald Tabletleri olarak bilinen 42 kita­ ba kaydedilmiş olduğu söylenmektedir. tapınak duvarlarında ve papinıs metinlerinde başı uzun gagalı bir balıkçık. Yazı. İbrani gelenek bir meleğ in Adem’i Cennetin girişinde karşıla dığını ve ona Kabala ve elementlerin gizemlerini öğrettiğini anla­ tır. Zamanının diğer medeniyetleri yanında Mısır’ı pek çok konuda ileri gi­ dişi. İkincisi as­ troloji olarak bilinen göksel varlıklar üzerine çalışmadır. (6) Her ne kadar. Cennet ve Dünya’nın simyasal sırlarının ilk ola­ rak ortaya çıkışının türümüzün ilk üyesi Adem olduğunu öne sürer. . Homeopatik tıp gibi bir dizi simyasal gelenek bugün de varolan “düşündüğün gibi olına” ve “y ık an d a gi­ bi aşağısı da” ilkelerini temel almıştır. Thoth’un simyasal il­ kelerin Yunan ustası Hermes Trismegistus'a (üç kes doğmuş olan anlamındadır) dönüşmesiyle simyasal gelenekler de­ vam etmiştir. bedeni ise bir insan olarak çizilen Thoth’un bilgeliğine atfedilmiştir. simya biliminin insan tarihinde bili­ nen en eski iki bilimden biri olduğu söylenebilir. kanun ve tıbbı eski Mısırlılarla tanıştırmakla kalmamış doğanın simyasal sırların ı da anlatmıştır. (7) eski bilimin başlangıçları Tehuti ve Djehuti isimleri ile de bil inen efsanevi Mısır figü­ rü Thoth’dan geldiği düşüncesi genel bir kanıdır. Her ikisinin de insanlığı tarihimizin başında gerçekleşmiş oldu­ ğu bize söylenen ‘‘düşüşten” kurtarmanın ilahi anahtarları olduklarına inanılmıştır.Grer-eg B a d e n Efsane. (8) Mısır’ın bilgisi Yunanlılar tarafından asimle edilince. simya biliminin çok daha geleneksel form­ ları halen netleşmemişse de.

yü zyılı n son yıllarına rastlam aktadır.Tartrt:nm Şifresi İlk Bilim in Eski K ayıtlan En temel düzeyde. Net olarak. fizik v e as­ tronomi dahil tüın bilimler eksiktir. h e r biri çalışmanın fiziksel boyutlarına odaklıydılar . d ah a g ü ç­ lü. Simya kendi neslinden olan kim yaya d ö n ü şürken.m odern kimya —çalışm am ıza son d e re ­ ce benzemektedir. Her ne kadar bilim halen varo lan m ad ­ denin değişen formlarını değiştirm ede . “g ö rü n m e y e n ” alan ­ larının etkilerini tanıyarak. b u ­ gün olayın gelişimiyle ortaya çıkmış olan kim ya. Yakın zam an a kadar.etkin olduğunu ispatlamışsa da. tarihin k aran lık za­ manlarından orta çağa ait bir şato n u n d erin lik lerin e gizlen­ miş penceresiz ve soğuk bir odada. eski simyanın felsefesi g ü n ü m ü z y e r­ yüzü elementlerini yeni ve kulianışlık ürünlerle değiştirm e ya da birleştirme . k u a n tu ın fiziği gi­ bi. hafif metaller üretm ek için elem entleri birleştirm ek gibi . g ö rü n e m e y en ele m e n tle ­ rin niteliklerini ciddi olarak önem sem eye ba şla m a sı sad e ce 20.ve yıldızların d o ğ u m u n d an ve atom ların h a ­ reketlerinden sorumlu olan enerji alanlarını ço ğ u n lu k la g ö r­ mezden geliyorlardı.ö rn e ğ in . son keşifler simya dil inde özgün bir biçim de anla tıl an hassas ilişkilerin m odern çevirilerde kaybedilm iş o ld u ğ u n u öne sürmektedir. Ateş. kim yacıların bilgisi e n eski doğa anlayışımız ile m odern bilim arasında bir b a ğ görevini görmektedir. ancak şimdi ya ra dil ışın elem entlerinin birbiri ile ilgili d o ­ ğasını ve böylesine derin köklü ilişkilerin yaşam larım ızdaki anlamım kabul etm eye başlamıştır. etrafı k u m m u ş hayvan parçaları ve içlerinde gizemli sıvıların k a y n a m a k ta o lduğu cam kaplarla çevrili bir şekilde çalışan u z u n sakallı bir . m odern bilim . Hava ve Suyun Sim yası Simya keliınesi bazı insanların aklına. Simya ve astroloji’nin perspektifinden b ak ıld ığ ın d a.“görebildi­ ğimiz” şeylere .

dünyamızın ve onun içindeki her şeyin üç basit element tarafından yapılmış olduğunu ifade eden tek bir doktrin ile başlamıştır. Babilliler ve Keldanililer kadar Doğu. Elementle­ rin trilojisini yaradılışı anlatmak için kullanıyorlardı: “Ateş” tipik olarak vermeye eşdeğerdi. Bugün. Eğer simyanın Ateş. . kendi zamanlarında bile eski olan bilgeliği korumak ve iletmek için ellerinden geleni yaptılar. Kutsal geleneklerin öğrencileri tarafından çok iyi bilinen bu ele­ mentler Ateş. simyasal çalışmaların temeli. polarite ve den­ genin aşırı uçlarını göstermeleriyle tanınıyorlardı. Roma ve Yunanlılar tara­ fından da bilindiğini öğrenmiş bulunuyonız. Hava ve Su. Kil tabletler ve tapınak duvarlarından büyük bir titizlikle hazırlanmış elyazmaları ve sözel geleneklere kadar. “Su” Şekil 4:1: “Pozitif"-. Hava ve Su’dur.Gregg Bıctden büyücü imgesi gelir. Bu bilgiyi tarif edecek bilim­ sel bir dilden yoksun olan simya bilginleri taşıdıkları. eski formüller bugün hangi sırları açığa çıkarırlardı acaba? Bir Trilojinin Yaratthşt Simyasal çağın dilinde Ateş. tarihin en eski ve en oturmuş gelenekleri arasında doğanın ürünlerini birleştirecek yararlı yolları anlatan kayıtlar buluyoruz. ya da "erkek” ifadeye. Böyle bir imge genellikle m odern sinemamn ve romanların simyacıları resmetme şekillerinden kaynaklanmaktadır. simyanın esaslarının Finikeliler. “negatif' ve “denge”yi değişik dünya göjüşleri ile tanımlayan örnek­ ler. Hava ve Su’ya dair en basit fikirlerini m odern kimyadaki denklerine “tercüme” edebilseydik. Genelde.

y a d a “çocuk”. v e “H ava” araların­ daki tüm önemli nötral dengeydi. G ü n eşin M eleği. negatif ve n ö tral) trilojisini taşımaya de­ vam etmektedir. köklerimizin en iyi şekilde anl a ta n h ik a y e le r ile olan ben­ zerlik inkar edilem ez boyuttadır. “negatif" ç e k e n . ve “nötral”in merkezi (bkz.1) Buna Hıristiyan geleneğinin B ab a/O ğ u l/K u tsal Ruh’u. yüzyıl fiziğinin esası olan pro­ ton. Pek çok gelenek bu üç özelliğin bir esasını p a y la şır: “pozitif”. G ö k y ü z ü v e aradaki yaratık­ ları (şema And Dağları yerlilerinin g e len e k le rin i gösteriyor) temsil eden hayvanları ve 20. sıvı. her ne k a d a r ü ç el em e nt tanım lan­ mışsa da. ya da “dişi” ifadeye. gizli e le m e n tin varlığını ima ederler. öne süren. elektronlar v e n ö tro n la r ile ilişkilendirilen ni­ teliklerin (pozitif. Aşağı Şekil 4.ilet­ meye giriştiği çok güçlü bir ö ğ re tin in olasılığına izin verir­ sek. geçmişin hayali parçalarını çabucak eski y e rin e k o y an “ihtimal bulut­ ları” protonlar. e sk i E sseneler yaradılışın dört gücünü “m elekler” olarak tarif e tm işle r ve onları şöyle isimlendirmişlerdir: R üzgar’ın M eleği. Su­ yun Meleği ve Toprağın M eleği.ki buna biz ve g elecek teki in s a n la r da dahildir . ya da yansıtan. . Bu tür dünya görüşlerinin d etay ları h er ne kadar gözle görülür derecede eski ve dilbilgisi a ç ısın d a n dem ode ise de. dünyam ızın doğal d ü z e n in i anlam ış olanlar her zaman dördüncü bir elem entin. Kı­ zılderili kültüründeki Y e ^ ü z ü . bize ne söylemiş olabilirler? B ilim ad a m ı atalarımız bizlere basitçe bedenlerim izi ve g ö rd ü ğ ü m ü z her şeyi ısı. S im yacılar dört elem entin nasıl türediğini anlam anın yaradılışı. elektron ve nötronu da içerm ek ted ir. y a şa m ı ve ölüm süzlüğü anlamanın anahtarı olduğuna in an m ışla rd ı. d a h a so n rak i simyasal ge­ leneklerde açıkça ifade ed ilm ek ted ir. E ğ er atalarım ızın torunları­ na .V 90_y Tanrı ’m n Şifresi almaya eşdeğerdi. İlk betim lem elerde. Kuantum fiziği alanından son zam anlarda yap il a n k eşifler her ne kadar atom hakkındaki fikirlerimizi d eğ iştirm ek tey se de. ya d a alan. Kayıp elem ent “T oprak". Hıristiyanlık öncesi Ölü D eniz Yazmalarının katipleri.

anlatmakta olduklarını öne sür­ mektedir.asıl kimya . “ilk bilimin” detayları gelenekle doğrudan ilişkisi olmayanlar dışında herkes için saklıdır. Öte yandan. Günümüz bilimsel anaiızlerin gözünden bakıldığında. Mistik Kabala Bilimi Açık olması için. Sepher Yetzirah'ın bütününde cümleler simyasalsa ben­ zer referanslarla bağlanmış görünmektedir. Bu tür bilginin çoğu zaman insanların hayatlarına mal olduğu bir dönem de ‘'en eski bilim”in gizlerini korumak için. o zaman en yetkin yaklaşımlarımızın anahtarı zaten henüz fark etme­ diğimiz bir şekilde mevcut demektir. geleneksel simyadan yaklaşık 2000 yıl önce gelen simyanı n çok daha eski şekli yaradılışın köklerinin ve Yaratıcımız ile olan ilişkimizin belki de en eksiksiz kaydını sunmaktadır. Her ne kadar geleneksel simyanın giz­ leri çok iyi belgelenmiş ve kolayca bulunabilir olsa da. ilk Su. çoğu zaman bilimin ortaçağa özgü şek­ li olarak görülen simyayı anlatmak için geleneksel simya te­ rimini kullanacağız. Ateş.Gregg Emden hava ve minerallerin mi oluşturduğunu anlatıyorlardı? Yok­ sa Ç0k daha kusursuz bir şeyi mi bizimle paylaşmışlardı? Bu bölümün geri kalanından ve bundan sonraki iki bölüm de ortaya konulan kanıt. Ateş ve Hava formüllerinin şaşırtıcı bir şekilde doğru ol­ duğu görülür! Eğer m odern bilim ve eski bilgelik arasında­ ki farklılığın sadece dilde olduğunu varsayarsak. al­ tında yatan ilkelerin açıklığı çok daha azdır. geleneksel simya­ nın özünü oluşturan sembollerin anlamı Orta Çağ boyunca gizlilik içinde saklanmıştır. gücünün yanlış kul­ lanımını engellemek için. Bu. es­ ki simyacıların yeryüzünün ve hücrelerimizin kusursuz bir oluşumunu . Bugün bile. Hava ve . onların zamanındaki kelimelerde. İbrani Harflerin mükemmel bileşimini kul­ lanarak kainatı betimleyen Kabala’nın bir parçasıdır: Sepher Yetzirah.

bu es-' ki betimlemelerin içinde. yapılmış olduğuna işaret etmektedir.ve hücrelerimizdeki mesajı çözm ek için ilk a n a h ­ tarı .doğrudan bir bağlantı görmekteyiz. Şaşırtıcıdır ki. K abala’nın öğretileri günlük yaşam bağl amında alarn ve ilişki su narlar. Bu hassas dünyalar a s­ lında kuantum fiziğinin gözlemlerini açıklam ak için kullanıl­ maktadır! Sefirotlar tipik birer küre olarak tanım lanırlar ve Hayat Ağacı’nın bilinen modelini oluşturacak şekilde dizil­ mişlerdir (bkz. . Burada. bizleri de o yaradılışın içine dahil eder.on b o y u ttan —.İbrani harfler olarak tanım ­ lanmışlardır. yaradılışın güçleri arasındaki ilişkiyi belirten on dünyanın ya da Sefirotun bir tanım ı ile başlar.T aun 'mn Şifresi Suyun birbirini ilk etkileyişini anlatan ayetler .2). Bu ağaçtan.zam anın b aş­ lamasından önce bir zamanda . Cennet ve Yeıyüzü arasındaki birliği resm ed e­ rek. geleneksel simyadaki doğanın il­ kele rine . yaradılış hakkındaki en son teoriler' d e kainatın enerjinin en az on etki alanından . H ayat Ağacı: K ainatın Ozaliti Sepher Yetzirah’ın hikayesi. Şekil 4.

(9) .Gregg Emden Şekil 4.2: Bu dünyanın özelliklerini on Sefirot olarak gösteren eski İbrani Hayat Ağacı (Ha!evi’den sonra).

Kabala’nın esası olan bilgeliği v u rg u la m a k gerekir. Nefes ve S u y a y ılır. tek bir genel d u ru m onların. ikinci ve üçüncü Sefirotlar Binah ve I-Iokhm ah Anla­ yış ve Bilgelik ilkeleri ile örnekse n irke n . İpucu. E lem entleri ta­ nımlayan aynı cüm lede. Tanrı ’nın kainatı ya ratm ak için kullandı­ ğı ilk üç harftedir. ki onlardan Ateş. boşanm a. ki onlardan her şey y a ra tılm ıştır. Halevi’nin (11) kelimeleriyle. Üç Esas h em en yara d ılış ın b ilin e n sim ya­ sal elementlerine bağlanır: Ateş. “Ağaçta a ç ık la n a n ilişki tüm varo­ luşun temelidir. hastalık v e sağ lık n e d e n le ­ rinden yaradılışın fiziğine k adar sayısız k o n u y a d e ği nm ektedir. Ö r­ neğin . H ava v e Su. M em (M) v e Shin (Sh).T an n’nm Şifresi x ) Her Sefirot Tann’nın kainatı yarattığı ve b izim yaşam ları­ mızda amaç edinebileceğimiz belli bir sıfatı tem sil eder. Her ne kadar alfabenin geri kalan 19 h arfin e h er biri kendi gücü ve önemi aşılanmış olsa da. İbrani harfler tarafından tem s il e d ile n e le m e n tle ri kulla­ narak tanımlanan Başlangıç v e B aşlan g ıçtan ö n c e k i zam an aracılığıyla üç Esas Harfin gizem inde bir a n la m bu lu ru z. b u k ita p b u ü ç h a r­ fe ve onların yaradılıştaki çok özel yerlerine odaklanacaktır. . Esas­ lar ve Esas Harfler olarak bilinir: Alef (A).” Hayat Ağacı ile su n u la n k a v ra m la r öylesi­ ne geniştir ki evlilik. (1 0 ) A.M ve Sh yüce. A. Şüphesizdir ki. yazı sade ve sad ece b u h a rfle r aracılığıyla yaradılışın gizeminin köklerine doğru iz sü rü leb ileceğ in i ifade etmektedir. İbrani alfabesinde b u n la r T em eller. g izle n m iş v e m is tik sırlardır. M ve Sh’nin ve bir önceki ifad en in içeriğ in i anlam ak için. d ö rd ü n c ü v e beşin­ ci Sefirotlar Gevurah ve H esed Ya rgıl a ma v e M erh am et nite­ liklerini temsil ederler. Yazının ikinci bölümü Hayat Ağacı’nın m istik doğası ile dünyamızdaki çok daha som ut bir şey a rasın d a ilk n e t bağ­ lantıyı kurar.kainat ve kainatın üstü ile olan ilişkilerini netleştirir: Üç Temeller.

Gregg Brcıden Sepher Yetzirah Hayat Ağacını dikkat çekecek kadar az sayıda cümle ile yaradılışın bir mecazı olarak kullanır ve ilk Sefirotun “Yaşayan Tanrı’nm Nefesi”ni temsil ettiğini söyler. Onunla Tanrı Zaferin Tahtını ve yu­ karıdaki tüm kalabalığı kazıdı ve oydu. (15) Bu ilk betimlemelerden sonra. Nefesin ve konuşmanın sesidir. Dört: Sudan Ateş. Hiçliğin On Sefirotu: Bir Yaşayan Tanrı’nı. yazı Esas Harfler ve ele/riientler arasındaki ilişki hakkında biraz şüphe bırakan belli •bir netlikte devam eder: “Üç Esas.. M ve Sh. dı. Ve bu Kut­ sal Nefestir. Onunla Tanrı Cennetin dört yönü­ nü (nefesini) kazıdı ve oydu: doğu. her ifade dünyaya ge­ tirdiği elementi detaylandırır.i çamuru kazıdı ve oydu . güney. kil ve .n Nefesidir. üzerlerine (harfler) su serpti : ve toza dönüştü. Böylece yazılyu. kuzey. ■ Ve her birinde bir nefes oldu. Su ve A teş’tir.. (14) :■0 4.. Kabalistler geleneksel olarak bunu yaradılış anının. İki: Nefesten Nefes. ilk nefe­ sin ya da ilk ışığın ve aynı zamanda da tüm diğerlerinin on­ dan şekillendiği asıl maddenin bir betimlemesi olarak yo­ rumlarlar. A. Kutsanmış ve takdis edilmiş olan Dünyaların Yaşamı­ nın ismidir. batı. Üç: Nefesten Su. tıpkı yazıldığı gibi. " (16) . (12) 2. O Meleklerini nefeslerden ve bakanlarını yanan t yu ateşten yaptı. okuyucu kainatı oluşturan ele­ mentleri elde eden simyasal bir yolculuğa çıkartılır. 0 3 ) 3. Aşağıda­ ki ilk dört Sefirotun tanımlamasında. 1. Kainatta Hava. Başlangıcı takiben. Onunla Tanrı kaos ve boşluğu.

A.Tayın ’nm Şifresi Ateş. taşlarının yerleşmiş olduğunu ve kainatım ızın m u c iz e s i için onları kullanmaya devam edilebileceğini ifade e d e r. le bildiklerini iletme y e te n e k le rin i isp at etm ektedir.... ve Rüzgarın Meleğine . O S h in ’i a teşin kra lı y a p tı . Hava ve Su nitelikleri y e rleştikten sonra. ‘‘Sözel sim ya”n ın bir şekli ... B ile b ild ik leri tü m kelim elerle kainatın oluşumunu tarif etm işlerdi! Yaradılışın ilk h a re k e tle rin i anl a ta n b u tanım O rta Çağda-.. rıca olağanüstü bir şekilde. nırlannı ve yaradılışın k u ra la rım tanım lar.: ğanın elem entlerinin basit b ire r Se m b o lü n d e n d a h a fazla şey . meleklerinin yaradılışı ile d e y a k ın bir paralellik içindedfa Burada “Tanrı’nın N e fe si” Hava. Üç Esasın Ortaya Çıkışı f Yukarıda gösterilen pasajları takiben. ifade ettiğini anlam ış oluyoruz.. Hayat Ağacı T anrı’nın k a in a tın ın sı. Esas Harf ile fiziksel yaşam ım ızda ki m o d ern e le m e n tle ri ve . o\ I y “O A le f h a rfin i N efesin kra lı y a p tı (17) ••. yaşamın mucizesini birbiri ne b ağ lay a n bir ipucu ile karşıla-< şırız.... dilin yokluğunda... ce yaşamış olan E ssen ler ta ra fın d a n betim lenen d o ganın. y a zı yapı V.. duğunu gösterm ektedir. G eri ■ kalan Sefirot aracılığıyla.:.. . Bilimsel.. O M e m ’i s u y u n kra lı y a p tı (18). bilgisinin nasıl kainatın g ü çlerin i an lam ad a birer a n a h ta r ol. yazıyı yazanlar tarafından b ilin e n bilginin derinliğini ve ay. eskiler s a n k i ç o k d ah a eski am a h e n üz ta­ nımlanmamış bir k a y n a k ta n m iras k alan bilgeliği iletrniş gi­ bi görünm ektedirler.. B u rad a d a üç . b u g ü n bile anlam lı k alan bir dü-. ki geleneksel simya k a d a r İsa ’n m d o ğ u m u ndan 500 yıl ön-. aracılığıyla ifade edilen ay etler b izl e re h er bir h arftek i gücün.” (19) Zaman ve çeviri e n g e lle rin e d ay a n an bu ta n ım la rla r.... M ve S h’n m do-.

“Sudan Ateş" Ateş ve Güneşin Meleği­ ne dönüşmüştür.bu üstünlüğe mükemmel bir örnektir.Grereg Braden dönüşmüştür. dua alan kişilerin bulunduğu gnıp iyileşme ve sa ğlıklafina kavuşmada istatistiki olarak ölçülebilecek kadar yarar . Bununla birlikte. yaşamlarını tehdit eden kalp sorunlarına s ahip 990 hasta. simyacılar ve Büyücüler dünyamızın neden böyle çalıştığını anlamaya çok cjaha az. öncelikle doğal süreçlerin neden çalıştığını ahlamak gerekliydi. Bu ilişkileri göz önüne aldığımızda karşıfulZa 'şu som çıkar: Yaradılışın bu esasi harflerini m odern biİirhin' kimyasına ne bağlamaktadır? “Neden”den “Nasıl”a Günümüz teknolojisinin büyük bölümü tarihsel olarak doğaya bırakılmış olan süreçleri değiştirmeye dayalıdır. Do­ ğayı düzeltmeye kalkışmadıkları için. İyileştirmeyi arttırmak için söylenen duanın gücü . “Nefesten Su" Su elementine ^dSüynn Meleğine. Kansas. City’deki Mid America Heart Institute’de yapılan pilot araştırmada. kendi tıbbi işlemlerine ve muayenelerine başla­ madan önce iki gruba ayrılır. aileleri. ama doğanın zamanla değerlenen ilkelerini yaşam­ larına nasıl uygulayacaklarına daha fazla ilgi gösterd il e r. (21) Bir grup beş gönüllü ta­ rafından gün aşırı dua tedavisi görürken diğer gruba bu uy­ gulanmadı..mo­ dern bilimin ve Batı tıbbının daha yeni yeni araştırmaya baş­ ladığı bir olgu . ( ^Testleri yürüten araştırmacıların çok şaşırdığı bir sonuç çıktı. köyleri ve top­ lumlar! ondan yarar sağlayabilsin diye doğayı inceden inceye'ıncelemeye çok az ihtiyaç duyuyorlardı. Ha­ va ka hplarını etkilemek ve maddenin yeni biçimlerini yarat­ maktan ürünlerin ve hastalığın genetik mühendisliğine kad a f bu mucizevi gibi görünen 'teknolojilerin her birinin tasafil1İanması için. bu tür bir bilgiye çok az ihtiyaç vardı. Benzer şekilde. Eski şifacılar. atalarımızın bakış açısına göre.

S u yu ve Ateşi y e n id e n D ü şü n m e k \ co j ız 2°. 1957 T em m u z’u n d an 1958 Aralık’ına kadar süren 18 ayhk bir d ö n eın boyunca. Bilim Eski Modeli Onaylıyor: Havayı. n e d e n diye sorm uyorl ar. . O nlar zaten duanın gücünü k ab u l etm e ve bu gücü başkaları ile paylaşm a k o n u su n d a rahatlar. Bilgisayarlann ve bilgin in depolanm asının gel işm esi ile.Tamı ’nm Şifresi görmüşlerdi. Y e ^ u z ü n ü n bileşimini ve doğal sürecini b elg e lem ek ü ze re bir proje birliğine katıldılar.etm ektedir. bedenlerim izi ve dünyam ızı açıklayan toplan­ m ış bilgilerden biri olan bilime odaklanm ayı vermiştir. hayatlarının her günü dua eden pek çok kişi için b u n u n pek de g erekli olmadığı hissedilebilir. tek bir nesilde eşi görülm em iş sayıda bilgiyi topladık ve depoladık.lar daha başarılı o ld u /’ diye rapor ettiler.sta. Son on yıl içinde (1987-1997) m sa n tarihinin tü m ü n d en çok daha fazla çok daha fazla biÜm sel bilgi edinilm iştir. Araştırma ilginçti am a öte yand a n . “İnsan bilgisi h e r 10 yıl­ da bir ikiye katlanm aktadır. Projeyi yürüten araştırmacılar. M khm Kaku yetenekleri bir araya getiren bilgiınizin ina­ nılm az hızını şöyle tarif. Zira duala­ rının işe yaradığını za ten biliyorlar. “D u a etm iş olan ha. Dr. yüzyılın sonlarına kadar. bugünün Yeryüzü hakkın d aki eşi görülm em iş bilgisinin. (22) Bu çalış­ m anın halka tanıtılan sonuçları ulusal g az etelerd e m anşete taşındı ve dua ed en gru b u n n ed en böylesine başarı gösterdi­ ğini kesin olarak anla m a çabasıyla G eorgetow n Üniversitesi Tıp Merkezi ve H arvard Üniversitesi ek çalışm alara başladı. keşifler bizlere doğayı idare etm e g ücü n ü . (24) koniktir ki. .”(23) Tarih. işe bu m o d e rn bilgi bugün eski simyanın ilkeleri ile za­ m anım ızın en karm aşık bilimi arasında köprü kurmamıza izin verm ektedir. 67 ulus o zamana kadar görülınemiş bir şekilde. Uluslararası Jeofizik Yılı (IGY) olan so n yüzyılın en geniş elbirliğiyle yapılan araştır­ m a ça b ası ile başlam ış olduğunu ortaya çıkarabilir.

Gezegenimizin üçte ikisini kaplayan su kimyasal olarak çok iyi bilinen H 20 formülü ile tanımlanır. havayı dengede tutmak için oksi­ jen ile birleşen bir başka element İle doludur. bel­ ki de Suyun başka bir fiziksel elementi tanımlayan bir kod olduğu sonucuna varabiliriz. karbondioksit. 1GY döneminde atmosferimiz üzerine yapılan çalışma durum un böyle olmadığını ortaya çıkarmıştır.Gregg Braden Hski simyasal metinlerde. ve bazı başka elementler havamızı oluş­ turan diğer elementlerdir). göllerde. eski simya ile m odern kimya arasında ilişki kurmak bizi oksijenin simyasal Hava’ya c!enk olduğuna inanmaya götürmektedir. Daha sonra yapılan yorumlar Öriün metinlerin aldığımız havayı kastettiğini varsaymıştır. Öte yandan. Her ne kadar oksijen yaşamamız için havada ihtiyacımız olan en Önemli element­ se de. ırmak­ larda ve nehirlerde. Bu durumda. (25) içimizde çektiğimiz her bir nefesimizin en önemli kısmı nitrojendir! : Eski simyacılar kendi zamanlarının diliyle Havayı yaradı­ lışın en önemli elementi olarak belirttiklerinde. Aynı tarz bir muhake­ meyi simyasal Ateş. Modern bilim aslında atmosferimizin bedenimizdeki her bir hücreye hayat veren görünmez elementle bizi beslediğini Göstermektedir: oksijen. acaba kas­ tettikleri madde nitrojen olabilir miydi? Bu tartışmanın ama­ cı gereği. Havayı nitrojen için bir kelime kodu olarak gören varsayımı bu duruma da uyguladığımızda. Su ve Toprak için m odern elementlere de uygulayabiliriz. bunun doğru olduğunu farz edeceğiz ve bunun bizi nereye götüreceğine bakacağız. En basit deyişle. gökyözündeki yağmurda ve bedenleri­ mizdeki suda her iki hidrojen atomu için bir oksijen atomu bulunduğunu anlatır. bu formül bize yeryüzündeki okyanuslarda. . nefes aldığımız havada bu değerli m addeden nispe­ ten çok küçük bir oranda bulunmaktadır! Atmosferimizin %78’i. IGY çalışma­ ları atmosferimizdeki oksijen oranının %21 olduğunu (ar­ gon. Hava elementi hiçbir zaman net olarak tanımlanmamıştır.

(27) Şekil 4. köm ür ve di­ ğer yanabilir ürünleri tüketen ateşler. Sıcak bir yaz günü hissettiğimiz ısı çoğunlukla güneşin çekirdeğinde yanan inanılmaz büyüklükteki ısı dereceleri yüzündendir (27 milyon°C kadar olduğu tahmin edilmekte­ dir!) Bilim. Dünyamızın yaklaşık üçte ikisini kaplayan suyun yak­ laşık %85. Bu. teknolojideki ilerlemeler. 20.) Tartışmamızın amacı­ na yönelik olarak. tarih boyunca ku llanılmış olan odun. güneş sistemimizin m erkezindeki ateşten kütle­ nin bileşimi olan elementleri detaylı olarak analiz etmemizi mümkün kılmıştır.8’i oksijenden yapılmıştır (saf suda aşağı yukarı %88. su için söylenen eski sözlerin oksijen ele­ menti için bir kod olduğunu varsayalım. Yakın zamanlarda ya­ pılan çalışmalar iki ana elem entin güneşin ateşinin yakıtı ol­ duğunu teyit etmiştir. gö­ rünmeyen oksijen elem entinin suya hakim olduğunu işaret eder. NASA çalışmaları. yaklaşık %71 hidrojen ve % 27.1 h ely ım ’dur. oksijen atomları çok daha büyüktür ve bu nedenle de. Ateş için söz konusu olan simya sa l konuların tüm ateşle­ rin asıl kaynağı olan enerjiyi temsil ettiğine inanılırdı: güneş. (Her ne kadar formül her bir oksijen ato­ mu için iki hidrojen atomu olduğunu ifade etse de. m uhtem elen sadece güneş enerjisinin içlerinden yayılıyor olmasından dolayı va­ rolmaktadırlar. yüzyılın ikinci yarısında.Tanrı 'nın Şifresi Yüzdelik oranlar temel alındığında.89) ve geri kalan yüzde hidrojen ve_ diğer mineralleri oluşturmaktadır.bütünün çok daha büyük bölümün ü teşkil ederler. sınır­ lı gaz stoklarını tükenene kadar yakan uçsuz bucaksız bir göksel lokomotif olarak görmektedir.3: Yaradılışın eski elementlerinin modern çevirimleri . Sonuçta. dünyamıza en yakın yıldız olan bu yıldızı.

3). Bundan çok daha büyük bir keşif ise bu dört elementten ikisinin . artık Ateş. Bedenlerimizde. bugün okyanusların altın­ daki katmanlar dahil. Kabala ile m odern bilim arasında bir kesişim elde edebiliriz. hidrojen ve alüminyum bu katmanın %90’dan çoğunu oluşturmaktadır. bedenlerimizin eski tanımları ile m odern kimyada­ ki denkleri arasında doğrudan bir bağ kurarak. Artık.bedenlerimizin %99’undan fazlasını oluşturmasıdır! Sadece bu.Brcalen Simyanın elementlerine uygulanan mantığı takip ederek.hidrojen ve oksi­ jen . Su ve Hava hak­ kında söylenenleri. Geri kalan elementlerden silikon kimyasal yapımızda önemli bir parça olmasına rağmen bedenimizde çok az bir miktar bulunması onun “kalıntı” element olarak tanımlan­ masına neden olmaktadır. “Farklı Kelimeler/Aynı Anlam”. sayfa 87). Eğer bu karşılıklı ilişki doğru ise. onu her ne kadar endüstri ve hava kirliliğinin bir yan ürünü olarak bazı zamanlarda soluyor olsak da. Bu keşiflerden yola çıktığımızda. m odern bilim tarafından bilinen kimya­ sal elementlere tercüme etmek mümkün hale gelmektedir (bkz. çalışmalar bile. Ateş’e atfedilen eski referansların da aslında ateşin kaynağı­ nı oluşturan elem ente atfedildiğini farz edebiliriz: hidrojen. İlginçtir ki alüminyum. yeryüzünün en üst kabuğunun büyük bölümünü oluşturan bir kaç elementi nispeten bilmekteyiz. Şekil 4. karbon ve nitrojen elem ent­ leri toprakta bulunan silikon ve alüminyumun yerini almak­ tadır. doğal oluşan bir elem ent olarak vücudumuzda hiç bulunmamaktadır. o zaman simyasal bilgi olarak ko­ runan hikaye ve Kabala’nın gelenekleri daha bile derin bir anlam kazanmaya başlar. IGY gibi çalışmalar sayesinde. Köklerimizin en eski ve en eksik­ siz tanımının yeniden yorumu geçmişimizin cevaplanmamış sorularına yeni ve şaşırtıcı yanıtlar getirmektedir! XlöT\ Gregreg . bizlerin gerçekten de “toprak­ tan" yapılmış olduğumuz sonucunu doğurmaktadır (bkz. oksijen. Elbette ki insan bedeni ve gezegenimizin yeryüzü katmanları arasında fark­ lılıklar vardır. Silikon.

Kitap bugün okunabilm ektedir ve ken­ di bütünlüğü içinde. sırasıyla hidrojen. Tüm yaşam aynı tozdan gelir. Hava ve Su’yun aslında bedenim izdeki en çok bulu­ nan üç elementi. Bu gelenekler içinde. . • Yaradılışımızın ve yaşamın koşullarını değiştirme yete­ neğimizin sırları (Cennet ve Yeryüzü arasındaki köp­ rü) eski simyanın saklı gelenekleri sayesinde korun­ muştur. • Yeni buluş: Modern bilim. • Kainatın ve insanoğlunun köklerinin yaradılışına reh­ berlik eden simyan ın detaylı bir hikayesi aynı zam an­ da Ya ra dılışın mistik İbrani Kitabı Sepher Yetzirah’ı da ortaya çıkarır. Su ve Hava. kainatı ve dünyamızı şekillendi­ ren daha yüksek bir gücün detaylı bir hikayesini sun­ maktadır. simyasal elem entler Ateş. anahtarlar dünyamızın ve bedenlerimizin elem entlerden yapıldığını işaret et­ mektedir: Ateş. nitrojen ve o ksijeni temsil ettiğini ortaya çıkararak eski modelleri onay­ lar.BÖLÜM 4 Ö ZET e insanın köklerinin eski hikayelerindeki ortak tema bizlerin toprağın “tozundan” ya da “kilinden” yaratıl dığımızı söyler.

. Acı çektikleri za m a n şaşıracaklar. Buldukları zam an. ” — THOMAS’IN KAYIP İNCİLİ .. acı çekecekler. 11 “Görmekte old u ğ u n uz şeyi tanıyın ve sizden gizlenm iş olanın size apaçık olacağını.“Bırakın arayanlar bulana kadar aramaya devam etsin.

A ynı zamanda. yaşam larım ızın o la y la rın ı sadece dört yazı şeklinin biri ya da bir k o m b in a s y o n u a ra ­ cılığıyla kaydettik. yazın ın k u lla n ım ı varolan ve gelecekte varolacak insanlara bilgi ile tm e k v e b u bilgiyi korumak konusunda gittikçe artan ö n e m d e b ir rol üstlenmiştir. dünyanın alfabesinin ve sonradan o rta y a ç ık a n dil lerin başlangıcı zamanımızın en b üyü k ve ç ö z ü lm e m iş g i­ zemlerinden biri olarak ka İmaya devam e tm e k te d ir.000 yıllık tarihinde.eski alfabelerin h a rfle ri olarak saklanmış kayıtlar .- 5 - K E Ş iF : H a rfle r E le m e n tle re D ö n ü ş tü ğ ü Z am an ısan bilgisinin oranının her on yılda bir ikiye k a tla n ığı ve makinel erin atom lar boyutunda k ü ç ü ltü le b ild iğ i ^ a m a n d a .bel bağlarken b u lu y o ru z .(l) Modern insanın 40. Bu zaman boyunca. Bu formlar aşağıdaki k a te g o rile rle a ç ık ­ lanmıştır: • Resim imgeleri • Kelime işaretleri • Bireysel seslemleri temsil ed en işaretler • Tüm alfabeler . kim olduğum uzu anlam ak için k e n d im iz i 'h a la geçmişimizin en eski kayıtlarına .

Daha Derin bir Gerçeğin Sembolleri Her ne kadar eksiksiz alfabelerin kullanımı son zaman­ l ı d a gelişmiş bir iletişim şekli olsa da bu durum.Gregg Braden Semboller aracılığıyla. Daha ziyade. resim imgelerinin. Yaptığı sadec:e patlamanın olduğunu kaydetmektir. Fotoğraf olayın kendisini kaydetmiş gibi görünse de. Spektrumun karşı ucunda. New Mexico>daki Chaco Kanyonu’nda bulunan bir uçurumun altında kaydedilmiş olan bir yıldız patlaması­ nın tek bir imgesi bu kavramı resmeder. Örneğin. eski resim yazılarının altında yatan düşüncelerin bugünkü kelimelerin gerisinde olanlardan daha az karmaşık olduğu an lamına gel­ mez. aynı za'man sırasında. hayvanlar ve o zamanın yaşam koşullarına olan et­ kileri hakkında hiçbir özellik sunmamaktadır. eksiksiz alfabeler kaydedilecek. günün saati. her form tarihin belli bir zamanın­ da belirli bir insan grubunun ihtiyaçlarının tenısil edilmesi ve bu ihtiyaçlara hizmet edilmesi için değişken karmaşıklık dereceleri sağlar. zamanla daha karmaşık bir hale gene sembollerin kendisidir. resimyazılarının en basit formları genellikle kaydedilmiş olan olaya daha büyük bir anlam veren detayları sağlamadan. iletilecek ve gelecekte kullanılmak üzere saklanacak bir olayın özelliklerini verir. . Örneğin. geniş ve yüksek boyutta kavramları resmederler. Harfler ve Alfabeler: . parlaklığın derecesi ya da olayın insanlar. 1054 C. Çinli astronomlar olayı çok daha karmaşık bir alfabe dili ile belgelemişler ve böylece olayın gerçekleşÜği kesin tarih gibi özellikleri gelecek kuşaklar için saklaya­ bilmişlerdir. Öte yandan. yılında bir süpernovanın patlamasını kaydetmek için bir kumtaşı çı­ kıntısına sem bolün çizilmiş olduğuna inanılır.E. Parlak göksel gösteri tüm Kuzey Amerika’da günışığında görüldü ve bu­ gün kalıntıla rı halen Crab Nebula olarak astronomlar tarafın­ dan görülmektedir.

Her biri çok daha derin anlam boyutları içeren pek çok ek katmanları harf sembolleri ile gösterilmiştir. Öte yandan.Tcmn’m n Şifresi Detayı eski resimlerden çok daha iyi bir konumda sakla­ mak kelime işaretlerinin (logogramlar) ve hece oluşturan işaretlerin (syllabogramlar) dilidir. zamanlar ve olaylar gibi bilgi bi­ riktiren ve aktaran kelimeleri ve sözcükleri oluştururlar. Tora uzmanlan.(2) Yazılı bilgiyi kaydetm e m etodunun en kusursuzu belli sesleri temsil eden semboller grubu sayesinde olur: alfabe­ ler. Atalarımızı temsil eden pek çok dil ve al­ fabeyi yaratmak için onlara yol gösteren katalizördür. Görünüşte. Tanrı’nın hareket­ lerini kaydeden her harfin içinde o kelimelerin anlattığı mu­ cizelerin gizli anahtarının varolduğuna inanırlar. İbrani harflerinin gücü sayesinde. Bu dışsal anlamın altında. semboller bilgiyi net ve anlamlı bir şekilde koruyan kelimeler üretmek üzere birleşen semboller vardır. bilginin daha az göze çarpan katm an­ ları kelimeler arasında hassas bir ilişkiyi ortaya çıkarır. her bir dile bağlı çok yönlü anlamları da gözönüne aldığımızda daha derin bir gi­ zem ortaya çıkmaktadır. içsel olarak da ya­ radılışın sırlarının şifrelenmiş bir rehber kitabıdır. tarihler. bizlerin harf diye adlandırdığımız sembollerin iki ta­ raflı bir amaca hizmet ettiklerini açıkça onaylamaktadırlar. Uzmanlar. kelimeler aynı metnin çok daha derin anla An­ larının içindeki yollardır. Tora “Tanrı Cenneti ve Yeryüzünü yarattı. Deneyimlerimizi kaydetme ihtiyacının insana özgü bir şey olduğuna inanılır. Tora dışsal olarak tari­ hin yazılı bir belgesi olmasının yanı sıra. Bir alfab ede. geçmişimizin eski ve kullanılmayan dillerinden günüm üzün en m odern dillerine kadar.” derken “Adem” . Köklerinin tutarsızlığı ile birlikte. herhangi bir alfabe ile şekillenmiş kelimeler kaydettikleri olayın yanda deneyimin sadece bir sembolüdür. en iyisinde bile. Şifreyi an­ layanlar için. Tüm bir heceyi ya da ke­ limeyi tanımlamak için bir sembol kullanan bu yazı formla­ rının kaydettikleri olayların bilgilerinin çok daha büyük öl­ çüde saklama yetenekleri vardır. harfler. Örneğin.

” Dakikalar sonra taksiye binmiş ve müzeye doğru yola çıkmıştık. “Onların hepsi yazmaları gör­ mek için mi buradalar?” . kelimelerin daha derindeki anlamı net olarak Cennet ve Yeryüzünün nasıl yaratıl mış olduğunu anlatmak­ tadır. insan kuyruğunu gösterdim. “Yazmalar burada. verilen dilin altında yatan sembollerin anlamının çeşitli boyut ya da katmanını hesaba katmalıdır. yazarlarının asıl ilet­ mek ded ik leri mesajın gücünü ortaya çıkarabiliriz. şehirde!” diye çığlık atmıştı görüşme­ nin hemen arkasında. Ölü Deniz Yazmalarının orijinalini hiç görm e­ dim! Onları görmeyi çok isterim. “Chicago Field Müzesi'nde!” “Sahi mi?!" diye cevap vermiştim. çiseleyen ilkbahar yağ­ m urunun altında beton basamaklara yayılmıştı. Bu saklı ilişkiler üzerine çalışarak.Gregg Brcıden ve “Yeryüzü” arasında çok daha derin bir ilişkiyi ortaya çı­ karılması gibi. Ö ğlenden hemen sonra. Harfler Harflerden Daha Fazla Olduğunda: İbranicenin Saklı Şifresi Taksi müzenin önünde durduğunda. taksiyle yaklaşık 15 dakika. ulusal haberler servisinden bir yazarla. Dil üze­ rine herhangi bir ciddi çalışma. Ölü Deniz Yazmaları hakkındaki fazlasıyla u zu n süren görüşme­ mi tamamlamıştım. “Belki bir baka­ biliriz.” “Her ne kadar Mısır’da Kıpti el yazmalarını görmüş olsam ve yazmalardaki kelimeleri üzerine detaylı bir çalışına yap­ mış olsam da.” demiştim. “Müze şu anda bulun­ duğum uz yerden ne kadar uzaklıkta?” “Bu trafikte. Taksinden inip dondunıcu rüzgar yü zü müze çarptığında. insanların oluştur­ duğu kuynık çoktan d ışarıya taşmış.

bizi birbirimizden ayıran asırlar yok oldu. Orada. “ama çoğu m uhtem elen Sue ’yu görmek için buradalar. sabırsız­ lığımın ve etrafımdakilerle ilgili heyeca n ım ın arttığını hisse­ diyordum . Odaya girince. grubum uzdakilerin hayranlık d o ­ lu iç çekişlerini duydum . dolayısıyla odanın belli bir b ölüm ünün aydı nlatılıp diğer bir bölümü nün 'karartılması ürkütücü bir etki ya­ ratıyordu. Bi­ let gişesine yaklaştıkça. Parçanın önünde dururken . bilinm eyen bir yazı­ cı. Mükemm el bir şekild e o ra n ­ lanmış harflerin her birini şekillendiren siyah m ü rek k eb in lekeleri hala parşömenin üzerindeyd i. hayvan derisinin lime lime olmuş bir parçasında 2 milenyumdan daha uzun zaman önce bir başka adam ın eli ile yazılmış bir mesajın harfleri vardı! İsa 'n ın yeryüzünde d o ­ laştığı zamandan yaklaşık 200 yıl önce. Işıklardan gelen ısının zararlarını en aza indirmek için. kendi zamanı için bile eski olan bilgel iğ in sözlerini k a y ­ detmek için zaman harcıyordu.Tann’nm Şifresi “Bazıları. Her ikisi de aynı m üzedeydi ve birbirlerinden sadece bir kaç yüz metre uzaklıktaydılar.eski Book o f Enoch'un bir bölümü . kuyruğun büyük bölüm ünün Sue’nun yönüne doğru dönm üş olduğu­ nu gördük.gördüğüm şeyin çekim gücüyle tü m bedenimin bir sıcaklık dalgasıyla kaplandığını hissettim. Kırıl­ gan parçaları taşıyan her bölme farklı zamanlamalarla aydın­ latılıyordu. Ana salonun bir tarafında belli zam an aralıkla­ rıyla küçük gruplar oluştu rup yazmaları gösteriyorlardı. Son gruba katılmak için tam zamanında oradaydık! Özel olarak tasarlanmış sergiye doğru yürürken.” diye cevap verdi. diğerlerinden bağımsız bir bölme içine konm uş gri msi küçük bir p arşö m e­ nin yanına gittim. her yazma parçasını aydınlatan am pul­ ler kısa aralıklarla bir donuklaşıp tekrar parlıyorlardı. Hem en odanın ortasında bir yere. Şim ­ di yüzümden sadece bir kaç santim uzaklıkta olan harflerin . uzun zam an ö n ce o n ­ ları yazan elin hareketlerini tarn olarak gösteriyordu. şüphelerimiz doğrulandı.” Tam o gün de lakabı “Sue” olan bulunm uş en eksiksiz Tyrannosaurus rex’in kalıntıları­ nın da sergisinin açılışıydı. Bir an için.

O dönem lerde bazı harflerin anlam ve kullanımlarında değişiklikler meydana gelirken. O kısa an içinde.Gregg Braden gizemiyle. bu tür dillerin mo­ dern yorumlarında. İbrani alfabesinde böyle bir duaım söz konu­ su değildir . İbrani alfabenin güçlerinin inanılmaz kuvvetine mal edi­ len Sepher Yetzirah.belki de daha uzun süredir . binlerce yıl önce kelimeler kaydedilirken yazarın ne iletmek istediğini kesin olarak bileceğimiz konusunda kendimize güvenebiliriz. Mantıksal bir bilginin ötesinde. Mısırlıla­ rın hiyeroglif ve Sümerlerin çivi yazısı gibi binlerce yıllık di­ ğer eski yazı formları bugün artık kullanılmamaktadır. belki de bu sayısal sis­ temlerin hiçbiri eski İbranice kadar yaygın olarak belgelen­ memiş ve sıkça kullanılmamıştır. unutulmuş yazıcı zamanın sınırlarına meydan okudu. Tanrı'nın harflerin kendisinden “her şeyi .sü­ rekli olarak kullanılmaktadır. geçmişle ge­ lecek arasında İbrani harflerin gücü ile köprü kuran sembol­ leri hissedebilmişim. İbranice okumayanlar bile onun harflerinde bir tür kut­ sallık. eski bir İbrani belgedeki kelimeleri tercüme e derken.E. İbrani alfabesinin harfleri kutsal dillerle ilgili çalışmalarda eşsiz bir öneme sahiptir. dilini daha evvel anlamadiğım şe­ kilde anladım.'de yazıl­ mıştır. Bu el yazması ' aynı İncil'in m odern versiyonları ile karşılaştırıldığında m etin harfi harfine uyuşmaktadır! Dilin kullanılmış olduğu zamanın uzunluğu ve alfabesinin sabitli­ ği yüzünden. İbranice yazılmış Eski Ahit’in tamamının en eski versi­ yonlarından biri olan Leningrad Codex 1008 C. Üç bin yılı aşkın süredir. alfabenin en azın dan 1000 yıldır değişm eden kaldığını kesin olarak bilmekteyiz.. Her ne kadar pek çok dil. huşu ve gizem hissettiklerini söylerler.3000 yıldır . Her ne kadar onları anlayabiliyor olsak da. kullanıldıkları zamanlarda bilinebilecek ince anlamları tamamen kaybetmiş olmamız son derece mümkündür. alfabelerindeki her bir harfin bağlı olduğu sak­ lı bir sayısal değere sahip olsa da.

n isp eten g ü n ü m ü z İn­ gilizce dili alfabesi. eski Yunan ve Latin etkilerinin birleşim i bile kaynak alfabeleri ile ilişkili olan ş ifreler sa y e sin d e dCl.ha derin bir anlam boyutuna sahiptir. disiplinin ya da çalışm anın” bir biliın ol­ duğunu öne sürer. şifrelen­ miş metin net olarak nasıl ve kimin (hangi g ü cü n ) tarafın­ dan türümüzün varolduğunu anlatmaktadır. Bütünlüğü içinde. gematria çalışması harfler. Bu ilişkilerin bugün m orfojenik alanlar ve . Bu kitabın kapsamı içinde. Tarihte bu iliş kilerin çalışması g em atri a o larak bilinir. Süm er çivi yazısının en eski işaretlerinden günüm üz dillerine kadar. kimyasal elementler ve varolduğu b il inen e n eski ve sürekli kullanılan dil arasında ki karşılıklı ilişki bu ifadeye ve belki de yaşamın kendisinin başlangıcına son d e re c e güçlü yeni bir bakış açısı sunmaktadır. (6) Eski İbranı metinler bu kitaptaki ana kavram ların kaynağı old u ­ ğu için. (4) Bugün pek çok yönden “bilimsel” diye tanım layabilece­ ğimiz The American Heritage Dictionary “h erh an g i m eto d o ­ lojik bir faaliyetin. gem atria kelimeler sadece okunduğunda genellikle' g ö z d e n k açan saklı ilişkileri ve daha derinlerdeki anlam katm anlarını orta­ ya çıkarır. Harfler ve sayılar arasındaki bire bir ilişk i say esin d e. h e r bir alfa­ benin her bir harfi her zam an belli bir sayı d eğ e rin e b ağlanmıştır. k elim eler ve söz­ cükler arasındaki belli etkilerden net ve tek ra rlan an so n u ç­ lar çıkardığı için. Çoğu kişi tarafından kab u l ed ilen b u ta­ nım sayesinde. (3) Tarihsel olarak. H a r fle r in S a y ıla r O la r a k B ilim i Her ne kadar belli bir harfin saklı anlam ının asıl n ed e n i kendi içinde bir gizem taşımaktaysa da. eski bir bilim olarak ele alınabilir. gematria bilimini İbrani kelim elerin bakış açısından inceleyeceğiz. Bir önceki bölüm de incelediğim iz gibi. uzm anlar bu ifadeyi T a n n ’nın gücünü yaradılışın kaynağı olarak sem bolize e d e n bir m e­ caz olarak görmüşlerdir.Tanrı 'nm Şifresi şekillendirdiğini ve şekilleneceğini anlatmış o ld u ğ u n u " işa­ ret eder.

(7) İbrani Alfabeye Kısa bir Giriş İbrani dil sessiz harflerden biridir. her kelimenin doğru anla­ mını bulmak için tercüme edilmeden önce ne yazılmış oldu­ ğunu bilmek yararlı olacaktır. bir sonraki harf olan Kaf ( 5 ) 20 sayısı değerindedir. Kabala’nın daha eski geleneklerinde. 1 sayısı ile ilişkilidir. Bu noktadan itibaren. kelimeleri okunabilir kılan sesli harfler sadece kelime­ lerin kullanış şekline göre. Bu ilginç durum dan ötürü. ve böyle devam eder. al­ fabe lOO’den artarak alfabenin ilk harfi olan Alef’in (“Büyük Alef” olarak ayrımlanır) en büyük versiyonuyla gösterilen . m etinde sesli harfler dışlanmıştır. Tarihsel ola­ rak. Daha sonraki dönemlerde.Gregg Braden kuantum etkileri gibi bilimin zorlandığı hassas ve görünm e­ yen güçlerin gizemini çözdüğünü eninde sonunda keşfede­ ceğiz. İlk İbrani alfabesi 100 sa­ yısının katları olarak devam eder ve değeri 400 olan Tav ( ) harfi ile biter. İlk İbrani alfabesi 22 harften oluş­ maktadır. Sesli noktalar ola­ rak adlandırılan bu semboller bugün her bir harfi ve kelime­ yi düzgün söylemek ve böylece doğru anlamı kesinleştir­ mek için kullanılmaktadır. Bu şekilde. ta ki Kuf ( i' ) harfine ve 100 sayısına ge­ lene kadar. Incil’e ait İbranice ile yazılmış bir sanat ya da bilim ya zısının çevirisinin yapılmasıyla ifade edi­ lirdi. ta ki Yod ( ) harfine ve 10 sayısına gelene kadar. İbranicenın seslileri bir keli­ medeki belli harflerin altına yerleştirilen nokta ve sembolle­ rin kullanımıyla yazı şeklini kazanmıştır. böyle gider. ) 30 değerinde. Dizi daha son­ ra lO’un atlan olarak devam eder. ikinci harf Bet ( S ) 2 sayısı ile ilişkilidir. Lamed ( ı. dile hem açık dışsal hem de saklı içsel bir anlamın gücü verilmiştir. her harfe kendine özgü bir ses ve numara atfedilmiştir. Alfabenin ilk harfi olan Alef ( N ). Bununla birlikte. Konuşulduğundan farklı yazılır.

1 İlk İbrani alfabesinin harflerini v e h e r bi­ ri ile tarihsel olarak ilişkilendirilmiş sayı d e ğ e rle rin i g ö ster­ mektedir.Tanrı 'nın Şifresi V ilV lOOO'de gelene kadar devaın eder. Şekil 5. Yeryüzü . Zam a­ nımızın en büyük İbrani uzm anlarından biri o la n R abbi Benjamin Blech’in çalışmasının aşağıdaki analizi C e n n e t. ö rn e ­ ğin ruh ve Cennet kelim elerinin ibranicesi g ib i. Geleneksel olarak. bizlerin C ennet o la r a k bildiğim iz yere geri döndüğü zam an yaşam aya d ev a m e ttiğ in i ö n e sü­ rer. Öte yandan k elim eleri sa y ıla r olarak ele aldığımızda. en üstün tu ttu ğ u m u z inançla­ rımız her birimizin iç inde bulunan m h u n ö lü m d e n sonra da. Şekil 5. aralarındaki d oğrudan b a ğ ın o rta y a çıkarıl­ ması bu ilişkiyi özellikle ve grafiksel o lara k g ö s te rir. Bu g en işletilm iş h a rf İb­ rani metinlerin daha derin anlamını araştırm ad a özellikle önemlidir. bu ilişki sadece d in i v e ru h a n i yazı­ larda ifade edilmiştir.1: Her bir harfle ilişkili olan"‘'sakh" sayı değerlerini gösteren İbrani harf setinin İlk Harfleri - Ruh ve Cennetin Saklı A n la m ı Saklı kelime anlamlarının derinliği en iyi b ir ö r n e k v e o n ­ ların yaşam ve ölüm ile olan ilişkileri ile g ö ste rile b ilir. Nerdeyse evrensel olarak. köklerinin olduğu yere.

iki kelime arasında doğrudan ve belki de şaşırtıcı bir ilişki keş­ federiz: 5 + 300 + 40 + 10 + 40 = 395 Cennet kelimesinin sayısal değerlerini topladığımızda 395 sayısı bulunur . (8) Ruhun İbranice kelimesi “NeShaMah”dır ve sesli harfler kullanılmadan N. M ve H ile yazılır. Sh. Sh. Sade­ ce. Son bölüm de anlaülan sayı şifrelerini ele aldığımızda. Sayısal terim olarak 395 “ruh”tur ve bu sayı bizim kelime­ lerin alfabetik şekildeyken . harf­ lerin sayı değerlerini kullanma işlemini Cennet kelimesine de uygulayacağız.in birleşmiş değerini. M ve H ’nin de­ ğerleri şöyledir: N 50 Sh 300 M 40 H 5 Bu sayıların birbiri ile toplamı yeni bir değer üretir.Gregg B a d e n ve insan ruhu arasındaki gizemle ilgili benzeri görülmemiş bir kavrayışı ve belki de en çok ihtiyaç duyulan rahatlığı sunmaktadır.ruh kelimesi ile tıpatıp aynı değer! /^TT\ 50 + 300 + 40 + 5 = 395 . İbranice’de Cennet Ha-ShaMaYim olarak hecelenir.görülemeyen bir ilişkisini araştır­ mamıza olanak tanır. sessizler ele alındığında kelime şöyle yazılır: H 5 Sh 300 M 40 Y 10 M 40 Her harfi kendi sayısal değeri ile tanımladığımızda. 395'. N. Cennet'in ülkesinin ruhun 395'i ile na­ sıl bir ilişki içinde olduğunu kesin olarak anlamak için.

Böyle bir ilişki n et olarak ruh ve Çennet kel im elerinde gösterilm iştir. Kü ltür ya da toplu m tarafından ver ilmiş a n la m ın a bakm ak­ sızın.ir...Tanrı ’nın Şifresi Gematria biliminin kanunlarından biri si sayı olarak birbi­ ri ile İlişkili olan iki kelim enin doğada da ilişkili olduğudur. Y aşam ve ölüm hakkındaki bu tür bir bakış açısı. Sayı: Yaradılışın Dili Tarihi çal ışması C um huriyette. Köklerimizin pek çok dini tan ım lam aların d a ima edildiği gibi. onların sayısal d e ğ e rle ri aynıdır! Bu nedenle. ölüm d e n e y im in in neden va­ roluşum uzun sonu anlam ına g e lm ed iğ in in d e som ut bir fik­ rini sunmaktadır. “O (insanoğlu) hem cennetsi h e m d e d ü n y e v i nitelikleri içinde birleştirir. Öte yandan. gematria bizlere C ennet ve lu h u n aynı şey olduğu­ nu bildirmektedir. Yaşamlarımızın s o n u n d a . A çık bir tesadü­ fi benzerliğin ötesinde. deneyimin dünyasında iki farklı ş ey gibi g ö rü n en “Tan­ rı Cenneti ve Yeryüzünü yarattı” aslın d a b irb iri ile ilgilid. bedenlerim iz­ de birleştirilmiş olan Cennet ve Y eryüzü k e n d i yerlerine ge­ ri dönerler. Plato’ya göre d ü n y a m ız ı dil aracılığıyla . B en (T a n r ı) insanı ikinin birleşimi o/swn diye y a r a t a c a ğ ı m .aracılığı ile gerçekten b ilin e b ile c e ğ in i ifade etmiş­ tir. Saklı sayı şifresi b ize b u n u n böyle olduğu­ nu temin eder. sayıların ilişkileri harflerin a ltında y a ta n gerçek anlam ­ ları doğrudan söylemektedirler.. Y u n a n fi lozofu Plato dünyannzın ge rç eğin in sadece d en e y im lerim iz —yaşamı dil ara­ cılığı ile betimle m eye kalkışm ak e n h a fif d ey im le bir soyut­ lamadır .” (9) Yaşamlarımız boyunca.. iki al an ın ö z e llik le ri tek bir 'varo­ luşta birleştirilmiştir. Ruhlarımız ve C ennet z a te n bir olm uşken b e­ denlerimiz toprağın tozuna geri d ö n er.

huzur ve baş­ langıcımızın en derin gizemleri bizlere çok uzun bir sayı di­ zisi halinde verilmiş demektir! Böyle bir bilginin net olarak Tora’nın oldukça kısa kitaplarının içine nasıl kodlanmış ol­ duğu net olmasa da. Dilin tek bir değer ile belirlenmiş her bir harfi ile.” diye ifade etmişlerdir.805 harf dizisi olarak verilmiş olduğuna inanmaktadırlar. Bugün bilim adamları ve tarih­ çiler benzer şekilde Tora’ın insanoğluna ilk olarak dilin ge­ leneksel şeklinde. metni uyarlamanın halihazırda çok çaba ge­ rektiren çalışmasının çok büyük sorumluluğunu da üstlen­ mek demektir. tüm Tora geniş bir sayı birliği olarak görülebilir. bizlere geçmişimizin mesajı kadar geleceğimizin anahtarları da verilmiştir.” (11) İbrani alfabesinde sayıların önemi yadsınamaz. (10) Önceki Çalışması Plato’yu çok fazla etkileyen Pitagor da sayılar ve dünya arasındaki çok önemli ilişkiyi kı­ sa ve öz bir biçimde tanımlamıştır: “Her şey sayılara göre düzenlenmiştir. yüzyıl bilginleri ‘Tüm ol­ muş olan. Eğer Tora’nın bu orijinal tanımlaması doğru ise. hiçbir noktalama işareti ya da sesli harf kullanmadan. birbiri ardına devam eden 304. ilk kelimeden son kelimeye ka­ dar.. gerçekten aradıkları şey sade­ ce akılda görülebilen o gerçeklerin görünüm ünü elde et­ mektir. Tek bir kelimedeki bir hata ile. (12) Gehius of Vilna olarak bilinen 18. Bu sayı şifresi içinde. o zaman şifa. tek olarak. Tora’nın harfleri ile dünyamız arasında doğrudan bir ba­ ğı kabul etmek. metinleri uyarlarken tek . yazıcının in­ san tarihinin yönünü geri dönülemez bir biçimde sonsuza dek değiştirebileceği söylenmektedir. olmakta olan ve zamanın sonuna kadar olacak olan Tora’da bulunmaktadır. Böylesine bir tamlığı kommanın ağır yükünden dolayı. uzmanların sayfalarındaki yazılı keli­ melerin görünen mesajlarının çok daha ötesine giden bir an­ lam buldukları açıktır.Gregg Braden tanımlamanın yolu sayılardan geçmektedir: “Onlar (geomet­ riler) görünen şekilleri kullanmamızı ve onlar hakkında ko­ nuşmamızı sağlamaktadırlar..

■ birbirler i arasında m an tık sal b ir karşılaştırm a yapm adan ön­ ce tüm bakış açılarını ay n ı d ile çevirm ekten. İbrani metinlerin güvenirliliği v e harflerine şifrelenmiş sır. talini- . olabilir mi? Bilim ve spiritüelliği y a d a d ü n y a m ız ı bilm enin h erhangİ. Benzer şekilde.• lar sayesinde bizlere b u g ü n d ü n y am ız v e birbirim iz ile olan < ilişkim iz içinde eşi g örülm em iş bir anlayış verilmektedir. ■ . sp iritü e llik v e bilim dilleri aram d a ortak bir birim bulm ak e n e sk i v e e n d e rin sayılan ge^n^terim izin bazılarına yeni a n la m la r y ü k le y e b ilir. bir mil m i y ° ksa 7 .9 2 0 fe e t iki m esafe arasında ^ s i d i k ­ le en uzun olanıdır.T an rı 'mm Şifresi bir harfte olabilecek hataya bil e to leran s gösterilem ez. İbrani kelim elerin harflerı ve kelimelerin ilettiği fikirler a ra sın d a güçlü bir bağ °ld u ğunu görm üştük. eğer bize “hangisi d a h a b ü y ü k tü r. yaratması aylar sü rm ü ş o labilen tüm bir belge­ nin yok olmasını sağl ayabil ir. Böy­ le bir kusur. ortak bir ölçü birim ine ç e v irm e k tir. İbrani m e t i n i rde t o r n lenen yaşamın kökleri ile g ü n ü m ü z bilim inin m ° d ern dili arasında saklı bir ilişki o lm ası m ü m k ü n m üdür? Yaşamın d i . ni ve bilimsel tanım lam aları ile B aşlangıç arasında varoldu­ ğuna inanılan uçurum . geçe r Ornegm. B unu yapm ak. “Elmalarla E lm a la r ı 3 K a rşıla ştırm a n ın Gücü Dil ve sayı bilimi sa y e sin d e . a s lın d a s a d e c e tam olam k aynı °iayları anlatan farklı d ö n e m le rd e k i farklı dillerin tar s°n u cu . B öylece.92° feet mi?” diye sorulursa ö n c e lik le yapılm ası gereken ataanikbir karşılaştırma y a p m a k iç in h e r iki uzunluk ölçüsünü de ■ . “K itap”ın (Tora) sa­ dece doğaı kopyaları g elecek k u şak lar için bırakılmıştır. B enzer bir şe k ild e . B öyle y ap a rak “d r n ^ a la portakallar”dan ziy a d e “e lm a la rla elm aları” katılam am a­ mızı sağlayacak bir o rta k b irim y aratm ış olurum Mü ö l k ü ­ nü 5 280 fe e fe çe v irm e k k a rşıla ştırm a yapm ayı ve sonucu. bir farklı görünen şekli a ra s ın d a k ö p rü kurm anın anahtan. 7 .bulmayı kolaylaştırır..

Böyle bir köprüyü keşfetmeni? anahtarı iki dün­ yayı ■birleştiren ortak bir bağ bulmaktır.1997’de tekrar isimlendirilmiştir) gibi. 1800'lerin başında California. V. 12 yıllık çalışmam sonucu sadece birinin yaşamın dört ele­ menti ile İbrani alfabe arasında bir köprü görevi gördüğünü . Bu özellikleri çı­ kartarak ve organize ederek. ^ Keşif: Alfabeden Elementlere VV 20.sınıflan­ dırılmışlar ve bir tablo şeklinde sıralandırılmışlardır.Gregg Braden V spiritüelliğin birbirine zıt dünyaları gibi pek çok görüş arasında uzun süredir aranan bir köprüyü de beraberinde getirebilir. ve Colorado’da altın bulma çabaları Batı Amerika’nın gelişimine katkıda bulunmuştur. Atmosferimizi oluşturan görünmez gazlardan baş­ layarak toprağı oluşturan sıkışık minerallere kadar sıralanan pek çok elementin bildik isimleri vardır ve dünyamızın tari­ hinde hatırı sayılır bir rol oynamışlardır. Her elementi tanımlayan pek çok muhtemel özellikten. Ek B) ve başka elementler bulun­ maya devam edildiğinden genişlemektedir. DNA'mızın elementlerini İbrani alfabenin harfleri ile birleştiren işte bu sayı özellikleridir. fiziksel dünyada hayal edebilece­ ğimiz her şeyin karşılaştırması yaklaşık 118 elemente indir­ genmişti. element olan dubnium (aslı Nielsbohrium . yüzyıla yaklaşırken.sayılarla tanımlanan özellikler . 1Ö5. îbranicenin altında yatan saklı sayı şifresi özellikle böyle bir bağ sunmaktadır. Bu anahtar hücrelerimizde DNA olarak şifrelenmiş eski mesajı okumamızı sağlamaktadır. bilim adamları her elementin tabloda nereye “uygun düştüğünü” belirlerler. Ö rneğin. Bu tab­ lo Elementlerin Periyodik Tablosu ya da basitçe Periyodik Tablo olarak bilinir (bkz.118 elementin her biri kendilerini diğerlerinden ayıran özelliklere göre . çok nadir olanlar sadece labo­ ratuar koşullarında ortaya çıkmaktadırlar ve çok daha dura­ ğan m addeler içine dağılmadan önce ancak saniyelerle va­ rolmaktadırlar. New Mexico.

aslın d a Ateşi.rek olm adığını g ö rm ek tey iz. Bölüm. alfabe arasm d aki b ağı o rtay a çıkaracağız.. yaradıhşın sim yasal elem entlerinin eski re fera n sla n n ın ■ . sayılan e kley e re k b u lu n a b ild iğ in i ortaya çıkarır. Bir-. denbire..007yi indirgem eye ge. İb ra n i h a rfle rin saklı sayı değerlerine bir eş ara­ m a m a ola n a k ta n ıy a n o rta k birim leri kanıtlamaktadır.: kip ederek.v e m u h -. (13). zira halihazırda 1 sayısı ile tem -. Havayı ve Suyu y a p a n kimyasal elem entlerin tanım lam aları olduğunu keşfetm iştik:/ Hidr°jen. Bu form ül bize Ateş. Eski edebiyattaki b u üç ele-. İsmi çok teknik gelse de. atom ik kütle terim ine kısaca kütle diyelim ve o n u | İbrani h arfler ile yaradılışın k im yasal elem entleri arasında. <<Ruh” ve “C en n et” arasın d ak i saklı anlam ı bize g ö steren iş-. teşem bir şeyler gözler ö n ü n e serilm eye başlam aktadır. dılışın eski hikayelerini g ö rd ü k çe heyecan verici.2 b u d eğ erleri özetlemektedir.' m ektedir... O k sijen için hesaplanan değer “6 ” dır (1 + 5 = 6)..00 ve oksijenin b a sit k ü tlesi 15. o la n 14.. 4 d e .. n in o je n için “14” değeri “5” (1 + 4 = 5) ba~ sil teütlesine d ö n ü şü r. (14) Bu kitabın am acına u y m ası/ açısından. hareket ettirdiğini anlatır. m ent tarafınd an sak lan an sırrı açığa çıkarm ak için.99’un Periyodik T ab lo ’d a n alm an kütle n u m a ra la rın ın kesir noktasının solundaki tüm.. “k ü tle ” fikri aldatıcı bir b içim de n basit bir kavram dır ve b iz e m ad d en in kendini nasıl kolayca. Başlangıç’ın belirli bir kesim e hitap ed e n referans-. nitrojen ve oksijen.Tanrı nm Şifresi °rtaya çıkarmıştır: atom ik kütle olarak bilinen özellik. İşte o rtak b irim in sahneye çıkacağı yer burasıdır. katalım ..: köprü kurm am ıza o lan ak tan ıyan ortak birim olarak hesaba). temin aymsını u y g u lay arak .. • Kesin olarak.Ateş H ava ve Su . ları güçlü bir anlam taşım aya başlar. O 5) / Böylesine m o d ern terim lerin m erceğinden b ak a rak yara. H ava v e Su h a k k ın d a yeni bir düşünce şeklini ta­ nıtmaktadır. Şekil 5. nitrojen ve oksijen ile. h id ro jen in k ü tlesi olan 1. Aynı işlem nitrojenin basit kütlesi. . D aha evvel.. / Sayüarı tnk bîr ra k am a indirgeyen gematria ilkelerini ta-. şim di İ b rani d fab esin d e o n ları -temsil e d e n harfleri bu İmamı z gerek-. hidrojen. sil edüm ek tedir.

yanında bu üç harfe ayrı bir şerefli ve saygın yer ve­ rildiğini' -belirtmektedir. Üç Temelin S ım Bölüm 4’de tartıştığımız gibi.5. saklı anlam ile ilgi­ :li somlarımızın cevabı benzerliklerden biri haline gelmekte­ dir. Tanrı yarattığının alanını “mühürledi” ve tanımladı.” (16) Üç Temel Harfi birleştirerek. “Hava" ve "SıCyu faiklı bir şekilde dü^hnıeüıizi Sağ!ar. Bu soruyu mantığın bir delilinin tanıdık şekli içinde so­ kabiliriz: . bu harfler de Tann’nın ismi için bir temel haline gelmişlerdir: Tanrı’nın Yeryüzünde tanınabile­ ceği bir isim.. modern elementleri birbirine bağlayan ortak birim -ılalirie1'gelen işte bu değerdir.2: "Kütle" değeri eski elementler ‘Ateş.Gregg Bmden Şekil. üç harfin seçildiğini ve alfabenin diğer harfl­ erinin. Sepher Yetzirah diğer her şeyin ondan yaratılmış olduğu yaradılışın 22^ harfinin oluşu­ munu takiben. "Doğal olanlar arasından üç h a rf seçti (üç tm ıel olan AlefM em ShinHn gizem inde) Ve Onları Kendi yüce ism ine koydu . Harflerin kendisi dışsal metinde halihazırda ortaya çıkmış olduklarından.. Eski kavramlarla. Dünyamızın yapılmış olduğu “m ad­ de” olmaya ek olarak.

Ve onlardan yayılm ış hava. ve eğer bu harf gerçekten de yaradılışın “Anne”si ise ve eğer Y. V olmalı! A M Sh'nin evriminin Y H V olmasına izin yeren ilişki es­ ki geleneklerde öylesine kutsal olarak korunmuştur ki. ” (17) Gizemimizin cevabı belki de tek bir cümlede bulunuyor: Kabala’nın bilginleri Tanrı’nın isminin üç harfinin (^HV) as­ lında üç Temel Harften (AMSh) türediğini ve onlara tekabül . M. H. mistik sır. üç halka ile kaplanıp mühürlenmiş. H. ve Babalardan. Sh ilk yaratılmışsa.M. Ve onlardan doğmuş Babalar. B ir yüce. “Üç Temel: A lefM em Shin.T an rı :nm Şifresi Eğer üç Temel harf A. gelecek nesiller. Sepher Yetzirah’ın tüm bir bölümü onların bağlarının sırrım ya­ nıtlamaya adanmıştır.Sh dışsal olarak görünm eyen bir işlem aracılığıyla Y. su ve ateş. ve V Tanrı'nın isminin harfleri ve tüm yaratılanın kaynağı ise o za m a n A.

ya da Tohu olarak tanımlar. Kabala’nın öğrencileri için. Bu ta­ şıyıcılar dünyamız için Hayat Ağacını. Sepher Yetzirah’ın '“yüce mistik sırrı”.alamıyor ya da veremiyorlardı. Durumlarından dolayı.Gregg Braden ettiğini ifade etmektedirler. Kırılan kapların parçaları daha alttaki ruhani bölgelere düşerek. Farklı böl­ gelerde kendini gösteren aynı gücü temsil etmektedirler. Tanrı’nın isminin dün­ yamızdaki harflerinin (YHV) ve Kaosun Kainatından gelen Temel Harflerin (AMSh) birbirini eşit olduğudur. Kapların Kırılması olarak bilinen bir hareket yaptılar: paramparça oldular. Kabala’da. alıp verebi­ lecekleri yeni taşıyıcılar olarak yeniden yapılandılar. ya da kaplar birbirlerini etkileyemiyorlardı ve bu da yaşamın esasın deneyimlemelerini imkansız kılı­ yordu . Mem ve Shin harfleri Kaos içinde doğm uş ve ilk kez tanımlanmışlardır. Kaosun Kaina­ tı. Bu ilişkileri aklımızda tu­ tarak. artık elimizde İbrani yaradılış hikayelerinin üç Temel Harfinin m odern bilimin elementleri ile nasıl eşit sayıldığı­ nın sorusuna cevap vermek için gerekli bilgiye sahibiz. Yod. Hey ve Vav sırasıyla A le( Mem ve' Shin’in suretlerinden gelmektedir. Tanrı tarafından verilmiş olan ışığı taşıyamamışlardı ve deneyimleri tamamlanamamıştı. bu yanıtın al­ tında yatan anlam ciltler doldurabilir. (18) Öte yandan. Düzenin Kainatı'nda. Bu durum dan dola­ yı. Alef. Doğmltmanın ya da Düzenin Kainatını oluşturan on Sefirota dönüştüler. on Sefirottan önce varolmuş olan elementler. . Başka bir deyişle. zamandan önceki bir ka­ inatın varlığı öğretileri anlamak için verilmiş ve hatta istenil­ miştir. Kaos’un İbrani harflerine yeni bir anlam verildi ve bizim gizemimiz anlam kazanmaya başladı. Modern fizikçiler Büyük Patlama(Big Bang) zamanından önce herhangi bir şeyin varolup olmadığı ikilemi ile uğraşır­ larken. Düzen olmayan bu dünyada. Düzenimizin Kainatının yaradılışı ve bizden önceki kainat arasında bir açıklık yapılmıştır. Kabala bunu “zaman ve düzenden önceki zaman"ı Kao­ sun Kainatı.

Tctrm ’mn Şifresi Kaos’un Dünyasında D ü z e n in D ü n y a sın d a Temel Harfl er T e m e l H arfler A Y M H = Sh v Bildiklerimizi gözden geçirme: T 1. nitrojen ve oksijen) Tanrı’nın eski ısınini oluşt:uran üç Y. Hava ve Su hidrojen.:• ya çıkarır ki. nitrojen. 5 ve 6'dır. mentinclen üçü ile (hidrojen. y 3. ilişkinin. Hidrojen. Ateş. : İbrani harflerin saklı sayık o d la rın ın b ir araştırm ası. Harfler ve elem entler a ra sın d a k i k ö p r ü sayıdandır.ve o k sijen in say ı d eğ erleri sırasıyH y 1.haıf. hata yapılabilm esi m ü m k ü n değildir! Şekil 5. termektedir. saklı sayı k o d l a r ı y arad ılışın eski ele­ mentlerinin basit kütlesi ile ta m ı t a m ı n a ö rtü şen sade ve . Mve Varasında (11 iki kere kullanılır ve YHVî olur) doğrudan bir bağ olduğunu gös---.öylesine h a s s a s o ld u ğ u n u da ° ıta.y ler ve elementler arasında sad e ce d o ğ r u d a n bir ilişkinin va-T rolduğunu değil.3: Simyanın eski elementleri ve İbrani harfler olarak kalplıkları yaşamın dört ek-. İbrani alfabede. n itro je n v e oksijenin eski y eşdeğeridir 4 2.

ilk çağların başlarında bile yaradılışın gizleri hakkındaki bilgiyi incilden önce yaşa­ mış bilginlerin kaydetmiş olduklarını anlıyoruz.tanınmaktadırlar! Bu tü r 'tanımlara güvenirlilik sağlamaya ek olarak. Hava ve Su yapı taşlarına ek olarak. Bu soınut ve gerçekliği kanıtlanabilir ilişki. Çerçeveli satırlardaki sayıları basitçe eş­ leştirerek. Teori ve mecazın ötesinde. yaşamın dördüncü elem en­ ti de bu üç Temel H arfden gelmiş olmalı. Eğer. her şey Y. İbrani alfabesinin eski harfleri ile m odern kimya­ nın elementleri arasında doğrudan bir bağ oluşturmak mümkün. o zaman. H ve V ‘ye dönüşen A. 5 ve 6 sayılarını çözdüğü görülmüştür (bkz. bu bilgiye dayanan bilgeliği kendilerininkini ta­ kip edeceklerini bildikleri nesiller için korumuşlardı. O günlerin diliyle. Dördüncü Elementin Gizemini Çözmek i Simya tarihi boyunca.3) . bir element her zaman ima . Ateş. tıpkı bizim bugün kendi kitaplarımız aracılığıyla yap­ tığımız gibi. in­ san DNA’sının elementlerini artık İbrani alfabesinden eşleri ile değiştirebiliriz.Gregg Braden sadeCe üç harf vardır. aynı anda ortaya çık­ mış olan bir olu şunı aracılığıyla. y . <. Şekil 5. Doğadaki bu basit elmalarla elmalar ilişkisi sayesinde. Y. atala­ rımızın bilgisi hakkında kitaplar doldurur. bu sırlar artık yaradılışın ve yaşamın kendisinin oluşumundan sorumlu detaylar olarak günümüz bilimi tarafından tanınmış ve doğmluğu onaylan­ mış elementlerin gerçek birleşimleri . : Sepher Yetzirah gibi kayıtlardan. ■ Gizemimizin son bölümü yaşamın dördüncü elementinin -karbon . H ve V İbrani harflerinin saklı de­ ğeri sırasıyla 1. ya da “saklı”.nereden geldiği sorusuna cevap vermektir. M ve Sh’den yaratıldıysa. dördüncü. karşılıklı iliş­ kilerimiz yaradılışın en eski tanımlarını daha evvel asla mümkün olmamış olan bir doğnıluk oranında tercüme et­ memize izin veren bir dil kazandırmaktadır. metinlerin öne sürdüğü gibi.

Tanrı ’nm Şifresi

edilmekteydi. Bu “Topraklın bildik maddesiydi. Daha son­
raki geleneklerde, şifrenin Toprak bölümü doğudan açığa
çıkmış olsa da, kesin olarak nereden gelmiş olduğu yaradı­
lışın sırlarının gizemini başlatanlar dışında herkes için saklı
kalmıştır. Sepher Yetzirah’m öğrencileri için, bu gizem in
anahtarı metnin kendisi sayesinde doğrudan ortadan kalk­
mıştır:
“B u üçü n d en (Nefes, Ateş ve Su)
O nun evini buldu. ”(20)
Belagatlı olduğu kadar derin de olan bir sadelikle, Yaradan’ın evinin sadece bu üç m addenin kullanım ından o lu ştu ­
ğu bize söylenmektedir. Biraz şüphe uyandırsa da, ister te k
başına ister birleştirilmiş olsun, Ateş; Nefes (Hava) ve Su
(hidrojen, nitrojen ve oksijen ) elementleri Y aradan’ın , d ü n ­
yanın ve bedenlerimizin evi haline gelen tüm yaradılıştan
sorumludur.
Dördüncü elementin gizemini çözm ek için gereken ip u ­
cu onun halihazırda varolan elem entlerden gelişmiş o lm ası
gerektiğidir. Yeni bir elem ent yaratm ak için, varolan üç e le ­
ment bir şekilde birbirlerini etkilemiş olmalıdır. İşte b u b ir­
leşme, ki çoğunlukla Ateş, Hava ve Suyun “evliliği” o la ra k
tanımlanır, dünya ve nihayetinde yaradılış hareketinin k e n ­
disi ile olan ilişkimizi anlamanın anahtarıdır.
Metin bizlere yaradılış sırasında Tanrı için sadece üç e le ­
mentin varolduğunu bildirmişse de, bizlere son de rece n e t
analitik seçimler bırakmıştır: dördüncü elem ent olan T o p ra ­
ğı yaratmak için bu elementlerin sayısal değerlerini k e n d i
aralarında ya toplamalı, ya çarpmalı, ya bölm eli ya da ç ık a r­
malıyız. Bu tür seçimler kendilerini gösterdikleri z a m a n ,
hangi tercihin bize en net yanıtı vereceğini seçm eden O c cam’ın usturası (21) diye bilinen bir yaklaşım ihtim alleri ç o ­
ğu zaman deneme yanılma usulü bir yaklaşımdan daha fa z la

Gregg B m den

daraltmaktadır. Kısaca, Occam’rn usturası ideal bir dünyada,
en basit çözümün en iyi çözüm olduğunu ifade eder. Böyle
bir durum da, dördüncü elementi tanımlamaya yardımcı ola­
cak en, basit toplama gizemimizi çözümleyecek değeri de
gözler önüne serer.
Tanrı’nın “Kainatını yaratmak" için kullandığı üç harften,
Yod} Hey ve Vav, 1, 5 ve 6 sayı değerlerini elde etmiştik. Ba­
sit bir matematiksel işlevle bu değerleri birleştirmek orijinal
üçlüden çok farklı özelliklere sahip yeni bir sayı ortaya çı­
karır: “12”
Yod
H ey
Vav
1 +
5 + 6 =

12

Şimdi, “12” dördüncü element olan ‘Toprağın” değerini
temsil etmektedir. Bundan sonra, artık bildiğimiz iki basa­
maklı sayıyı tek basamaklı sayıya indirgeme işlemini kulla­
narak 12’nin 1 + 2’sini toplayacağız ve yeni bir değer elde
edeceğiz, 3. son olarak, bu değeri gizemli elementimizi bul­
mak için Periyodik Tablomuzda arayacağı z.
İnsan bedeninin kimyasına kısa bir bakış arayışımızı he­
m en bir kaç olasılığa indirgeyecektir. Varolduğu bilinen 118
element içinden, sadece dördü insan bedeninin %99’unda
tanımlanmıştır: hidrojen, nitrojen, oksijen ve karbon. (22)
Karbon bu gruba dahil edilmemiş tek elementtir. Dolayısıy­
la, araştırmamızın düzeyini bir karbonun özelliklerinin sim­
ya ve kimya arasında bir köprü oluşturup oluşturmadığını
inceleyerek arttırabiliriz.
Karbonun kütle değeri 12.00’dir. bu değeri basite indir­
geme uygulamasını yaparak, 1 + 2, karbonun teni değerini
(basit kütle) buluruz=3. Bu belki de tesadüf değildir, çünkü
karbonun 3’ü 118 elem ent içinde Tanrı’nın isminin, Y, H ve
V, harf değerlerini (1, 5 ve 6) birleştirerek bulduğumuz 3 ile
tam olarak eşleşen tek değerdir.
Sepher Yetzirah'a göre, bu daha büyük bir anlam taşı­
maktadır. Tanrı'nın çalışmak için sadece Ateş, Hava ve Su’ya

T ann

nın Şifresi

sahip olduğu bize söylendiği için, bugün renksiz ve ko ku suz gazlar olarak bilinenler içinde karbon bizi som ut y ap a n
tek yaşam elementidir. Bu dördüncü fiziksel elem entin y o k ­
luğunda, bedenlerimiz varolmazdı!
Eskiler bizlerin Ateş, Su, Hava ve Topraktan yapılm ış o l­
duğumuzu kaydettiklerinde, kendi za mani arının dilinde bizlerin hidrojen, nitrojen, oksijen ve k a rbondan yapılm ış o Idu ğumuzu söylüyorlardı - taın olarak 20. yüzyıl bilim inin b u iuşları. Karmaşık test araçlarının, yüksek ölçekli m ik ro sk o p ­
ların, m adde analizlerinin- ve kimyasal denklem lerin m ate­
matiğinin gelişiminden önce, atalarımızın her insan h ü cresi­
nin yapı taşl arı nın tanımlayarak bedenlerim izin bil eşim ini
ortaya çıkarmışlardır.
Böylesine doğru bir bilginin açığa Çıkmasıyla, şim di şu
so m y ı sormamız gerekir: Acaba bizden ö n ce g elen lerd en
bizlere, farkına varmada başarısız kaldığımız başka n e kal­
mış olabilir? Bu soruya cevap olarak, şem am ızın so n b ö lü ­
mü önem kazanmaktadır. İbrani harflerinin dilinde k a rb o ­
nun eşde ğeri nedir?
Bu bölüm ün son kısmında uyguladığımız işlem leri takip
etmek beklenmedik, ama açıklayıcı, bir sonuç ortaya çıkar­
maktadır. İbrani alfabenin sadece bir harfi k a rb o n u n basit
kütlesi ile aynı değeri taşımaktadır: büyük G harfi ile tem sil
edilmiş olan dördüncü harf, Gimel (
). Sayı p ersp e k tifin ­
den, Gimel İbrani kutsal m etinlerinde “k arb o n ”d u r ve eski
simyada “Toprak’’ür (bkz. Şekil 5.4).

Şekil 5.4: Eski elementleri,, modern elemenden ve İbrani alfabesini ortak sayı birimleri­
ne çevirince, yaradılışın simyasal elementleri DNA'nın modern elementlerine dönüşmek­
te ve bedenlerimizdeki her bir hücrede YHVG İbrani harfleri olarak çevrilmektedir.

Gregg Braden

Eski İbrani harflerinin daha derin anlamım anlamadaki
son basamak bize bedenlerimizdeki Tanrı'nın isminin gize­
mini çözmek için bir anahtar yaratma imkanını vermektedir.
ö te yandan, aym zamanda, m odern elementler ile alfabe
arasındaki bağ yaradılışın eski hikayeleri olarak bize bırakı­
lan sırlar hakkında yeni sorular orta ya atmaktadır. Neden bu
ilişkiler bu kadar önemli? Eski bir mesajın keşfi m odern
dünyamızda bize ne anlatmakta? Bu somlara cevap verme­
ye, bu mesajın basit bir tesadüften öte olduğunu gösteren
ihtimallerin ne kadar büyü k olduğunu araştırarak başlayabi­
liriz.
Bölüm 5’de de değinildiği gibi, standart İbrani alfabesin­
de toplam 22 harf vardır. Bu ha rfle r dilde anlamlı kelimeler
yaratmak için bir araya getirebileceğimiz olasılıklar alanını
temsil ederler. Tıpkı bir cüinlenin içerdiğinin kelimelerin sı­
rasına bağlı olmaması gibi, hücrelerimizdeki mesaj da harf­
lerinin sırasına bağlıdır. Hücrelerimizdeki mesajın bu özel
bölümü, YH:VG, 22 olası. harften 4'ünü kapsamaktadır. Bu
bilgiden yola çıkarak, İbranı alfabesinden rastgele dört har­
fin yanyana dizilerek bir an lam oluşturmasının olasılığını
hesapladığımızda, sonuç 22 üzeri 4 ya da sadece 234.256’da
I'dir!
Başka bir şekilde söylemek gerekirse, YHVG harflerinin
yan yana dizilmesinin tamamen şans eseri olması ihtimali
%0.00042’dir (1/22 üzeri 4 x 100). İbra ni alfabesini 28 harfe
çıkardığımızda bu ihtimal %0.00016’ya düşmektedir! Her ne
kadar bunlar astronomik tahnıinler olmasa da, mesajın ter­
cümesi ile birleştirildiğinde, şifreden sorumlu olan şeyin
“şans" ya da ‘‘tesadüften” çok daha öte bir şey olduğu kuv­
vetle görülmektedir. Bu halihazırda zayıf ihtimaller, Periyo­
dik tabloda insan DNA’sını yaratan tek dört elemente denk
gelenin sade ve sadece bu dört element olduğunu hesaba
kattığımızda çok daha fazla zayıflayacaktır!
Bedenimizdeki her bir hücresinde bulunan kimyasal şif­
reyi yazılı bir mesaj şeklinde okumak için gerekli tüm bilgiye

Tanrt’m n Şifresi

sahip olmamıza rağmen bir şey hala gizemini k o ru m ak tad ır.
Mesaj net olarak ne anlama gelmektedir? Bu gi zem i ç ö z m e k
için, Tanrı’nın eski ismi ve onun yaşamın h ü crelerin d e o rta ­
ya çıkış şekli hakkındaki tartışmayı derinlem esine a ra ştır­
malıyız.

\my

BÖLÜM 5 Ö Z E T
• «Neredeyse tüm yazılı iletişim şekilleri s e m b o lle rin
sadece dört şeklinden birine ya da d ö rd ü n ü n b irle şi­
mine denk gelmektedir: resim imgeleri, h a rf işa re tle ri,
tek heceleri tem sil eden işaretl er ve tüm b ir a lfa b e gi­
bi simge koleksiyonları.
• Orijinal formlarında, pek çok eski alfabenin h a rfle ri
aym zamanda belli bir sayı değeri ile ilişkilidir. B u
“saklı” şifreler, kelimelerin kendilerinin ilettiği d ışsa l
anlamdan çok daha derin bir ani amı tem sil e tm e k te d ir.
• İnsanın köklerinin en eski ve en eksiksiz h ik a y e le r in ­
den biri eski İbranice dili ile kaydedilm iştir. B u d il e n
azından son 2000 yılda çok az değişim e u ğ ra m ıştır.
• Yaradılışın eski hikayelerini günüm üz bilim i ile b ir le ş ­
tiren anahtar, “elma ile elm ayı” k arşılaştırm am ıza o la ­
nak tanıyan sayıların ortak birimidir.
• Yeni keşif: Günümüz Elem entlerin P eriy o d ik T a b lo s u ­
nu tanımlayan 17 özellikten sadece biri k e s in o la ra k
İbranice’nin saklı sayı değerleri ile u y u ş m a k ta d ır —
atomik kütle ya da basitçe kütle.
• Dördüncü elementin gizemini çözm ede, S im y a v e K a­
baladan, yaşamın dördüncü elem e nti o la ra k " T o p ra k ”
bulunmuştur: karbon.

256’da l ’dir ya da daha zayıf ihtimalle %0. Hey. Vav ve Gimel. . bedenleri­ mizdeki DNA’nrn elementleri (hidrojen. nitrojen. Bu dört harfin tesadüfen İbrani alfabesinden anlamlı bir mesaj oluşturma olasılığı sadece 234.00042’dir. oksi­ jen ve karbon) bugün İbrani alfabenin dört harfi ile yer değiştirilebilir: Yod.Gregg Em den /" 6 İ T \ • Yeni keşif: Basit kütlelerini tanımlayarak. kelimesi kelimesine okunabilir. böylece DNA'mızın her bir hücremizin içindeki tercüme edile­ bilir bir alfabe gibi.

" "Oluşturulmuş ve söylenm iş olan h e r ş e y te k b ir isimdir.. ki o n d a n her şey y a r a tıld ı. yüce. gizlenm iş. m istik y ü k s e k b i r s ır ki o n d a n Ateş.... Nefes ve S u y a y ılıy o r . ” — SEPHER YETZIRAH .“O üç h a r f seçti. O n la n y ü c e ism ine y e r le ş tir d i .

dua ederek. Bunu anlamaya çabalar­ ken. Tanrı’nın Adı Yaradan fikrini kabul edenlerin huzurunda. mutlu zamanlarımız da bile. en Tekgüzelbir hayallerimizi kutlarken ve en büyük trajedileri­ mizin yasım tutarken. zamana yenik düşmemiş olan en sevdiğimiz geleneklerimiz sayesinde tanıdığımız bir Tanrı Yaradan’ın doğasının pek çok ve farklı tanımlamalarıy­ la ’bize sunulmaktadır. Eğer tek bir Tanrı varsa. bu tür sorular çok daha temel bir şeye yanıt vermemiz için bize sorulacaktır: Acaba bizler sadece mucizevi hayatı oluşturmak için elementlerin ve molekülle­ rin “şans eseri” birleşmesinin bir ürünü müyüz yoksa bizler yaradılışın kasti bir hareketinin sonucu muyuz? . hayatımızdan vazgeçerek ve hatta öylesine gizemli bir varlığın adına öldü­ rerek sadece^ O nun gerçekten var olduğunu gösteren işaret­ ler istediğimizi nasıl savunabiliriz? Eninde sonunda. o zaman Tanrı’nın nasıl bir şey olduğuna dair neden bu kadar çok fi­ kir vardır? Yaşamımızı adayarak. aynı gücün nasıl olur da her ikisinin de kaynağı olabildiğini soruyoruz.-6 Ş İF R E N İN - İÇ İN D E Ş İF R E : Tüm Yaşamın Her Hücresinde.

yanıtlarımın ortaya ç ık a b ile c e ğ in i v e gizemlerin çözümlenebileceğini hisederdim . A nlatılam aya­ cak kadar geniş. Dalgalı beyaz saç bu klele ri o m u z l a r ı n ­ dan dökülmekte. Siyah beyaz çizgiler g ö r ü n m e z bir düzleme boylu boyunca yatmış çok yaşlı bir a d a m ı ö n e doğm uzatmış eliyle kosm osu çevirirken ve y a ra d ılışa h a y a t verirken resmetmişti. Benim işim sedece onları bulm aktı. C ehennem gibi sıcak g e ç e n Missouri yazlarında salonun soğuk taş döşem esine y ü z ü s tü yatıp The Golden Treasury of Bible Stories (İncil H ik a y e le ­ rinin Altın Hazines i) ( l ) ’nin çocuklara uyarlanm ış v e rs iy o n u ­ nu . Her zaman en başından başlardım. Tanrı kavramı beni büyülerdi. böyle bir varlığın yaşamımdaki anlam ının ne o ld u ğ u n u a n ­ lamam için beni zorluyordu. takip eden hikayen in te m a s ın ı açıklayan basit bir resim vardı.Tanrı ’nm Ş t/r e s ı Tanımlamaya Karşı Olan B ir T a n n Çocukken. öylesine k a lın d ı ki etrafını saran kitapların desteği olm adan. Kitap raftaki yerinden k o rk u tu c u bir otorite kaynağıymış gibi görünürdü.çalıştığımı hatırlıyorum.yaradılışın İncille ilgili gizem lerine açılan ilk p e n c e r e m . Her bölüm ün başında. eğer kitabı yeterli sayıda açarsam ve h e r k e lim e y i doğnı şekilde okursam. G enesis’in h ih ay esi ile ilgili ilk resim bugün bile aklımdadır: b ir sanatçının T a n rı’n ın y a ratırkenki betimlemesiydi bu. İncille ilgili z a m a n ­ la rın gizemlerini resm eden bu ve pek çok d iğ er r e s im d e . tek b aşın a a y a k ta durabiliyordu. B ir ş e ­ kilde . Tanrı çoğu zaman İnsani koşullarda resm edilm işti. aynı şekilde dalgalı olan sak a lına k a r ış a r a k ka inatın boşluğu içinde kaybolm aktaydı. bilge ve m evcut bir şeyin varolm ası fik ri. ağır siyah k a p a ğ ı a ç a r ve bir sonraki sayfayı çevirm eden önce her resm i v e ip u ç la ­ rı veren h er kelimeyi dikkatle incelerdim . . kitabın yazıldığı dönem de bu akla u y g u n g e lm iş ti. Y a ra d ılış mucizesini yapan bir insan olarak öyle bir şek ild e g ö s te r il­ mişti ki. B öylesine e tk ile ­ yici bir kitabın Tanrı ve ya ra dıl ışla ilgil i b ü tü n s o ru la rım ın mutlaka yanıtlarını içeriyor olması gerektiği d u y g u s u n u ' ç o k net hatırlıyorum.

. devam ettirmek ve yok etmek gücünü kozmosun Yü­ ce Tanrısına. bilim adamları ve uzm an­ lar Tanrı ile ilgili bu tür referansları isimlendirilemeyeni isimlendirme girişimi olarak yorumlamışlardır: yaradılışın kaynağının bir simgesi. yaratma gücü kesinlikle aynı gücün üç yüzü olarak ifa­ de edilmiştir: Brahma. Bunun nedeni Tanrı’nın doğası gereği heryerde ve herşeyin içinde varolmasının bilinemez veya tarif edilemez olmasıdır. Eski İbranicede ve sonradan gelen Hıristiyan geleneklerinde de anahtar bir role sahiptir. Ebedi varolma niteliği sayesinde. Judeo-Hıristiyan -geleneğinde. yaratan. Batı geleneklerinin ilk kökleri bile Tanrı’yı doğrudan bilmenin ya da temsil etmenin imkansız olduğunu söyler. herşeyi gören ve her zaman varolan yaradılışın kaynağı hakkındaki anlayışımızı anlatan bir mecaz olduğu­ nu biliyonız. ve Shiva. Hindu kozmolojisinin kutsal Bhagavad-Gita’sında. Vishnu.Gregg Brcıden Her ne kadar böyie bir resim Tanrı’nm çalışmasını bir yü­ zünü temsil ediyor olabilse de. Resmin. herşeyi bilen. az sayıda kişi fiziksel olarak evlerimizin “üzerinde” bir yerde yüzüstü yatmış bir adamın kozmosu idare ettiğinden şüphe duymaktadır. doğrndan bir ismin ötesindedir ve Yeıyüzündeki insanlar ta­ rafından sadece doğa ve yaşam mucizesi olarak kendini gösteren mucizelerle bilinir. Yaratıcı’ya atfetmiştir. örne­ ğin. o Tek ya da Sonsuz olan cinsiyetin ötesindedir. yokeden. Her yüz. İsmi yaşamın bir anında kendini gösteren olaylar ile bağlantılı olan bu tek bir Yaratıcı teması pek çok yerli ve Doğu gelenekleri ta rafından paylaşılmıştır. koruyan. yaşam ve ölüın döngüsünü sürdürmek ve kozmosun devamlılığını sağlamak için diğerleri ile' uyum içinde çalışır. Tann ’nın Pek Çok İsmi Geçmişimizin en eski efsanesi yaşamın kendisini yarat­ mak.

Musa'nın Tanrı’ya ‘'Beni kim in yolladığını söylem eli miyim?” som sunu sorduğunda aldığı isimdir. ya da yaradı­ lışın başlangıcı ve sonu. Mistik Yaşam Ağacı'mn on Sefirotu’n u kullanarak. (4) . Halevi yaradılışın tüm alanının nasıl Tanrı'nın p e k ço k m istik ism in­ den bir tarafından temsil edilebileceğini anlatır. Kabala’nın ilk versiyonlarında.Tanın'n m Şifresi Tanrı’yı bütünlüğü içinde bilme konu su n d ak i yetersizliği­ mizin en doğrudan tanımı belki de e n iyi günüm üz Kabala öğretmeni Z’ev ben Shimon Halevi’nin sözlerinde bulu n ­ maktadır. Bu bir mesajı İsraillilere iletmesi istendi­ ğinde. Tanrı anlam ı Sonsuz ya da Sonsuz Varlık olan Ayin Sof ismi ile sö ylenirdi. Tanrı’nın doğasının bilinem ezliğini açıklayan Kabala’dan örneklerle destekler. birbirinden çok farklı ve her bi­ ri Sonsuz Varlığın yardılışta kendini gösterdiği belli bir şekli netleştiren en azından altı isimle d a h a seslenm iştir. (3) Sırasıyla. Gerçek bir öğretm enin uzdilliliğiyle. Ya­ şam Ağacı’nın her bir Sefirotu Tanrı’n ın doğ asın ın bir özelli­ ğini işaret eden belli bir isimle ilişkilidir (bkz. EHYEH ASHER El-NEM (BEN BENİM).1).” (2) Eski İbrani metinlerin yo rumu ndaki uzm anlığı sayesin­ de. Şekil 6. Tanrı’nın gi­ zemini üç basit kelime ile özetlem ektedir: Tanrı Tanrı’dır. Şekil 6. İlk alan. ör­ neğin. ismi ile ilişkili o lan K eter’in ya da Taç’ın Sefirotudur.1: Hayat Ağacı'nın Sefirotu ile ilişkili olan Tann'mn isimleri arasındaki eşlikler. Halevi bu tanımı.(5) D aha so n ­ ra Sepher Yetzirah Tanrı’ya.

Her iki hikaye de Tora’nın ikinci kitabında ve Exodus’ün Eski Ahit Kitabı ’nd a saklanmaktadır.’ dediğim­ de ve onlar da bana ‘Onun İsmi nedir?’ diye sorduklarında. öte yandan. Ev Sahiplerinin Lordu. Tanrı'nın ismini bu dünyaya göstermesi olayı ilk defa Exodus'ün üçüncü bölüm ünde kaydedilmiştir. Her ne kadar Kur’an da bu hikayelerin genel temalarını an­ latsa da . Kabala ve Sepher Yetzirah gelenekleri' tek bir isimden gelen tek bir kuvvetin pek çok birleşimlerini ve doğrudan bilinemeyen bir gücün etkilerini anlatmaktadır. Kainatın Kralı ve El Shaddai'dir.Gregg Braden Bu isimlerin örnekleri Yalı. Exodus Musa'nın cevap olarak tek bir soru sorduğunu kaydeder: "İsrail’e vardığım zaman ve onlara ‘Babalarınızın Tanrı’sıı beni size yolladı. Musa’dan Mısır Firavunu’na bir mesaj iletmesini istedikten sonra. İsra­ il’in Tanrı’sı.Tanrı’nın kişisel ismi İslam ge­ leneğinde dışsal olarak ortaya çıkmıyor gibi gözükmektedir. Yahudi ve Hıristiyan isiml eri aynı kaynaktan çıktıkları ve ya­ radılışın aynı gücüne eş oldu kları görülmektedir. hikaye Tanrı ile Musa arasında geçen. Yaşayan Tanrı. onlara ne demeliyim?” (7) Yazıları içinden en eski versiyona göre. Yanan çalılık mucizesinde. Tanrı’nın İslami. Tanrı’nın kendisini çok kişisel olan tek bir isimle ortaya çıkardığı söylenen en az iki örnek kaydetmiştir.İbrani geleneğin Tanrı’nın gizli ismini ortaya çı­ kardığını söylediği Musa’nın Sinai dağında Tanrı’dan “Ka­ nuncu alması ile sona eren . Tanrı Musa’ya doğrudan yanıt verir. Eski İbrani ve Hıristiyan gelenekler. (6) Sonuçta. İbrahim’in. İshak’ın ve Yakup’un ve Musa’nın babasının Tanrısı tarafından tarif edi­ len aynı Tanrı olduğunu ilan ettiği doğrud an bir konuşma olarak anlatılmıştır. Exodus’un başlangıcı 3:14’de Tanrı mistik “EHYEH ASHER EHYEH” kelimelerini verir ve devam /^ T \ Ben ki B e n ’im . Tanrı'nın kendisinin Musa’nın atalarının. Bölüm 9’da göreceğimiz gibi.

” “BEN (Kİ) BEN OLACAĞIM. Asher’in anlamı “ki”. Yazılışı değiştirmeden. Ben olacak kişi olacağım. ki bunlara "BEN (Kİ) BENİM. ilkinin İkincisine nazaran farklı bir zam an kipinde o ld u ğ u n u göstermektedir. her birinin kelim enin kullanış şekline göre doğru olduğunu söylemektedir.” İbrani bir kelime olan Ehyeh “olm ak” kelim esinden birin­ ci tekil şahıs olarak türemiştir. Ya da h er biri aynı z a ­ man kipini temsil ediyor da olabilir. ya da “ki o ” olabilir. Bu örnekte. Tanrı Asher kelimesini doğrudan iki Ehyeh kelimesinin arasına yerleştirmiştir. olarak işlev görm ektedir. isim sunulduğu sırada hangi zam an kipinin kastedilm iş olduğudur. Bu tercüm eler “Ehyeh”i tercüme ettiklerinde sonuç “Benim . aynı sözcükle kelimenin iki kere tekrar etm esi gerçeği. Kelim e­ nin kendisi İbranicenin gücünün u r u c u bir örneğidir.’” Bu kelimelerle birlikte gizem ve tartışmalar başladı ve o andan sonra 3. Bazı Tora yorumcuları bu belirsizliğin farklı ter­ cüm elerden kaynaklandığını. Buna ek o la­ rak. Tanrı'nın Musa’ya ism ini açıkla­ ması olayında. Kutsal yazıların tercüm esinde e n çok kullanılan “BEN Kİ O BENİM"dir.” Böylece. Her biri doğru bir tercüm edir ve kelim enin nasıl kullanıldığına göre değişir.” ya da »Ben Benim.200 yıl boyunca devam etti. ilki “Benim ” olarak sonuçla­ nırken diğeri “Ben olacağım” olabilir. açık olm ayan şey. “Böylece İsraillilere söyleyesin. “Ehyeh-Asher Ehyeh." p ek çok şe ­ kilde okunabilir.” “B en o laca­ ğım. Musa ile kimliğini paylaşm ak için te­ meli yayarak. Musa’ya K endi d o ğ ru . (8) Öte yandan. Eğer öyleyse. “Ben.” dahildir.” ya da “Olacağım” anlam ında olmaktadır. Asher belli bir zamir şekli. Tanrı’nm kendisini gittikçe _daha fazla ortaya çı­ karması ve kullandığı t kelimelerin m uhtem el tercüm eleri üzerine merkezlendi. Tartışma. ‘Ehyeh beni size yolla­ dı. en yaygın kabul edilen tercüme tarihsel ola­ rak "ki” dir. “Ehyeh ki Ehyeh. kendisinden hem en önce gelen kelim eyi işa­ ret eden göreli bir zamir. Tanrı'nın isminin ortaya çıkışını ön sö z y ap m ak için kullandığı kelimeler.Tanrı ’nm Şifresi eder.

bu sonsuza dek benim adımdır.” (9) İlk defa. İbranıceyi okurken. Tanrı’nın Musa'ya açıklamasıyla. T a n r ı ’m n K iş is e l İ s m i Exodus’de kimliğinin ortaya çıkışının başlangıcım taki­ ben. dahil ederek uyguladığımı lüt­ fen not edin. olmakta olan ve olacak olan herşeyin kaynağı) özdeştirdiğini söylemektedir. Tora daha sonraki açıklamada Tanrı’nm kişisel isminin gizemin açığa çıktığını kaydeder: “Böylece İsraillilere konu­ şacaksın: Efendi. İbrahim’in Tanrı’sı. Tanrı’nın ismi İsminin geri kalan üç sessiz harfi ile açığa çıkar ki bunlar dört harf olarak yazılırlar (Y) (H) 1 (V) M (H): YHVH. Her ne kadar Tanrı kendisini ilk başlangıçta “Ehyeh-Asher Ehyeh” (Ben ki Benim) olarak tanımlamış olsa da. öte yandan. ishak’ın Tanrı’sı ve Yakup’un Tanrı’sı beni size yolladı: Bu her zaman benim ismim olacaktır. Aynı metinlerin daha eski versiyonları. dolayısıyla k el ime si olarak görünür. İbrani kelimeleri. Bu ade ti tüm kitap boym ca. bu ifadede Tanrı’nın kendisini “EFENDİ” olarak ta­ nımladığını göstermektedir. harfler sağdan sola doğru okunur. Hem İbrani hem de hıristiyan yazı larının günümüz tercü­ meleri. kutsal ve konuşulamayan isim YaHWeH. 'Eski İbraniceden seslilerin atılmasının adetini ta­ kiben. babalarınızın Tanrı’sı. YHVH’nin EHYEH isminin eski bir varyasyonu olması m üm kün­ dür.Gregg Braden ve kişisel ism in i sunm adan önce Tanrı ’mn kendisini ilk ön­ ce başarı ile tamamladıklarıyla (olmuş olan. (10) YHVH ismi Musa’dan önceki Patrikler tarafından f Uü \ . Kesin olarak isimlerin hangisinin Musa'ya aslında Tanrı’nın kişisel ismi olarak verildiği ile ilgili karışıklığı görmek için başladığımız yer işte bu YHVH isminin harfleridir. Musa’ya başlangıçta başka bir ismin verildiğini ortaya çıkarır: mistik. tercümeleri her ne ka­ dar soldan sağa okunsa da. onun kişisel ismine doğru dan bir girişe sahip olmaktayız.

O nun kutsal ismine istinaden. Bu özel isimin öylesine kutsal. kendisi bu inanç için bir temel şart koşarak uyarısını yapar: “Tanrınız Yal-IWeH’in ismini yanlış kullanmamalısınız. Tora uz­ manları ismin kullanımına dair bir uyarının kelimelerin ken­ di içlerinde doğal olarak bulunduğunu söylerler. Tanrı'nın Musa'ya ismini tanımlaması şeklinde bu­ nun açığa vurulduğuna inanmaktadırlar.) harfi olan olarak değil t:.^.düşünerek.” (14) ..olarak ya­ zılmıştır. Genesis zamanında onun anlamını Ya­ ratanın asıl ismi olarak asla anlamadılar.823) kezdir. Tora’nın. yorum devam eder: “Hiçbir insan İsmi harflerine uygun olarak dile getirmemeli­ dir. Belirgin olarak. Cennetteki Tanrı'nın çeşitli yüzlerine atfedilen pek çok isim olmuş olsa da. öylesine güçlü ve öylesine derin saygıya layık olduğuna inanılır ki. onun yanl ış bir şekilde di­ le getirmek ya da bir şekilde ona saygısı zca davranmak Tanrı'yı olabilecek en kötü şekilde lekelemek demekti. Vav’ın kayıp olmasının ismin saklı bir şey olarak anlaşılması gerektiği için olduğuna işaret ederler. Tanrı'nın ismini asla yeryüzündeki insanlar arasında dile getirilme niyetinde olmadığı gibi bir amaç verilmiştir. Patriklerin günlerinde Musa zamanına kadar geçen asırlar boyunca. gerçek saydıkları as­ lında YHVH isminin basitçe Yaşayan Tanrı’nın bir başka yü­ zü olduğudur.(12) Bu ipucu üzerine .” (13) Exodus’deki iki hikayeyi temel aldığımızda. İbranice sonsuza dek kelimesi geleneksel olarak söylendiği gibi or­ tasında Vav ( I. isim “geleneksel bir isimden daha fazlası hemen hemen hiç olmamıştır. Uzmanlar. Genesis sırasında. eski İbrani metinlerde Tanrı'yı tercih ettiği YHVH ismi ile adlandırma yaklaşık 6.”(11) T a n rın ın Konuşulam ayan İsmi İbranicenin kendisinde.Tanrı ’nm Şifresi net olarak bilinse de.ismi olacağını ifade ettiği zaman. Tanrı YHVH’nin “sonsuza d ek ”.800 (bazı hikayelerle net ol arak 6.

M. ilk görüşmelerini takiben ortaya çıkabilmiş olabilecek herhangi bir yanlış anlaşılmayı netleştirerek Kendisini tekrar tanıtır. (16) Her ne kadar İbrani alfabesinde W har­ fi olmasa da. yaklaşık 6.Ö.Geleneksel olarak. orjinal ismin asıl söylenişi geçmişte ka­ lan bir şey oluvermiştir. (15) Her ne kadar doğnı söylenişi Tapınak’ın sözel geleneklerinde korunm uş olsa da. Musa’nın günlerinde. İsim sadece tapınak servisleri sırasında yüksek papaz tarafından. Burada satırlar arasına Tanrı’nın kutsal ve söylenmeyen ismini temsil eden semboller olarak dört nokta yerleştirme anlaşması gösterilmektedir. Tanrı /^6Ç Î\ Gregg Braden .2 ilk Isaiah Yazmasından (1Qisa) ^^XXI kolonun bir bölüm ünü göstermektedir. Exodus 6:2-3'de. bugün ^HVH isminin nasıl söy­ lendiğini net olarak bilememekteyiz. Uzman fikirlerin büyük bölümü. 1947'de bulunan İsaiah’ın ilk yazısı gibi.200 yıl önce gerçekleştiğinin somut kanıtını sunmaktadır. Y^HVH’nin “Yah-Weigh” olarak söylen­ diği üzerinedir. Şekil 6. ya da tam olarak "İsim” olan Ha Shem ya da Adonai halini almıştır. yanlış kullanımını engellemek amacıyla metinlerde başka bir isim ile yer değiştirilmiştir. Ölü Deniz Yazmalarının parçalar. Tanrı’nın ismi için bir başka kelimenin yerine geçirilme­ si gerçekleştiğinde. Tanrı’nın ismini değiştirmek için alterna­ tif bir kelime ya da sembolü yerine geçirme uygulamasının halihazırda. Kefaret. bir Yahudi edebiyat koleksiyonu dördüncü ve beşinci yüzyıllar arasında zaman­ da derlenmiş. Tanrı tarafından Exodus’de tanımlanan ismi. Yazmaların yaratıldığı dönemde bile.800 kez tekrarlanan Tanrı’nın isminin hepsi anlamı Efendi. Musa’nın. yaklaşık 2.70 ’de Kudüs’deki İkinci Tapınak’ın yıkılması ile Talm ud’un derlenmesi arasında bir yerde. İbrani yorumcuların "Deity” olarak tanımladık­ ları ikinci karşılaşmasında Tanrı. söylemde V harfi W’nun sesi ile yer değiştiril­ miştir. Daha sonra. Tevrat’ta ismin aslen Musa’ya sesli harfler olmaks ızın ve­ rilmiş olmasından dolayı. G ünü’nde yeknesak bir şekilde okuyarak dile getirilirdi.

2: İlk Isaiah yazmasının bölümü. Daha sonra kendisinin İsrailli büyüklere görünen ve onlara neden o za­ manlarda isınini bilmemiş olabileceklerini açıklayan aynı Tanrı olduğunu teyid etmeye devam e d er. İs­ hak ve İbrahim’e kişisel ism inden ziyade' bir simge aracılı­ ğıyla tanıttığını ileri sürerler. İshak ve Yakub'a El Shaddai olarak göründüm . Kendi sözleriyle. ’nm Şifresi Şekil 6.Tanrı. uzmanlar Tanrı’nın kendisini bir kez daha Yakup. (17) (Fotoğraf: John Trevor) Musa ’ya net bir şekilde : “Ben ^YHVH’yim” der. ^YHVH isminin aslında yaklaşık . sayfanın ortasında. ama onlara kendimi ismi ile tanıtm adım . ‘İbrahim . El Shaddai ifadesi genellikle “Herşeye Kadir Tanrı” ya da “Gücü sınırsız Herşeye K adir” anlamındadır. (19) Böylece. bu dünyanın insanlarının onu her zaman bileceği çok b elir­ gin bir isim sunmaktadır. Tann'nın kutsal ismi için bir temsilci olarak yerleştirilmiş dört nokta gösterilmektedir. tercümeler ve basımlar. Tanrı ’nın En Yaşlı İsm inin K adim K anıtı Bilinen en eski İbrani metinler üzerine yapılan son k e şif­ ler.” Bu cüm le­ lerde. dünya dinlerinin y an sın d an çoğunun temelini oluşturan ilk kayıtlarda tam iki kez 'Tanrı. ikinci cümlenin üzerinde.

Mümkün olduğu kadar tamamlanmış bir belge oluş­ turma çabası içinde. Bu tek kelime Tanrı’nın Kendisini Musa’ya tanıtırken kullandığı kişisel ismidir. Bulgu ile ilgili bir eleştiride. bu ismin binlerce parça arasından bozulmamış olarak bulunmasını bir ironi olarak yommlan^JT'. Zaman ve doğa faktörlerin­ den kurtularak. öyle ki belli bir belgeye bağlanamamaktadıdar. 12 yıllık bir araştırma ve bu bölümün ilerleyen sayfalarında açıklayacağım kanıtın b u l u l a s ı sonucu. hem uzmanla­ rın hem de tesadüfi okuyucuların dikkatini hemen çekmek­ tedir.000 adet daha parça bulunmaktadır. Tarnı’nın gücünü ve varlığını tanımlamak için kullanılan pek . Her bir harfi net ve okunabilir olan minik parçalardan bi­ rinde. arkeolojik gazete Biblical Archaelogy Review’un editörü Hershel Shanks. tercüme edilmiş ve de rlenmiş 3.000 ön­ ce dikkatle yazdığı gibi korunmuş ve harfler bir kelimeyi öylesine yanlışsız bir şekilde taşımaktadır ki. yazarın her bir çizgiyi ve kıvrımı 2. tek bir kelime kalmıştır. “Bu sadece basit bir tesadüf mü? Ya da bunun anlamı bu ismin bu dini belgelerde böylesine çok kullanılmış olması mı onun sıklıkla ortaya çıkışı­ nı (ve hayatta kalışını) sağlıyor? Ya da daha derin bir anla­ mı mı var bunun?” (21) ‘‘Tanrı’nın Şifresini yazmadan önce. hayva n derisi ve bakır par­ çalarına ek olarak. şimdi Ölü Deniz Kütüphanesinin en önemli bulguları haline gelmişlerdir. Sinai Dağında Mu­ sa’ya hangi isim ile kend ini tanıttığını mümkün olduğu ka­ dar doğru bir şekilde oturtmam gerekiyordu. Şekil 6:3).Gregg Braden 3. Yazma uzmanları tarafından “kırıntı ve parçalar” olarak adlandırılan bu parçalar. Bununla birlikte. Ölü Deniz Yazmaları Kütüphanesini bir araya getiren yakla şık 22. halen Ölü Deniz Yazmalarının muazzam keşfin in bir parça­ larıdır. Bunlar yazmaların son derece küçük parçalarıdır.000 papirus. : (bkz. tüm mantıksal şüphelerin ötesin­ de ve bu konu hakkındaki akademik uyuşmazlıklara karşın. yakın zamanda belgelenmiş.500 yıl önce Musa’ya beliren isim olduğu tezini kuvvetlen­ dirmektedir.

doğru kelimenin böylesi bir güce sahip olup kullanmasının geri alınıp iade edilmesine kadar.T a n n 'n ı n Şifresi Şekil 6:3: Tanrı'nın eski ismi Mlrt't 'un en eski kayıtlarından birinin büyütülmüş hali. Ölü Deniz Yazmatan Kütüphanesinin belli bir yazmaya bağlanamayan 3. saklı tarikatlar ve gizli topluluklar tarafından ayakta tutulmuş ve korunmuştur. ^HVH isminin içindeki gücünün ilave kanıtı Masonların geleneklerinde korunm uş olan efsa­ neler ve törelerde bulunabilmektedir. Yaşamın . "İsmin ” Gücü Yaradılışın sırları ile ilgili kişisel bir içedoğuşun eksikli­ ğinde. Metnin bu parçası.000 parçasından biridir. Bu isim dört harflidir: Y ^^H . yaşamlarımıza anlam katmak ve dünyamıza bir anla­ yış yüklemek için. Tanrı’nın isminin etrafındaki gizem geçmişimizdeki papaz­ lıklar. Mah Hah Bone kelimesi­ nin bir temsilci “parola" olarak kullanıldığını söyler. Bu tür hikayelerden biri Kral Süleyman’ın baş mimarı olan ve öldürüldükten sonra tek bir kelimenin kullanımıyla hataya dönen Hiram Abif’in hikayesidir. Öte yandan efsane. bu tür tesadüflerin eski hikayelerine ve bu hikayelere yaptığımız yorumlara kalmış durumdayız. Mağra IV’den parça no 66. (20) (Fotoğraf: Israel Antiquities Authority) x şn çok kelime ve isimden sadece birinin Tanrı’nın kendisini net bir şekilde tanımladığı kişisel ve tercih edilen isim olarak ayakta kaldığına eminim.

telafuz etme ve seslendirmedir. Exodus 15:2 şöyle der: “Efendi (Yah) benim .tarafından kullanılmış olan sürecin geniş bir özetini sunmaktadır. sonsuzlukta oturan ve K utsaldır O nun ismi.(23) Bu cümlede Yaratıcı’ya verilen ilk isimin. Öte yandan. El Shaddai. “Ebedi” olarak tercüme edilen YH (25) is­ minin esasına kısaltılmış. Ya da. ”.en fazla beş isim tarafından tanımlanan . (26) YH’nin geleneksel yazılardaki kullanımı bugün hem Tevrat hem de İncil’in yenilenmiş versiyonlarında bulu­ nabilir. YHVH isminin aslında Yaratıcının kişisel ismi olduğunu öne süren arkeolojik kanıta ek olarak. ^H . yü ce ve yüksek. Tanrı’nın ismi ile ilgili gizemin temeli pek çok kişi tarafıdan inanılan “Cennetin altındaki)’ en güçlü ve kutsal olan tek bir ismi heceleme. kainatı­ mızın doğuşunun harekete geçmesi için yüce bir güç . Tora'da. (22) Herhangi bir efsane için geçerli olan hikayeyi. YHVH is­ minin eski bir şekli olduğu Tevrat uzmanları tarafından ge­ nel olarak kabul edilmektedir. Yaşayan Tann. ^HVH’nin küçültülmüş formu ola­ bilir. sayılarla ve anlatarak yarattı.v Sahiplerinin YH~VH’si. İsme atfedilen yaradılış ve yaşamın verilmiş güçlerinin yeniden diriliş ile ilişkili olması şaşırtıcı olmaz. İlk bölüm de gördüğümüz gibi Sepher Yetzirah. (24) Bu ismi kuşatan belirsiz­ lik kesin olarak ismin nasıl türediği yönünde artmaktadır. “Bilgeliğin 3 2 mistik Yolu ile YH'yi oydu. Bu aslında. YHVH’nin genişletilmesiyle oluşan ismin orjinal ha­ li olabilir.Gregg Braden gerçek kelimesi Tanrı’nın söylenemeyen ismiydi: YHVH. doğrula­ ma gücü olm adan kabul etmek kişisel bir inanç meselesidir. O Kainatını üç kitapla. O bölüm ün ilk cümlesinde. bize T ann’nm kainatını bilmenin ve iletmenin üç yolu ile yarattığı söylenmişti. elle yazarak. E. Sepher Yetzirah'da veril­ miş olan ismi dikkate alarak başka bir kanıt toplanmıştır. İsrail'in Tanrı’sı.

(27) Tanrı’nın ismi olarak Yah'ın belki de en d o ğ n ıd a n b e lir­ tisi bize Haggadah’da verilmiştir. H aggadah v e Sepl.” İngilizce versiyonlarında T an rı’yı kasteden “Efendi” kelimesi kullanılırken.er Yetzirah’ın perspektifinden bakıldığında.ı.rumculann karışık tartışmaları olsa da. Havva’nın yaratıldığından önce ona verilm iş olan Adem ismini bırakarak. karısını Ishah ve k e n d isini de Islı olarak adlandırdı çünkü Tanrı.Tanrı ’nın Şifresi gücüm ve kudretimdir. Metinde anlatıldığı gibi. . b u n u n b ö y le o lm a ­ sı çok muhtemeldir.Yod Ish’a ve H e Ishah'a — e k le ­ mişti. Adem’in Havva ile Bahçe’de evlenm esinin h ik ay esi aracı­ lığı ile tanıtılan metin okuyucunun kafasıqdan b iraz ş ü p h e bırakarak yazılmıştır zira Tanrı kendini Y eryüzünde M u­ sa’nın zamanından bir önce açığa çıkarm aktadır. on ların Tanrı’nın yolunda yürüdükleri ve em irlerini y erin e g etir­ dikleri sürece isminin onları tüm k ö tü lü k lerd en k o ru ­ yacağının göstergesi olarak kendi ism i Yah'ı e rk e k ve kadının isimlerine . hem Adem hem de Havva. birleşm elerinin içle­ rinde neden olduğu değişikliği yansıtm ak için isim lerini d e ­ ğiştirirler. (28) YH’nın tanrısal bir isim olup olm adığına dair İb ra n i y o ­ . onlar T anrı’n ın ism ini kendininkilerle birleştiren türüm üzün ilkiydiler: N ^ } y Adem. Evlilikleri­ ni takiben. İbrani m etin T anrı’nın ismi Yah’ı Yod ve Hey harfleri olarak net bir şe k ild e gösterir. Sepher Yetzirah'ın b u ilk ve ço k ö n e m ­ li ifadesinde. yazı YH isimli tanrısal varlığın nasıl yazılı. sa ­ yısal ve sözlü olarak tanım lanan bilginin üç tü rü n ü n k u lla ­ nımı aracılığıyla yaradılış hareketini gerçekleştirdiğini a n la t­ maktadır.

Bedenlerimizde. sadece bu harfler sayesinde Tanrı’nın kainatı inşa ettiğini belirtir. Sepher Yetzirah’ın bu bölüm ünü Tanrı’nın kainatını «yazıyla (Sepher). kainatın . (29) Girişi takiben. Anlamlarında az da olsa şüphe uyandıran cümleler. sayı ve iletişimin tercümesin i sırasıyla nitelik. ” (30) Anlam o kadar açık ki. onları değiştirdi. ''22 harf. nicelik ve iletişimi ilave edip genişleterek açığa kavuşturmuştur. Öte yandan. Haham da­ ha sonra bu üç bilme şeklinin daha hassas anlamlarını m e­ tin.doğmasına izin veren harfler her insan hücresinde mucize olarak üretildi. Kabala’ya olan il­ ginin yeniden güçlenmesinden dolayı. kopya­ landı ve depolandı. sayıyla (sephar) ve ileti­ şimle (sippur)” yaratışı olarak tercüme etmiştir. mısralar aracılığıyla kainatın başlangıcından bedenlerimizle ilişkisine kadar büyük kavramları sırasıyla anlatır. onları tarttı. bu kitabın amacını gözönüne alarak. Sep­ her Yetzirah Tanrı’nın yaradılışını tamamladığı asıl süreci detaylandırır. Kısa ve düzyazı şeklinde paragraflar. On Sefirotun boşluktan ortaya çıkmasından sonra. yazı nasıl “Hiçliğin On Sefirotu”nun. Onları kazıdı. ima ettikleri insanın kafasını ka­ rıştırıyor. varlığa belli nitelikler getirmiştir: yaşamın ve yaradılışın tüm ele­ mentlerini baştan sona yansıtan nitelikler. sadece bedenimizin her bir hücresinden saklı olan yaşayan mesaja bizi doğrudan götüren Sepher Yetzirah’ın bölümlerine odaklanacağız.ve Tann’nın ismi ile ba­ şarıyla sonuçlandırdığı herşeyin . onları oydu. günümüz dünyasında onun zamansız bilgeliğinin anlayış ve uygulamasına adan­ mış bir dizi mükemmel metin bulunmaktadır.T ek b ir İs im d e n K a in a t Haham Kaplan. \ /^i\ Gregg Braden . onları değiştirdi ve onlardan hiç olmamış olanı ve hiç olmayacak olanı oluşturdu. mis­ tik Hayat Ağacı’nm on krallığının yaratıldığını anlatır. Her bir Sefirot kainatın boşluğundan oluştuğundan dolayı.

(31) İnsanı ü rküten b u z a m a n süresinde. Böyle yaparak.. ' DNA: Yaşamın “Rosetta Taşı” Kozmosun tüm şemasında. Y e^üzünün yaklaşık 4. saa t 12 olm a­ dan önceki son iki ya da üç dakika in san h a y a tın ın ortaya çıkışının kanıtını taşımaktaydı. İlk türüm üzü gelişi ise sad ece 160. bizler sa d e c e kısaca g ezeg e­ nimizin yaşam süreci içinde varolan b ir türüz. yüzyılın son bölüm ünde DNA m olekülü bir "dil” olarak tanımlandı. DN^mızı oluşturan elem en tlerin yerine İbrani alfabesinin harflerini koym anın şifreyi b ize m ü m k ü n kılacağı gösterilmiştir. o zamanların deyimiyle bizleri v aroluşum uzun bilgisi­ ni keşfetmek için “içe bakmaya" davet ettiler. genetik kodun bir dile nasıl çevrilebildiğini a n la m a k için ö n ­ celikle DNA’nın bedenlerim izde nasıl çalıştığını kısaca anla­ mamız gerekir. herbirinin ne zam an başladığı ile ilgili gittikçe b ü ­ yüyen bir orta karar ortaya çıkıyor g ö rü n m e k te d ir.000 yıl öncesine . H er sa a t Y ery ü zü n ü n va­ roluşunun engin genişliklerini temsil e d e rk e n . onların bilgelikleri bizlerin m odern DNA m acerasını bir adım ötedeki bir dil olarak taşımamıza izin verm ektedir. kainatın yaşının ve insanlığın d o ğ u m u n u n ortaya çı­ kışlarının göreceli zamanlarını gösteren tipik b ir saatin y ü ­ zünde resmedildiğini hatırlıyorum. Bir o k u l kita­ bında. Sadece geçmişimizdeki eski kayıtlarda k o ru n m u ş o lan ta­ limatları izleyerek. Big Bang(Büyük Patlama) teorisini d e ste k le y e n y e n i bir kanıtla birlikte. Yaradılış anından ve insan hayatının b a şla n g ıc ın d a n ö n ­ ce kesin olarak ne olmuş olduğuna dair tartışm alar devam etse de.5 milyar yıl ö n c e o lu ştu ğ u n a inanıl­ maktadır. yaşam ım ızın dilini ter­ cüme edebileceğiz ve mesajı okuyabileceğiz.Tanrı ’ntn Şifresi Sadece 20. Ö te y a n d a n . Her ne kadar eskilerin hücreler ve moleküller için kullandıkları m odern kelim eleri olm am ış ol­ sa da. asırlar sonra. kainatın doğuşu yaklaşık 13 ila 14 m ilyar yıl ö n c e ­ sine gerilemiştir. B ugün.

İşlem belli bir zaman dilimi içinde dış­ sal bir ortamda gerçekleştirildikten sonra çocuk taşımaya doğurmaya her açıdan hazır bir kadının rahmine yerleştiri­ lerek gerçekleşmektedir.Gregg Braden dayanmaktadır. Böylesine afallatıcı tahmini zaman dilimleri­ nin gerçeğine yakın olduğunu varsayarsak. onlara gebe kalınmadan önce çocukların özelliklerini seçmemize. gelişmiş hücrelerin toplanması ve geliştirilmiş doku yaratmak için belli hücreleri kuluçkaya yatırılması amacı için gebe kalın­ masına olanak veren mucizevi güçlere bizi götürmektedir.20. yeni bir yaşam için cinsel ilişki gerekliliği bir m ecburiyete n çok bir tercih haline gelmiştir.annesinin rah­ minin dışında başarılı bir biç imde gebe kalınan ilk insan . Böylesi mucize gibi teknolojilerin gelişimleri 20. yüzyılın ortalarınd a yayınlanan te k bir raporla başlamıştır. İngiliz gazetesi Nature James Watson ve . o günden itibaren. Böyle bir gebe ka­ lışı tarif etmek için söylenen tüp bebek teriminin ortaya çık­ masıyla. 20. tek bir deneyimi ilk ata­ larımızla her zaman paylaşmış olduk. Yeıyüzünde ortaya çıktığımız andan itibaren. böylesi bir keşfin sınırı. gezegenimizde­ ki yaşamın %99’u ilk atala rımız ortaya çı kmadan önce geç­ miş demektir! Kesin olarak nasıl başladığımız ya da ne kadardır burada olduğumuz hakkındaki tartışmalara bakmaksızın. yüzyılın son kuşağına kadar. Louise . 1953 yılında. türüm üzün ilk üyeleri ile paylaştığımız bağ Louise Joy Brown’un doğumuyla sonsuza dek değişti. saat 11:47’de.000den fazla çocuğa anne rahminin dışında gebe kalındı. “Yaşamın S im ”nı Keşfettik! 1978 yılında. O yı­ lın 25 Temmuz’unda. bir insan hayatına gebe kalmak ve onu doğurmak işlevi aynı kalmıştır . O günden beri. Yaklaşık çeyrek mil­ yon yıldır.İn­ giltere'nin bir hastanesinde dünyaya geldi. gebe kaldıktan sonra özelliklerini değiştirmemize. Gebe kalma işini ve gebeliği yeni­ den tanımlamaya ek olarak.

olan sorumluluklarımız gibi hararetli tartışm a k o n u la n ola­ rak devam etmektedir.Tanrı ’nın Şifresi Francis Crick tarafından yazılan ve başlığı “N ükleik A sitlerin Moleküler Yapısı: Deoksitiboz Nükleik Asit için b ir Yapı. kök ■ hücre araştırmaları ve insan yaşam ının ilk b a s a m a k la rın a ’:. .o la n çift helezonlu yapıyı ortaya çıkardılar. yaşamın esasını değiştiren. yoğun bir araştırm a d ö n e m in i takiben sıradan geçen bir zam an dilim inde. Nobel Fizik/Tıp ödülü Watson. C rick ç a b a la rı so ­ nucu “yaşamın sırrını" bulduklarını ilan etm işti! (3 3 ) Bu sır onları Louise Brown’ın gebelik dışı d o ğ u m u n u m ü m k ü n kı­ lan teknolojiye götürecekti. günüm üzde de insan k lo n la m a . Tezlerinin yayınlanm a sıyla bir­ likte.." (32) ola n bir rapor yayınladı. Londra’daki K ing’s C ollege’d e n iki' bilim adam ı olan Rosalind Franklin ve Maurice W ilkins’in araştırm aları­ nın da dahil edilmesiyle.. etkileyen' ve d o ğ ru d a n planlayan bir kapı açıldı: DNA m olekülü.: baren. Crick ve Wilkins arasında DNA yapısın? keş/eltiklerı çalışmalarından dolayı paylaştırıldı. B ilim konu. Daha sonra Watson’un hatırlayacağı gibi. genetik davranışın g izem in i çöze n ve sonunda 1962 Nobel Ö dülü alm alarına n e d e n . D N A ’n ı n A l f a b e s i : Ç e v r i l d i Hemen hem en yaşam ın şifresinin k e şfe d ild iğ i a n d a n iti. bilimadamları ve bilim a dam ı o lm a y a n la r yaşam ın genetik kopyasını bir “dil" olarak tanım ladılar. Rosalind Franklin 1958 yılında öldü ve ödülde adı geçmedi. o zam anki B aşkan Bill C lin to n tarihteki en geniş kooperatif araştırma çaba larında n b irin i n eticelen ­ diren ik i şirketin liderleri ile birlikte o tu ru y o rd u : İ n s a n Geni (*) 1962 yılında. W atson v e C rick'in çalışmasına. W atson ve C rick'in k e ş fin in ah­ laki açıdan tepkileri.. Cambridge’deki Eagle P ub’a gitti v e o g ü n ü n saba­ hında keşfetmiş olduklarının önem ini b ö b ü rle n e re k anlattı. F ran cis C rick İn­ giltere. (*) Ç oğı zaman olduğu gibi.: ları ile ilgili 2000 yılı yazında ya p ılan n a d ir g ö r ü lm ü ş bir ba­ sın konferansında.

Öte yandan. ve adenin her zaman timin . En küçük tek hücreli organizmadan tek bir insan bedenini oluşturan yaklaşım 100 trilyon hücreye kadar.yaşamın kimyasal şifresinin “dil ini ” . yüzyılda tıp ve hayat bilimle­ rine yeni bir çağın kapısını açmışlardır. Yaşamın bu temel üniteleri . yaşamın yapı taşlarını . her bir çift yaşamın kopyasını çıkarmak için diğer çiftlerle birleşecek kalıplar içerirler. Kilometretaşının önemini. genetik kodum uzun ilk haritasını üretmişler ve 21.DNA esasları olarak adlandırılırlar.Gregg Brcıden Projesi. İnsanlığın ailesi olarak bizleri şu ana kadar ayırmış olan tüm farklılıkları aşan tek bir mesajı içinde saklayan işte bu dildir. Sadece bir bölümü anlaşılmış olan bir süreçten geçerek.tarif etm ede mecazi anlamdan çok daha öte bir şek ilde kullanılmaktadır. T. Son derecek teknik ol­ mayan bir anlatımla. Bedenlerimizdeki m e­ sajı ortaya çıkarmak için. Birleştirdikleri çabalar sonucu. yaşamın yapı taşları şaşılacak kadar ba­ sittir. Genetik araştırmanın esası tüm yaşamın sa­ dece dört kimyasal bileşimin bir araya gelmesi sonucu oluş­ tuğu anlayışına dayalıdır.adenin. her bir esas sadece belli bir eş ile çalışır: guanin her zaman sitozin ile çiftleşir (G-C). ' G ve C) . timin. Watsonlun dehası ve Crick’in keşfi onların DNA molekü­ lünü tanımlamalarında yatmaktadır. yaşamın alfa besini anlamamız ge­ rekir. anlatırken. her bir yaşam formunun şifresi bu dört esasın farklı bileşimlerinden oluşmuştur. ve öyle bir şekilde yerleştirilmişlerdir ki hem dikkat çe­ kici bir şekilde etkindirler hem de aynı zamanda göze de hi­ tap etmektedirler. guanin ve sitozin’dir (sırasıyla A. DNA'ya artık es­ ki ve tercüme edilebilir bir alfabenin gerçek dili olarak ba­ kılabilmesi netlik kazanmaktadır. esaslar kendilerini esas çiftler olarak b il inen belli çiftler şek­ linde düzenlerler. (34) Böylesine sık görülen referanslar. varolduğu bilinen tüm yaşam formlarını üretmek için gerekli tüm bilgiyi taşırlar. Başka bir de­ ğişle. Clinton genin “Tanrı’nın yaşamı yaratırkenki dili” olduğunu ilan etmiştir. bu kitapta tarif edilen ilişkilerden.

Tanrı ‘nm Şifresi Şekil 6.. bildiğimiz çift helezonu o lu ştu ru rla r (35) (bkz.4). G ile ve A. betik harf. Çiftler birbirleri ile zıt şek ild e d ü zen len ir­ ler ve deri benzeri yapısı olan kıvrılm ış bir el m erd iv en i şek­ lini. ile çiftleşir (A-T). s o n su z gibi g ö rü n e n alfa. 26 Haziran 2000’de. T ile. tüm d ü n y a şaşk ın lık v e m erak için­ de biri özel diğeri federal b irb irin e ra k ip iki şirk etin kaynak­ larını İnsan DNA’sını oluşturan e sa sla rın nasıl d ü zenlendiği­ nin ilk haritasını üretm ek için b irleştird ik leri d u y u ru su n a şa­ hit oldu. ŞekiL 6..4: Beili esasların her zaman bir diğeri ile nasıl çiftleştiğini gösteren DNA'mn çifthelezon yapısının resmi: C.selleri televizyon e k ra n la rım ız d a n v e popüler . Bu esas çiftler son bir kaç yıldır b iz e çok tanıdık gelen genetik kodlama rakam ve işaretler sistem ini oluştururlar. Bu haritayı resm etm ede.

(36) Aşağıdaki. Bazıları yüzler­ ce harf uzunluğunda olan diziler. Eşleşen değerlerini temel alarak.akıp gidiyordu. elementleri harflere çeviren keşfi kullanmaktır. DNA’nın şifresini anlaşılabilir bir dile çevirmenin anahta­ rı. Yanıtında. Albert Einstein’a Tanrı’nın neye ben­ zediği ile ilgili k endi anlayışı sorulur. insan DNA m olekülünün farklı yerlerinde tanımlanmış olan esasları temsil ediyordu. hidrojen İbranice Yod (Y) harfine çevrilir. Bizi tür olarak eşsiz yapan 23 çift yaşayan bilgiyi (kromozomlar) oluşturan işte bu gen­ ler grubudur. Tanrı ’nın ismi ile m odern bilimin elementleri arasındaki bu köprü sayesinde.TTCTAAGATGGCTAGATAAGCATCTTCAGGGTTGTGCT TC T A T C T A G A A G G T A G A G C T G GTCGTTCAATAAAAGTCCTCAAGAGGTTGGTAATACGCAGTITAATAGTATGGT . Bu yerdeğişmeler. artık tüm gizemi açığa çıkarm ak ve hatta bedenimizin her bir hücresi olarak yaşayan eski bir şifredeki daha yüce bir anlamı bul­ mak m üm kün hale gelmiştir. genetik şifremizin (Şekil 6. bu şifrenin görünüm ünü res­ metmek için insan kromozomu 1 ’in bir bölümüdür: İn sa n kromozomu 1'in bir bölüm ünden iki y ü z kırk esas.Gregg Braden dergilerin sayfalarından hızla .S’de altı çizili harfler) sade kimyası olarak varolan Tanrı 'n m ismi­ nin eski şeklini ortaya çıkarır. Bu birleşimler gen olarak bilinir. oksijen Vav (V) ve karbon Gimel (G) olur. her ne ka­ dar Yaratıcı doğru d an görünmese bile. YH. nitrojen Hey (H). Her bir H ayatın Her Hücresinde: Şifre Açığa Çıktı Bir söyleşi sırasında. her günün her anında / ' kT \ GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAATAACACTGGGCTGTAGGAGTGATGGGGITCACCTCTAA.

‘‘bilinen dünyada kendisini gösteren yüce bir zekanın kanıtını derin­ den hissetmemden gelmektedir.Tanrı 'nm Şifresi iuğımda birleşmelerinden meydana geldiğine göre.” (37) Böylesine samimi bir görüş sayesinde. YHVH’deki son H . O zekayı yaşamın elementlerine bağlayan keşif bugün Eisntein’ın algısından bile çok daha büyük bir anlam vermektedir. “Benim Tanrı anlayışım. YHVG’nin hücrelerimizde çok bü­ yük sayıda birleşme şekli bulunmaktadır. Tann’nın eski isminin tüm dört harfi yerine m odern ele­ mentleri koyduğumuz zaman. Onun var olduğunun kanıtı bize gösterilmektedir diyerek gerçeğe bir dokundurm a yapmıştır. bizlere son yüzyılın en büyük beyinlerin­ den bi ri nin algılayış şekliyle dünyamızın altında yatan zeka hakkında bir anlık görüş verilmektedir. öyle bir sonuca varırız ki ilk başta hiç beklenm edik olabilmektedir." diye paylaşır Einstein.

Başka bir deyişle. bizlere onun heryerde varolan ve bu dünyada gözle görülemez bir şekil alan olduğu anlatılmıştır. Bu Kutsal Nefestir. Sepher Yetzirah daha sonra yaradılışın boşluğundan Ka­ inatı m üm kün kılan Temel Harf olarak yayılan ilk İbrani har­ fi anlatır: Alef. Belki bu ifadelerde. d ü n ya la n n ya şa m ı. Her iki tanım da aynı elementi tarif ediyor gibidir! Exodus bizlere çok belirgin terimlerle.dönüşür.Gregg Braden yerine onun kimyasal eşdeğeri olan nitrojeni yarleştirdiğimizde. varolan herşeyin . Dolayısıyla o sadece ortaya koydukları ile bilinebilmektedir. kokusuz ve görün­ meyen gazlardır! . Genesis’in ilk bölümleri yaradılış sırasın­ da varolanın Yaratıcı’nın fiziksel olmayan şekli olduğunu anlatır (Genesis 1:2). Aynı d e ­ recede net terimlerle. nitrojen.hepsi renksiz.. Toprağın yüzeyi boyunca ilk hareket eden “Tanrı’nın Ruhuydu”. Sepher Yetzirah Tanrı’nın varlığının bu fiziksel olmayan şeklini Tanrı’nın “Nefesi” ola­ rak tanımlar. “Hiçliğin On Sefirotu: Biri Yaşayan T a n n ’nın Nefesidir. Yüce ve mistik “sır” sayesinde. insanoğlunun Tanrı’nın “imgesinden” yapıldığı gösterilmiştir. oksijen ve nitrojen (HNON) elementlerine . Y î V I isminin Tanrı’nın kişisel ismi olarak açığa çıktığım hatırlatır. T anrıcın ismi hidrojen. ” (38) Buna ek olarak. Alef kainatı­ mızda ortaya çıkan ilk elem ent olan Hidrojen ve Tanrı’nın isminin ilk harfi olarak evrimleşir: Yod. Tanrının ki­ şisel isminin %100'ünü bu dünyanın elementleri ile yer de­ ğiştirmek fiziksel varlığı olmayan ama yaradılışın son dere­ ce gerçek bir şekl i olan bir maddeyi ortaya çıkarır! Hakikaten de. Tanrı’nın ilk tanımlamalarında. Big Bang ile ilgili m odern teoriler hidrojenin yaradılış sırasında açığa çıkan ilk element olduğunu ve kainattaki en bol element olarak kal­ dığını öne sürer.

köklerim izle ilgili ifade bizlere T an­ rı gibi ya da ona eşit yerine sa d e c e o n u n im gesinden yapıl­ dığımızı hatırlatır. Bu Tanrı’nın görünm ez bir g a z d e m e tin d e n yapıldığı an­ lamına gelm em ektedir. Y H ^ H ’clen bizi so n derece fark­ lı kılan birşeyler y ü zünden ayrı d ü ştü ğ ü m ü z ü de ifade eder. es ki harfler yerine m o ­ dern elem entler geçirildiğinde. Bizi T a n rı’d a n ayıran bu tek harf aynı zam anda bizi d ü n yam ızda “g e r ç e k ” kılan elementtir. Altta Şekil 6. bu ifa d e bizlerin Yaratıcımızın: özelliklerini ş ü p h e götürm ez bir b i­ çim de paylaşıyor olsak da.6).birleşimimizin %25'i çok farklıdır gösterir. olm akta ve o laca k o la n h erşe y in bir parçası ol­ duğunu anlatır. dünya­ mız ve yaşamın temeli m ü m k ü n kılınm ıştır. ta d ın ı. Yeni bir vurgu ile. k im y asal ismimizin d ö rd ü n ­ cü ve son harfi T an n ’dan ayrı k a lm a k ta d ır (bkz. Kendi­ sinin olmuş.bize bedenim izin rengıni. kai­ nattaki tek en bol elem en t o la n h id ro je n form unda. d o k u su n u ve sesini veren “m addedir": karbon. ismimizin son harfi. nitrojen ve oksijenin görünm ez ve duyum sanm az b ir şe k ild e y k e n . bu durum Tanrı'nın isminin dört harfinden üçünü genetik kodla­ rımız olarak kullanırken Onunla eşit olmadığımızı . . Dil aracılığıyla. Tanrı bize.Tanrı’mn Şifresi Şekil 6. Tanrı’nın varlığı üç gaz. h id ro je n . D aha d o ğ ru b ir deyişle. O 'nun üç milenyum önce M usa’ya açık ladığı ism i sayesinde. kaynağı ile ilişkimizi tanım layan en k e sin ipucu bulunm ak­ tadır. Bize fizikselliği veren ve bir tür olarak eşsiz olduğumuzu gösteren işte bu fark­ lılıktır. He r n e k ad a r g ü ç algılansa da. Her ne kadar bizler Y aratıcım ızın ism inin %75’ini temsil eden ilk üç harfi paylaşıyor olsak d a .6: Tanrı'nrn isminin YHVH'sindeki H İnsanın YHVG'sindeki G He yer değiştiril­ miştir.

Gregg Braden İnsan Bedeninde Tann ’nın İsmi Efsane. YH. Bu tek isim dört harflik YHVH idi. özgünlükler zaman ve kültür içinde değiş­ se de. konum u ve döşe­ nişi ile ilgilidir. Uzmanlar genellikle ve YH isimlerini değişm ez olarak kabul ederler. m odern İngilizcede. bir taşın. (41) Tam ola­ rak bu “ebedi” yön hem Tanrının ismi YHVH’de hem de in­ sanın bedeninde. ortaktır. Bu asla bitmeyen nite­ liği Yaratıcımız ile. daha evvel not edildiği gibi onun YH olarak kısaltılmış ver­ siyonunu da kullanmışlardır. Bugün Masonların gelenekleri sayesin­ de korunan bu ritüel. İlkçağla­ rın gizli harf şifreleri ve DNA’nın bir alfabe olarak tam ter­ cümesi sayesinde. altı çizildiği gibi. Tanrı’nın ismini v e insanın bedenini oluşturan günümüz harfleri yakın incelemesi. ulusunun gücünü temel aldığı ve yeryüzünün organize ol­ muş dinlerinin üçte b irini n temeli haline gelmiş bir isim ol­ muştur. . Sembolik olarak. Denir ki. kral bizzat tek bir isim yazdığı bir parşömen parçasını bu temel taşının içine yerleştirmiştir. Kral Süleyman’ın Kudüs’te kutsal tapınağını inşa ettiği zaman. ebedi kelimesinin anlamı net olarak başlangıcı ve sonu olmayan ve zamanın sınırlarının ötesinde işleyen bir varoluşu kastetmektedir. İncildeki metinlerin orjinal versiyonları Tanrı’nın ismini olarak bildiriyorsa da. büyük yapının diğer taşları­ nın sıra sıra merkezlendiği temel taşının. ismi “Ebedi" olarak okunabilir. bu eski ilişkinin bugün bize ne söylediğini net olarak açıklar. genetik şifremizi tanımlayan elementlerin %50'si aracılığıyla paylaşmaktayız. Tann’nın zaman­ sız ismi. (39) tercüme edildiğinde. varlığımızla ilgili birşeylerin kalıcı ve ebe­ di olduğunu bizlere göstermektedir. Kral Süleyman'ın insanlarının liderliğini. Kudüs’ün Kutsal Tapınağının temel taşına tutturulmuş isim. YHVG. döşenen ilk taşın bile katıldığı eski bir ritüelin başlatıldığını söyler. (40) Her ne kadar.

. ver-ilmiş bir.7b). ya da anlamı “kan” olan A dem i s m in i n k ö k ü n ü temsil eder. dılışın değişerek oluşan alanlan ile ilişkilidir..nı sonuç olan 3’ü vermesi gibi. (43) GV DM’yi.Taun ’nın Şifresi YHVH YHVG = = Tann'nın adı İnsanın adı YH (Tann/Ebedi) Tanrı ’n ın ism inin ve h ü c r e le r im iz d e k i Şifrelenmiş ismin ya n sın ı o lu ştu rm a kta d ır. ) İbranicede. Geınatria bilim inde. T ann’nın bedenim izde n a s ıl v a r o l.) kinin doğasını tanımlar.. Şekil 6. Buna ek olarak. e s k i a lf a b e le r in i. mizdeki her bir hücrede hecelenm iş m esajı o r t a y a çıkarırız (bkz. ) . DNA'nın İbrani h a rf o la r a k e ş d e ­ ğeri olan ismimizin (^^V G ) bir sonraki iki h a rf (V G ) b u iliş. sıma ile bağlantılı olan özellikler değişse d e. “Bedenin içi” olarak tercüm e edilir.: si değişmeden kalır.. insanın ismi o la n '^H .. harf setinin ters (değiştirilmiş) dizilimi ç o ğ u z a m a n y a ra -). olacaksak. a n l a m ı n kendi-. sayı şifrelerini not etmek önemlidir ve b u n lar h a r f le r in d ü -i. B ö y le b ir yan-.. Tıpkı 1 + 2 v e 2 + 1 ’in ay. değerleri ile aynı karşılığı verirler.V G ’nin. Tann’nın ismi aracılığıyla y a r a d ı lı ş ile o lan ilişkimize eşi görülmemiş bir anlayış su n ar. i. GV harfleri “içinde” fikri ya d a d a h a b elirg in . bedeni.: VG ya da GV’sini göz önüne alarak çok d a h a y ü c e b ir anla-) yışın harfi harfine tercümesini arayabiliriz. D N A ’n ı n ele­ mentlerini İbrani harflerdeki eşleri ile d e ğ iş tir e r e k . Yetzirah'ın gizemli 231 mistik yaradılış k a p ıs ı i ç i n d e . Hücrelerimizdeki mesajın b u t e r c ü m e le r i n i bir araya getirmek. ( 4 2 ) Sepher. Böylece. Dahası. zeni açısında duyarlı değildirler.: duğunu net olarak anlatır. harf şifrelerinin k u r a lla r ı harf. T ann'nın insanın Bedenindeki V a a d i Kimyasal ismimizin ikinci tarafı Tanrı ile ilişk im iz i y e n i bir boyuta taşır. Kabala’nın gizemleri a r a s ın d a .

timin.8). guanin ve sitozin . (44) daha önce. oksijen ve karbonun kombinasyonlarının kı­ saltmaları olduğunu söylemiştik.Gregg B ra d e n Şekil 6. nitrojen. dört DNA esasının adenin.7a: DNA'nuzın elementlerinin İbrani alfabesindeki harflerle tercümesi • ^H : Tanrı’nın eski ismi YHVH/Ebedi’nin kısaltılmış ve kabul edilmiş şekli. • VG/GV: bedenin içinde. Şekil 6.7b: Hücrelerimizin kunyası eski İbrani harflerine tercüme edildiğinde ortaya Çıkan mesaj. bu ilişkiler Tanrı ve Yaradılış ile aramızdaki ilişki hakkında yeni ve çok farklı bir bakış açısına kapı açmaktadır. bedenlerimi zdeki isimden yaşamın özünü yarat­ mak m üm kün hale gelmektedir (bkz Şekil 6. Açıktır ki. C. insan hayatının nasıl Tanrı’nm bedenlerimizdeki isminin varyasyonlarından yaratılmış ol­ duğu bize net olarak gösterilir. DNA’nın esaslarını yapan hid­ rojen. Her elementi kendi İbrani harf eşi ile değiştirdiğimizde. T. böyle bir oluşum . Tanrı’nın isminin bedenimizdeki her bir hücrede nasıl orta­ ya çıktığını görebiliyoruz: Tanrı/Ebedi bedenin içinde. Bu yerine koym anın grafiksel gösterimi. Ö Daha fazla çalışmayı garanti ederken.farklı kombinasyonları aracılığıyla. A ve G harflerinin. Harfi harfine yapılan bir tercüme mesajı ortaya çıkarır: Bu kelimeleri genetik şifremizin yerine koyduğumuzda. Şifrenin te­ melinin Tanrı’nın “bedenin içinde” varoluşunun değişken derecelerini taşıyor olması aynı derecede nettir.

d ü n y a ­ mız ve birbirimizle ilişkilerimizde eşi görülm em iş' b ir a n la y ış sunmaktadır. bir dizi so n u ç h e m e n g ü n ışığına çıkmaktadu. • İbrani alfabe ile ilişkilendirildiğinde.8'e gelince. • DNA esaslarının farklı oluşum ları te k ra rla m a n ın farklı derecelerinde mesaj üretm ektedir. Şekil 6. tü m y a ş a m ın ' şif­ resi hücrelerimizdeki tercüm e edilebilir b ir m e sa ja d ö ­ nüşmektedir.8: Tanrı’nın kadim ismi YH’nin genetik şifrelerimizin çatısı içinde grafiksel gös­ terimi . Hücrelerimizdeki mesajın %50’si h arfi h a rfin e “T anrı/Ebedi" olarak tercüm e edilir.Tann’nm Şifresi bizleri çok daha derin bir anlayışa götürecek o la n g e n iş b ir çalışmanın sadece başlangıcını temsil etm ektedir. Şekil 6. Dil ve elementler arasındaki bağlar her ne k a d a r d u a la rı­ mızdaki Tanrı’nın kim olduğunu y a da böyle -b ir v arlığ ın n e ­ ye benzediği ile ilgili tanım lam ada yetersiz k alsa d a .

. En gerçek anlamda. yaşam­ larımızın şartlan ve sınırlarından çok daha fazlası olmamız vaadini elinde tutmaktadır. En azından. bağımsız ve ebedi bir esastan oluşmaktadır. x A ^ . farklı kombinas­ yonlarından üretilmiştir. Sepher Yetzirah gibi metinlerin Yaratan ile eşit saydığı yaradılışın bu kıvılcımı varoluşumuzun sebebi olan ismin en az %50’si aracılığıyla net olarak paylaşılan bir kıvılcım . ki herbiri yaşamın dört ana elementinden . YH (Ebedi). tüm yaşamın her bir hücresindeki Tanrı’nın is­ minin keşfi. birbirimize zorla kabul ettirdiğimiz her türlü farklılığı aşan bir mesajı ve bir vaadi açığa çıkarmaktadır. • YHVH ismi İbrani geleneklerinde öylesine kutsal sa­ yılmıştır ki. bizlere daha yüce bir güçle ilişkimiz ve o ilişkinin biten doğası hatırlatılmıştır. oksijen ve karbon . varoluşumuzun temeli sınırsız. kadın. böylece Tanrı’nın bu dünyadaki ebedi doğasım nerede bulacağımız anlatılmıştır. nitro­ jen. onun yanlış kullanımını engellemek ya da şerefini korumak adına temsili bir isim ile yer değiştirlmiştir. BÖLÜM 6 Ö ZET • Tanrı’mn varoluşunun sonsuz doğasından dolayı. YH YHVH (YH Efendi). Tora’daki yaklaşık 6. El Shaddai ve Yara­ tıcı gib i Onun ortaya çıkışlarını anlatan is imler aracılı­ ğıyla tanımlanmaktadır.Gregg Braden • Genetik şifremizin geri kalan %50’si ‘‘bedenin içinde” olarak tercüme edilir.yapılmıştır.800 değiniş.hidrojen. çocuk ve global ailemizin her bir atası tarafından bedenlerimizdeki her bir hücrede şifre­ lenmiş yaşayan bir mesaj olarak paylaşılmaktadır. İşte. • Tüm ya şamın yapısı sadece dört DNA esasının.her birimiz için. İnsanlığın en bilinen geleneklerinde. Bu vaad h er erkek.

tüm yaşamın esasının Tanrı’nın. özellikle insan hayatının ve g e n e ld e tü m y a ş a ­ mın ortak bir miras sayesinde birleştiğinin b ir h a tır la ­ tıcısıdır. “bedenin için d e” a n la m ın a gelen VG harfleri yaşamın geri kalan y ap ı ta ş la r ın d a kodlanmıştır. v a rlı­ ğının gerçekliği ve böyle bir m esajın şa n s e s e r i oluş. anlam ı “E b e d i” o la n eski ismi ^ H ’nin değişik kom binasyonlarından y a p 11mış olduğunu açığa çıkarır. • İsmin kendisine ek olarak._ muş olmasına karşı gelen deliller. Şifrenin hücrelerim izde tam o la ra k n a s ıl b a ş ­ latıldığının anlatımı birden bire kesilm iş o ls a d a . .Tamı !nın Şifresi o Yeni keşif: DNA’mızın dört elementini kadim v e s a k lı sayı şifreleri ile temsil edilen harflerle d e ğ iş tirm e k . • Mesaj. k ö k le rim iz in te m e ­ lini oluşturan zeka ve bir niyeti kuvvetle iş a re t e tm e k ­ tedirler.

BÖLÜM - 3 - Anlam: Mesajı Uyarlamak .

o b izim içimizdedir. 11 — WILLUM BLAKE . b iz o n u n .T a n n b iz gibi oldu. belki de b iz o n u n g ib iyiz. T a n n in sa n d ır ve.

din. ırk. Başlangıçta yanıtlar inanmamazlıktan korku ve şaşkınlıkla sınırlanmış bir meraka doğru sıralanıyordu. Kültür. Her zaman sorular ve daha fazla bilmeye kar­ şı bir özlem vardır. yaşamın şifresi içinde Tanrı'nın isminin açığa çıkması böylesine bir büyüklüğün saklı anlamlarını da taşımaktaydı ki bu kesinlikle inşanı etkiliyordu. davranış ya da inancın ötesinde. Geçmişe baktığımızda. yaşamın şifresi basit ve doğrudan­ dır.ski alfabelerle m odern elementleri birleştirme keşfine E d u y u la n beklenen tepkiler değişiyordu. bağların kaybolduğu /^9l\ T a n n ’n ı n D i l i n i O k u m a k . Bu sadece. keşif h oş karşılanan bir rahatlama sunmak­ taydı ve zaten kalplerinde hissettikleri ve hayatlarında da ya­ şadıkları şeyi bilimsel olarak kabul ettiler. böyle bir şey nasıl mümkün olabilir?” "Böylesine önemli bir şeyi bu kadar uzun zamandır nasıl farketmedik?” Diğerleri için. mesaj bizlerin birbirimize ya da kendimize zorla kabul ettirebileceğimiz farklılıklardan çok daha yüce bir şeyin parçası olduğumuzu hatırlatmaktadır. görünüşte bilim ile bağlantısı olmayan doğa üzerine çalışmalarımızın! azalttığımız. “Eğer şifre doğru ise.7 iL K G U N D D EN M E S A J: __. Bazıları için.

Bu a n latım ın İngilizce t e r c ü m ^ i şöyle okunur: “Ben yeterince^ sö y lem iş olan Yaratıcı T a n rı­ yım. O nun kişisel ismi d eğ işm ed en . ” O larak tercüm e e d ile b ile n She-amar Day olan iki ibrani ism in kısaltmasıdır. Y H V H harflerini İbrani a lfa b e s i­ nin sayı şifrelerine değiştirm iştik. sto p . vs. G em atria’nın d a h a evv. R u h u n M ü k e m m e lliğ i Bedenlerim izdeki mesaj y aradılıştaki rolüm üzle ilg ili n e ­ yi açığa çıkarıyor? Ö nceki b ö lü m le rd e . Tanrı’nın isminin b e d e n le rim iz d e olma p o t a n s iy e li ve belki de n ed en d ü n y a v e varlığım ızın bazen m ü k e m ­ m elden daha az gö rü n d ü ğ ü g ö sterilm ektedir. Tanrı’n ın ism inin sayı olarak 26 gösterdiğini aç ığ a çıkarm ıştır ki. belki mesaj da aynı sadeliktedir. Bedenlerimizdeki Tanrı’nın ism inin keşfi bizlere b ilm e . b u say ıy ı 2 ve 6 yı birbirleri ile toplayıp 8 'e d e indirgeyebiliriz. ShaDaY ismi Tanrı’nın s a d e c e b ir yönünü tem s i1 ettiği için. Yaradılışın Tanrısı. Y H V G için uygulayarak benzer ama biraz dah a az bir sayıya u la şırız .\ nin farklı yolları tek bir anlayış içine karıştırıp birleştirm en in /. şimdi Benim ön ü m d e y ü rü y ü n v e m ükem m el o l u n / ’ Tanrı’nın bu tarafına atfedilen isim . tarih ve dini ta n ım la y a n geleneksel sınırlamaları aşarak. Tanrı h a l a ken­ dini Y^VH ol a rak tanım lam aktadır. O nun varlığının z a m a n ın verilmiş bir a n ın d a bilinmesi yoluyla nasıl bağ lan dığı anlatılmıştı: M erh a m etin Tanrısı. G e n e sis Kitabı tü rü m ü z ü n ka­ derinde rolüm üzü anlam ak için e n gü çlü ip u çların d an b a z ı­ larını verm ektedir. . | dir. b izlere daha büyük v e e n ­ tegre olmuş bir dünya görüşü su n u lu y o r. ShaDaY olarak v e rilm iş­ tir ve “O yeterince söyledi. Tanrı’nın daha tam am lam adan sü reci d u rd u rd u ğ u n u açı­ ğa çıkarır (G enesis 17:1).Tanrı ’m n Şifresi ve mesajın karanlığa göm üldüğü ayrılığın dünyasında b ö y le -. Orjinal îb ra n ic e ’d e yazı yaradılış s ıra s ın ­ da. İşlem . A y m İş­ lemi DNA’m ızın değerleri. yararını göstermektedir. (1) B u tek cüm lede.el uyguladığımız işleınlerinde. Şifrenin s a d e liğ i gi­ bi. Kimya.kalm ıştır. dil. eski yazıların T anrı’nın ismiyle.

Bu değer m e­ tihlerin zaten kelimelerle açığa çıkardığını sayı ile gösterir ve teyit 'eder.000 yıl öncesine dayanmakta­ dır _(bkz. mo­ dern insanın keşfi şu andan 160. evrimleşmek ye ■dünyanın tamamlanmasına katılmak için emir ve özvarIık:'vermiştir: birlikte-yaratma emri. Tanrı’nın isminin özelliklerini paylaşırken. bizlere Tanrı ile eşit olmadı­ ğımızı hatırlatır (bkz. Mo­ dern şartlarda. Gimel. Özvarlîğın Evrimi En eski kayıtlarda ortaya çıkan yazılı tarihle birlikte.Gregg Braden Şekil:7.inin dünyamızın elementleri olarak ve kendi ismimizin her bir h\İcremişde şifrelenmiş şekliyle karşılaştırması. İnsanlığa “mükemmel ölün” diye buyururken. potansiyelimizi gerçekleştirmek ve “m ükem ­ melliğimize” ulaşmak için bize imkan tanıyan ruhani özel­ likleri seçme işi bize bırakılmıştır. İnsan DNA'sının saklı şifre sayısı 10 + 5 + 6 + 3. Tanrı bize değişmek. fiziksel . Bölüm 2) ve başlangıçtan bu yana fiziksel şeklimizin . ya da 24’dür. Şekil 7.1).bedenimizin son harfi. Genesis 17:1 çok nettir: Yaradılış hareketinin sadece ne olabileceğimiz konusunda kusurlu olduğunu iına eder. gelenek bizlere'fizikSeUiğmıizüı (karbon ya da Gimel’in G'si) bizim Onun eşi olmamızı engellediğini hatırlatmaktadır.1 Tanıı’nın îsm. Tanrı ile ilişki içindeyken. bu fiziksel mükemmelliğimiz hakkında daha azi. 2 + 4'ün toplamı 6’nın şifreli değeridir. ve belki de insan olarak amaçladığımız derin nitelikler hakkında daha fazla olan bir ifade olarak okunabilir. Tanfı’nın süreci durdurduğu sırada bedensel olarak tamamlan­ mış olsak da.

Örneğin. hayat ve b irb irim iz le ilg ile n m e şek lim iz .b in le rc e yıl ö n c e gelm iş ataları­ mızdan öte bir şeyler olm ak için n e t b ir ş e k ild e “evrim ge­ çirdik”. liklerde büyük bir değişikliğe m a ru z k a l ın m ış olunabileceği. yaşam ın d ü ş k ırık lık ların ın acısını aş­ ma ve güvenimizi kötüye k u lla n a n la rı a ffe tm e yeteneğim iz.. ne değinmektedir... ti. Biyolojik tarihimiz d e re c e d e r e c e g e lişim d e n ziya­ de arasıra olan olaylardan biridir. fiziksel evrimin bir form u a p a ç ık m e y d a n a gelirken.. ■ .4) .. . be..: lerini değiştirme.” diyerek eşsizliğimize h itap e tm işle rd ir. d u y g u la r ve hisler­ den gelen sezgi gücüm üz . ■ İemektedir. Tattersall ve M atternes m a k a le le rin d e .. n e fe sim iz i ve m etaboliz­ mam ız{ değiştirme yeteneğim iz b ilim se l v e tıbbi eseri erde ' çok iyi belgelenmiştir.Tanrı ’nın Şifresi çok az değiştiğini gösterm ektedir. likleri sayesinde. F o s il' k a y d ı evrim leşm ekte olan bir ilerlemenin fiziksel k an ıtım s u n a r k e n . ve kalp atışım ızı. h o rm o n seviye. bizi tüm diğer yaşam lardan ayrı k ıla n ö z e llik le ri e ld e etmiş olına gerçeğinde yatmaktadır. (3. D u y u m sa m a şeklim izi' değiştirerek bağışıklık işlevi e rini g e liştirm e .. B akış açım ızı değiştirdikçe.15 No. Tem m uz 2003). Başka bir yaşam dan (2) bizi a y ıra n d u y g u la rım ız ın özel-. geçm işi­ mizdeki çeşitlilik yol boyunca p e k çok k ıv rım v e dönüşler olduğunu söylemektedir. Bu anlayış evrim im izle ilgili fizik sel k an ıları destek-.. yüzlerce. “İn s a n evrimi­ nin hikayesi yalnız bir k ah ram an ın d o ğ m s a l ç a b a sı gibi ol­ mamıştır.gibi b izi e şsiz k ıla n soyut nite.” B el ki d e . Scientific A m e ric a n ’ın Ö zel Basım'ına (Vol. ev rim im izin en büyük gizemi bu “arasıra o lan o lay lar” a r a s ın d a b ir yerlerde.■ denlerimizi de yeniden ta n ım la rız .2. dışsal dün­ ya ile birbirimizi nasıl etkilediğiyle b a ğ la n tılıd ır: Davranış. H o m o Sapiensin “g örm ezden gelinem eyecek k a d a r o la ğ a n ü s tü ” o la n özellik­ leri kapsadığını daha sonra d a “O şe y h e r n e ise.p rüm üzün özellikleri. B u tür gözlemci ler.sevgi ve şefkat ifademiz v e d ü ş ü n c e le r. bu tür deneyim lerin yaşam ım ızdaki a n la m ın ı y e n id e n tanım ­ lamamıza olanak sağlamıştır. sal. k a tk ıla rın d a la n Tattersall ve Jay Matternes bu o lg u d an b a h s e d e rle r.

daha yüce bir mükemmelliğin kaderini gerçekleştiriyonız. Daha yl.Gregs B a d en Genesis’in Tora versiyonundan: “Şimdi Benden önde yü­ rüyün ve mükemmel olun” ifadesi. türünün en ge­ niş 'ortak çabasında.insan bedeninin kimya sal çözümü . yeni ipuçları evrimim izi n doğa­ sın!<:laha iyi anlamamıza yardımcı olabilir. mole­ küllerin “Şans eseri” birbirine karışmasının bir sonucu olarak karmaşık ■ve zeki bir türe dönüştüğüne im nıyorsak.iksek bir güç ile ilişkimizin olasılığını her ne ka­ dar dışsal olarak biliyorsak da. o zaman yaradılıştaki rolümüz fikri de değiş­ melidir. Nihayetinde. gi­ zemimizin yanıtının genetik haritamızın kalbinde yattığını bulabiliriz. 'Öte yandan.uzun zamandır beklenen ilk taslağı tamamlan­ mıştı. gelecek -kuşakların bilim tarihindeki en .' mümkün müdür? Eğer insan ailemizin. insan geninin . 20 yıllık bir araştırmadan sonra. taşı­ na" ulaşıldı. o za­ man kozınos’da yalnız olduğumuz ve hayatta kalmamızın gerçekten de ■en güçlü ve en uygun olana dayandığı fikri dlüşür. zamanla ve hayatta kalma çabamız yüzünden böyle bir ilişkinin içerdiği anlamı unut­ muş olmamız. “insan genini haritalamak bir insanı aya koymakla ' karşı­ laştırılıyordu. ama ben bunun ondan daha önemli olduğuna . insan DNA’sını orjinal' bir dil olarak okuyarâkbulduğum uz şeyler gib i. Bu şekilde. eğer global ailemizin "yaratılmış” . öte yandan. her birimi­ zin yaşamlarımızda yüzyüze geldiği zorlukları aşmak için bir davetten ziyade eksikliğimiz hakkında bir gözlem niteliğin­ dedir. İnsan Geninin G iz e m i: B iz i Farklı Yapan Nedir? Haziran 2001’de.önemli başarılardan biri olarak tanıyacağı bir kilometre.olduğunu keşfedersek.da­ ha yüce bir zekanın kasti ürünleri olduğumuzu . Öyle bir kader ki Tanrı’nın ayna görün­ tüsünden sadece bir harf çıkarılıştır. Belki.

” demiştir. bunun “insan ta­ rihindeki en önemli başarı” olabileceğini tahmin etmiştir.000 gen olması gerektiğine inanılıyordu. Şimdi. “İnsanda farede bulunm ayan sa­ dece 300 adet gen vardır “ (6). insanın ilk genetik haritasının tamamlanmasının bir sürpriz olduğunu.000 gen olduğunu düşünürken (genetik) kontrol mekanizması anlatmada zorlanmıştık. Keşifleri belgeleyen ekiplerin şaşkınlıklarına karşın insa­ nın genetik kopyasının beklenilenden daha az olduğu gene sahip olduğu ilan edilmiştir. gözden' kaçmış.” diyor projenin İngiltere ayağını destekleyen Wellcome Trust’ın direktörü Michael Dexter.Taun ’ntn Şifresi inanıyorum. bir insan vücudunu tanımlamak için en az 100.(7) kendi ekibinin bulgularını bir adım öteye taşıyan Venter şöyle demiştir: “bu bana genlerin bizi biz yapan herşeyi m uhtem elen anlatamayacağını göster­ mektedir. kaçırılmış ya da basitçe unutulm uş olan bil­ ginin anahtarı bulunmaktadır. beklenm edik bulgu ların önemi hakkında ondan yorum yapılması istendi­ ği zaman bir kaç kez yinelemiştir. “100. (5) İnsanın ilk genetik haritasını yaratmanın ö nemini özetleyen Dexter. Yaklaşık 20 yıl önce. tüm ölçülerimiz ve işlevlerimizin açıkça genetik bir bileşeni . yaşamızda kilit bir başarı olmasına ek olarak. insan bedeninde tahmin edilenin sadece üçte biri kadar gen olduğu söylendi. bunu çok azının beklemiş olduğunu söylemiştir. Venter bu fikri. 2001’deki duyu­ rularda rapor edilen ilk bulgular arasında. proje baş­ latıldığı zaman. ama bul gular hala yaşayan organiz­ maları anlamada bazı şeylerin eksik kaldığı şüphesinin ço­ ğalmasına neden olmuştur. bu tür.bulguların anlamlarını yorumlar­ ken . Günüm üz yaşamının karmaşık tanımlamalarına yönelen keşif yoluyla birlikte bir yerlerde. genetik doğamız ile ilgili soruları yanıtlarken. “tüm davranışlarımızın. Öte yandan. Haritalama ekiplerinden birine liderlik eden şirketin baş­ kanı Craig Venter’e göre. sadece üçte bi­ rine sahibiz. Projenin ABD bölüm ünün li­ deri Francis Collins.” (8) İnsan Geni Projesinin elde ettiklerinin önemini küçüm se­ mek mümkün değ ildir.

ruhani uygulamalarımız. yüzyılın ilk yıllarında. Bu­ gün. Neredeyse evrensel bir şekilde. bizi türümü­ zün diğerleriyle ve Yaratıcı ile sonsuza dek bağlayan ruhani özün gizemli bir ip olarak tarif edilen şeyle aşılandığımızı anlatırlar. “”Bizler bir tür olarak buradayız. en derinden taşıdığımı z inançların ve dini geleneklerin kalbinde yatan anahtar olduğunu keşfede­ biliriz. bizi böylesine farklı yapan nedir? Sonuçta. Her Yerde ve Her Zam an Varolan ve İnsanın Duygularına Yanıt Veren Güç Geçtiğimiz yıllarda. genetik şifremize eşsizliğimizi aşılamış olan da aynı güçtür. eski hikayeler bize türümüzün ilki ile birlikte. aına genler sadece oluşum un sadece bir bölümü açıklar. bu sorunun yanı­ tının net bir biçimde. Yaşamın tüm diğer formlarından bizi ayıran işte bu kıvılcımdır. bu tür bulguların anlamlarını ve gelecekle ilgili olayları doğru olarak bilen Venter’in yo­ rum unun nasıl gerçek olduğunu anlamaya belki de daha' ye­ ni başlıyoruz. ünlü teorik fizikçi Stepher Hawking bu . dini geleneklerimiz ve kutsal ede­ biyatımız insan hayatının kemiklerden. Belki.Gregg Braden olduğuna inanıyorum.” (10) Bir tarla faresinden bizi ayıran sadece 300 genle birlikte. etten. Kaydedilmiş tarihin yedi milenyumu boyunca. insanın genetik şifresinin haritasını çıkarmak için yapılan 20 yıllık bir çalışma sonucu tamamen aynı so­ nuca varmıştır. kastan ve saç­ tan çok daha fazlası olduğunu ve çıplak gözle görülebilecek kadar aşikar olduğunu farketmemiz için bizi uyarmıştır. bazı bilimadamları m odern dünyamı­ zın yaşamın gizemlerinin açıklamalarını temel alan ruhaniyet ihtiyacını büyüttüğünü söylemişlerdir. Alman haber der­ gisi Der Spiegel’de. "çünkü genin ötesinde olan bir uyum sağlama yeteneğine sahibiz.” (9) 21. özel bir “kıvılcım”. karmaşık aletleri ve zamanımızın en büyük beyinlerini kullanarak.” diye göz­ lemlemektedir Venter.

bilimadamları birdenbire kendilerini g e le n e k s e l bil im ile görünm eyen güç­ lerin mistik dünyası a ra s ın d a k i sın ırın silikleştiği bir dünya­ nın bilinm eyen to p ra k la rın d a b u ld u la r. yaradılış o la y la rın ın bir şekilde birbiri ile ilgili olduğunu öne s ü rm e k te d ir. _ “Tanrı’nın Aklı.cün referansları o ld u ğ u m u zu keşfedebiliriz! Pek çok atom un k esin lik le a y n ı yerde. b u d a h a evvel bilinm eyen enerji bölgesi. v.' ■ m anda yapılan keşifler b u g ü n H a w k in g ’in “bilim in kanunla­ rının " ve spiritüel g e le n e k le rin in “T a n n ”sımn' aslında birbiri.le aynı anında birbirlerine ç a rp m a d a n (12) varolabildiğimbelgeleyen çalışm alardan.Tanrı‘nın Şifresi bakış açısını örneklerle açık lam ıştır. başlangıçtan b e ri h e r z a m a n v e h e r yerde varolan ve en derin duygularım ıza c e v a p v e re n bir zeka form unda kendini gösteren bir güç o la r a k ta rif edilm iştir. Bu tür gözlem lere im k a n d a h ilin d e n e n ed e n ola bili r? Ye­ ni araştırma en küçük a to m s a l p a rç a c ık ta n devasa l ve uzak galaksilere kadar. bu tür tanım lam alar T a n rı'n ın varlığına dair eski refe­ ranslarla dikkati çek ecek k a d a r b e n z e r görünm ektedir.. d ü n y a g ö rü şüm üzün tem e­ linin dramatik bir şek ild e d e ğ iştiğ i açıktır.) ile şaşırtıcı ve b eklenm edik b iç im d e birbirleri ile ilgili oldu­ ğunu öne sürmektedir. S o n u ç ta . 20. A v u straly a Ulusal Ü niversitesi’nin bir ışık dalgasının te le p o s ta s y o n u n u n (ışık dalgasını parça­ lara ayırmak ve sonra d a b ir b a ş k a b ö lg e d e tekrar bir araya getirmek) ilanına 0 3 ) ve b irb irle rin in davranışlarını birbirle­ rinden millerce u zak tay k en b ile y an sıtan “b ü k ü lü fotonlar” (aynı kaynaktan yaratılm ış ışığ ın iki birim i) olgusuna kadar (14).” ve “K uantum Hologra­ mı” gibi isimler verilerek. M odern şart­ larda. bizlerin kesinlikle aynı gü.. . sa d e c e T a n rı’n ın gerekli olm adığıdır.” “D o ğ a n ın ^ k l ı . yüzyılın son y ılla rın d a . Bu T anrı’nın olma­ dığının kanıtı değildir.”'■ (11) Kuantum fiziğinin h ız la g elişen alanındaki yakın za-.:. E nerjinin d ah a önceleri bi­ linmeyen şeklinin varlığını h e s a b a k a ta ra k . kainatın bilimin kanunları ta ra fın d a n saptanm aya başlandı-) ğının m üm kün olduğunu g ö ste rm e k tir. zam anın kesinlik. “yapm ış olduğum şey.

birbi­ rinden çok uzakta olan atomların iieşitimi ve bedenlerimizin sağlığı hakkında ipuçları vermektedir...Gregg Braden Belki de isimlerin gücü sadece. Diller birbirlerinden göz­ le görülür derecede farklıyken. "Ve İnsan Yaşayan Bir Ruh Oldu " Eşsizliğimizin gizeminin ilk anahtarlarından biri bu yazı­ ların. bu gücün hala açığa çık­ mamış olduğuna dair keşiflerin önemini ima etmek için baş­ lamıştır. :yeniden düzenlenen versiyonlarında bulunan mısralar aracılığıyla.. tek bir birleştirici güç bugün fizik çalışmalarının anahtarı olarak görülmekte. " (17) diye ilan eden ifadeler şeklinde ipuçları sunmuştur. tarif ettikleri temalar dikkat çekici bir biçimde bilimin 20. yüzyılın sonlarındaki çıkışları ile benzerdir. Böylesine hassas ve her zaman varolan bir gücün anlamı aynı anda iki yerde varolan atomların gizemi. ''Ruhumu içinize koyacağım.. İncile ait çevirile­ rin. ■insan bedeni ve bedeni hareket ettiren Tanrı’nın esa­ sinin kıvılcımı arasında yaptığı ayırımdır. (15) Aynı zamanda böyle bir bölgenin onayı.. eski Hrİstiyan. tam olarak böyle bir gücün mo­ dern bilim ile eski tanımlamalar arasında son derece ih duyulan köprü sağlar. insan be­ denini oluşturdu . İbrani ve Gnostik edebiyatın edit edil­ miş ve yeniden düzenlenmiş metinlerine daha yakından bir bakış bizi diğer yaşamdan ayrı kılan hatırlayamadığımız fark için başka ipuçları da verir.. yaşamın temelindeki tek bir tam güçte kuvvet ilkesi de ya­ şamın köklerinin en farklı ve en eski hikayeleri arasında de­ vamlılığını sürdürmektedir.” (16) ve Efendi YaHWeH haber verdi. bizlere bu gizemle ilgili “YaHWeH. Hemen hemen aynı şekilde. esrarlı varoluşumuzu anlamlı kılmak için . Aklında böylesine bir güce sahip olarak... Kuantum dünyasındaki yeni keşiflerin ışığında. Her ne kadar bu tür hikayeler kesin olabilse de. yaradılı­ şın ilk hikayeleri olarak saklanmış olan bilgeliği yeniden zi­ yaret etmek için bir isteklilik vardı.

“Adem i. A d em an . (20} Hikayenin içeriğinde A dem ’in y a ra d ılışın ın e k b ir anktımı..” (18) diye. . A dına A d e m d e n il d i .. b a ş lığ ı O ünyanım ve Yabancı İnsanın Yaradılışı o la n b ir m e tin d e A d e m ’in ya.Tann’mn N M / Ş i/r e s i bize yardımcı olacak detaylardan y o k su n d u rlar. el yazması Tanrı’n ın y ö n etim i a ltın d a . üçüncü yüzyıl tarihli o ld u ğ u n a. nır ve hareket eder. rek başlar. m odern zam ana k a d a r a y a k ta k a lm ış teki: Gnostik m ezhep olan M andaeanların n a d ir bir y a z ıs ı m ev.. yarattılar ve onu yatırdılar. net bir fikir verilmektedir. “Ve Ruh so n u n d a m e y d a n a g e ld i. nin ortak bir çabası ola rak g ö stere n diğer G n o stik yazıkra .. radı! ış ını anlatarak başlarlar. ve o A d am (Adem) yaşayan bir nıha dönüştü. cak “yaşamın” gizemli gücü ile aşılan d ık tan s o n ra b e d e ni uya.. C. Ö te y an d an . Genesis’in ilk k ita p la rın ın m istik b ir yorum u. cuttur.” (21) Adem’in mutlak doğası h a k k ın d a d a h a b ü y ü k bir netlik için. tanımlayan Mandaean yazıları Y ery ü zü n d ek i d en e y im im izin eşsizliğine odaklanmaktadır... Adem'in yaradılışm ı C e n n e tin m elekleri. am a için d e ru h y o k tu . H ikayelerine. in an ılm a k tad ır. "İnsanoğlunu bu dünyaya y ab an cı b ir y a ş a m ofarak. bulunmaktadır ve bu anlatım A d e m ’in r u h u n u n yaşayan. aşağı in­ di ve onun içinde yaşam ak ü z e re g eld i... daha evvel de değinilen “kayıp” G nostik m e tin le r d e n insanruhunun hassaslıkları ve nasıl oluştuğu ile ilgili b iz le re ç°k<i: daha.tu”’dan sonra o gözlerini b ed en sel g ö v d e d e a ç tı. < Metin Adem’in bedeni ile o lu şu m u n d a n s o n r a b e d e n ine^ giren ruh arasında hatasız bir ayırım y ap m ak tad ır. Talmud gibi İbrani ve H ristiy an g e le n e k le rin in m i l l e ­ rinden zor bela ipucu to p lam ak tay ız. The Hypostasis of A rchons o la ra k b ilin e n bir b aşk a Gnostik yazı.. esasını bedeninden farklı ve ayrı o la ra k n e t b ir şekilde ta­ nımlamaktadır.. Ancak “Yaşamın ışığı o n u n (A d em ) iç in d e konuş. dur. benzer şekilde. ^ Nag Hammadi K ütüphanesinde yerlid en e ld e e d ile n bd gelerin zulasında..” (19) ).E..

titreşimler fiziksel dünyamızı son derece derinden etkilemektedir. me­ leklerden eşsiz oluşumuza katkıda bulunan dört özelliği mi­ ras aldık. tüm etkiler tit­ reşimlerden m eydana gelir. Konuşma titreşimlerimizi duyu­ labilir kılmaktadır. Bir deprem sırasındatüm bir şehri harap • eden gücün büyüklüğünden güçlü bir duygu sayesinde be­ denlerimizi iyileştiren daha az bir güce kadar. (22) Bunlar: • “konuşm a gücü”müz • "dimdik yürüyüşüm üzü ve • gözlerimizin “bakış’inı. ne Ye£u\ • “ayırım yapan zih in”imizi . Buna ek olarak. Bilim göster­ miştir ki.Gregg Braden İnsanoğlu: Yeryüzünün Bedenlerinde Meleklerin Bilgeliği Y Örneğin Haggadah. ruhlarımızı harekete geçiren deneyimlerimizi başkalarıyla paylaşırken geçmişimizin hatıralarını saklarız. insanoğlunun Cennetin dünyaları ve Yeryüzü arasında bir köprü olarak özellikle yaratılmış oldu­ ğu açıklamasına ek olarak. kelimelerimiz sayesinde. y “Konuşma gücü”müz yeryüzünde başka hiçbir canlı ile paylaşmadığımız iki misli bir gücü temsil eder. Özellikle. Karnımızdaki diyaframı tam olarak titreş­ tirme ye te neğim iz ve ses tellerimizin kasları aras ındaki tamıtamına doğru miktarda havanın gücü sayesinde. konuşma yeteneğimiz sayesinde inançlarımızı başkaları ile paylaşsak bile. bedenleri­ mizi iyileştiren ve dünyayı değiştiren güçlü titreşimler yara­ tırız. “Ayırım y ap a n zihnimizin” gücü. Cennetin meleklerinin ve Yeryü­ zünün yaratıklarının kesin olarak hangi özelliklerinin “in­ san” türünü yaratmak için birleştiğini anlatır.

sayesinde. Bir b aşk asın ın gözlerinin içi ne baktığımız zaman.Tann ’nın Şifresi zaman ve nasıl seçim yapacağımızı sağlar. en derin duygularım ızı ifade etm e yeteneğini elde etmiş oluruz. sa ğlığım ıza. Dik duruşum uz . zihinse l konum um uza.dünyam ı­ zı inşa etme. sevm e ya da n efret e tm e gücüne sahip oluruz. dik duruşum u z aynı zam anda ayaklarım ızın altındaki topra­ ğın zorlukları ve dertleri karşısında “d ik d u rm a ” ve “üzerine yükselm e” yeteneğimiz için bir m ecaz olarak görülebilir.” . “Dimdik yürüm e” yeteneğim iz say e sin d e. basit bir ışık ve o p tik sü reçten çok daha fazlası m eydana gelir. duygu la rımıza ve arzularımıza dair çok sayıda bilgiyi. “Gözlerimizin bakışı” bel ki d e m el e k le rd e n gelen yetene ­ ğimizi en çok anlatandır. Bilinci yansıtan y aşa m ın perpektifinden. Meleklerle paylaştığımız özellikleri d en g elem ek için. ilettiğimiz m esaj aracılığıyla iyileştir­ me ya da yok etme.ve Y e^ruzünde başka hiçbir canlının durum unun el verm eyeceği bir şekilde . G özlerim iz say e sin d e bize “ruhun penceresi verilmiş” denir. pişman olduğum uz seçimleri ‘‘düzeltm ek ” için girişim ler­ de bulunurken sürekli bir tepki k o n u m u n d a yaşam aktansa hareketlerimizin so nuçlarını ö n ced en dik k ate alabiliriz. k e n d im ize has bir yolla değiş tokuş ederiz. “bölgenin canavarı”n d an da d ö rt ö ze llik edindik: (23) 1. birbirim i­ zi ve kendimizi önem serken . “ölürüz. “bedenlerim izdeki artık m a d d e le ri salgılarız” 3. zam anım ızın saygıdeğer saydığımız davranışlarını gerçekleştirm ek için gerekli oynaklığa sahip olarak ellerim izi v e kollarım ızı k u l­ lanmada özgür oluruz. M eleklerden aldığım ız “b ak ış” yeteneği sayesinde her birimiz. “yer ve içeriz ” 2. Türüm üzü “çoğaltırız” 4. Zihnim iz sayesin­ de. Başkalarını nasıl görm eyi seçm e şek ­ limiz ve başkalarının bizi göresine izin v e rm e şeklim iz saye­ sinde.

daha eski ve daha özgül paragraflarla birleştirilmiş olan bu cümle var oluşumuzun merkezindeki eşsizliğimizin ayrıntılı anlayışına katkıda bulunmaktadır. Ruhumuzun gizemli gücü . yazı insanoğlunun ruhunun cinsi ile ilgili' net ve hatasız bir açıklama yapıyor. beden ve ruhun doğası hakkındaki görüşüm üz genellikle Genesis’in Kral James versi­ yonundaki bilinen paragraf ile sınırlı kalır: “Efendi Tanrı in­ sanı yerdeki tozdan yaptı. başka türler tarafından paylaşılamayan bir şekilde Yaratıcı­ mız ile bizi bağlayan bir kıvılcım taşıdığımıza inandıkları çok açıktır. Melekler ve İnsanın "Yaratılışı ve Adem’in Yaratılışı gibi başlıklarla. “Tanrı (Adem’in) ruhunu özel bir özenle bişimlendirdi. cümle net bir şekilde türümüzün ilkine aşılanan özün dişi olduğunu söylemektedir. Yaratıcısınınki ile aynı olduğunu ima eder. bu örnekler. Böyle yazılar Tann'nın Yeıyüzündeki cinsiyetini sorgula­ maya davet ederken. Tanrı’nın doğası ile ilgili iki önem ­ li ipucu yakalamış oluyomz." (25) İnsan yaşamının yaradılışında aynı anı net olarak anlatan. ruh da insan bedenini doldurur” (24) Bu bölüm sayesinde. Tanrı’nın “ruhu”nun Adem ile yaradılışını takiben birleşen ayrı ve farklı bir güç olduğunu açıklar. ruhun kendisinin doğasına dair en büyük detay Haggadah’dadır. Bize Adem’in bedeninin tasarım olarak dişi olan bir güç ile doldurulduğu söylendi. Tanrı’nın kıvılcımının özelliklerini anlatırken. Bu durum. Adem’in torunları olarak. O Tanrı’nın imgesidir. ve bu nın deliklerini yaşamın ne­ fesini üfledi.Gregg Braden Bu tür metinlerin yazarlarının. ve insan yaşayan bir varlığa dönüştü. bö­ lüm Adem’in ru hunu n dişi doğasının. İkincisi. en azından bölüm ola­ rak. yazı Adem’in-Tanrı’nın özünü ruhu olaral elde ettikten sonra neye benzediğinin bir hikayesini vermektedir. İncile ait geleneksel tercümelerde bu bo­ yutta bir detayın yokluğunda. ve Tanrı’nın dünyayı doldurması gibi. Adem ’in diğer ruhani taraflarının erkek olmasını engellemediği gibi. Belki de. İlki. Tanrı’yı erkek olarak tanımlayan geleneksel yorumların aksine.

yaşamlarımızı geliştirme ve bizi takip edenlere daha iyi bir dünya bırakma fırsatı verildi. tüın dünyanın m inyatür hali” olarak tarif edilir. Eski tanımlamalardaki ortak payda. yazı etrafımızdaki dünyayı kolektif do­ ğamızın bir aynası olarak tanımlar.” (26) Tüm diğer yaratıklar. güçlü bir kavram başka bir zamanın dilinde bir kaç belagat!! kelime sayesinde sunulmaktadır.Tanrı ’nm Şifresi sayesinde. bedenlerimizin her bir hücresinde Tanrı’nın ismini taşımanın tam olarak ne anlama geldiği konusunda yeni bir görüşe sahip oluruz. ki bu Yeryüzünde başka hiç bir yaratığın elinde olan bir şey değildir. tüm kainatta eşi ol­ mayan bir yetenek ile doldurulmuş olduğudur. insa­ nın Cennet’in altında olan tek yaratık olduğunu ve oluşum u­ na fiziksel ve kişisel Tanrı’nın m üdahale. türümüzün ilki olarak. ettiğini açlıklar. her insanın bedeni bir “mikrokozm. eski kaynaklar Tanrı’m n kişi­ sel ruhunu sadece insan hayatının içine doldurduğu konu­ sunda çok açıktır. “Öte yandan Dünya in­ sanın bir tepkisidir. Adem’in. (28) Bir kez daha.”(27) Sadece 20. Her ne kadar tüm yaşam Tanrı’nın ismine eşit gelen elementlerden yapılmışsa da. “Tanrı'nın sö­ zünden” yaratıldı. Bu ayınlma birlikte. Bedenlerimizde Tanrı ’ntn İsmi: O nun Anlam ı Nedir? Eşsiz olmamızın nedeni belki de bedenlerimizin özel ola­ rak Tanrı’nın “kıvılcımının” kapları olarak tasarlanmış olma­ sıdır. m odern bilim etrafımızdaki dünyanın aslında duygularımı­ zın en derin konum unu yansıttığını kabul etmiştir. diye devam eder yazı. . yüzyılın son yıllarında. “O (insan) Tanrı’nın eli tarafından yaratılmış olan tek şey­ dir. İnsan yaşamını yaratmanın birincil hareketi aracılığıyla. Diğer taraftan. Haggadah bu ayrımı desteklemekte. Haggadah’ınkiler gibi yazıların geçmişimiz adına basit bi­ rer mecaz olduğunu belirten geleneksel bilgeliğin ötesine cüret edersek.

” (3l)İnsanın bedeni ile insanın bedeninde yaşayan Kutsal Ruh arasında net bir ayırım yapmıştır. im alardaha doğrudan olmaya başlıyor. (29) Corinthianların üçüncü bölüm ünde.” Dediği kay­ dedilmiştir. Öğretinin esrarı çözüldükçe. tenıa doğrudan bir ifadeye dönü­ şür: “Bedeniniz içinizde olan Kutsal Ruhun tapınağıdır. taşıyıcının özelliği ile ilgi­ li eski bir reçete olarak görülen. John’un Incil’i İsa’nın “bedeninin tapınağından bahset. Gnostik ve Hristiyan metinlerde bedenlerimizden Tan­ rı ’nın kutsal özünü barındıran “tapınaklar” olarak söz edil­ mektedir. böyle bir taşıyıcının yaratılması ile ilgili eski sır korunduğu ve her bir insan yaşamının mucizesi ile geçiril­ diği için rollerimiz devam etmektedir. Örneğin. Bizi. Yeni Ahit’te.G'regg Braden Tanrı kendisinin bir bölümünü “nefesini üfleyerek" türumüzle paylaşmıştır. Anlamları açısından biraz şüphe bıra­ kan cümleler aracılığıyla. İbra­ ni. Böyle yaparak.farklı kılanın ne olduğunun gizemine verilecek yanıt belki de kendinde ya­ şamın şifresini barındıran minicik molekülün içinde saklı ka­ lacaktır: DNAmız. bizler tanrısal ruhu eşsiz bir şekilde ihtiva eden “kaplar'1 görevini üstlenmiş olmakta­ yız. pek çok ruhani gelenek bedenle­ rimizi. Yeryüzü krallı ğında Cenneti içermek için inşa edilmiş özel yapılar olarak vurgulamaktadır. “Sizler Tanrı’nın tapınağı ve içinizde oturmakta olan Tanrı’nın ruhu olduğunuzu biliyor musunuz?” (30) aynı ki­ tabın altıncı bölümünde. rolümüzün incelikle sunulmuş ta­ pınaklar olarak ima edildiğini görüyoruz. Tıpkı içlerindeki kutsal yeri barındırmak için inşa edilmiş fiziki tapınaklar gibi. hem Hıristiyan kilise­ si yasaları hem de Gnostik metinler sadece insan formunun Tanrı’nın ruhunu barındırma yeteneğine sahip olduğunu ka­ bul etmektedirler. genetik şifremizin Tanrı’nın özünü taşıması şarttır. Bu perspektiften bakıldığında. Bu gün. Bedenlerimizin Tanrı’nın özünü barındıran yapılar olarak . dinle­ yenlere çok temel bir soru sorarken konu daha doğrudan­ dır.

178 Tanrı !mn Şifresi tanımlanmasını ayrıntılayan Kabala bizi T anrı’n ın ışığının ta ­ şıyıcılarının (Bölüm S’de anlatılan “kaplar) nasıl kırılıp Yer­ yüzünün daha alt spiritüel bölgelerine d ü ştü ğ ü n ü an latarak daha bir derin bir gizeme davet etm ektedir. kaplar yeniden şekillendi ve ışıklarını insanların d ü n y a sın d a iletme yeteneğine sahip oldular. Yaradıl ışın gücünün bir ifadesi olarak. • Bizler yaradılışın kasti bir h a r e k e ti o la ra k b u ra d a “bir amaç için" bulunuyoruz. T arihin e n b ü y ü k zorluklarıyla karşılaştığımız için. hücrelerimizdeki mesaj yaşayan v e s a b it bir sem b o l. D ünyevi b ö lg elerd e . h ü crelerim iz in h e r birinde-/ ki mesaj gücüm üzün ve eşsizliğim izin b ir hatırlatıcısıdır. Yaşamımızın olayları bizleri m a n tık ö te si sın ad ığ ı zam an. bir başlangıcı ve bir ■so n u v ard ır ve b e l k i bir başarı ya da yen ilgi olarak yargılanırlar. günüm üzün en b ü y ü k ironisi aynı teknolojinin/ hem elde ettiğimiz herşeyi yok etm e g ü c ü n ü elin d e tutması/ hem d e yaşamlarımızın engin v e h a rik a b ir şey in ifadesi ol-< duğunu açığa çıkana gücü elirıde tu tm asıd ır.: rız ve bir şekilde bizleri daha iyi insanlar y a p a n seçim y a p ­ ma anlayışına sahibiz. • Yalnız değiliz.eşsizliğim izin . yaşam larım ızın özelliklerini yaratı-. . K aranlığın ve aydınlığın birlikte varolduğu burada. H er g ü n ü n her/ anında. günün bir amacı. Sadece bizim d ü n y am ızın için d e h e r . silip çıkarmalarına ve yo ru m lam alarına h iç bir zam an kontı olmamıştır. hayatlarımızı yaşam şeklim izle.. Mesaj bozulm am ış o lara k kalm ıştır. bir k îter olarak dikilir ve bize şunu hatırlatır-. H ü c re le rim iz i/ her birindeki ‘kelimeler gelenekse! m e tin le rin kurgularına. •// Tarihte. tıpkı varolu­ şum uzun ilk günündeki gibi.h e d i ­ yesini ya doğmlarız ya^ da inkar ed eriz. • Birbirimize ve tüm y aşam a k a ç ın ılm a z bir biçimde bağlıyız. sa d e c e b iz d ü n y a ­ mızın olaylarına katılırız.

orga­ nize kimyasal sistemlerin” bir sonucu olduğunu öne sür­ müşlerdir. Soru şudur: yaradılışın en eski “çorbasındaki” rastgele kim­ yasal tepkiler mi ilk yaşayan hücrelere neden oldu? Yoksa dünyanın kimyasallarını bedenlerimizin yaşamını oluştur­ mak için organize etm ede bir rol oynamak için başka ama tanımlanmamış bir güç mü müdahale etti? t Bu yazının zamanında.yaşama­ yan bir m addeden yaşamın yaratılması asla bilimsel olarak laboratuar ortamında belgelenmemiştir.paylaşmaktayız. Bölüm 1 yaşayan sistemlerin bir tanımını kimyasal açıdan verdi ve yaşamı “belli kimyasal sistemlerin belli bir karmaşıklık seviyesine ulaştıklarında elde ettikleri davranış kalıpları” olarak tanımladı. (33) Böyle kısır gibi görünen tanımlamaları yaşa­ mın ne yaptığını tanımlarken. yaşamın nasıl varolduğunu anlatmada başarısız kalmaktadırlar. Yaşam: Seçerek m i Şans Eseri mi? Ancak yaşamın şans eseri başladığına karşı olan kanıtla­ rı tanımlayarak hücrelerimizdeki mesajın anlamını tam ola­ rak kavrayabiliriz. ty Yaşamın şans eseri mi yoksa kasti bir sıralı olaylar dizisi sonucu mu başladığı. yaşam için kimya sal bir başlangı­ cı tarif eden hiçbir teori varlığını sürdürememiştir . bilimadamları tamamen şans eseri yaşamın ortaya çıkmasının olasılık­ larının zayıfladığını kabul etmektedirler. öyle ki bu bizi Dünyadaki düm diğer yaşamlardan ayırmaktadır.Tanrı'nın özünü . Aslında. yaklaşık 400 yıl önce bilimsel m eto­ dun doğum undan beri bir tartışma konusu olarak kalmıştır. (32) aynı metnin daha sonraki bir bölüm ünde. ilk yaşam zerresinin ortaya çıkması için gerekli . yazarlar yaşamın “çoğalan. metabolizma tarafından üreten.G re g g Braden ® Eşsiz bir özelliği . büyü­ yen. Nobel ödüllü Francis Crick. çevresini kullanan ve kendisini -ondan konıyan ve çevresinin uzun süreli değişim­ lerine göre kendini geliştiren ve değiştiren karmaşık.

Tanrı ’nm Şifresi

şartlarm çok, karm aşık ve d eğ işk en şartlar ol m a sı gerektiği'-.
üzerine yorum yapm ıştır. “B ugün sahip olduğum uz tüm bil­
gi ile donatılmış dü rü st b ir insan sad e ce, yaşam ın başlangı­
cının neredeyse bir m ucize an ın d a ortaya çıktığını, o n u n de■vamlılığı için pek çok şartın yerine getirilmiş olm ası gerek-:
üğim ifade edebilir.” (34) katıksız şans ve olasılık konusun-.
da ofa^lıklar bocalam aktadır.
Ünlü İngiliz astro n o m Sir F red Hoyle ve Cardiff Univer-;
sity of Walls’da m atem atikçi ve astronom olan C handra Wickramasinghe bize b u tü r olasılıkların ne kadar önem li oldu.:.
guna dair bir genel d u ru m verm işlerdir. Yaşam ın en basit
fo raların ı destekleyen b ir dizi etk en in u zu n süredir unuttu.:.
gumuz geçm işim izde bir y ere yerleştirildiğini varsayarsak/
en basit y aşamı bile ü re te n m oleküllerin rastgele birleşimle'.:.
ri için gerekli olan o lasılıkların yaklaşık 10 üzeri 40.000’de ■r
° ldugunu tahm in edilm ek ted ir. (35) bu sayıyı bir çarpanla;:
yarıya rndkgesek bile, elem en tlerin şans eseri karmaşık bit'
y aşamı o faştu rm ak için birleşm eleri olasılığı D ünya tarihinin'
4. 5 milyar yılda bir olacaktır.
Ünlü yazısı M olecular B iology of the G e n e ’de (36) James
Wa tson yaşayan h ü c re le rin eşsizliğini ve es ra rını tanımlar.'
“hücre yapısının asla su ya da glikoz m olekülleri ile aynı şe..
kilde anlaşılm ayacağını acilen itiraf etmeliyiz. Sa dece hücre/
nin içindeki en m ak ro m o lek ü l yapı çözüm lenm em iş olmak..
la kalmamış, h ü c re le r için d eki yerleri de üstü kapalı bir şe..
kilde bilinm iştir.” (37)
G eleneksel m o d e rn bilgelik sayesin de açıklam aya karŞf
gelen b ed en lerim izin h e r bir hücresinin m ucize üretimliği
içindeki süreç h a k k ın d a birşeyler ortaya çıkıyor gibi görün­
m ektedir. Bu tü r g ö zlem ler sayesinde, bizlerin yaradılışın
“şans eseri bir rastlan tısı” so n u cu olduğum uzun olasılık <lahilinde olm ayacağını h issetm ey e başladık. Böylece, her bir
h ü crem izde şifrelen m iş m esaj daha da büyük bir anlam ifa­
d e etm ektedir.
f

Gregg Braden

Zekanın Bir İşareti Olarak D üzen
Doğada, düzen çoğu zaman zekanın bir işareti olarak
görülür. Evrensel formüllerle tanımlanabilen öngörülebilir
Ve tekrarlanabilir kalıpların varlığı düzen kelimesinin ne an­
lama geldiği ile ilgili bir öernektir.
./ Yaşamının sonlarına doğru yapılan samimi görüşmele sıfasında, Albert Einstein yaradılışın temelini oluşturan bir dü­
zene olan inancını ve böyle bir düzenin nereden geldiğine
dair duygularını paylaşmıştır. Bu konuşmalardan birinde
şöyle söylemiştir, “Bir kalıp görüyorum ama imgelemem ka­
lıbı yapanı resmedemiyor... hepimiz görünmez bir gaydacı
tarafından çalınan gizemli bir ezgide dans ediyoruz.” (38)
Yaşamdaki anlamı arayışımızda, düzenin mutlak varlığı ço­
ğu zaman “dışarıda bir yerde” çok daha yüce bir şeyin işa­
reti olarak görülür.
v Örneğin, kesinlikle böyle bir düzen, 1976’da Viking'in
Mars görevinden gelen 60.000 çekilmiş resim arasında göz­
lemlenmiştir. Gezegenin yüzeyinde suni bir yapı gibi görü­
nen şeyin keşfi günüm üze kadar devam eden bir araştırma
ve tartışmaya neden olmuştur. (39) Kilometrelerce uzanan,
mükemmel bir biçim de hizaya getirilmiş siperler arasına
yerleştirilmiş. iki-, üç-, dört-, ve beş kenarlı piramitse! yapı­
lar eğitimli bir göz için gün gibi ortadadır, som devam eder:
Bunlar doğanın bir ürünü mü, yoksa uzun. zaman öncesinin
kasten yapılmış inşasının kalıntıları mı? Bu esrarın çözümü­
ne doğru yanıtı verm enin içinde insan olan bir uzay gemisi
görevlendirmeyi gerektirmesi bir yana, yapıların kendilerin­
de somutlaşan anahtar matematikse! ilkelerin varlığı (40) ke­
sinlikle onların irade dolu bir .tasarımın ürünü olduğunu ile­
ri sürmektedir.
ve Benzer bir şekilde, yaşamın mutlak temelindeki düzenin
keşfi o yaşam içindeki bir zekanın işareti olarak algılanabi­
lir. Yaşamın dört elementinin eski bir alfabenin temel harf­
lerini temsil etmesi ve bu alfabenin bir mesaj oluşturması

T an rın ın Şifresi

yaşam ın altında yatan d ü ze n d erecesin i çok daha y ü ce bin
büyüklüğe taşımaktadır. A m acın halihazırda güçlü olan b il
belirtilerine ek olarak, b e d e n im iz d e k i her bir hücrenin ke­
sinlikle aynı mesajı taşıyor o lm asın ın anlaşılm ası ve b u şif
renin anlamı belki de k eşfin k e n d isin d e n çok daha büyük­
tür.
Yaşamın her bir h ü c re sin e şifrelenm iş olan Tanrı’n ın is­
minin varlığı sadece özel b ir m esaj barındırm am aktadır, ay­
nı 2am anda da özel bir a n la m d a taşım aktadır.
“T a u n B i r ’d i r ”i n E s r a r ı
Tarihsel olarak, bir e r k e k v e b ir kadının, annem iz ve ba­
bamızın, birleşmesi so n u c u d ü n y a m ız a dahil oluruz. İster
seçerek, ister şans eseri o ls u n , an n em izin rahm indeki yeni
bir hayatla sonuçlanan şey h e r b irin in b ed e n i tarafından kat­
kıda bulunulan DNA'nın b irleşim id ir. Yaşamın gizemlerin­
den biri ve insan k o lo n lam a ile b u g ü n daha da gizemli bir
hal alan, bir insan y aşam ın ı y a ra tm a k için tüm gerekli olan,
şeyin sadece bir sperm v e b ir y u m u rta olduğu mudur? On­
lar yeterli midir, yoksa d a h a fa z la sı mı gereklidir?
Kesin olarak, tamı ta m ın a d o ğ r u şek ild e ve doğru zaman­
da sağlıklı bir erkek y a d a k ız b e b e k üretm ek için hücrele­
rin büyüm esi ve b ö lü n m e si “e m rin i” v eren bu görünm eyen
güç nedir? Einstein’in k o z m ik “ezgim izin” kaynağı o k rak
söylediği o “gaydacı” kim? E sk i sayı perpektifinden doğuma
daha yakından bakm ak b iz e b ir ip u c u verebilir.
Aşağıdaki “den k lem ” b ir in s a n b e d e n i üretm ek için anne
ve babanın birleşm esini te m s il e tm e k te d ir, tıpkı Adem ’in sa­
dece Tanrı’nm sayısal d e ğ e ri o n a eklendiğinde tamamlan­
ması gibi. ' Bölüm 4 tü r ü m ü z ü n ilk d o ğ u şu olan “Adem" Kân
kullanılan İbrani k elim en in A D M (İkinci ünlü harf kullamlm adan) olduğunu g ö s te rm iş ti. H e r b ir harfe belirli sayı de­
ğerlerini uyguladığım ızda, s o n u ş aşağ ıd ak i gibidir:

Gregg Braden

..

A
.
(AleQ = 1.

D
(Dalet) = 4

M
(Mem) =40

Bu sayılan topladığımızda yeni sayı 45’dir bunu tek ba­
samaklı sayıya indirgediğimizde ise Adem’in sayısal değeri
9’dur.
1

+

4
4

+
+

40
5

=

= 4 5
9

Sayısal olarak 9 Adem’dir. Sayı dili sayesinde, şimdi
Adem’in anneskve babası ile olan ilişkisini araştırabiliriz.
Anne ve babanın Adem’in 9’u ile nasıl bir ilişkisi olduğunu
saptamak için> öncelikle onların saklı değerlerini bulmamız
gereklidir.
Anne kelimesinin İbranicesi ünsüz olarak EM olarak oku­
nur. (41)
E
(Alef) = 1

M
(Mem) = 40

Oluşan değerleri toplandığımızda 41 ’i buluruz, onu da
indirgediğimizde 5’e ulaşırız.' AV (42) olarak söylenen “ba­
ba” r da benzer bir uygulama yapıldığında sonuç:

"

A
OUef) = 1
1

V
(Vet/Bet) = 2
+
2 = 3

Bu harfleri toplayınca yeni bir değer olan 3 ortaya çıkar.
Şimdi sayıların ortak diline çevrilmiş olan baba, anne ve
Adem kelimeleriyle “elmalarla elmaları” karşılaştırabilir ve
kelimeleri daha derin bir boyutta inceleyebiliriz.
Adem (İnsanoğlu) baba ve annenin birleşmesinin bir

Tann’mn Şifresi

sonucu olduğuna göre, ismin ikisinin birleşimine eşit bir de­
ğerde olmasını bekleriz. Ama babanın 3'ünü an nenin 5'ine
eklediğimizde durum öyle değildir. Bu basit toplam A dem ’in
9‘undan daha düşük olan 8 değerini vermektedir. Bu görü­
nüşteki esrar Tora’daki tek bir cümle ve H aham Benjamin
Blech’in anlayışı ile bir kez daha çözümlenm ektedir.
Her ne kadar pek çok araştırmacı eski gel en eğin parag­
raflarını bir mesaj olarak yorumlasa da, Tora'daki referans­
lar çok daha nettir. Örneğin, Haham Blech T an n ’m n bir sa­
yı değeri olduğunun Genesis'de nasıl açıkça söylendiğini
işaret etmiştir. “Efendi birim tanrı’mızdır, Efendi Bir’dir.” (43)
(Yazarın İtalikleri). Bazı uzmanlara göre, bu Tanrı’nın sayı­
sal d eğerinin 1 olduğunun doğrudan ilanıdır. Öte yandan
“1 ”in içinde daha derin bir esrar yatmaktadır.

Yaşamın Denklem ini Tam am lam ak
İbranice’de 1 sayısı alfabenin ilk harfi olan Alef ( N ) ile
bağlantılıdır. Alefin yaradılışının altında yatan daha derin
nedenler ve katmaşık konu başlıbaşına bir çalışmadır ve ke­
sinlikle daha fazla araştırmaya değerdir. Neden “an n e” ve
“baba”nın Adem’in yaratılmasında bir sayı eksik kaldıkları­
nın ardındaki esrarın nedeni için, tartışmamızı- sınırlayaca­
ğız. Alef’in başlangıcı araştırıldığında, “Efendi Bir’dir” sözcü­
ğünün gizemi gözülmektedir.
Haham Blech’in açığa çıkardığı gibi, eski Alef harfi aslın­
da iki farklı harfin birleşmesinden oluşmaktadır ve bunlar­
dan biri iki kere kullanılmıştır. Alef in Üst sağ ve alt sol kö­
şesi Tann’nınen küçük ve ilk ismi olan Yod ( )dur. Yod’un
bu oluşumun arası yana eğilmiş bir Vav ( ' ) ile ikiye bölün­
müştür. Alef’i yapan bu harfleri tek tek ele alırsak, gizemi
çözmüş oluruz.
İbrani harfleri sayılar olarak analiz edersek, her Yod’a 10 sa­
yı değeri ve Vav’a da 6 sayı değerini veririz. Bu değerleri topladığııruzda (10 + 10 + 6) 26 sayı değerini buluruz - Tanrı'mn

Alef aynı zamanda dolaylı olarak Tann’nın kişisel ismöinin ve varlığının şifrelenmiş kodudur. Şair William Blake’in o bildiğimiz etkili ve gü zel sözleri Tanrı ile' olan ilişkimizi birkaç kısa kelime ile özetlemektedir: “Tanrı insandır ve o bizim içimizde. Karbon. yaşamın bize Tanrı’nın be­ denlerimiz olarak varolduğunu anlatmasıdır. “Tanrı” Adem’i bütün olarak verm ek için anne ve babanın denklemindeki eksik olan değerdir.” Tanrı ile olan ilişkimizi sade bir şekilde tanımlama­ nın ötesinde. Y A Ş A M IN D E N K L E M İ Anne 5 + + Baba 3 + + Tanrı 1 Adeın 9 Sonradan akla gelen bir düşünce gibi yaşama eklenen bir mesajdan çok daha fazla. Blake Tanrı’nın insan olarak varolduğunu ve böylece insanın her gün bizi Yaratıcımızın mükemmell iğine daha da yaklaştıracak seçimleri yapabileceğini söyleyerek . “Bir” tamı tamı­ na “Tanrı”ya eşittir. taşıdığı sayı değeri ile tamı tamına ay­ nı! İbrani alfabesindeki 1 sayısını doğru dan temsil etmesine ek olarak. değer olarak birbiri ile bağlantılı iki kelime doğa ile de bağlantılıdır. yaşamın “esasları” Tanrı’dır. Erkek ve kadın tarafından katkıda bulunulan dünyevi miktarlar arasındaki birleşmeye ek olarak. ken­ dimizi ya da dünyamızdaki herhangi bir yaşamı daha yük­ sek bir gücün varlığından aylamayacağımızı anlatır. Şifre Tanrı'nın kim olduğunu kesin ola­ rak tarif etmese d e. Bu bakış açısından. oksi­ jen ve nitrojen atomları olarak gördüğümüz şey. Bölüm 4’de incelediğimiz sayı ilişkilerinin kanunu a ra cılığıyla.Gregg Brâden eski isminin. biz onun içinde va­ roluruz. bizlere kendi bilimimiz açısından. YHVH. şifre. Tanrı’nın ruhu Ademin (insanoğlunun) tamamlanması için hazır bu­ lunmalıdır.

Tann 'mn Şifresi devam eder. ya şam ın şa n s e s e ri m e y d a n a gelme.' liriz. BÖLÜM 7 Ö Z E T Tora’mn orjinal dilinde. ' eden değerler ortaya çıkarm ıştır ki. ihtimalinin bir m ucizeye dayalı o ld u ğ u n u ileri sür­ mektedir. . deki potansiyelini gerçekleştiren sp iritü e l öz olduğu­ nu ileri sürmektedirler. (Genesis 1:17). Doğada. Bilimin daha y a n ıtla y a m a d ığ ı bir gücün ya­ şamda varolduğu görülm ektedir.:■ rı’ya eşit değiliz. önüm de yürüyün ve M ükem m el o lu n ” d iy e emrettiği . ki b u n a g e n e tik şifreyi keşfe­ denler de dahildir. Pek çok bil im adamı.” Bu fikrin bilgeliğini kucaklayarak. y aşam larım ızın zor­ luklarının ve bizi bölm üş olan. Yaşamın şifresinin b ö y lesin e b ü y ü k ç a p ta bir düzeni kapsaması ve bu d ü ze n d e b ir m e s a jın varolm ası olgu­ ları çok daha yüce bir b ü y ü k lü ğ ü n z e k a s ın ı akla getir­ mektedir. her türlü fark lılığ ın üzerine: çıkma gücü bize bahşedilm ektedir. “Tanrı bizim gibi oldu ve biz o n u n gibi olabi. Hücrelerimizdeki DNA’yı (^ ^ V G ) te m sil e d e n bir sa­ yı değerleri analizi ve T anrı’n ın ism in i temsil. U zm an lar b u ifadenin be­ densel m ükem m elliğim izden ço k b e d e n le rim iz in için:. evrensel m atem atik fo rm ü lle ri ile tanım lanan düzenin varoluşu altta y atan b ir z e k a n ın işareti olarak'' görülebilir. Tan:. b iz le r h er ne ka­ dar Tanrı’nın isminin özelliklerini p a y la ş s a k da. söylenmiştir. bizlere T anrı’n ın yaradılışı ta­ m am lam adan durdurduğu ve in s a n o ğ lu n a “benim.

Gregg Braden • İbrani Yaşam denkleminde. Sadece Tanrı’nın sayısal varlığı bu sayılara eklendiği zaman denge sağlanmak­ ta ve formül tamamlanmaktadır. türümüzün ilkini. “anne” ve “baba”nın basit birleşimi “Adem”i. . yaratmaya yetme­ mektedir. Birşeyler eksiktir.

...“İn sa n la rg ü n a h ka r o lduklan için sa va şm a zla r... A çlıktan ölenleri d o yu ru n .. Savaş öncelikle m erkezi o la n ın uğruna sürdürülür. Savaşı önlem enin ve barışın y ü c e k u ts a m a s ın ı garantiye a lm a n ın aracı b u d u r. ekm ek... ” — BENJAMIN BLECH . A ç olanların acısını h a fifletin . M uhtaç olana y a rd ım edin.

tek­ nolojik seçimlerimiz artık yüzlerce yıl ve pek çok nesil de­ vam edecek olan sonuçlar taşımaktadır. pek çok bilim adamı. genetik olarak besinlerimizi ve bedenlerimizi değiştiren ve okyanuslarımızdan.- 8 - N E O G R E N D IK ? G e ç m iş im iz in D e rs le riy le ni bir yüzyıla girişimizin kutlamaları halen zihinleri­ mizde tazeyken. nehirlerimiz­ den ve ormanlarımızdan yaşamı tüketen endüstriler yaratan bir başka asır boyunca hayatta kalacak mıyız? Belki de en önemlisi. organizasyon ve ilgili insan gerisinde pek çok sonıyu da beraberinde geti­ ren tek bir soruyu sormaktalar: Türümüz bir 100 yıl daha ha­ ya tta kalacak mı? Özellikle. /^ 6 8 l\ G e le c e ğ im iz i K u rta rm a k . ki buna kuantum fiziği. genler ve minyatürleşen elektronikler dahildir. acaba insanoğlunun tarihindeki en öldürücü silah olan doğanın muazzam gücünü çözmeye devam etmeye cü­ ret edip etmeyeceğiınizdir. bu tür sorular sormak pek bir anlam taşımıyordu. 20. yüzyılın ortalarına kadar. Bugün. bu değişti. Ih Dünya Savaşı sıra­ sında gelişen bilimsel buluşların sonucunda.

Başka bir deyişle. k a y d e ­ dilmiş tarihteki en gel işmiş teknolojilerden b azılarını g elişti­ ren parlak bilim adamları ve m ühendislerle çalışm a a y rıc a lı­ ğına eriştim. b ö y lesine yoğun bir araştırma dönem i aynı d ereced e y o ğ u n b ir iç muhasebe gerektiriyordu. u lu s u m u z yabancı petrole karşı bağımsızlığını yeniden k a z a n d ığ ı v e aynı zamanda da Soğuk Savaş sırasındaki ve u zay p r o g r a m ­ larındaki üstünlüğünü kom m ak için m ücadele e ttiğ iin a n ılmaz bir hızın varolduğu bir dönemdi.' B eklenildiği g ib i.a h la k ım ız ı v e etik hakları sorgulayan sıcak tartışmaları sıklıkla k ış k ır ta n korkunç bir güçle birlikte gel en şey sorum luluktu. Benzer şirketler ve üniversiteler için. Gerçek anlam da. teknolojinin bizi nereye götüreceğini g ö r m e m i z . hava kalıplarını d e ğ i ş t i r m e ve maddenin ve yaşamın yeni formlarını yaratma k a p a s ite m iz ­ den dolayı.Tanrı ’nm Şifresi Geleceğimizle ilgili sürüp giden bu soru gelişen te k n o lo ­ jilerden ziyade onları yaşamlarımıza geçirm edeki bilgeliği­ mizle ilgilidir. örneğin. Sırf yeryüzünün geniş bölgelerindeki h a v a ka­ lıplarını değiştirmek ve yeni yaşam formları yaratm ak gibi bir yeteneğe sahip olduğumuz için. Doğada varolan güçleri “bükm e” yeteneğim izin b u t e k ­ nolojileri sonuna kadar araştırma yetkisi olduğu b ir in c i d ü ­ şünce şekliydi.ki b en d e h e v e s li bir şekilde her fırsatta buna dahil olmuştum_ . b ilim a d a m la ­ rı yaşamı ve gezegenimizi tarihsel olarak T ann’y a v e d o ğ a ­ ya bırakılmış bir boyuta değiştirmek yeni b u ld u k la rı y e te ­ neklerin sınırlarını araştırıyorlardı. Böylesi teknolojileri kullanmak için . böyle şe y le r y a p m a hakkına sahip miyiz? Tanrı yı Oynamak: Bize B u H akkı N e Verir? 1970’lerin ortasın dan 1990’larm başların a kadar. İ ç in e p a ­ ra atılan makinelerin ve su içme fıskiyelerinin ö n ü n d e p a t ­ lak veren ve çoğu zaman tuvaletlerde ya da k a f e te r y a la r d a devam eden ateşleyici tartışmaları gen ellikle d ü ş ü n c e n in iki ekolünden biri takip ederdi.

sadece doğayı ve yaşamı idare etme yeteneğine sahip olmamız illa ki gü­ cümüzü denemeye hakkımız olduğu anlamına gelmediğini ileri sürüyordu. arabayı illa o ka­ dar hızlı sürmemiz gerekmiyor! Belki de bir hız ölçer benzetmesi bize net olarak bir üçüncü düşünce şeklini sonuyor olabilir. iyi döşenmiş. Soru bunlardan hangisinin bize doğru yapılması gereke­ ni söylediği idi. o testin za­ manını. Sınırları zorlamak ve yetenekleri aşırılık­ lara taşımak insanın doğasında var gibi görünüyor. Kuru ve kendimizi ve başkalarını yaralama riskinin en aza indirgendiği bir havada. Bu tartışmaya çoğu zaman bir arabanın hız göstergesindeki sayılar örneği de ekleniyordu. Anlaşma sa­ atte 160 mil’e kadar bir hızı kapsıyor diye.ya da ani bir istekle harekete geçip. Her ne kadar kelimesi kelimesine söylenmese de. kullanıcı ile yaratıcı arasındaki çizgiyi geçmek bizi Tanrı’nın gücü ile yarışma haline sokmaktaydı. muhtemelen sürücü bunu belli bir zaman aralığında dene­ meye kalkışacaktır. geniş ve ıssız bir yol bulabiliriz . işlek bir karayolunda kendimizi teh­ likeye sokarak ve etrafımızdaki insanların hayatlarını riske . Bu tür bir muhakeme yolunu destekleyen­ ler için. Öte yan­ dan anahtar. İkinci düşünce şekli çok daha tutucuydu. eğer bu şekilde dav­ ranmazsak. uzayıp giden.Gregg Braden gerekmektedir. Bu tür bir m uhakem e. doğanın güçleri kurcalanmaması gereken "kutsal” bir kanunu temsil ediyordu. Eğer bir hız ölçer aracın saatte en fazla 160 mil yapabileceğini gösteriyorsa. bizim bu tür sınırları test ederken. Çocuklarımızın genetik şifrele­ rini onlar daha doğmadan belirlemek ve ihtiyaçlarımıza uy­ sun diye global hava şartlarını değiştirmek sınırı aşmak de­ mekti ve eski ve dile gelmemiş bir güveni kötüye kullan­ maktı. yerini ve şartlarını da belirleme gücüne sahip olma­ mızdır. onları mümkün kılan sırları asla çözemeyeceği­ mizi öne sürerek sık sık başka bir savunma boyutuna yönel­ mektedirler. Yüzeyi gayet iyi.

sad e ­ ce on yıl önce bizlere bilim kurgu gibi gelirdi. acaba k e n ­ dimizi bir bakteri ya da virüse karşı bağışık yapabien bir d e ­ ğiş ime genetik olarak pşanlayabilir miyiz? Teknolojinin b u ve başka senaryoların her biri için zaten varolm asından d o ­ layı. h er za­ manki gibi bu tartışmalar gelecekte nükleer silahların yerini hangi teknolojinin alacağı sorusu g ündem e geldi. Eğer yak m zamanda olabilecek bir biyolojik tehdit k arşı­ sında DNA’mızı yeniden yapılandırırsak. m esai saatinden sonra bir araya gelip silah teknolojisinin gelişimi hakkında sohbetler yapardık. adil olmak adına bu kitapta. Dışarıya yönelik bu saldın silahlarına e k olara k . tartışma bunların m ü m k ü n olup olmamasına değil. Soğuk Savaş’ın so n u n d a . bunları geliştirip geliştirm em em iz üzerine olacaktır. kuşku duymayan bir halkm üzerine b iy o lo ­ jik bir vims salıveren namu ssuz bir güç olayında. Y eryüzündeki hedeflere uzaydan ayna tutarak toprak-m erkezli güçlü lazer atışları yapılmasından binaları. örneğin. süpergüçlerin nükleer cephaneleri indirgendiğinde. b ö y le bir seçim gelecekteki yeni tehditlere karşı bedenlerim izin bizi koruma yeteneğini nasıl etkileyecektir? Bugün elde ettiği b a ­ şarılı şifreye ulaşmak için binlerce yıl harcamış o lan tü ın bir nüfusun genetik formülünü değiştirmenin u zu n vadeli s o ­ nuçları nelerdir? Sonuçlarını tam olarak anlam a d an y a şa m kurtarıcı bir seviyede olduğuna inandığımız ş eyleri u y g u lamadaki cehaletimiz sayesinde türüm üzün hayatta k alm asın ı yanl ışlık la tehlikeye atıyor olma m ız m üm kün m üdür? • . Savunma endüstrisinde geçen zamanım boyunca. Biri sorumluluk içinde yapılır di­ ğeri ise dikkatsizce. Örneğin. Her iki senaryoda da sınırlar test' edilmiş olur. savunma teknolojilerini d e k ap sa m a k ­ tadır. arabaları ve evleri o ld u ­ ğu gibi bırakıp “sadece” yaşamları yok eden nötron b o m b a ­ larına kadar yapılan bu yeni ciddi senaryo tartışmaları. tartışm a­ lar bazen içe yönelik.Tcınn ’nın Şifresi ederek aracın hız sınırını test edebiliriz. Belki aynı prensibi yaradılışın güçlerine hükmetme sınırlarını zorlama şeklimizde de uygulayabiliriz.

. öyle ki doğa ve yaşama hükm etm enin bilinmeyen topraklarında araştırmalarımıza devam ederken yanıtları mutlaka bulun­ ması gereken sorulardı bunlar.000 Olası Zeki Medeniyet: Neredeler? Kozmos’da bir yerde ve hatta Dünya’nın uzak geçmişinde. keşif yol­ culuğumuzu.denklemini for­ müle etti.000 kadar m edeni­ yetin olabileceğini tahmin ed en ü nlü Drake . kendi öğren­ me sürecimizi de hayatta tutmaktır. idare eden bilim ve bilim adamlarına em a­ net etmiş olduğumuz bir dünyada buluyoruz. zamana. işleri bu tür olasılıkları ger­ çekleştirmek olan kişiler tarafından bu tür som lar hemen hemen her gün soruluyordu. bu sorular varolan teknoloji temelli toplumların yüzleştiği en acil somlar olarak kaldı. kendimizi. Umudumuz. Soğuk Savaş’m bitmesinden 10 yıldan fazla olmuştu ki. yaradılışın güçlerine hükm e tmeyi öğrenirken. Bu ilkeleri.ila 14milyar yıllık tarihini oluşturm uş olan 10. Böyle bir sayıyı göz ö n ü n de tutan bilim adamları ve araştırmacılar bugün şu soruyu sormaktalar: eğer bu ka­ dar çok sayıda medeniyetin varılğı olası ise. aynı deneyimlerden geçmiş ve gelişimleri ile ilgili ben­ zer soruları sormuş başka medeniyetler olması mümkün müdür? Eski toplumların teknolojik seçimleri acaba kendi medeniyetlerini yok edici boyutlara ulaşmış olabilir mi? Eğer öyleyse. onların deneyim lerinden bir şeyler öğrenmek ve belki de bu gün yok olmuş olmalarına neden olan hataları ortadan kaldırmak m üm kün olabilir mi? 1961 yılında. uzaya ve m addeye hükm etm eleri için doğanın evrensel ilke­ lerini keşfetmiş olmalarını beklem ek mantıklıdır. neredeler? Bu 10. kainatın 13. 10. \ . ki geri dönm e olasılığımızın çok az olduğu bir yolculuktur bu. Bugün.000 zeki medeniyetin bir bölüm ü bile var ise. astronom Frank Drake.Gregg Braden Soğuk Savaş günleri boyunca.

oAstronom ve D rake’in iş ak rad aşı C a ri ^ag an bugün b u anlaşılır sinyallerin yokluğunun iki n e d e n i o la bi leceğini tah-. min etmiştir. aslında diğer zeki y a r a tık la r ın geçm işte va­ rolduğu. bizlerle aynı yolu izlediği v e a rtık varolmadığıdır. Aslında. İlki. Sagan’ın yaşamı boyunca m üm kün o lm a m ış o lan arkeolojik kazılar sayesinde.ı o ld u ğ u n u ileri sür­ müştür. B u n e d e n le rd e n dolayı bu teknolojilerin kanıtını burada. böyle bir gücün bize -v e r e c e ğ i soru m lu lu k lar için­ de olgunlaşmamız gerekm ektedir. Y e r y ü z ü n d e iletişim sinLf yalleri şeklinde beklem ek son d e r e c e an lam lıd ır. o z a m a n b i z l e r türüm üzün tari­ hinde son derece kritik bir n o k ta d a y ız — a y n ı hataları yap­ ma ve aynı. eğer bizler teknolojinin e r g e n lik d ö n em inde ya­ şıyorsak.ki o b u z a m a n ı “teknolojik er­ genlik” olarak adlandırm aktadır . sonuçların acısını ç e k m e te h lik e s i içindeyiz . ergenliğimiz sayesinde y a şa m la rım ız d a k i değişim­ leri yönlendirm enin ve sağ salim g e ç iş y a p m a n ın bir yolunu bulmalıyız. ge­ çişleri bir karışıklık ve uyum z a m a n ın ı iş a re t eder.de­ mektir. Ö te. Sagan bu gelişmiş yaşam fo rm larının h e r h a n g i bir kanıtının. Ç o c u k la rın yetişkinliğe geçiş yaptıkları evrensel d e n e y im le rd e n farklı olm ayan bir biçimde. çocukların b e d e n le r i toplulum uzda bir . . bizlerin e v rim im iz d e d o ğ a n ın güçlerine. şan ilk m edeniyetlerden biri o ld u ğ u m u z olasılığıdır. hayatta kalmayı başaram am ış ve d o g a n ı n güçlerini yanlışkullanarak kendilerini yok etm iş o lmaldt_r-J.s a h ip o lm a noktasına ula--. Eğer durum bu ise. (1) İkinci olasılık. kendi yaşa m ş e k ille rin e dahiletmiş î olmalarını beklem ek de m antıklıdır.Temrinin Şifresi tıpkı bizde olduğu gibi. Anlaşılan aniden. hükm etm e yeteneklerine . bulunmamasının nedeninin o n ların ö ğ r e n m e dönem ecinde. bugün bu olasılık m ü m k ü n gibi gözük­ memektedir. ço­ cukları ergenlik dönem inde p a tla m a la r y aşad ık ların d a.yandan bu olasılık b ir b a ş k a düşünceyi' açıkla­ maktadır. Genç insanların ailelerin in sö y le y e c e ğ i gibi. Bu zama-. na kadar bu tür sinyaller tanım lanm am ışım .

Worldwatch Enstitüsü şöyle not etmiştir: “Yeni bir yüzyılın parlak vaadi /^ ö T \ Gregg Bmclen . nefes alamayacağız!” (3) olarak tanımla­ dığı durumumuz dersimizin ivediliğini. öğrenmezsek (hepimizin birbirine bağlı olduğunu. her genç insan onlara ne olmakta olduğunun anlamını kavramak ve hayat­ ta kalmak için tüm bu olanları çok çabuk düzene sokması gerekir. pek çok genç ihsan için. 2000 yılı Dünyanın Durumu raporlarında. ■hayatta kalmamız basit bir felsefi tartışmadan çok. p 'Global bir aile olarak bugün yüzleştiğimiz krizlerin bü­ yüklüğünü ifade eden. “Eğer. dünyamızdaki yaşamı doğrulayan ya da inkar eden seçimle­ rin farkına varma yeteneğimize bağlıdır. en iyi şekilde “yaralanmazlık” olarak anlatılabilen biI" duygunun eşlik ettiği değişim zamanlarıdır. he­ pimizin birbiri ile ilgili olduğunu. her şeyin tek bir yaşayan beden olduğunu). Bir kez daha çocuktan yetişkine örneksememize başvuracak' olursak. Kendi tarzlarında. yok edilemez oldukları duygusu. keşfettiklerimizin gücü ile yaşamın ve doğanın değerleri arasında bir denge oluşturmanın yollarını bulmalıyız.yetişkini tanımlayan tüm o baskılar ve sorumluluklarla bir­ likte yetişkinliğe açılıverir. Buna çok benzer bir şekilde. fütürist Barbara Marx Hubbard. Bugün. teknolojik ergenliğin bu or­ tak dönemi ' boyunca. Yeni keşfet­ tikleri güçleri ' ile. en basit şekilde açık­ la maktadıc E n B ü y ü k T e h lik e İ ş a r e t i m i z :-v. ergenlikteki bir güçlük. bugün genç insanların bir numaralı katifolmasında anahtar etken olduğuna inanılan işte bu yeni­ lemez olma ■duygusudur: bir sürücünün gereksiz yere risk alıp neden olduğu kazalar. otorite ve fuantığın sınirlarını çözümledikçe yavaş yavaş ilgisizliğe dö­ nüşür Üzücüdür ki. (2) # Çocukların ergenliği ile ergenlik temelli teknolojimiz ara­ sındaki paralellikler kesinlikle dikkate alınmaya değerdir.

H epsinin. suyun ve havanın endüstriyel kirliliği. orm anların kayıt­ sızca yok edilmesi sonucu dünyevi oksij enin olası kaybı ve okyanus planktonunun zehirlenmesi.” (4) Neredeyse hiç hatasız. . önde gelen psikiyatrlardan Stanislav Grof dünyam ızı teh ­ dit eden gittikçe kötüleşen şartlarla ilgili pek çok kişininduyduğu endişeyi yansıtan bir belge tanıttı.hesapsız ulusal düşm alıklanm ıza. pek çok bilim adamı. eğer kontrol ed ilm ed en bıra­ kılırsa.. “Burada. yüzyılın sonlarında. İrlanda. araştırm acı ve organizasyon 1990ları bir döngünün tam am lanm ası ve hatalarımızı ve başarılarımızı küresel bir toplum olarak d e ­ ğerlendirmek için bir fırsat olarak görümüştür. küresel toplumların en sonunda yıkımına n e d e n o la­ cak benzer bir dizi sena ryo anlatmaktadır. (5) G rof tarafın­ dan anlatılan yakın tehlikeler arasında “toprağın. Killarney’de yapılan bir k o n feran s­ ta. raporda sözü edilen tehditler bilimdeki son dönem gelişim ­ lerinden ve güçlü teknolojilerin yaşam la rımıza salıverilm e şeklinden kaynaklanmaktadır. sera etkisi. yeryüzün­ de küresel sorunlarımıza . Yeterince besin üretm ek ve güçlü ekonomiler inşa etm ekten gen bazlı teklortojinin b e ­ lirsizliklerine ve yeryü zündeki bölgeleri yüzlerce k u şak b o ­ yunca yaşanamaz hale getiren silahların yayılmasına kadar. ve yediklerim iz ve iç­ tiklerimizdeki zehirli katkı m addelerinin tehlikeleri” sayıl­ maktadır (6) pek çok diğer bilim adam ının duygularını d a yansıtan Grof’un değindiği şartlardan herhangi biri yeryüzündeki yaşamsal sistemlerin gerçek bir tehlike aldında ol­ duğunun sinyalini vermesine yeterlidir. tarihte ilk kez aynı anda varolması gerçeği neredeyse hayal bile ed ile­ meyecek bir tehlikenin büyüklüğünü gösterm ektedir.T an n’nm Şifresi doğal dünyamızdaki dengenin eşi görülmemiş bir tehdit al­ tında kaİmasıyla göigelenmiştir. Carl Sagan her biri. insanoğlunun türüm üzün hayatta kalması yolunda yok e d i­ ci bir yönde olduğu açıktır. 20. ozon tabakasının delinm esi. Ünlü Search for Extraterrestrial Inte11igence (SETI) (7) ra­ porunda. 1995 yılının Haziran ayında. nü kle er atık ve kazaların teh d i­ di.

. çok yakında çökmeye mahkum olmuş bir sistem­ de yaşadığımız sonucuna varanlar var. en büyük tehl ike lerimiz olarak tanımladığımız pek çok durumu incelediğimizde. tamamen aynı bilgiyi kullana­ rak bir başka bakış açısından devam eder. Karşılaşması b eklenen muhtemelen gelişmiş medeniyet hakkında tek bir soru sorma şansı olsay­ dı. fakir ile zengin arasındaki eşitsizliğe. açıkça görülme ktedir ki. düşün­ celi bir şekilde. sorusu ne olurdu? Kısa bir duraksamadan sonra. Seçme sürecinin bir parçası olarak.çocukluk döne­ m inde olup bir gün büyüyeceğine inananlar var. Grof ve diğerlerinin bah­ settiği her bir durum sonu yıkımla biten potansiyel senaryo­ ları anlatmaktadır. insanlığın hala . Bu na ek olarak.(8) “Dünyamn duru­ mu” ha kındaki gözlemlerine. Worldwatch Enstitüsü . her biri bu tehlikenin tek kaynağı olarak insanoğlunu göstermektedir. Dr. türümüzün hayatta kalmasının en büyük tehlikesi olarak kendimizi ortaya koymaktayız! Türümüzün hayatta kalmasını sağlama ve dünyamızın gelecek kuşaklar için ya­ şanabilir olması gücüne de aynı derecede açık bir şekilde tek başına bizler sahibiz. Contact fil mindek i belki de gelecek olayları en doğru. büyüyen nüfusumuza. ona varsayıma daya­ nan bir senaryo sunulur. Sagan. günü­ müzde . besin ve kaynakların yokluğu­ na ve gezegenimizin doğal ortamının yanlış bir şekilde de­ ğişimine . Bu tür istatsitiklerden. onları birbirine bağlayan ortak bir tehlike ile karşılaşmaktayız. bi­ len sahnelerden biri. Arroway’in kendisini dünya dışındakilerle bağlantıya girme olayında Dünya vatandaşlarının değerlerine en iyi kim temsil edeceğini belirlemek için ulus­ lararası bir uzmanlar panelinde sorgulanırken bulduğu an­ dır. Bu tehlike insanoğludur.Gregg Braden nükleer cephaneliklerimize. “Bir de s o m l a ­ rımızın çözülebilir olduğuna. onlara soracağı sorunun teknolojik ergenlik dönemlerini kendilerini yok etm eden nasıl aştıkları olduğu­ nu a çıklar.boş boş bakanlar ve birdenbire dengesizleşen bir sistemde.” (9) İlginçtir ki.

Tann ’m n Şifresi Contacfdaki bu tema ile b u g ü n d ü n yam ızda ortaya çıkan olaylar arasındaki paralellik açıktır. Doğal dünyayı bugün te h d it e d e n tehlikelerle birlikte. medeniyetleri yok ed eb ilecek v e gezegenim izi asırlar bo­ yunca en basit bir canlının b ile yaşayam ayacağı bir yer ha­ line getirecek güce sahip silah teknolojisinin büyüyen gc>l~ gesi içinde de yaşam aktayız. göller v e o r m a n la r —yok edilmesi çoğun­ lukla fosil yakıtlarının ve k im y a s a lla rın dünyamıza yapabile­ ceği zararı geçmişte b ilm e m e s in in sonucudur.inanç v e fikirlerde ku Hanımıyla nasıl m ücadele ettiği not edilmiştir. B u tü r teknolojileri keşfetme arzusu ve yapılmış olan sila h la rın sonuçlarının kesinliği ve kullanımlarını bugün haklı ç ık a rta n rahatlık . Cehaletten Kastta: Yok Olma E şiğinden Y o lu m u z u Bulm ak Gezegenimizin yaşam d e s te k sistem lerinin . özellikle farklılığım ızın ve dünyam ızın neye benzem esi gerektiği ile ilgili b ö y lesin e çok farklı düşünce­ nin var olduğu bir d u m m d a n e d e n i olduğu yetenekler ve inanılmaz güçten nasıl sağ çıkaca ğ iz? Bu tema insan tarihi için y eni değildir. H er n e kadar dünya dı­ şı bir varlıkla illa ki bağlantıya geçm em iz gerekm iyorsa da. İnsan medeniyeti­ nin en eski kayıtlarında . m u cizelerin masalları ve yaşamın güzelliğinden ziyade. bir m edeniyet olarak Dr. nehirler. A rrow ay’in p a n e ld e ortaya koydu­ ğu ayn ı sorular ve kaygılarla m ü c a d e le etm ekteyiz. Bilim ve teknolojinin.ve hatta yaşa­ mı devam ettirebileceğine o la n in a n ç —bugün hayatta kal­ mamın önündeki en b ü y ü k te h lik e y i şüphe getirmeyecek şekilde yaratmakta dı r. eskiye b ir g ö z atm am ız ve insanın güç ve o gü cün geçmişte^. “İçerlerde birileri” belli teknolojilerin te h lik e le r in e giriş iznine her zaman sahipken ve güç ve hırs y e n i teknolojilerin oluşumunda şüphe getirm eyecek ro lle r ü stle n irk e n . atmosfer.okyanuslar. genel nüfusun .

çevreyi tüketen ürünlerin tehlikeleri tanımlarimış ve bilimsel ve eski öngörüler onaylanmış olduğuna . son günlere kadar çok azımız kendi yaşamları ve ailelerinin yaşamlarını kolaylaştı­ ran Ürünlerin gerçekte nereden geldiğini görmek için yakın alışveriş merkezleri ve süper marketlerdeki rafların ötesine . : değişimleri yapmak ve “yanlışları doğruya” çevirmek için ' birlikte çalışabiliriz. Tüketiciler olarak. büyük ölçüde kasıtsız. kimyasal fabrikalardaki patlamalar ve ' zehirli atıklar dahil) öne sürülebilecek hiç bir mazeret yoksa da. maruz kal digı bozulma. Bugün. çevresel trajedilerin tehlikelerini kitle imha silahlafinın büyüyen tehdidinden ve onların üretilmesine neden "olan düşünceden net bir şekilde ayırdetmeye yaramaktadır. Nere­ deyse bir kuşaktan beri ilk kez. B u :perspektiften bakıldığında. Ortalama bir Amerikan ailesi nükleer santrallerdeki radyasyöri miktarını güvenli bir seviyede koruma ve madenler ve f a b r ik a d a n bırakılan su. gezegenimizin. Bu dönem içinde dünya genelinde her ne / /^66t's \ Gregg Braden . ek kaynakları boşaİtan endüstrilerin taşıya­ bileceği sonuçların farkmda değillerdir.büyük bölümü. Her ne kadar gerçekleşmiş olan fe­ laketle sonuçlanabile cek etkiler için (Petrolün deni zle re akı­ tılması . bakmıştır. gelişim. sürekli bir nükleer savaş tehdidi ortadan kalkmış gibi görünüyordu ve ABD ve Rus­ ya yeni bir ilişki içine girip Soğuk Savaş sonrası birlikte ça­ lışmak için yeni yollar araştırmaya başlayınca dünya derin bir nefes almıştı. ekonom i ve dünya'ile olan ilişkimiz hakkında değişen görüşlerimizin so­ nucu ve bir yan ürünü olarak görülmüş olmayı deneyimlerhiştir. 1980’lerin sonundaki Soğuk Savaş’ın sonu dünyada bir barışın başlangıcının habercisiydi. H a la S av aş H a lin d e B ir D ü n y a Pek çok insan için. nükleer sızıntılar.ğöre. duman ve atıkların güvenli ol­ duklarından emin olma konularında devlete ve endüstriye güvenmektedir.

tüm d ü n y an ın d ik k a ­ tini Batı’daki pek çok ülke ve şehrin üzerine odakladı. 1999 yılında S u­ dan'da kuzeydeki Müslümanlar ile güneydeki H ıristiyanlar arasındaki savaş çoğu şivil yaklaşık 1 . pek çok kişi için b arış d ö ­ nemi olarak anılan dönem aslında barış hariç h er şeyi k a p sıyordu. Amerikan birliklerinin Afganistan’daki. H indistan. 11 Eylül 2001 ’deki trajik olayları takiben. Filipinler. Tacikistan. Medyanın çok az dikkatini çeken ama ölü sayısı h a lih a ­ zırda milyonları bulan bu çatışm alardan bazıları eski a n la ş ­ mazlıklarda geliyor ve onlarca yıldır devam ed iy o rk en . d i­ ğerleri nispeten daha yeniydi. “Olası bir “medeniyetler çatışm asının nitelikleri şu a n d a . savaş iç in d e olan en az 20 ulus daha vardı.9 m ilyon kişinin ö lü ­ mü ile sonuçlanmıştı. (10) Her n e kadar çoğu z a ­ man bunlardan “çatışmalar” olarak söz edilse de. h e r ş e y e rağmen bu düşmanlıklar. göreli b a rış aslında gerçekten de göreli idi.Tanrı ’mn Şifresi kadar ”ilan edilmiş” savaş çığlıkları olm asa da. Endonezya. 1990’ların so n u n d a. yüzyılın sonunda. ilan edilmiş savaşların işa re tle ri olan aynı acı ve ölümlerle sonuçlanıyordu. (11) 20. H untington’un k elim eleriy ­ le. d ü n y a d a k i ilan edilmemiş savaşların yaklaşık yarısı Afrika kıtasında g e rçekleşirken. Ö zgürlük için yapılan savaş ve m ücadelelerden d ini sa v a ş­ lara ve etnik temizliklere kadar. Kaşmir. B ir­ denbire. geri kalanları Bosna. Azerbeycan. S onsuz ö n ­ celik! i güvenlik prensibini destekleyerek. Kosova. Ç eçenya. O rta Doğu’daki İsrail ve Filistin arasındaki toprak m ü c a d e le sin in son derece gözler görülür olmasına ek olarak. terörizm te h d i­ di daha evvel görülmemiş bir biçim de. M ak ed o n y a. ağırlıklı olarak İs­ lam ülkelerinde yerleşen teröristleri aram a işi bir kaç ay iç in ­ de yakın tarihte gömmemiş bir şekilde dünya barışının d ü ­ zenini değiştirdi. Kabil ve T o ­ ra Bora gibi Pakistan’a sınır olan dağlık yerlerine in m eleriy ­ le bu bölgeler çok bilinen isimler haline geldi. Tibet ve Orta Doğu gibi “sıcak b ö lg e le rd e ” idi. Örneğin. Harvard profesörü Samuel P.

Fransa. Hindistan ve Pakistan. Çin. teknoloji. dünyamızdaki barış konusunda hükmedici etken haline gel­ miştir. Böyle bir dünya ortamı içinde. Bugün.Gregg Brcıden mevcuttur. Geçtiğimiz yüzyılın büyük bölümünde Batı güçlerine üstünlük sağla mış olan kovansiyonel silahların kapasitesi ve gelişmiş bir nükleer arsenal bugün bizleri kendilerinin düş­ manı sayan kişilerin ellerine düşmüştür. kıtaların güven­ liği ve İsrail gibi ülkelerdeki insanların hayatta kalmaları ko­ nularındaki tehditlerle nasıl başa çıkılacağı konusunda bö­ lünmüş görünmektedir. yüzyılın başında. 21. Natural Reso­ urces Defence Council (14) raporlarına göre. Soğuk Savaş’ın zir­ vede olduğu dönemde.000 nükleer başlık da dahil olmu ştur! 0 3 ) Bu istatisikler aktif olarak yerleştirmiş olan silahları ve bir savaş anında tekrar dolum gereçlerinin depolarını da kapsa­ maktadır. Her ne kadar Soğuk Savaş yasal olarak 1980’lerde bitmiş olsa da.” (12) Yakın tarihte. nükleer uluslar pek çok Dünya büyüklüğünde gezegeni yok edebi­ lecek büyüklükteki silah depolan iddialarından da vazgeç­ meye başladılar. N e d e n Ş im d i? Geçtiğimiz on yılın sonunda. dünyada hala oldukça büyük nükleer arsenal Soğuk Savaş’ın en yoğun . Soğuk Savaş çağı bitiminden' gelişmiş olan silahlar kalmıştır. bir kez daha. İngiltere. Nük!eer başlıkların bu insanı sersem eden sayısı­ nın indirilmesini öngören antlaşmaları takiben. Avrupa ve Asya’da dağıtılmış yaklaşık 70. “nükleer klüp”ün (gelişmiş ve stoklanmış nükleer silahlara sahip olduğunu yasal olarak kabul eden uluslar) yedi üyesi olduğu açıklandı: ABD. Aktif olarak nükleer silahlanma programı izleyen ülkelere bugün Kuzey Kore ve birkaç olası ülke de eklenmiştir. ABD ve eski Sovyetler Birliği arasın­ da yaratılmış olan nükleer silah stoklarına Kuzey Amerika. Rus­ ya. belki de her zamankinden daha fazla. dünya bugün ulusal menfaatler.

Tüm bu olasılıklar içinde. halkın bilgisine h e n ü z su n u lm u ş olan küresel silah toplanmasında ek tehlikeler vardır. D ünyada b u g ü n kalm ış olan nükleer silahlar konusunda.Tanrı ’m n Şifresi olduğu dönemdekinin yarısı. Jorgen W o u ters ABC News’a “Büyük güçler halen gereğinden d ah a fazla g e z e g e ­ ni pek çok kere titretecek kadar güçlü Soğuk S avaş silah la­ rını ellerinde bulundurmaktadırlar. daha bilinmeyen arsenalleri d ah il değildir. Nükleer komşular arasında artan farklılıkların v e y ü k se ­ len tansiyonun varolduğu bir zam anda bu tü r sto k lam aların tehlikelerini tahmin etm ek m üm kün değildir. zira bu sayılara İsrail gibi nükleer ülkelerin ila n e d ilm e ­ miş.” (15) Birbirlerinin düşmanı '"haline gelmiş g ü çler a ra sın d a k i nükleer stoklara ek olarak. gittikçe artan say ıd ak i kim yasal ve biyolojik silahlar küresel boyutta korkutucu b ir sav aş te h ­ likesini halihazırda ilave etmektedir.(16) 1925 C e n e v re Pro­ tokollerinin ve 1993 Kimyasal Silahlar K o n v e n siy o n u ’n u n (17) “yasa dışı” ilan etmesine rağmen. yaklaşık 36. Öte yandan konsey raporlam ada hızlı d a v ra n m ış­ tır. savaş z a m a n ı için ta­ sarlanmış biyolojik zehirlerin ve kimyasal e tm e n le rin varlığı bugün son 100 yıl içinde hiç olmadığı k ad a r b ü y ü k bir te h ­ like yaratmaktadır. H e r n e k ad ar nükleer stokların belli bir yüzdesinin im hası S o ğ u k S avaş'ı takiben başlamış olsa da.000 n ü k le e r başlık. '‘Şa­ şırtıcı şeylerden biri de nükleer silahsızlanm anın p o ta n siy e l olarak durmuş olmasıdır. sürecin hızını k ay b e tm iş o ld u ğ u görülmektedir. Hareketin devamının eksikliği ü z e rin e Carnegie Endowment for International P eace’d e Y ayılm ayı Ö n ­ leme Projesi direktörü Joseph Cirincione’n u n y o ru m u . Şartların bir savaş zamanı yıkımı ve b u n u n la b e r a b e r tah ­ min edilemeyecek boyutta hayat kaybı için h ay al e d ile m e ­ yecek boyutta varolduğu açıktır. Bilinen p e k ç o k te h lik e n in her birine karşı hazırlıklı olmanın ya da kendim izi s a v u n m a ­ nın neredeyse imkansız olduğu da aynı d e re c e d e açıktır.” olmuştur. kadardır. Dünya güçleri arasında bu tür büyüyen a rse n a lle r ve .

“Üçüncü Dünya savaşın­ da nasıl savaşılacağını bilmiyorum. Yanıtı.kayalar!” (18) 21. Eşi görülmemiş bir yıkım gücüne sa­ hip silahların küresel bir arsenalinin varlığı içinde olduğu­ muz ve onlara bir de temelinde farklılıklarımızın yattığı po­ litikaları zorla uygulatmak için kullanma isteği eşlik ettiği bu zaman. dünyanın herhangi bir yerindeki çatışına bugün dünya genelinde bir çatışma olara k düşünülmelidir. Einstein şöyle cevap vermiştir. yüzyılın ilk yıllarında. sivil savaşlar. bana şu soru sorulmaktadır: “Neden şimdi? Neden hücrele­ rimizdeki mesajı anlatan kitabı şimdi sunuyorsunuz?" Eğer farklı etnik. .sa­ dece çeyrek yüzyıl önce bile mümkün olmayan bir şekilde coğrafi bölgeleri ve tüm kıtaları belalı bir işin içine sokma potansiyelini taşımaktadırlar. ama size Dördüncüsün­ de ne kullanacaklarım söyleyebilirim . dini savaşlar ve ekonom ik savaşlar . bir m edeniyet olan bizlere bağlı olan sorumluluğun da ürpertici bir anımsatılmasıydı. hücrelerimizdeki mesajı sunmanın en mükemmel zamanıdır. küresel bir medeniyet olarak ürkütücü bir dönem ece gelmiş bulunuyoruz.Grereg Braden tırmanan gerilim sonucu oluşmakta olan durum dahilinde. “Rus”.nasıl oluştuklarına bakılmaksızın . Albert Einstein’a nükle­ er çağda bir ü çü ncü dünya savaşında silahların ne olacağın ı düşündüğü sorulmuştu. bugün kendimizi bulduğu­ muz teklik el i yolun olduğu kadar tahmininin asla gerçekleş­ meyecek olduğunu sağlamlaştırmak için. bu zaman işte bu kuşağın zamanıdır. Küreselleşme ve teknolojinin yayılması sonucu. dini ve politik fikirleri birleştirebilen bir ilkenin gücünü herhangi bir zamanda keşfetseydik. Alfred Werner ile 1949 yılında yaptığı ve Liberal Judaizm’de yayınlanan bir röportajında. Artık küresel çatışmanın kenarından sıyrılıp geçmek bir "Amerikan”. Her zaman çok iyi bilinen sadeliği ve açıkkalpliIiği ile. Dünyadaki Uluslar kendilerini dini inançlar ve politik ide­ allerle düzene soktukları için. “Çinli” ya da “AvrupalInın seçimine bağlı değildir.

Geleneksel tarihte her ne kadar tanınm am ış olsa da. Ö y­ lesine gelişmiş bir teknoloji kullanarak öylesine yıkıcı so ­ nuçlar doğuran bir savaşın belki de en detaylı anlatım ıdır ki.Tanrı ’nın Şifresi En güçlü orduları bile aciz bırakabilecek. şehirleri ve ulusları y o k edebilecek ve tüm bir nüfusu buharlaştırabilecek tek n o lo ji­ lerin varlığında. iki çok b ü y ü k im p arato rlu ğ u n sonunu getiren savaşı net olarak detaylandırm aktadır. türüm üzün geleceği bugün farklılıklarım ızın ötesine kolektif olarak geçmemize bağlıdır. yaşam ın e n te ­ melinde yıkıma neden olabilecek. k an ıt­ lar bunun yeryüzünden tüm m edeniyetleri silebilecek g ü c e sahip silahların kullanımıyla kendi yıkımımızın g erçek leşe­ ceği ihtimalinin insanlığın ilk kez yüzleştiği bir şey o lm ad ı­ ğı yolunda gittikçe çoğalmaktadır. Mahabharata'daki savaşan toplum ların ö d em iş ol­ duğu bedel sayısız insan hayatı. Her ne kadar eski hikayeler savaşın so n mücadelesini kazananları anlatsa da. Geçmişimizden Dersler Hem Hindistan’ın ulusal efsanesi hem de H indu Kutsal Kitabı olarak bilinen M ahabharata u zunluk ve genişlik açı­ sından konusuyla paralel olm ayan edebi bir çalışm adır. en azından belgelerden bazılarının gerçek tarihsel olayların son kalan kayıtları olabileceğini ima etmektedir. ekin yapılam ayacak to p rak ­ lar ve tarihten önce gelmiş bir ileri m edeniyetin y o k e dilmesi . o zam an bizler bugün çok eski bir dersin m odernize edilerek y e n id e n uygulanışına ve yeni bir sonuç seçm ek için yeni b ir fırsata tanık olabiliriz. İn san tarih in in büyük bir ironisi haline dönüşebilecek şey her ne^ ise. gerçek bir zafer hiç ol­ mamıştır. Eğer bu olaylar gerçekleşirse. g e ç ­ mişimizin bazı en eski kayıtları böyle bir senaryoyu v e tari­ himizin başlamasından önce. hikayeyi tarihi bir belge olarak kabul etm ek n e re d e y se d ü ­ şünülemez bile. G ele­ neksel çalışmalarda anormal olduğu varsayılan gittikçe ç o ­ ğa lan arkeolojik kanıtlar.

(23) .geleneksel tarihin büyük medeniyetlerin ve karmaşık tek­ nolojilerin var olduğunu ileri sürdüğü zamandan çok önce! . Aynı tarifler bugün bilim adamlarının ve araştır­ macıların da dikk atini çekmektedir. ile sonuçlanmıştır.. Kali yuga çağında. Ya klaşık 100. Hikayenin orjina li 2. geniş bir bölge içinde diğer tüm hayvanlar yere çöküp öldüler. “bilinm eyen silah. Hindistan. .” (19) olarak tarif edilmiştir. Gizamli silah savaşta ortaya çıkarılıp ateş edil­ diğinde.000 güneş ka­ dar parlak. Saç ve tırnaklar dökülm üştü. Filler alevler için­ de yandı.'’ anlatır. metin böylesi bir yıkım­ la birlikte insanları yakalayan korkunç kaderi anlatır. “Yer sarsıldı. Mahabharata’da anlatılan son savaş da Hint kozmolojisinde son döngünün. Etkisi “dum an ve ateşten akkor kolonları.” (20) olarak anlatılmıştır.” (22) Ek detaylar da nasıl “Çanak­ ların nedensiz kırıldığım. Dvapara yuga.gerçekleşen büyük bir savaşla sonuçlanan bir mücadeleyi anlatır. İlginçtir ki. Hint efsanesindeki savaş silahlarının ve taktiklerinin tari­ fi tarihçilerin ve generallerin geçm iş zamanlarda çok ilgisini çekmiştir.. 10. Sular kaynadı ve orada yaşayan canlılar da öldü. Mısralar silahın ateşlendikten sonra geride bıra ktığı mut­ lak ve tam yıkımı anlatarak devam etmektedir. kainatın tüın gü­ cü ile şarj edilmiş tek bir mermi. “Be­ denler öylesine yanmıştı ki tanınmayacak haldeydiler. demir yıldırım.Grerep. bu silahın korkunç sıcaklığıyla kavruldu.000 ila 10...” (21) Savaşın son bölümünde.kuşların havada dönerken b eya za dönmelerini.g Braden dahil kutsai bo)'\ıtların da b ir yıkımı. Biz şu anda o çağda yaşamaktayız.000 mısradan oluşan ef­ sanenin ana tem ası iki krallık olan P andu Krallığı ve Dhritarashtra Krallığı arasındaki sonunda 8. sonu ve dü nyanın son büyük çağının başlangıcı olarak gösterilmiştir.000 yıl önce .500-3-000 yıllan arasında eski Sans­ krit dilinde yazılmıştır. Delhi yakın­ larındaki ovalarda başgösteren Mahabharata’nın mısraları Yeryüzünün geniş alanlarının ve o bölgedeki tüm yaşamın mutlak yıkımı ile sonuçlanan bir silahın kullanımını detayla rı ile anlatır.

ölüm oldum . Her biri tak ip e d e n yı k ım ı iyi k ö tü arasında­ ki geçmiş mücadeleye ve in san o ğ lu n u n g ü c ü aram asına mal etmiştir. savaş için üretilmiş olanlar dahil. 20.” (24) İlginçtir ki. kesinlikle tarihin bir zam anında varolm uş. yüzyılın o rtaların d a dünyaya tanıtılan atomik silahlara kadar olan bir tarihtir. 1909 yılı gibi erken bir d ö n e m d e . Yakın zam a­ na kadar. n ü kleer te k n o lo jile r Y eıyüzünde var olmuş olabil ir mi? İleri bir m edeniyet. yandan. M ahabharata'daki feci savaş ile n ü k le e r y ık ım ın gücü ara­ sındaki ilişki yakın zam anda farkedilm iştir. H indu Tanrı S h iv a’n ın h em yaratıcı hem de yok edici rolinden b a h se d e n O p p e n h e im e r Shiva ’nın inflakın şiddetine şahit olduğu z a m a n y ap m ış olduğu açıklamayı söyler: “Şimdi-Ben.Tanrı'nın Şifresi Eğer anlatılan te k noioji ve onun etkileri u z u n za m an ö n ­ ce olmuş olan bir olayın tam am en doğru b ir hikayesi ise. . Gü­ ney Amerika yerlileri ve Tib etl i D zyan d a h il ç o k sayıda baş­ ka kültür de geçmişimizdeki bü y ü k b ir y ık ım zam anından bahsetmişlerdir. D ü n y an ın ilk atom bombasının 1945 yılınta Trinity test b ö lg e sin d e başarı­ lı bir şekilde paüatılmasını takiben. k o n v e n siy o n e l tarih başlamadan binlerce yıl ö n ce. savaş sırasında k u lla n ıla n ilk nükleer bom banın patlamasıyla b u tür felaket b o y u d arın ın m o d ern bir gerçeğe dönüşmüştür. Acaba. . M ahabharata’da anlatılan b ü y ü k lü k te ' bir yıkım ın tek bir silahtan çıkması tasavvur ed ilem ez b ir şe y d i. Öte. uzak geçm işim izin b ir y e rin d e . fizikçi R o b ert O ppenheimer doğrudan M ahabharata’nın bir b ö lü m ü o la n BhagavadGita’dan alıntı yapmıştır. d ü n y aların y o k edicisi. sad e ce k e n d i yıkım ının hara­ beleri içinde parçalanm ak için.ki bu. b ilim adam ları atom­ dan açığa çıkabilecek gücü ilk a n la m a y a başladıklarında. te k n o lo jik evrim in merdi­ venlerini tırmanmış olabilir mi? Gittikçe artan kanıtlar ve gittikçe a r ta n say ıd a bilim ada­ mı tam olarak bu tür sorulara ciddi ö n e m v e rm e y e başlamış­ lardır. Hindistan’ın destansı şiirle rin e e k olarak. 1945 yılında. b ilin m e y e n bir si­ lahı anlatmaktadır .

bu­ lunması ile birlikte. 20. geniş cam. İngiliz arkeolog Sir John Marshall 1920’lerde önce eski şehir M ohenjo Daro'yu buldu ve çalışması Sir Martimer ^ ^ e e le r ’ın daha başka keşifleri ile 1946’da devam etti.E. sonuçlanan yıkımın iz­ lerini bugün görebiliyor olmamız gerekir. Her ne kadar bu bölgede göçebe insanların binlerce yıl yaşamış olduğu bilinse de. gerilemiştir.Harappa ve Mohenjo Daro . yüzyılın başında.E. tabakala­ rın üzerine yapışmış eski çöl kumla rı ve yeryüzünün her ye­ rinde rapor edilen eski radyoaktif iskeletler ( 26) bir yana. (27. tarihi za­ man çizgileri 1500 B. o tarih yaklaşık 3000 B. yılla rında bölgede Hint-Avrupalı is­ tilaları ile bağlantılı organize gelişmeleri daha evvelden bir­ leştirmiştir. 28) Ka zıları şaşırtıcı şekilde iyi ve bugün pek çok şehir ve köy alanlarında olmayan ince bir zevkle planlanmış bir şe­ hir m erkezini ortaya çıkarmıştır. Izgara içindeki pek çok yapı­ nın akan suyu ve kapalı kanalizasyon sistemi vardı ve halka açık ya da dinsel törenlere ait banyolar olduğuna inanılan bir kaç geniş korunacak bulunuyordu. İki ana şehrin .C.C. eski bir medeniyet atomun gücünü kul­ lanmak için gerekli bilim ve teknolojiye sahip olmuşsa ve bu gücü savaş sırasında kullanmışsa. Mohenjo Daro’nun mimar­ ları şe hri 30 feet genişlikte ana yolların sınırladığı kare bir ız­ gara şeklinde inşa etmişlerdir. “Geçmiş­ te atomik enerjiye aşina olmuş olan medeniyetler varoldu­ ğuna ve onları yanlış kullandıkları için tamamen yok olduk­ larına inanıyoru m . Kömürleşmiş dağ zirvelerinin alışılmışın dışında keşifleri.Gregg Braden fizikçi Frederick Soddy şöyle bir yoru m yapmıştır. arkeologlar Kuzey Hindistan ve Pa­ kistan’ın Indus Irmağı Vadisi’nde bilinmeyen bir medeniye­ tin kalıntılarını buldular. Şeh irlerin ileri teknik tasarımlarına ek olarak. unutulmuş . Indus Kültürü’nün sakinleri hiçbir zaman tercüm e edilememiş ya da çözülememiş.” (25) Eğer gerçekten. belki de en çok şey ifade eden bulgular Mahabharata’nın kendisinin anlatıldığı efsanevi savaş alanı yakınlarında mey­ dana çıkarılmıştır.

doğal çürüme ya da ölmelerinden son­ raki yağmalar tarafından bozulmasına engel olmuştur? Bu soruların yanıtı belki de bugünkü Delhi şehrine yakın yerde bulunan daha az kişinin bildiği benzer iskeletlerin ke­ şiflerinde yatmaktadır. çalışanlar garip bir şekil de düzensiz­ ce dağılmış insan iskeletleri buldular. Japon şehri Hiroshima’daki zararın en geniş bölgesi yak laşık 10356 km 2’dir) or­ taya çıkmıştır. (30) İlerleyen araştırmalar külün bulunduğu yerin yaklaşık 7780 km2 olduğu (karşılaştırma için. Sakinlerinin geride ne bıraktıklarını okuya­ madığımızdan. Kazı bölgesin­ deki başka bulgular da benzer şeyi anlatmaktadır: "Bazı yer­ lerde. toğrağın yüzeyinde kalın bir radyoaktif kül tabaka­ sı buldular. İskeletlerin çoğu garip pozisyonlarda bükülmüştü ve bir kaçı hala eleleydiler.bugün Indus Vadisi El Yazısı olarak bilinir . Rus arkeolog A. Kazı eski yol­ lar düzeyine ulaştığında.” (29) Bu insanlara ne olmuştu ve iskeletleri ne­ den böyle bozulmadan kalabilmişti? Hangi koşu llar bedenle­ rinin vahşi hayvanlar. sanki başlarına beklenmedik bir felaket gelmiş gibi. bize sadece Harappa ve Mohenjo D aro’nun hikayesini anlatan fiziki artefaktlar kalmıştır. işçiler olmaması gereken bir şey buldular.Tanrı ’nın Şifresi bir yazı formu . Gorbovsky raporunda bu bölgedeki an az bir insan iskeletindeki radyoaktivite oranının doğal radyoaktivi­ te oranının yaklaşık 50 katı olduğunu yazmıştır! (31) Nazareth’li İsa’nın zamanından yaklaşık 2000^ yıl önce doruğuna ulaşmış sonra da yok olmuş bir m edeniyete ait bu "anorm al” bulguları ne açıklayabilir? . Terk edilişlerinin nedeni ney­ di? ^faeeler’ın keşifleri buna bir ipucu olabilir.kullanmışlardı. Eski şehirlerin bize bıraktıkları en büyük gizem belki de neden unutulmuş olduklarıdır. Bir barınak projesi inşasının hazırlık­ ları sırasında yapılan kazılarda. merdivenler üzerinde uçuş duruşunda iskelet grupları bulunmuştur. Riddles of Ancient History adlı kitabında. Halihazırda yüksek derecede kanser ve kusur­ lu doğumların yüksek oranda olduğu ilan edilmiş olan bir bölgede.

kimyasal ve biyolojik cephanelik­ lerinin yıkıcı gücünü göz önüne aldığımızda. aynı hataları yeniden yapma tehlikesi içinde miyiz? Milletlerin birbirlerine karşı asırlık toprak mücadeleleri. bu bulgular çok zaman. Öte yandan odaklanmış bir çalışmanın yokluğun­ da dahi. ve karşılaş­ tırmalar kaçınılmazdır. parallelliği nettir. derinden korunan değerlerin ve inançların tarafını tutm ak için gereklilik olarak görünen ne varsa kullanılması için . Hristiyan. süregelen soysal.önce. Marshall ve diğerlerinin keşifleri ilerlemiş bir medeniyetin kanıtını ve kötü sonunu ve “teknolojik ergen­ likleri "ni yaşatmada başarısız oluşlarını ını ortaya çıkarmak­ tadır? Nükleer patlamaların etkileri bugün çok iyi belgelen­ mektedir. dini ve siyasi düşünce mücadelelerinde sı­ ralandıkları günüm üzde. ve ilerleme. Bu tür etkilerin benzerlerinin böylesine eski böl­ gelerdeki bulgularla benzerliği. sözcü­ ğünün anlamına dair çelişen bakış açılarının uzlaşmaz gibi gözüken bir şekilde dünyamızı bölmesine müsade edecek miyiz? Dünyanın nükleer. tek bir soru akla gel­ mektedir: eğer daha evvel de kendimizi yok etme yoluna girmişsek ve gücün yanlış kullanımı sonucu tüm bir m ede­ niyeti yok etmişsek. Wheeler. bu ve benzer yerlerde daha yapılması gereken çok şey vardır. bulguları değerlen­ direbileceğiz ve bunun gibi gizli kalmış sırları açığa çıkara­ bileceğiz. sonucunda bütün bir medeniyetin yok olduğu yıkıcı etkilerin yaşandığı birşeylerin olduğunu işaret eden kanıtlar gittikçe çoğalmaktadır.Greeg Braden Açıktır ki. çoğu zaman “kudreti” haklı çıka­ rıldığını göstermiştir. eğer savaşı kazanamazlar­ sa medeniyetlerinin ve yaşamlarının sonu olacağına inanmış . Günüm üz somut delilini geçmişimi­ zin yazılı kayıtları ile birleştirdiğimizde. sıcak çatışma içinde. Mahabharata. acaba bu farklılıkların dünyayı ye­ ni bir küresel çatışmaya sürükleme ihtimali var mıdır? Kapi­ talizm ve sosyalizm arasındaki ayrılıkların. Ek çalışmalar sayesinde. bu soruların cevaplarını arama adına riske girmeye değer mi? Tarih. Yahu­ di ve Müslüman değerlerinin farklılığının.

İster söz k o n u su 17. G ü n ü m ü z ihtilafları’nın çoğu in­ sanların.. insanoğlugeçmişte benzer düşüncelerin sonuçlarına şahit olm uş vegüç bela süregelmiştir. y ü zy ıldan beri yaşam şekillerini ko­ rum aya çalışan G üney A m erika yerlileri olsun. Süregelmemizin-. ırkların. . bu sorunların kökeninin aslında ne ka­ dar sade olduğu fark edilm ez ola bil iyor. yüyılın tehlikelerinden kurtul m ay ı deneyen küresel ailemiz. G erçek ya da algılanabilir olsun. Evrensel m iza cı ile.T anrının Şifresi •v o\ bir ordunun son çare olarak kullandıkları güçlü bir öldürü­ cü silahın hikayesidir. Eğer karşılaştırılabilir bir senaryo gü­ nüm üzde ortaya çıksaydı. isterse de 21. 21. yüz yılın büyük savaş . karşısındaki en b ü yük tehlikenin kaynağı. dinlerin ve inançların arasındaki farklılıkla-ra dayanmaktadır. Tanrı’nın vücut hücreleri­ mizdeki ismi böyle bir p ren sib in tem elini oluşturabilir. Her ne kadar zam an değişm iş ve b izler b u g ü n atalarımızın 100 yıl önce hayal bile ed em ey ecek leri bilim ve teknoloji faktörleri ile ilgileniyor olsak da. Şayet Kızılderili edebiyatı gerçekten tarihsel olayların tutarlı bir tescili ise. yüzyılda tüm sorunlarım ızın ü stü n d e n gelebilecek. pek ço k şekilde. insanların inançlarını ve hayat yollarını birleştirebilecek tek bir prensip ' günüm üzde ruhani bir anlayışın ötesinde stratejik bir vasıf haline geliyor. Dünya sorunlarının m erkezinde b u çoğulcu ve karm aşık sorunlar duruyorsa. yani fikirle­ rin bil inm eyen bölgelerinde nasıl ilerleyeceğimiz konusun­ da bazen bizlerin en iyi ö ğ retm enleri olabilmektedir. gelecek nesiller bizim zam anım ı­ zı benzer inançlara dayalı olarak 21. Bir d ahaki sefere bu kadar şanslı ol­ mayabiliriz. F a r k lılık la r ım ız ın Ö te s i: B ir lik Y o lu y la K u r tu lu ş Bizden ö nce gelenlerin tarih ve deneyim leri. değişime ayak uy­ durm a ilkeleri aynı kalmıştır. farklılıklarımızı nasıl algıladığımıza bağlı. destanı olarak okuyabilirlerdi.

Buna rağmen. çeşitli kabilelerin yaŞayü şekillerini korumak için yardımlaşma içinde olup tek bir ağızdan konuşmaları gerektiğini farketmişlerdi.edilemez bir durumdu. Yüzlerce yıl boyunta/doğanın döngüleri ile günlük ihtiyaçlarını başarı ile den­ gelemiş olan yerli kabilelere göre. Top­ raklarını istila edenlerin n iyetleri ni her ne kadar tam olarak a:nla:masalar da bu öngörülü kimseler. toprağa sahip çıkılması tlpkı. yerli yaşam biçimi Avrupalı dünya görüşüyle asla ayakta kalamazdı. Doğanın "sahiplehilebilmesi” kavramı çok az şey ifade ettiği için. Kuzey Amerika’daki AVRUPA KOLONİLEŞMESİ BOYUN­ CA ilgisiz ve hatta ve hatta kendi komşularına karşı düşm an­ ca olan yerli kabileler farklılıklarının üstesinden gelmenin önemini çok önceden görmüşlerdi. onlara ve kültürlerine ne ol­ makta: olduğunu anlamıyorlardı. deneyimlediklerimiz aynıdır: Yaşa- füa saygı duymaktan bahsediyoruz. Basitçe.kurtulmalarını onlara yardım eden yerlilerin öğüt ve des­ teklerine borçlu oldukları yazılıdır. kısa zaman içinde bu iki yaşam biçiminin birbirine zıt olduğu anlaşıldı. Bugün Amerikanın kuiyüydoğu kıyıları olarak bilinen yerlere ilk gezginler ve yerjlŞiınciler geldiklerinde.Gregg Braden olsun. aksi halde . Tarihin bize öğrettiği en büyük derslerden biri.hazırlıksız yakalandıkları bir kış -. Ku­ zey Amerika’daki ilk sabit Avrupa yerleşim yeri olan Virginia. pek çok yerli Avrupalı kolonicilerin ciddi olarak ortaya koyduğu tehcJideri ciddiye almadı. en temel boyutta. Öte yandan aynı kabileler içinden bir avuç lider yaklaş­ makta olan tehlikenin gittikçe daha fazla algılıyordu. Jamestown*da yerleşenlerin günlüklerinde 1607-1608 kı­ şındaki korkunç soğuktan . rekabet ve çanşma He asla gerçekleşmeyecek bir hayatta kalma şansı sunmasıdır. kuşaklar boyunca orada yaşayan kabileler ve aileler onları memnuniyetle karşılamışlardı. birlik ve yardımlaşmanın. 'etraflarındaki havanın ve göklerdeki yağmurun sahiplenilmes i gibi idrak.

Hayatta kalmalarının bunu ger­ çekleştirmek olduğunu biliyorlardı! Maalesef.çünkü biliyorsunuz ataları­ mızda bol geyik ve deri vardı. yerli insanlar yaşam şekillerini Avnıpalılara kaptırıyordu. ve hepim iz aç kalacağız” (33) Maalesef. o n u Uncas . tırpanlarla çi­ menleri kesti ve baltalarla da ağaçl arı devirdi. Ama bu İngiliz topraklarımızı aldı. aynı anda. aksi halde kısa zaman içinde sürüleceğiz. ovalarımız geyikler ve ormanlarımız ve köylerimiz çok balık ve kuşla doluy­ du. ve açgözlüleri deniz kenarla­ rındaki yiyecek yerlerimizi yağmaladı. Kabileler arası savaş sıra­ sında. Mohawk kabilesine ulaşıp tarihçi lan K. İngilizler bu konuyu yargılam a hakla­ rının olmadığına karar verdiler. (32) 1642 yılında. tarihin derslerinden biri daha. inekle­ ri ve atları çimen yiyor. artık çok geçti. Öte yandan. şef söylendiğine gö­ re şöyle dedi: Onlar (İngilizler) gibi bir olmalıyız. Çok daha büyük bir iyilik için birleşme ko n u su n d a aldık­ ları dersi belki de en keskin bir şekilde anlatan Narragansett kabilesinin hikayeleri ve liderleri Şef M iantonom o'dur. İngiliz Kolonilerinin yargılam a sınırlan içinde olmadığı için. Sonuç olarak. organize olma ve öyle harekete geçme konusunda toplumlarınm başarısızlığının sonuçlarına şahit olduklarında.Tanrı ’nm Şifresi sonsuza d ek yokolacaklardı. liderler de bir­ leşme. Şef. Kuzey Amerika’daki kendi kabilesinin. yaşam ın bir ye­ rindeki iyi niyetli çabaların başka bölgelerdeki sorunları her zaman çözmediğini göstermiştir. Steele'in “Ameri­ kan Yerlilerinin direniş hareketi” olarak adlandırdığı bir bir­ leşme ittifakı önerdi. bir zam anlar savaş­ tıkları civar kabilelerin üyelerinin sayısından çok daha fazla kişinin kolonileşmenin ortaya koyduğu tehlikeyi farketmişti. Şef M iantonomo M ohenganhiar tarafından esir alındı ve İngilizlerin hapishanesine bir “asi” olarak ko­ nuldu.

o birleştirici ses yeterince çabuk oluş­ madı. yüzyılda. Buradaki anahtar. dolayısıyla da direnmekten biraz fazlasını yapabildil er sa dece. kolonileşmenin nasıl meydana geldiği bambaşka bir açıdan anlatılırdı.sı iç savaş ve fikir. tüm Avrupa’da son derece derinden hissedil en memnuniyetsizlik dalgası ve “Yeni Dünya”nın kolonileşmesine imkan veren teknoloji durdurulamayacak bir hız kazanmıştı. Kuzey Amerika kabilelerinin topraklarına ve yaşam şekillerine neler olduğunu gördüklerinde ise AvrupalIların tanıttıkları hastalıklar (çiçek hastalığı gibi) yüzünden çok za­ yıf düşmüşler ve gelişmiş tüfek ve top (aynı zam anda atla­ rın. kolon ileşmenin ilk yılla rında eğer yerliler bir araya gelebilselerdi. Bu hikaye kişisel farklılıkları bir kenara bırakıp ortak bir tehlike karşısında birleşmenin değerini net olarak anlatmak­ tadır. 17. Her ne kadar kesin olmasa da. Kabileler arq. Yerl iler tarafından gösterilen çabalara aldırmaksızın Kuzey Amerika'nın kolonileşmesinin gerçek­ leşebileceği de şüphelidir. Kuzey Ameri ka’da kat­ ledilen yaklaşık 20 milyon yerlinin sonu bambaşka olabilir­ di. değerler ve amaçlardaki farklılıklar yüzünden. Öte yandan gelişimin m eydana geliş şekli 1607 yılında Virginia'da yaşayan yaklaşık 50. bölgesel farklılıkların üstesinden gelme ve oıtak bir yarar için birleşme konusundaki başarısızlıkları yü­ zünden Kuzey Amerika’nın yerlilerinin sevdikleri herşeyi kay­ betmiş olmalarıdır: kültürlerini. yüzlerce kuşaktır gözettikleri .Greeg Brcıden kabilesine iade ettiler ve asılırken İngilizler cezasının yerine getiril diğine şahitlik etti. “yeni” topraklarda nasıl hayatta kalabilecekleri hakkındaki bilgileri ve tek bir sesin gücü sayesinde. trenlerin ve kalelerin kullanımı) gibi silahlarla etkisiz ha­ le getirilmişlerdi. kolonizasyonun meydana geliş şekline bakıldığında yerlilerin yerleşimcileri onl a ra karşı çalışmak yerine onlarla biri ikte çalışmaya ikna edebilmişlerdi.000 yerlinin varlığını yeni­ den şekillendirmiştir. Çok sayıda ol malarının verdiği kuvvet.

grafiksel olarak göstermesidir. ■ uygulanabilir. kayesi anlatılabilecek pek çok bu tür hikayeden biridir sa.T an rı ‘mn Şifresi topraklar ve nihayet yaşam şekillerinin büyük b ö lü m ü n ü . baş.. 'A ynı ilke daha büyük açıdan bizim gezegenim iz için de. rini yaşam şekillerini tehlikeye sokan farklılıkların ötesine : yö n eltm elerine ve varlıklarını tehdit eden konuların üstesin. hay­ van ve insanlardaki prensipler benzedir. toplum larrn ve ulusl. Özellikle bu örneği verm e nedenim hayatta kalm a . d ır Buna ek olarak. Ders basitçe şudur: grupları.arın ilgile. yen iden kurulm akta ve konınm aktaj. h akkında bugünden öğrenebileceğim iz çok güçlü bir dersi. dönm ektedir.: nın hayatta kalması. daha sonraki çalışmaları . ka türlerin örneklerinde de birleşm e ve işbirliğinin gücünü d ° g m d a n gördüğüm üz kanıtlar vardır. geleneksel tıp... Her ne kadar türler farklı da olsa. böcek.. D arwin'in teorisin i geliştirirken yaptığı gözlemler sosyal davranış çalışmalarında verlien klasik örnekler haline gelm işlerdir. . G örünüşte doğru bir sağduyu olmasına ek olarak. Böylesine engin ve eski bir yaşam ş ek linin kalıntıları b u g ü n Kuzey Aınerika’daki geriye kalan bozulm am ış. The Origin of Spic e s’da kuvvet ve hayatta kalm a hakkında Darwin'in dikkat çektiği görülen sonucunun aksine. tarih hayatta kalm ak için gerekli olan bu • tem el prensibi fark etme k o n usunda başarısızlıklarla dolu­ dur. D oğa: B ir lik v e İş b ir liğ in in M a v i K o p y a sı H er evrim teorisinin kendisi sert eleştirilere m aruz kal­ m ışsa da. ibadet ve yaşam şekille-. e n g e bel i ve güzelim topraklarında.■ den gehnek için birlikte çalışmaya bağlıdır.dece. Her ne kadar bu gözlem sezgisel olarak çok: ■ aşikar görünse de. Şef Mia ntonom o ’nun ve ABD’nin ilk kolonileşm esinin hi. n n d en m em nun olmayan gittikçe daha fazla sayıda insan Amerika ’nın ilk sakinle ri tarafından kutsal sayılan esk i yola.. ailelerin.

tohumun hasat edilmesi ve “malt haline getirilmesi”. Swomley rekabetten ziyade işbirlikçi bir konu ınun . binaları.ropotkin karmcaların rakip olmaktan ziyade işbiriikçi top­ luluklar hal inde yaşamak için sah ip oldukları içgüdüsel ye­ tenekleri sayesinde böcek krallığının deneyimled iği faydala­ rı belagatli bir şekilde anlatmıştır.tüm bunlar yoğun ve zahmetli yaşamla rının her evresinde uygu ladıkları ortak yardımlaşmanın doğal bir sonucudur. yerin altına yaptıkları kemerli galerileri.Gregg Braden “en uygun şekilde hayatta kalma”dan ziyade birleşme ve iş­ birliğini temel alan hayatta kalma stratejilerini anlatmaktadır. İnsanlarınkine nazaran çok daha üstün nitelikli ha­ rika yuvaları. bir türün başarısı ve hayatta kalmasının anahtarının işbirliği ve birleşme olduğu nu nasıl bulduğunu anlatarak Darwin’in son çalışmasını kendi gözlemleri ile desteklemiştir.” (34) 20. K. Bir sonraki kitabı olan The Descent of Man’de. Paul School of Theology’de' sosyal ahlakiyet üzerine fahri profesör olan Dr. yumurta ve larvalarını besle­ mek ve Linnaeus’un son derece resimsel bir şekilde tarih ettiği “karıncaların inekleri” olan yaprakbitlerinin yetiştirilmesi için inşa edilen özel yuvaları. ve nihayet. ge­ lecekte küresel toplumlar kurmak için barışçıl ve işbirlikçi bir yol bulm anın bizim yararımıza olacağı konusunda biraz şüphelidir. yüzyılın başında. mısır tarlaları. Darwin bu gözlemleri şöyle özetlemektedir. John Swomley. 1902 yı­ lında yazdığı klasiği Mutal Aid: A Factor of Evolution’da. (35) Kansas City'deki St. Rus doğabilimcisi Peter Kropotkin. “Sıcakkanlı üyelerin çoğu­ nun çok büyük bölümünün de dahil olduğu bu toplumlar en iyi şekilde gelişmekte ve çok s ayıda üremektedirler. yiğitlikleri ve üstün zekaları . cesaretleri. kazılmış yolları. Kropotkin ve diğerlerinin gösterdikleri kanıtlara değinerek. geniş odaları ve tahıl am­ barları.

Tanrı ’m n Şifresi ^ vd\ °y ^ sadece başarılı bir toplum un yararına olm asında çok daha fazlası olduğunu söylemektedir... bir kez daha karşılıklı yardım laşm a alışkanlıklarına sahip olan hayvanların şü p h e getirm eyecek şekilde en uygun olduklarını görürüz. Basit ve doğru dan bir şekil­ de... . Swomley türler içinde ya da arasındaki reka­ bete değinerek Kropotkin’in söylediklerini tekrar ed e r “bu her zaman türlere zarar vermiştir. Doğaya. Doğanın derslerinden. bizlere bu birlik ve işbirliğinin yaşayan canlılar için b ir avantaj olduğu göste­ rilmektedir. (39) Doğa çoğunlukla böcekler ve hayvanlar arasındaki birlik. sı­ nıfta. sem pozyum un başkanı R onald Logan katılımcıların doğayı başarılı toplumların bir m odeli olarak görm eye çağır­ mıştır. Rusya. işbirliğinin “evrim ve hayatta kalm anın ana htar e tk e n ”olduğunu değinmektedir. ailede. B irobidzhan’da gerçekleşen H um anistic Aspects of Regonal D evelopm ent’in açılış konuşm a­ sında. her zam an yıkı­ cı değildir. işbirliği hay atta kalma deneyim lerini katliam a yeri olarak al­ gıla nır.” (38) Aynı konuşm ada. şü h p e siz ki. “eğ er bizler. Etrafımızdaki d ü n y a d a n böylesine zam anla test . Karşılıklı yardım laşm a ve karşılıklı destek aracılığıyla rek ab etin ortadan kaldırılm ası daha iyi şartların oluşmasına n ed e n olmuştur. ‘En uygun olan kim dir: birbirleri ile sürekli savaş halinde olanlar mı yoksa birbirlerini destekleyenler mi?’ diye sorarsak. Kropotkin’den söz ed erek şöyle d emiştir. (36) Şubat 2000 yılında yayınlanan bir yazısında. gmplarda yararlı o ra n d a bir rekabetle ilgili araş­ tırmasını a nlatmıştır. Kohn şu sonuca varmıştır: “ideal oranda bir re k a b e t. oyun b ah çesin d e.. daha sonra Logan yazar Alfie K ohn'nun (No Contest: The Case Against C om petition) çalışm asından bahsetmiş.” (Noetic Sciences Review . 1990 baharı). O nların hayatta kalm a şans­ ları daha fazladır ve kendi saygın snıflarında.. işyerinde. her türlü ortam da. İşbirliği ve re k ab et üzerine belgelenm iş 400 çalışmayı gözden geçirdikten sonra." (37) 1993 yılında. zeka ve be­ densel organizasyonun en yüksek gelişim ine ulaşm aktadır­ lar.

Hastalığın yok edildiği. biliınadamları. farklı alanlarda 150'den fazla bilim adamı He yaptığı söyleşiler sonucu. sınırsız enerji kaynakla­ rının. global işbirliğinin ve boyutlar arası /^ H z \ Güven Duyulacak bir Gelecek . Sonuçların değer olduğunu ve bunun dört gözle beklediğimiz bir şey olduğu­ nu bilmeye ihtiyaç duyarız. yaşam sürelerinin yüzlerce yılla ölçüldüğü ve hatta ölümsüzlüğün m ümkün olduğu bir dünya görmekteler. hayvan krallığında olmayan ama bi­ zim dünyamızdaki ek bir etmenin açıklanması gerekir. Zamanımızın en parlak. son derece fantastik bir imkanlar çağından bahseder. Biz­ leri evrim geçiren. ölümsüzlüğün. Kaku neredeyse gerçek olamayacak kadar güzel . 1O yılı aşkın bir süre boyunca. Bi­ reyler ve bir tür olarak. tür olarak neye ulaşacağımız hakkında tahminlerde bulunmuşlardır. yaşam şeklimizi değiştirm eden ön­ ce. gelecekçi ve ileri görüşçülerin ba zıl an şu anki teknolojik ilerleme oranının yıl­ lar ve hatta asırlar boyunca bozulmadan devam ettiğini var­ sayarak. uzay yolculuğunun. genellikle “nereye gittiğimizi” ve oraya gittiğimizde ne ile karşılaşacağımızı bilmek zorundayızdır. Öte yandan. bu gelecekçiler dünyanın en karanlık şart­ larını bizleri öngördükleri zamana taşıyan geçici engeller geçilmesi gereken basamaklar . böyle bir stra­ tejiyi uygulamak için. Her ne kadar her bir vizyon farklı da olsa. Visions adlı kitabında. Aynı zamanda. zaman yolculuğunun ve Uzay Yolu gibi teknolojilerin sıradan olduğu gezegenler ve galaktik türler arasında canlandırmaktadırlar. Neredeyse evrensel olarak.Gregg Braden edilmiş stratejiler şüphesiz ki bizleri hayatta kalmamız için bir mavi kopyaya götürmektedir.olarak görmektedirler. hepsi insanlı­ ğa en büyük acıya neden olan şartların geçmişimizin hatıra­ larına dönüştüğünü önceden görmektedirler. Michio Kaku bir gezegen olarak geleceğimizin nasıl olacağına dair görüşünü anlatır.

Tip II ve Tip III olarak adlandırarak so n u ç la rın derecelerini geniş bir şemaya 3 seviye şeklinde yerleştirir. Kardashev ilerleyişin ilk se v iy e sin i Tip I olarak tanımlar. M edeniyetleri Tip I. Bu örnekte ve apaçık şem ad a. Böyle bir geleceğin nasıl olacağına dair bir ö n çalışm a oluşturmak için. sınırlı yakıt k a y n ak l a rı üzerine savaş ve re­ kabet ihtiyacını ortadan k a ld ırm a k ta d ır. Bir Tip I m e d e n iy e tin in sah ip olduğu geniş enerji kaynakları. enerjiyi yaşamın temel ih tiy a çları için üreten teknolojileri muhtemelen çoğalm akta o la n n ü f u s a çokça yetmektedir. Her tipteki enerji tüketim inin farklılığı bir önceki seviyenin kabaca 10 m ilyar katıdır ve kısa zam an dilimleri içinde nispeten “k ö p rü k u ru lab ilm ek ted ir”. savaşlardan ve bir şekilde u z u n z a m a n dilim leri içinde k en ­ dilerini yok etm eden k en d ilerin i en g elley en yadsınam az farklılıklardan kurtulm uş o lara k canlandırm ıştır. Tip II m edeniyetlerinin ö z e lliğ i şim diki gezegenlerinin ötesine ulaşma ve enejilerini e n y a k ın güneşlerinden alma . Aynı zam anda. (40) her tip m ed en iy e­ ti ayıran anahtar özellikl er tü k ettikleri enerji m iktarı ve en er­ jilerinin kaynaklardır.Tanrının Şifresi yolculuğun varolduğu bir g eleceğ in . fosil yakıtlarının sınırlarınave nükleer-güçlü ek o n o m ilerin risk v e tehlikelerine tırman­ maktadırlar. O k y an u su . binlerce yıllık bir zam an aralığ ı ile ölçülen m edeniyet­ lerin. a ncak günü m ü z fosilyakıt bazlı ekonomilerin krizlerinden ve teknolojtyi k en d i­ mizi yok etme eğilimi üzerine ku llan m am ızd an kendim izi kurtulabilirsek m üm kün olacağını şart koşm aktadır. doğanın elem entlerini enerji kaynakları olarak kulIanma yeteneklerine göre m ed en iy etlerin gelişim lerini sınıf­ landırma girişimine başvurur. rüzgarı ve de­ rin yer teknolojilerini k u lla n a ra k . uzun öm ürlülüğünü sa ğ la y a c a k işte böylesi geniş bir zamandır. Y üzlerce -değil. K ardashev m edeniyetleri global bir perspektiften. Kaku Rus astro n o m N ikolai K ardashev ta­ rafından. ' Özellikleri doğanın gücünü k u lla n m a la rı ve enerjilerini ge­ zegenin kendisinden alm alarıdır. tek n o lo jik erg en lik dönem lerinden.

Bazı kuramcılar Tip II gi­ bi bir medeniyet olarak. Kaku’nun görüşüne göre.yeteneğidir. araştırmacı. pek çok bilim adamı. böyle bir medeniyetin uzun ömürlülüğü günümüz dünyasında asırlardır kayıp olan gezegensel döngülerle ilgili hazırlıklara da imkan verecektir. "doğal” kötüleşmenin ve “şans eseri” olguların onla­ rı yok edebileceği olasılığının sınırlamalarından zamanla kurtulunmuştur. bu büyük miktarları kullanılabilir enerjiye çevirmek üzere tasarlanmış toplayıcılarla güneşe gideceğimizi öne sürmektedirler. İklim kuralları ve gezegene ait ayarlamalar teknolojisi sayesinde. Yerel güneşleri ta­ rafından yararlanılan enerjinin ötesine ilerlemiş olan bir Tip III medeniyeti enerji araştırmalarını başka yıldızlara ve bel­ ki -de galaktik bir medeniyetin içinde geliştiği için. 6iz\ Gregg Braden . Kardashev’in sınıflandırma şemasındaki en karmaşık ge­ lişmeler Tip III medeniyetlerininkilerdir. bizlerin aktif olarak böylesine bü­ yük miktarlarda solar radyasyonun yönünü dünyaya yönel­ tecek. Uzun yaşam süresine ulaşmış olarak. Kaku doğanın güçlerinde artık yararlanamaz bir dünya tas­ vir etmektedir. galaksi­ nin kendi üretimine doğru gelişecektir. Bir Tip II medeniyetin tadını çıkardığı faydalarla ilgili. G üneşlerinin enerjisini kullanmak teknolojile­ rini bizim bugün yaptığımız pasif olarak ışın toplamadan da­ ha karmaşık bir hale getirecektir. Hem hayat hem de medeniyet ölümsüz olacak. bir Tip III medeniye tinin bilimi. gelecekçi ve öngörülü kimse böylesi teknolojilerin ve geleceklerin sa­ dece mümkün olmakla kalmayıp kaderimiz olduğuna da inanmaktadırlar. Bugün bu senaiyolar ne kadar fantastik gö­ rünüyorsa da. Tip II me­ deniyetlerinin enerji ihtiyaçları onları yavaş yavaş yeni ve sı­ nırsız enerji kaynakları bulmak için başka gezegenlere yö­ neltmektedir. yıldızlar ve galaksiler arasında kısa yöl tünelleri yaratmak için uzay/zaman açılı­ mına izin vererek yakalanması zor Planck enerjisine bile hükmedebilecektir.

zira farklılıklarım ızı gi­ dermenin. Kaku’nun sözleriyle. Öğrenme virajım geçm eli ve b izi geçmişte birbirim izden ayıran fa rk lılık la rd a n çok daha yü ce olm anın bir y o lu n u b u lm a lıyız. globalleşen dünya ekonom isi say e sin d e git­ tikçe birbirimize daha fazla bağlı bir d urum a gelm ekteyiz. ırkçı. etnik ve d ini savaşla­ rın varlığında. 21. Aynı z a m a n d a . Hala kullanımı çevrem izi de teh d it e d e n fosil yakıtların sınırlı kaynaklarına bağlıyız. bizler hala Tip O medeniyetiz: hala um utsuzca çatışan ve kısk an ç ul us larla kırılmakta. Tip O medeniyetlerinin bir imzası da kolektif bilgilerini türlere bir bütün olarak yararlı olacak bir bilgelikle d o ğ u r a ­ mamalarıdır. Bu trendler bizi nereye götürecek? G erçek an lam d a. Sivil. bu dünyanın tam olarak neye benzem esi g erek ti­ ği ile ilgili inançlarımızı birleştirmenin yollarını aram aktayız. Avrupa Birliği gibi ticari organizasyonların o lu şu m u n u b u trendin bir kanıtı olarak aktarmaktadır.Tanrı ’m n Şifresi Bu boyutta ilerlemelere u la şm a n ın a n a h ta n B ugün yaşam akta o ld u ğ u m u z şeylerden geçm ektir. b u sorunun yanıtı bu gün yaratılmaktadır. Bu sınıflandırma şem asında. Eğer son 200 yılın başarıları türüm üz için neyin m ü m k ü n olduğunun herhangi bir belirtisi ise. o zam an g elecek .” (41) Bir um ut ışığı olarak. bugün pek çok kişinin sadece rüyalarında g ö re b ile ­ cekleri bir vaadi taşımaktadır. insanoğlu d ah a Tip I m e d e ­ niyetinin seviyesine ulaşamamıştır! D ünyam ızın şartları ve bilim ve teknolojinin gel işimi göz ö n ü n e alındığında. yüzyılın sabahında bizler bir Tip O m edeniyeti olarak sınıf­ landırılmaktayız. Böylesine yaygın o la n acı v e . aynı zam anda o lu şa n bir trendden de baksetmektedir. d o ğ ­ rusu. bu yak ıtl arın mülkiyeti dünyamızın nüfusunu “sahip o la n la r” ve '‘sahip olmayanlar” olarak tanım lam akta en d ü strileşm iş dünya çağını baştan sona çatışma içine sokm uştur. dini ve ulusal sınırlarla d e rin d e n ayrı lmaktayız. “Y eryüzünde.

muhtemelen. Houston şöyle demektedir.Gregg Braderı trajedinin üstesinden gelmenin anahtarı. silah ve teknoloji ola­ rak serbest bırakıldığı bir başka 100 yıl daha yaşayıp yaşamayacağımızı sormaktadırlar. • Drake’in denklemi kainatımızın tarihinde 13-14 milyar yıl içinde gelişmiş 10. kurmalıyız. Eskiden varolan her şey artık yok ve bugün varolmayan her şey bir gün olacak. . gelecek­ ten ne bekleyebileceğimizin ve çalışmasının niteliğinin be­ lirleyicisi haline gelen belagatla. İşbirliği yapmalı ve farklılıklarımız arasında köprü . "Beklenen tek şey beklenmeyendir.” (42) BOLUM 8 Ö Z E T • Hala zihnimizde taze olan milenyumla birlikte.000 zeki medeniyet olabileceği­ ni tahm in etmektedir. Bi­ zimki bir kuantum değişimi çağıdır. tarih içinde zamanımızın büyüklüğünü en iyi anlatan yazar ve ileri görüşçü Jean Houston'dur. Belki de. Ve bizler devam edenleriz. Bugün yüz­ leşmekte olduğum uz değişim derecesine istinaden. Yaşayan her bir hücrede saklı olan mesaj bize geleceğimize inanmak için bir neden ve böylesi gelecek me­ deniyetlerin m ümkün olabilmesi için farklılıklarımız arasın­ da köprü oluşturm anın anahtarını vermektedir. bilim adamları doğanın güçlerinin yaptığımız şeylerin so­ nuçlarını tam olarak anlamadan. pek çok kişinin ön­ gördüğü bir dünya inşa etmek için yeteri kadar uzun yaşa­ maktır. Belki de türümüz tarafından şimdiye kadar deneyimlenmemiş bu en büyük değişim zamanından sağ şalim çık­ malıyız. Pek çok kişinin sorduğu som şudur: Neredeler? Car! Sagan onların teknolojik ergen­ likten kurtulamamış olduklarını öne sürmüştür. dünyanın şimdiye kadar hiç görmediği en radikal yapı-çözüm ve ye­ niden yapılanm a çağı.

erim iş çömlek ve cam üzerinde erimiş k u m on ların k en d ile­ rini atomik silahlarla yok etmiş oldukları teorisini mi desteklemektedir? • En az 20 aktif sivil. h e p im iz a y n ıy ız .000 yıl önce yaşamış b ü y ü k bir şehrin arkeoelojik keşifleri tarihimiz b aşlam ad an ö n ce bir zamanda. "B eşparm aklı insanlar olarak. bir m edeniyet o la ra k . gn y • Amerikan yerlilerinin geleneklerinden v e doğadaki gözlemlerinden örnekler birlik ve yardım laşm anın. gerekli bi­ limsel ve m hani anlayışa ulaşm ak için yeterince uzun yaşamamızdır. Yeryüzünde daha evvel gelişm iş bir m e d e ­ niyeti mi işaret etmektedir? Tıpkı eski H indu efsanesi Mahabharata’da an la tılan büyük savaşta söylendiği gi­ bi. " .Tanrı 'nm Şifresi ® 8. dini ve politik savaş b u g ü n devam etmekte ve Soğuk Savaşı takip e d e n "barış” sad ece göreli bir barış olarak kalmaktadır. bizlere d ü ş ü n m e yeteneği ve ellerimize ya şa m verilm iştir.000 ve 12. K üresel baskı ve kitle imha silahlarının gittikçe artan stoklanm ası m u h ­ tem elen son i 00 yılda olmadığı k ad ar yıkım la so n u ç­ lanan bir gezegensel çatışmaya n e d e n olm aktadır. re ­ kabet ve saldırganlıktan çok daha fazla hayatta kalm a şansı verdiğin i net bir şekilde gösterm ektedir. radyoaktif insan iskeletlerinin kalıntıları. B öyle bir zam ana ulaşmanın anahtarı. • Gelecekçiler çok uzak olm ayan bir gelecek te g ü n ü ­ müz hastalık ve acılarının geçm işin anıları olarak ka­ lacağı bir zaman öngörm ektediler. Beş parm aklı insanlar olarak. H ücreleri­ mizdeki mesaj böyle bir birliğin m ü m k ü n old u ğ u n a inanmak için bir neden sunm aktadır. Birlik ve yardımlaşma bugün ruhani gerçek ler o ld u ğ u kadar stratejik değerler olarak da görülm ektedir.

— LINDA DEE (DINE’ NATION) .

h e rk e s. çoğu zam an “elek trik ” diye tarif edilen bir his uyandırır. alışveriş y ap an lar v e banliyödeki evlerinden her gün şehirdeki işlerine gidip g e le n le r genellik­ le. Y ine de. kendilerini yaşamlarının o. toplantılara ya d a y an ların d a yü­ rüyen kişiye odaklanmış. herhan­ gi bir kalabalığın içinde.-9 T A N R E N IN - Ş İF R E S İ: İ n a n m a k i ç i n ■b i r N e d e n ^ —alabalık insan topluluğu beni her za m a n büyüler. ■ geniş kitleleri içine alan m uazzam b ü y ü k lü k te havaalanların­ da dolaşırken ya da herhangi bir şehrin k aldırım kenarındaki . YüzJ ^ le r c e ya da binlerce insan aynı y e n ay n ı zam an dili­ minde bir araya geldiğinde.kısacık anını paylaştıkları y ere getirm iş olan acı ve kişisel trajedi kadar başarı ve n e şe n in d e ürünüdür. bazen kendilerinden sadece bir kaç san tim u z a k ta olan et­ raflarındaki tarihin farkında bile değillerdir. konserler ve re sta u ran tlard an top­ lantı salonları ve oyun parklarına kadar. Penı'daki egzotik m arketlerde. çok daha büyük bir p lan d ah ilin d e b u tür deneyimlerin çok daha belirsiz bir rol o y n ad ığ ın ı tahm in et­ mek kolaydır. Ayak işlerine. K ah ire’n in pazarlarında. Her biri kendi h ay atların d ak i işler hakkında düşünceye dalmış bu kadar ço k k işinin organize olmuş kaosunda.

fırtına. insanların birlik oldukları zamanı düşündüğüm üzde. genellikle bunun paylaşıl­ mış bir trajedi ya da ortak bir hedef gibi birlik olma ihtiyacı olmaktadır. karşılık olarak ilk aklımıza gelen. çok kereler tek bir soru kafama ta­ kılır: "Bu kadar çok kişiyi birlik olma duygusunu paylaşabi­ lecekleri bir ana taşımak ne kadar zaman alır?” İnsanları kül­ türel. En çok verilen yanıt kişisel deneyime ve tarihsel perpektife dayalı olur. Birbirine ta­ mamen yabancı insanlar arasında. Açıkçası. sel ve kontrol edilemez yangınlar­ daki . zira son 100 yıldın meydana getiıriigi kuraklık.Gregg Braden bir kafesinde otururken.ve ayrıca endüstriyel ve çevresel felaketlerdeki . yüzyılın son yarısında. iyi fırsatlardan birini de yaratmıştır. global ailemizin hem insan ya­ pımı hem de doğal haddin den fazla sayıda felaket deneyimlediği gibi bir duyumsama mevcuttur.bü­ yük aşırılıklar daha evvel hiç saptanmamıştı! (1) Andrew Kasirgasının yıkımı ve Doğu Avrupa’daki sellerden Oklahama'daki bombalama ve Rusya’daki Çernobil reaktöründeki sızıntıya kadar. 2°. mutlu olaylar sonucu oluşan bir birlik duygusunu da deneyimledik. dini ve sınıf farklılıkların ötesine taşıyan ulusal bir marşda olduğu gibi. benzer bir etkiye sahip ne tür bir gerçek açı­ ğa çıkarılabilir? Hangi cümle geçmişte pek çok kişiyi birbirin­ den ayırmış olan inanışları aşacak güce sahiptir ve söylendik­ ten çok uzun zaman sonra bile devam edecek bir birliği ve­ rebilir? Seminerler ve konferanslar sırasındaki resmi olmayan tar­ tışmalarda. Süper Bowl maçları ve Olimpik müsa­ bakalar neşe ve zindelik veren anlar ve paylaşılmış bir /^ z z \ Birleştiren Deneyimler . Bu şüphe istatsitiki ofarak da doğrulanmaktadır. kraliyet düğünlerinin ne­ şe veren görüntüleri. aynı zaman dilimi içinde. hafızalarımıza silinmez izler bırakan trajedi­ ler işbirliğ i açısından en. sık sık dinleyicilere bu soruyu sorarım.

. b aşkalarının kahramanlık o la­ rak algıladıkları g ü c ü n d ışa doğnı dalgalanmasının içlerinde hareket eden d a h a y ü c e bir kuvvetin gerçeküstü ve bazen de m istik d u y g u s u n d a n geldiğini söylemektedirleı. insan olarak kendimiz hakkında da birşeyler ö ğ r e tti. her z a m a n ­ kinden daha sık. H e r n e kadar olaylar “trajedi sonucu bir• lik” örnek le rin d e b iz i b ir araya getiren katalizörler olsalar d a. b a n k e rle r. b ir z a m a n la r N ew York ’u n gururu ol an g ö k delenin taş y ığ ın la rın d a n m ü m k ü n olduğu kadar çok in san ı kurtarmak için k u r ta r m a ek ipleri ve orada olan herke sl e b irhkte omuz o m u z a çalışm ışlard ı. yitişlerine v e c e h e n n e m in içinde kaybolup gitmelerine şahit' olduğumuzda. Dinleyicilerim. b içim de sendeleyerek uzaklaşırkeh gözlerindeki o b a k ış ı k im unutabilir? Aynı binalara. Kendim d ü ­ şü nmeyen b ir k a. O gün. b e ­ denlerini kaplam ış ü rk ü tü c ü b ir gri kül tabak asıyla yanan b i­ nalardan sersem lem iş bir.h isse ttiğ im iz k o rk u ve gurunı kim unutabilir? Birdenbire. içlerimizd e u y a n d ır ık la r ı güç için için yanan bina. yardım se­ ver insanlar b ir a n b ile te re d d ü t etm eden başkaları yaşayafü bilsin diye h a y d a r ı n ı risk e attılar.Tanrı'nm Şifresi \ vo\ y ^ deneyimde birlikte e ğ le n ip oynam a n edeni sağlamıştır. Ö t$ yandan bu anlar. < 11 Eylül 2001’in g ö rü n tü le ri bu neslin zihinlerinde ta p ta ­ ze kalacaktır ve m u h te m e le n . tarih in gidişatını gerçekten şekillend i r e c e i hayat-değiştiren o lay lar o lm ak tan ziyade kısa süreli d u y g u ­ sal patlamalar olarak yaşanm ıştır. Bü tür olaylardan kurtu­ lanlarla y ap ılan s ö y le ş ile r d e .h ra^ n an lığ ın sayısız örneklerinde. eşy a tüccarları. türümüzün en k ö tü dışavurum unun s o n u c u o la n felaketlere tamamen zıt o la n türüm üzün e n g ü z e l ifa d e sin e de şahit olduk. artık­ larından çok d a h a fa z la b ir şeydir. . başka la ­ fını kurtarmak için k o ş a n polislerin ve itfayecilerin gözd<=Q. gelecek pek çok neslinde d e . birlik için e n b ü tü k fırsatların trajediler o l­ duğunu söylem ektedirler. şarküteri şeflerl v e sokak s a ç ıla rı. ' Bir topkım o l a r a k k e n d im iz hakkındaki şeyleri gösteren bu tür olaylara e k o la r a k . Yaşamın her k e s im in d e n v e farklı uluslardan insanların.

başka boyutjlSiiuşnıuştu. pazarda ya da soruyu a z \ İ .■illiI tiS8s?. SİHayat kurtarmak için çılgın bir çabayla omuz omuza çallmış olanlar. Onları genellikle tehlikeden uzağa yönelten 8İnnsı aşarak yaşanan deneyim içlerinde çok daha derin m e y le ri uyandırmış ve onlar da harekete geçmişti. Ve bu yanıt ■jay anında deneyimlenen duygu ile bağlantılı olmalı. “Hepimizin için8 |9 ah a büyük bir birlik ve amaç duygusunu uyandırabilel l f hangi tür bir deneyim bu kadar çok kişi ile paylaşılabifijllbikkatimizi sadece ana çevirmenin ötesine geçirmenin. öyle kişisel y^öyle gerçek bir duygu içinde paylaşma ihtiyacında olma:||iz ki onu görmezden gelmemiz imkansız olmalıdır. kendime “Bunun bedeli nedir?” l||uşunu sorduğumda. Bu. insanların yajlP yü sonsuza dek değiştiren olayların kendisinden çok deneyimin anlamıdır. her birimizin öyle derin. ^katalizör her ne ise. İpeklerimizi ve zihinlerimizi yeni bir yaşamı saygın kılan iş­ ediği ve barış gerçeğine yöneltmenin bedeli nedir?” sorusupırçBu tür soruların mutlaka bir yanıtı olmalı. genellikle güçlerinin diğer kurtarıcılarla birlikpH|erçekleştirdikleri basit bir yardımlaşma nıhundan çok İSfia fazlası olduğunu ifade ederler. |trilük rutinlerimizi değiştiren bir “: ı a ” konumu gerektirSelidir.S Gregg Braden Üllgeçtıkleri sırada aKiııarınaan r da insanüstü çabalarından dolayı saygı duyulan bu kişilerin bu soruyu "başka bir seçimleri olmadığı” şeklinde yanıtlamaflrlliiÇ nadir görülen bir olay değildi. aslında sorduğum. Sadece bunun doğru olduğunu bilmek bile özüınüMrçmerkezine nüfuz etmeli. ensemizdeki ince tüyleri diken §j§en etmeli ve gözlerimizi yaşla doldurmalıdır! Bu büyükJljtöe bir deneyim havaalanında. İhtiyaç halindeki İPŞkşka insanın dolaysız deneyimi onlarla bir . Bu ve buna benzer örneklerde. ffİBu açıdan bakıldığında. Bu sanki onların bir kifiilî tek başına yapabileceğinden çok daha fazlasını “birlikllbaşarabileceklerini bilmekten kaynaklanan ruhların “erifi^ si gibidir.

bir üyenin deneyimi diğerlerinin de başka bir zaman m uhtem elen . kendimize az görülen bir fırsat bahşetm iş oluruz: dünyamızı ve belki d e daha da ön emlisi. Deneyim. bizlerin paraya. her erkek ve kadın . böylesine doğrudan ve içten kişisel d en ey im in inkar edilemez duygusudur. Anın ö te sin d e ka­ lan. daha evvel hiç görmemiş oldukları bir şeyi görm elerini sağ­ lar: daha yüce bir plandaki birleşmiş rollerinin so m u t ifade­ sini. daha yüce bir şe­ yin parçası olduğumuza inanmak için bir n e d e n ve d ü n y a ­ mızda bir fark yaratmak için kuvvet buluruz. yö­ netici. küresel savaşın ve hastalığın ötesine. ebeveyn ve öğretm en. Anın Gücü Hücrelerimizdeki mesajdan çıkan böyle bir yaşam ı-doğrulayan deneyim anında.d a ­ ha yüce bir güç ile ilişkilerinin bilgisi ile dayanıklılık g ö ste­ rir. Böyle bir paylaşım anına izin verm enin kiş isel etkisi sa­ yesinde. ertafındakilerin gözlerine yeni bir g ü v en . te k n o ­ lojiye ve sınırlara koyduğum uz değerden çok d a h a değerli olduğumuzun kuşkusuzluğuna taşıma gücü vardır. öz saygı ve onurla bakabilir. miras. ya kın çevremizin ötesinde olanların da başına gelmesi m üm kündür. O bilgiyi şüphe duym adan ve tereddütsüz b en im sey e­ rek.m uhtem elen yaradılışın bu engin. Hücrelerimizdeki mesajın bizi bir aile olarak. geçmişte asla an lam aın ış. sa­ vaşçı ve din adamı.geniş­ liğinde türümüzün tek örneğiyiz. Tam olarak. ırk ya da dine bakm aksızın . hoşgörmemiş ve hatta sevmemiş oldukları kişilerin varlığında. birbirim izi daha yüce bir olasılığın ışığında görm e şansı. Biz bir aileyiz .Tanrı ’nm Şifresi sorduğum kafede bulunanların başına gelebiliyorsa. Duygu sayesinde. m irasa. her çiftçi ve kabile üyesi. anın meydana gelmesine izin veren istekliliğimizden çok da ha az önemlidir. böyle bir anın bizi nereye götüreceği. kontrolden çıkmış teknolojinin tehditkar krizlerinin.h e r işçi. Tıpkı bir ailedeki gibi.

Zamanımızın en iyi düşü­ nürlerinden bazıları. bizi böyle bir duruma getiren düşünce sistemimizi değiştirmediğimiz sürece.Gregg Braden aynı deneyimi yaşayacayabilecekleri sinyalini verir. bizlerin felaketle çar­ pışmaya doğru gittiğimizi ifade etmektedir. Böylesine genişçaplı sorunlar karşısında . hasta lığın. Ne kadar uzakta yaşanırsa yaşansın. “Çok da­ ha önemli işlerimizin” olduğu açıktır! . ailemizin bir bölümünün başarısı diğerlerininde başarılı olması ve hayatta kalması için bir örnek ol­ muştur. insan ailesinin hayatta kalmak için bilinen tarihindeki en büyük meydan okuma ile karşı karşıya olduğunu göstermektedir. H er ne kadar &ünya liderlerinin aynı düşüncede olmadı­ ğı pek çok konu olsa da. yaşa­ mı görm ezden gelen teknolojinin ve nefretin her üstesinden gelişinde. Her bir üye bütün için bir potansiyeldir. bilinen her tür­ lü ilaç tedavisine karşı bağışıklığı olan virüslerin yayılması­ na ve yaşam destekleyici ürünler yetiştirme gücümüzü hali­ hazırda değiştiren hava olaylarındaki değişimlere ek olarak. belirli bir noktada. bugün bir de son derece gerçek bir küresel savaş tehdidi ile karşı karşıyayız.atalarımızın. savaşın ve yoksulluğun traj ik b oyutla rı. bir insanın. başkalarının onü. hoşgörüsüzlüğün. derimizin renginin ve Tanrfya ibadet şeklimizin farklı olmasından do­ layı birbirimizi öldürmek son derece anlamsızdır. Aynı şekilde. toplumun ya da ulusun başına gelen k ıtlığın. başkalarının da benzer trajedileri başka bir dönem de deneyimleyebileceğinin bir' ifadesi olarak dur­ maktadır. bir eğilim vardır ki üzerinde kü­ çük bir tartışma çıkacak gibi gözükmektedir: Gezegensel değişimin öncü sinyalleri.hastalığı. Eko sistemleri­ mizdeki yarım asırlık çöküntünün tehdidine.ki her biri tü­ rümüzü tehlike altına sokmaktadır . İçimizden birinin. takip etmesi için bir kapı açılır.

Bunun anlamı.o lu p olm adıği k o ­ nusunda derin düşüncelere daldık. sinyalin d ü n y a m ız a u la şm a d a n . Radyo benzeri y a y ın ların 'iletişim ­ leri ışık hızında hareket etmektedirler ve y ıld ız la r ve g eze­ genler arasındaki geniş uzaklıklara seyahat e tm e le ri ç o k faz­ la zaman almaktadır. b u n u n anla­ mı o sinyali yollandığından 300 yıl sonra a lm ışız d em ek tir. İlk cümlede. sadece sinyalin ortaya çıkmasının bile bilim sel araştırm a­ nın ve tüm toplumun düşünce yönünü d o ğ ru d a n etk iley e­ cek yararları olabileceğine dikkat çekmiştir. Cari Sagan D ü n y a’m n dışında bir zekanın keşfinin davranışlarımız ve toplum larımız üzerindeki etkisi hakkında tahininde b u lu n m u ştu . y a y ın ım ız ın al ınması için bir 300 yıl daha geçmesi gerekir v e b u d a tek b ir iletişimin 600 yıl alacağı anlamına gelir! G a la k s im iz d e k i yıl­ dızların mutlak sayısından dolayı. Pek muhtemeldir ki. Sagan böyle bir keşfin teknolojik rotamızın yaşam ı s ü rd ü rm e yeti­ si üzerine bir ipucu vereceğini öne sürm üştür. uzayın derinliklerinden g e le n bir ya­ yın bugün bizimkinden çok daha eski ve ta h m in e n d a h a ge­ lişmiş bir medeniyete aittir. Eğer o sinyal e yanıt vermeyi seçersek. Başka medeniyetlerin h a le n v a ro ld u ğ u ­ nu farzeden bilim adamları aralarındaki o rta la m a uzaklığın yaklaşık 300 ışık yılı kadar olduğunu tahm in etm ek ted irler.'’ (3) Sagan d a h a sonra dü nya dışı bir yayın kaynağına yanıt verm em eyi seç se k bi­ le. Ünlü S E 1 yazısında (2).kozmosdaki düşünen ahbaplar . yıldızları ölçüp biçtik ve insanoğlunun eşsiz o lu p olm adığı ya da bizim gibi. ihtimaller ü k m esajım ızın en yakın komşumuzun ötesinde bir yerden g e le b ile c e k olm a­ sı yönündedir. başka bir yaşam araştırm ayı in­ sanlık kadar eski olan bir merakın parçası o larak tanım la­ mıştı. Komşu bir yıldızdan gelen bir sinyal b u lu rsak . Y alnız o lu p ol­ madığımız sorusuna sadece yanıt bulm anın ö te s in d e .Tanrı ’nm Şifresi Bir Mesajın Gücü 1996 yılındaki ölümünden önce. şöyle demiştir: “Tüm tarihim iz b o y u n ca. düşünüp taşınan ve m erak e d e n b a şk a var­ lıklar .

hüc­ relerimizdeki Tanrı’nın ismi dünyamızın ötesinden geldiği kadar dünyamız kadar da somuttur. “teknolojik er­ genlik süresince yaşamanın mü ınkü n olduğunu göstermek­ tedir. Sagan bu muhtemel olmasa bile. (5) Eğer sadece bir sinyal almanın küresel ailemiz üzerinde böylesine birleştirici bir etkisi varsa. farklı altyapı­ ları olan insanlar arasındaki en büyük birlik duygusunu tu­ tuşturan.” (4) Buna ek olarak. elde edilen teknolojinin sonuçlarına hakim olmuşlardır. Böyle yaparak. Uzayın derinliklerinden elektronik bir sinyalin sembolik mesajım almaktan ziyade. “insan medeniyetinin geleceğinin yıldızlararası mesajların alınması ve deşifre edilmesine bağlı olduğunun” son derece mümkün olduğunu ileri sürmüştür. öte yandan. İnsan Geni Projesi gibi çokuluslu ve uzun süreli bir arastırmadan çıkan Tanrı’nın varlığının kanıtı kesinlikle böyle bir etki meydana getirme potansiyeline sahiptir. sinyalin bir de anlamlı olması­ nın ne demek olacağlİ1 bir düşünün . acaba bedenlerimizdeki Tanrı’nın isminin somut mesajını al­ mak benzer bir etkisi olan benzer bir deneyim oluşturu mu? Çalışmaların dolaylı olarak açıkladığı gibi. . sadece böyle bir sinyal almak bile sinyalin geldiği yerdeki medeniyetin tek­ nolojik evrimlerinden sağ çıkmış olduğunu bize anlatmakta­ dır. "Uzaydan tek bir m e s a jd iy e devam etmiştir. süreç içinde kendilerini yok etmeden. an­ lamlı bir iletişim neredeyse imkansızdır! Sagan’m bakış açısına göre. eğer uzaydan gelen bir sinyal almanın yararlarını farklı türde bir mesaja uygulasaydık ne olurdu? Ya başka bir dünyevi zekanın keşfinin öne­ mi hakkında bildiğimiz herşeyi bedenlerimizdeki her bir hücrede bulunan mesaja uygularsak? Gerçek anlam da.Gregg Braden önce o kadar büyük bir uzaklık katetmesi demektir ki. paylaşılmış bir deneyimin büyüklüğüdür.okunabilen bir mesaj! Bağlantı/ Sagan'ın kuramını dikkate alarak.

o kanıtı bulacağı­ mıza ve bunun birbirimiz ile savaşmayı durduracak bir . tartışmamızın konusu dünyamızı saran bilincin birleşik alanının bilimsel kanıtı ve bu alanın barış duaları için kanal olarak hizmet etme gücüydü. tanınabilir bir formda ve dünyam ızın ötesindeki bir kaynaktan gelen uygulanabilir bir m esajın alı­ mı olarak tanımlarsak. B irden.Yaratı­ cımızın ‘kartviziti’ .olarak adlandırılan bir konum a ulaştığı zam an oluşan etkinin. çalışmaların yürütüldüğü yerdeki aileler ve topluluklar içindeki dua eden grubu n ötesine ge çtiği nin ka­ nıtlayan çalışmaları paylaşmıştım. “o zaman o zeka varlığının kanıtını geçm i­ şimizde bir yerde bırakmış olmalı. “Bir gün. Radyo parazitinin bildik cızır­ tısını ve mola sırasında bir süre için yayın dışın da o lduğu­ muzu işaret eden “bip” sesini duydum.” D üşünceler arasında ancak nefes alarak devam etti. Bizlerin (insanoğlu) geniş ve eski bir zekanın ürünleri olduğumuza dair inancını benim le pa ylaşarak başladı konuşm asına.güçlü.bir işaret olmalı. “Eğer bu gerçekse” diye yüksek sesle düşündü. Sunucunun bu tür çalışmalara olan tepkisi h er n e kadar olağandışı olmasa d a. bizlerin kendimizden çok daha büyük bir şeyin parçası ol­ duğumuzu bize hatırlatacak son derece kesin olan . bilirkişinin sesi telefonda bağırdı: “Harika bir söyleşi Gregg . Belli sayıda insan “tutarlı duygu” —barışın birleştirici duyguları aracılığı ile ya­ ratılan gibi . o zaman insanın genetik şifresindeki Tanrı’nın eski isminin keşfi gerçek bir bağlantı olarak görü­ lebilir! M ükemmel Zam an \ <Qy y Söyleşimizin ikinci bölüm üne yaklaştığımızda program ın sunucusu “Yayında kalın! Haberlerden sonra y en id en b u ra­ da olacağız!” diye anons etti. bir konu! İyi bir başlangıç yaptık!” bundan önceki 30 dakika boyunca. Bu dünyanın bir ye ri n d e .Tanrının Şifresi Eğer “bağlantıyı”. daha sonra bana söylediği şey tüyle­ rimi diken diken etti.

Soru sorulduktan sonra ki bir saniyelik tereddütten sonra. böyle bir sorunun bana sadece sorulmuş olması bile bu hi­ kayenin anahtarıdır. Umarım onu bir an önce bu­ luruz! Ne düşünüyorsun. Soruya. Öte yandan. cevap verme fırsatım asla olmadı ve bana da bir daha asla sorulmadı. “Sadece onu en kısa zamanda bulmamızı umuyorum!” sözlerini duymak. kolektif olarak. Eğer bizler gerçekten ortak bir bilinç aracılığı ile birbiri­ mize bağlıysak. anlaş­ malarıma karşı gelmeden. görüşmeyi yapan kişi sonıyu tek bir kişi olarak so­ rarken. sesindeki ton ve aciliyet neredeyse bir yalvarma gi­ biydi ve yorumları keşfime devam etme konusunda beni uyandırmış ve sadece bir kaç ay sonraki bu kitaba doğru yö­ neltmişti. çalışma tamamlanmadan ve so­ rumluluğu paylaşılmadan önce söylemeden bu soruya dü­ rüst olarak nasıl yanıt vereceğim konusunda aklım karışmış­ tı. yaşamımın o anında kesinlikle ihtiyacım olan cesareti bana vermişti. bu sanki. /^ s z \ Gregg Braden . Gregg? Onun dışarıda bir yerlerde olduğuna inanıyor musun?” Sözleri beni tamamen gafil avlamıştı! Telefonun diğer ucundaki adamın tam 11 yıldır tamı tamına aynı kanıtı ara­ mış olduğumu bilmesine imkan yoktu! bulduklarımı. bizim ortak farkındalığımız herkese sorduğu bir sorudur . Be­ nim için. “On saniye sonra tekrar yayındayız!” dedi ve program ın bir sonraki bölüm ü başladı. onu bulmadaki yaklaşımı­ mı sorgulamaya başlamıştım. bilinçsiz ve konuşulmamış bir boyutta. Şifrenin kendisi­ nin varlığını asla sorgulamazken. Bu açıdan bakıl­ dığında.neden olacağına inanıyorum. o zaman muhtemelen dünyamızda çok az sır ve kesinlikle çok daha az “kaza” vardır. sunucunun sesini tekrar duyduğumda ikilemim kayboldu. yardım için kendimi­ ze sorduğum uz sorudur! Söyleşiyi yapanın hiçbir şekilde bilmesine imkan olma­ yan şey çok yakın bir süre önce araştırmamda özellikle çok sinir bozucu bir noktaya gelmiş olmamdı.ki bu. İnanıyorum ki.

eğer en derin inançlarımızın özünü tem elden sarsan bilginin rutin bir şekilde ortaya çıktığı bir zam anda yaşıyor olsaydık. yü zyı l “en öldürücü yüzyıl” olarak in­ sanlık tarihine geçmiştir. Özellikle şaşırtıcı olan.doğal felaketlerden ye has­ talıktan daha çok bir tür olarak. şu anın hücreleri­ mizdeki mesajı paylaşmak için mükem m el bir zam an oldu­ ğunu da göstermektedir. “bizim” kendimize söyleşiyi yapm anın' tarif et­ tiği kanıtı bulmayı. istatistikle­ rin pek çok kişinin halihazırda . kesinlikle doğıu zamanda söyleriz ve başkaları tara­ fından asla hayal bile edemeyeceğimiz bir şekilde duyulu­ ruz. Bölüm l ’de paylaşmış olduğum hayatlarını kaybedenle­ rin istatistiği tarihçi Eric H obsbaw n’m ifades in e göre karan­ lık bir ahit olarak 20. mesajın etkisi kaybo­ lup giderdi. her biri geleceğimizin bir tehdidi olarak .Tann ’m n Şifresi hepimiz bu şekilde çalışmaktayız. çoğu zaman kesinlikle d o ğ m kel i— meleri.ve dünyamıza en az son 4 yüzyıldır hükm eden zulmü tersine çevireceği ile ilgili duygularımı paylaşm am is­ tenir. kendimize dünyam ızda barışın m üm kün olacağına inanma için bir n eden' vermeyi istediğimizi duy­ dum. Ebedi/Tanrının hücreleri­ mizdeki mesajı kesin olarak böyle bir değişim in sıçraması­ nın katalizörü olabilir! Geniş bir boyutta böylesine bir değişim daha evvel gö­ rülmediği için. bu büyüklükteği bir değiş imin ulaşılabilir ve gerekli oIduğuna da inanıyorum. Geçmişi­ mizin bu kasveti i hatırlatmalarıyla yüzleşildiğinde. şiddet içeren kasti hareket­ ler ve başkalarının iyiliğini önem sem ediklerinden dolayı kendi türümüzün kaybında ne büyük sorum luluğa sahip ol­ duğum uzdan . herkesçe bilinen timsah gözyaşları” gibi. O akşam. Konuşmalarımızda sade­ ce dürüst olduğumu zda.şüphelendiklerini göstermektedir. Bugün. b end en çoğu zaman tek bir bilgi kırıntısının nasıl olur da hayatı de­ ğiştireceği . şu an mükemmel bir fırsat kapısı olabilir. -Sorunun sorulmuş olması gerçeği. Anlamlı bir ölçüde böylesine bir değişimin olması m ümkün müdür? Yanıtım ısrarlı bir evettir! M ümkün olm ası­ na ek olarak.

11 Eylül olaylarının kayda değer bir yan ürünü de. anlamlı bir de­ ğişimin fırsatı. böyle bir acı­ masızlığın yüksek teknolojili kaplamın şiddeti belki de hiç beklenmedik bir başka yan ürünü ortaya çıkardı. O günden sonra. o güçten bir me­ saj taşımakta olduğum uzu böylesine net bir biçimde bilmek. Bugün dikkatimizi bir kaç dakikadan daha fazla tutması istenen tanıtımın doğası ve tarzı geçmişte alıştığımızın çok ötesine gitmiştir. ye­ ni bir gazetecilik formatı ile karşılaştık: Gözlerimizin önün­ de oyna na n ve insanın zaten donup kalmasına neden olan dramı çoğaltan güçlü grafikler ve dikkatle bestelenmiş mü­ zik temaları ile güçlendirilmiş televizyon ile rapor verme. aynı yoğunluk içinde haberleri almaya devam ettik. bugün olabilecek en güçlü medya yayınıyla bile rekabet edebi lir! Hücrelerimizdeki mesajı bilmek. şok edici ek değerler ge­ rektirmektedir. kitle iletişim araçlarının belgelediği trajedinin kötü sonucu ile birlikte devam | eden şiddettir. küresel ailemizin her üyesine dokunan bir mesajın gücüyle kendin i tanıtmaktadır. Neredeyse Amerikalıların Vietnam dönemi sırasında savaş kazalannın istatistiklerine karşı hissizleşmesiyle aynı şe kil d e. Cinsellik ve tabu imasının çok daha büyük bir düzeyde etkileyiciliğinin bile bugün günlük programımı­ zın m tininden sivrilebilmesi için.dikilmiş duran böylesine çok şartın yakınlığı. günlük yaşamımızda ye­ ni bir tür “normalliğin” arayışı içindeyken. sanki her yeni gün ye­ ni bir kriz getiriyormuş gibi. bu mükemmel anın “aynılığımızın" farklılıklarımızdan çok daha yüce oldu­ ğunu keşfetmesini sağlamaktadır. öte yandan. Olayı takip eden günler ve aylarda. İşte bu genel durum içinde. Küresel ailemizin yüzde 95’inden fazlasının daha yüksek bir gücün varlığınan inanmasından dolayı. 11 Eylül trajedisinden önce pür dikkatimize hakim olan olaylar artık yaşamımızın rutinleri haline gelmiştir. /^ Z \ Gregg Braclen . genel halk savaşın ve terörün güçlü belgeleri ile uyuşturuldu. Raporların ilk saatlerinde. Çeşitli düzeylerde.

ağaç halkalarındaki bilgiler ve fosil kanıtlar havada da çok büyük değişimler meydana geldiğini işaret etm ekte­ dir.■Tann ’nm Şifresi kendimizi gördüğümüz şekilde bir temel değişimin m eydana gelmesini garanti etmez. örneğin. saatler ve günler süresince. tüm kıtaların ve halkların keşiflerini. genişleme ve hakimiyetin tarihine eşlik . Yeryüzünün m an­ yetik Kuzey Kutbunun Güney ve Güney Kutbunun da Ku­ zey olduğu 180 derecelik bir değişime şahit oldular. Jeolojik kanıtlar Pleisto­ sen çağının sonlarına doğru. Değişimin bir Türü Değişim insan doğasının temel bir parçası olarak gö rü n ­ mektedir. deği­ şimlerle duraksatılmıştır. feth edilm esini ve köleleştirilmesin! . Atalarımız hayatta kalmak için çabuk hareket etm ek zorundaydılar ve anlaşılan bunda başarılı da olmuşlar. diğerleri sad ece hayatta kalmak için hızlı ve yenilikçi bir düşünce gerektir­ miştir. Bu olayı açıklayacak bilim ve iletişimin yokluğunda. Yaklaşık 10.000 ila 12. Mesaj sadece keskin bir neden ve fırsat yaratarak sahneyi hazırlar. Son yemekleri hala ağızlarında yürürken donup kalm ış tarih öncesi mamutların kalıntıları değerlendirildiğinde. ataları­ mız m odern dünyamızda neredeyse hiç akla gelm eyecek bir değişim düzeyi deneyimlemişlerdir.deneyimledik. Bazıları yeni bir görüşe adapte ol­ maktan biraz daha fazlasını talep ederken. son 500 yıl b o ­ yunca. Birdenbire. D önm e île birlikte. tarihsel olarak k u ­ ru ve çöl olan bölgeler soğuk ve sulak olurken bir zam an­ lar ılıman ve verimli olan toprağın bölümleri kurak oluver­ miştir. nadir görülen m anyetik bir dönm enin meydana geldiğini ileri sürmektedir! O sırada y a­ şayan herkes.000 yıl önce. Türümüzün kısa tarihi değişik düzeylerde. o la­ yın ne anlama geldiğini sadece hayal edebiliriz. Değişime yanıt verme yeteneği­ mizin örneği olarak.hayal bile edilemeyecek oranlarda travmalar . ısı­ daki değişim ve buna eşlik eden donm anın çok çabuk m ey­ dana geldiği anlaşılmaktadır. Doğal olayların yıkıcı etkilerine ek olarak. Bu başlamak için bir yerdir.

Braden eden kültürlerin.000 feet yüksek lik te 48 saatlik bir mola vermiştik. Buna yanıt olarak. Isı ve nem dereceleri birbirleri ile rekabet edip 90’lara kadar varmışken. dinlerin ve ırkların birleşmesine de tanık olduk. güçlü bir birlik deneyiminin ve onun gerek­ tirdiği değişim in geniş bir kitle tarafından kabul edilebilme­ si için hangi kanıtın varolduğu sorusu a çıkta kalmıştır. bir yolculukta. dürtüklemelere ve yakın rastlaşmalara a lış ık olarak büyü­ müştüm. bizi deniz seviyesinden 17. aşağıya. Katm andu’nun tarihi Bharkor Meydanı’nın açık alanında grubumuzla birlikte dururken. Böyle bir tarihten açıkça anlaşılıyor ki. Bizler hayatta kalanların. “İ y i l i ğ i n ’■ b i r T ü r ü Önceleri o kuw etli çekiş ancak hissediliyordu. . Yakın mahallelerdeki diğerleri ile dolaşmaya eşlik eden çarpmala­ ra.000 feet yükseğe götüren .e gerekiyorsa yapmaya da hazırız. Öte yandan. pantolonumun kıvrımla­ rındaki o nazik çekişi duyınamış gibi yapabilirdim. Eğer bu kadar kasıtlı olmasaydı. Orta Tibet’in dağların­ da 23 gü nlü k bir münzeviliği kolaylaştırma şerefine eriştim. Nepal ül­ kesinde. Bedenlerimizi böylesi bir aşırılığa alıştırmak için. Allahtan. Anahtar insa n doğasının kendisidir. kendimizi sokak sa­ tıcılarının sesleri arasında. Gördüğüm şeye hazırlıklı değildim. 1998 ilkbaharında.Greegp. bugün ortak geleceğimizi garanti altına almak için n. kalın Pakistan aksanlı rehberimi­ zin bizi barakalarına çağırışını duymaya zorlarken bulduk. İçgüdü­ sel olarak. bu kısa ziyaret Tibet platosunda yavaş yavaş tır­ manmamıza ve kendim izi Nepal kültürüne kaptırmamıza fır­ sat verdi. beklenmedik şartlara ayak uydurma yeteneğine sahip olanların bir türüyüz. değişim kim olduğumuzun önem li bir parçasıdır. dikkatim i dağıtan şeyin kaynağına doğrn g özlerim i kayd ırdıın. 4. bazen kendini yoketmenin kenarındaymış gibi görünen bir dünyada anlaml ı ve yaşa mı destekleyen seçim­ ler yapmanın anahtarına olan inanışıma güveniyorum.

ranlığırn ortaya çıkaran yamalar vardı. İçgüdüsel olarak biraz ürkerek geriledim.Ta nrı ’mn Şifresi Gözlerim dizimin biraz yukarısı uzunluğunda. altına küçük tekerlekler takılı kısa bir tah­ ta parça'sı vardı. dengede durm ak için bir avu­ cu hala yerde. yere sürünen kirli bir peştem al vardı. tek bir hareketle bize arkamızdaki binayı gösterdi. Gördüğüm şeyi başka birinin fark edip etmediğini görmek için etrafa göz attım. azıcık pembemsi renkli yüzüyle eski görünüşlü bir ad a­ mın yoğun bakışları ile karşılaştı. Tek kelim e söylemeden. Tahtanın üzerindek i adam. bacaklarının olmadı gereken y erd e sa­ dece gevşekçe bağlanmış. Neredeyse çıplaktı. Gözlerimin ne gördüğünü anlam am için bir an d uraksa­ dım. yıllarca kullanılm aktan lekelen­ miş ve kararmış. Belinin altında. b ek len ­ tiler ve kibir hakkında çok güçlü bir dersti. Bu “tekerlikli tahta" onun bir y erd en bir ye­ re gitmek için kullandığı tek vasıtaymış gibi görünüyordu. Yukarı baktığım ­ da. seyrek sakal­ lı. arada deniz seviyesinden yüksekte olan güneşin altın­ da yılla rca kalmanın daha da koyulaştırdığı b ed en in in ka. bulunduğumuz yerde yükselen çok güzel ve çok eski . Bundan sonra olan şey benim için önyargı. geleneksel ola­ rak kutsal insanları kaplayan beyaz kül ıslak derisine yapış­ mıştı. ona uzattığımı geri çevirdi. Başını sağa ve so­ la doğru oynatarak evrensel dilde bana 4<hayır” dedi ve açık eliyle parayı bana doğru geri itti. gözlerinin aşağısmda neler olduğundan kesinlikle bihaber­ lermiş gibi geldi bana. Olaylar sanki sadece adam ve benim için gerçekleşiyordu. Geçmiş günler boyunca gördüğüm üz akılalmaz yoksulluğa artık alışmış olduğum dan. Aynı eli kullanarak. Sırt çan­ tama ulaştım ve bulabildiğin tüm N epal parasını ona doğru uzattım. Bacaklarının yerine. adam her iki-avucunu da yere d eğdirerek ken­ dini bana doğnı sürdü. Etrafımdakiler. ilk tahm i­ nim adamın bir dilenci olduğu ve para istediği idi. meydandaki taş döşem enin üzerinden kırbaç gibi es en sıcak rüzgarla hareket eden gümüş rengi uzun saçl arının gerisin­ den dikkatle bakıyordu. Gözlerinin net beyazlığı.

Binanın pencerelerini ve kapıları­ nı çerçeveleyen karmakarışık bir şekilde oyulmuş ön cephe­ sini kaplayan yeşil yosunu hemen geçip ilerlemiştik. bana bir şey iste­ mek için yaklaşmamıştı. Birden. Böyle ani deneyimlerin ne kadar güçlü dersler içerdiğini öğrendim ve bunun da o anlardan biri olduğuna hiç şüphem yoktu. Hiçbir şeye sahip olmadığı bir konumda. Bir nedenle. tahtanın üzerindeki adam sadece dünyasının bir bölüm ünü benimle paylaşmak istemişti . Aksine. kalırdı.ve bütün istediği de buydu. adaını yargılamış. insan doğasının en hakiki özü olduğuna inandığun 6Ç Z\ Grereg Braden .bir tapınak gördüm. yavaşça ve kasten ken­ dini meydanın kenarına doğru iten adamın sırtını gördüm. O sırada öğrendiğim ders: işte burada büyük ihtimalle hiç evi ve ona bakacak ailesi olmayan bir adam vardı. pek ç oğu Hindu tanrılar olan. Onun yapm ak istediği şeyi yaptığını düşündüm. O anda. eski ahşabın üzerine kazınmış. onun gitmiş olduğunu gördüm. Öncelikle. aksi halde gitmez. bir şey vermek için gelmiş­ ti! Zihnim bir sanıya kapılmışken ve dilene iye işe yarar birşeyler verip verm em e konusunda (rehberimiz ve tercüman­ larımız para vermemmizi söylemişlerdi) beceriksizliğin her türlüsüyle yarış ederken. ayakları yoktu ve m uhtem elen sahip olduğu tek şey o peştemal ve bedeninin altındaki tahtadan belki de az biraz fazlasıydı. insana ben­ zeyen binlerce ince figürün inanılmaz ayrıntılarını çözmeye başladım. ona uzattığım parayı da reddetmiş­ ti. Teşekkür etm ek için onu takip etmeyi düşündüysem de. taşların üzerine. gözlerim meydanda dolaşan münzevilerin ve turistlerin arasında dört dönüyordu. Uzak­ lığa uyum göstermek için gözlerimi kısarak. gnıbumuz meydana geldi­ ğinde onu fark etmemişti. Oysa o sadece para istememekle kalmamış. Etrafa bakındım. Dikkatimi böylesine güzel bir yere çektiğinden dolayı adama teşekkür etmek için tekrar aşağı baktığımda. yapmadım. onu dünyada artık son de­ rece sıradan bir durum haline gelmiş olan sürekli para iste­ yen dilenciler kategorisine sokmuştum.

O gün. En kötü kabuslarını yaşamla­ rının bir gerçeği imiş gibi yaşayan hem en hem en her kuşak. bizler. her zaman istisnalar vardır. Her toplum da. bireyler uzak durduğu muz ve tiksindiğimiz en karanlık özelliklere karşı kutuplaştıkça. ko­ runmak ve hayatta kalmak için. tahtanın üzerindeki adam tara­ fından kanıtlandığı gibi. Böylesine güçlü duyguların sonucunda. işte böyle zamanlarda doğam ızın en kötü ve en ürkütücü tarafına şahit oluruz. İnsanlarla ilgili her türlü geniş içerikli genellem e ile bir­ likte.. temel doğamızı um ursam a­ yan güce. nazik. savaşçıların ve ha­ yatta kalanların da bir türüyüz. Onunla karşı­ laş mamış olsaydım hayatımın ne kadar farklı olabileceğini düşünm eye başladım ve böyle bir insanın “oralarda” bir yer­ de varolduğunu bilmekten dolayı kendimi iyi hissettim. Bireyler. şefkatli ve önem seyen bir tü­ rüz. En temel boyutta.iyiliğin bir türüyüz. Sakalını. ihtiyaçtan dolayı. topluluklar ya da uluslar olarak bizi tehdit ettiğine inandığı­ mız şartlar. daha sonra adamı düşündüm ve onu özlediğimi farkettim. . yüzünden şiddetimiz tetiklenebilir. onun bana bir bina göstermekten çok daha fazla şey vermiş olduğunu farkettim.Tanrı’nm Şifresi şeyin bir örneğini bir an için görebilmiştim. -bedenin­ deki külü ve gözlerindeki bakışı özlemiştim. kontrolüm üzün dışında ge­ lişen şartlarda katıksız bir umarsızlıkla debelenip durnyoaız. En temel konu­ mumuzda. bel­ ki de en “kötü tohum '’ olarak tarif edilen terörü deneyim lemiştir. iyiliğimizin yanlış olduğunu kanıtlar gi­ bi görünen istatistikler vardır. Başka zamanlarda. kapasiteye ve arzuya da sahibiz. Aşın uçlara gittiğimizde. Temel “iyiliğimiz” denen şeye ihanet etm e nedenim iz ne olursa olsun. yoksul olduğumuza ve hayatta kalmak için fırsat­ lardan istifade ettiğimize ya da rekabete girdiğimize bizi inandıran yüklerden özgür olarak. aslında bizler nazik ve vericiyizdir . ya gerçek ya da algılanan. tıpkı saygın topluluklar ve çevrelerde öfke salarak kargaşa yaratan seri katiller Jack the Ripper ve Ted Bundy gibi. Aynı zamanda da. aileler.

bir türün iyiliği de bireyin iyiliğinden gelir.” (6) Dört yüzyıl sonra. yüzyıl bilgini St.” (7) Bir tür olarak eşsizliğimiz. Bugün. git­ tikçe artan sayıda eski. Planlarını gerçekleştirmek için tüm bir or­ duyu etkileyen karizmalarını kullanarak.. fırsat ve­ rildiğinde bizlerin barış içinde ve türümüzün iyilikçi. diğer ırklara. bu terör bireylerden ve küçük dar gelirli gruplardan iyi finanse edilen uluslararası organizas­ yonlara kadar gelişerek yeni bir boyut kazanmıştır. yaşam­ larımızdaki gerçek ve kalıcı değişimin. doğayı ve günlük yaşamı paylaşma onuruna sahip olduğum insan­ lar arasında bulduğum ortak bir tema var. “Slobadan Miloseviç’’ ve terör örgütleri birer ilkeden ziyade birer istisnadır ve bir kaç tanedir ve birbirin­ den u zaktır.Gregg Braden Nadir durumlarda. Öte yan­ dan. Thomas Aquinas tarafından belagatli. devlet adamı ve doğabilimleri uzmanı Francis Bacon benzer bir duyguyu yazıla­ rında aksettirmiştir: ‘İyiliğe. bu tür kişiler inanılmaz bir güç ortaya çıkarabilmişlerdir. zamanı. Bizi hayvani davranışlara iten şartların yokluğunda. En uzak köylerden . diğer uluslara ve hatta kendi insanlarına karşı büyük bir zulüm göstermişlerdir. türümüz için böylesine karanlık anlarda. yemeyi. “Adolf Hitler”. doğamız ge­ reği nasıl olduğum uzdan ziyade. bir şekilde ifade edilmiştir: “Tıpkı şeklin cisimden gelmesi gibi.tarafını onurlandıran saygın bir yaşam sürmeyi tercih ettiğimizi gös­ termektedir. aşırı uçlardaki şartlar altın­ da ne yaptığımız daha çok şeyi açıklayabilir. 13.eğilim insanın doğasına derin­ den yerleştirilmiştir. filozof.. tohum vermesi için hücrelerimizdeki mesajın kapılarını açan esas karakterimiz olan iyilikle birleşmiş olmamızdır. alimane ve bilimsel kanıtlar. E n G erçek D o ğ a m ız İyilik duygumuz. Allah'tan. Antarktika hariç dünyanın tüm kıtalarına yaptığım yolcu­ luklarda edindiğim deneyimlerde.

Daha sonraki yılların­ da ise. sağlık. hangi şartlar için­ de olursak olalım mutlu olmanın yollarını buluyoruz. 20.(9) Hüsnü kuruntunun ötesinde. bencillik ve saldırganlığın temel doğam ız olduğunu ileri süren. (8) İyiliğimize olan tereddütsüz inancı. Maslöw’un çalışmaları onu “insanların hepsi tem elde saygındır"a inanmaya itmiştir. Yaşamı tehdit eden olaylarla karşılaşıldığında. tayfunlar ve terörizm trajedilerine ka­ dar. bir insanın başka birinin iyiliği için hayatını öne sürdü­ ğünü görmek hiç de az rastlanır bir olay değildir. Evsiz dilencilerden ve arazisini çalıştıran en mükemmel sınıftan insanlardan teknik ve politik güce sahip parlak zekalara k a­ dar. insanoğlunun özümüzün bir parça­ sı olarak “daha yüksek bir doğası olduğunu” ve türüm üzün “kendi insani ve biyolojik doğası dışında harika” olabilece­ ğini yazdığı yaşamının son günlerine kadar devam etmiştir. yemek. aynı dönem den meslektaşı Sigmund Freud’de rağmen. özüm üzdeki “iyilik” bu ni­ teliğin gücünü yaşamlarımızda gösteren sayısız örneklerle desteklenmektedir.Tann ’nın Şifresi ve Mısır’ın. aileleri için iyi bir y a­ şam fırsatı ve yaradılıştaki yerlerini daha iyi anlama. Şehvet. Luxor’ pazarındaki sokak satıcılarına. önceleri primatların sosyal davranışları üzeri­ ne çalışma yapmaya kendini vermiştir. tüm Av­ rupa’ya ve Avustralya ve Kuzey Amerika'nın kırsal kasaba ve kafelerine kadar. Basit bir m odern olgudan öte. barınak. Christian Crusades’in savaş meydanlarındaki kahramanlıklarından ya­ kın zamandaki seller. çoğu zaman başkala­ rının hayatlarını koruma içgüdüsü kendi yaşamımız için korkma ve endişelenme duygusundan baskın gelir ve o n a . insanlar doğaları gereği temelde “iyi" gözünmekteler. Tibet’in ve Güney Amerika'nın dağlarındaki m a­ nastırlardan. Bireyler ve aileler olarak. hepsi yaşamlarında aynı şeyi arıyor gözükü­ yorlar: huzur. yüzyılın en büyük psikologlarından biri olan Abraham Maslow. genelde. varlığımızın '‘harika imkanlarını ve esrarengiz derin­ liklerini” fark edip kendini insanın doğası üzerine çalışmaya adamıştır.

yetkililer yavaş yavaş boğularak öleceğine Kadir’in hayatını hem en sonlandırmaya karar verdiler. Sonunda. yaşam­ larım riske atarak panik içinde etrafındakileri kırıp döken Kadir isimli bu 35 yaşındaki Hintli fili özgürlüğüne kavuştur­ mak için hararetle çalışıyorlardı. Bu içgüdü doğamızın yapısına öylesine de­ rinden ekilmiş gibidir ki. Sağlam olmayan binalarda ve . 11 Eylül'ün ertesi sabahı. bu duyguyu kendi türümüzün' öte­ sine geçirip hayvanlar ailemi için de hissederiz. Almanya ve Çek Cumhuriyetinin tarihi bölgelerini sular altında bırakan yağmurlar sırasında ben Pern’nun Güneyinde bir tura önderlik ediyordum. evlerini ve ailelerini kurtarmak için enerjilerini harcama­ ları çok daha kolay ve kesinlikle kabul edilebilir bir şey ola­ caktı. Avrupa’nın bazı bölgeleri ne­ redeyse son yüzyılın en şiddetli yağmur ve sellerine maruz kaldı. (1 O) Bu kadar çok kaosun içinde. Amerika'nın Batısındaki sel basmış kanyonlardaki at­ larla. Geç­ tiğimiz yıllarda. Avusturya. çökmüş otellerinde ve yanmış evlerde kaos sı­ rasında bırakılmış ev hayvanlarını kapı kapı dolaşıp arama­ ya odaklı bir proje başlatıldı. içlerinde bir şey mantığın ötesine geçti ve Kadir’in tarafında yer aldılar. kediler ve hatta fa­ relerle ilgili benzer hikayeler de internette dolaşmıştı. yanan evlerden kurtarılan köpekler. Üstlerine gelen dağ gibi su ve yıkıntılara rağmen. küçük dağ ötelindeki tek istasyonlu televizyonlara uydu antenle gelen kaos ve zararı anlatan haberlere kısa kı­ sa göz atıyordum. her birinde de kurtarıcıların hayatlarını riske attığı. 2002 yılının Ağustos’unda. O dönem boyunca şahit olduğum tüm görüntüler içinde kişisel olarak bana e n güçlü geleni Prag şehrindeki bir hayvanat bahçesinde kendi barınağında bo­ ğulmakta olan bir fili kurtarmak için yetkililerin gösterdiği çabalardı.Gregg Braden göre davranırız. Hafta bo­ yunca. çabalar sonuç verm edi ve bir umutsuzluk anında. Alt Manhattan’ın harap olmuş binalarında. çalışanların kendi hayatları­ nı. öte yandan. Seçimle yüz yüze kalarak.

İnsan dokunuşuna kuynıklarmı sallayarak ya da uysalca i n .. kişinin “sağlıklı olm a” ile il­ gili hassas yaşam modelleri altüst edilir ve kaosun içine atılır. tonların ve şarkıların so n derece hassas kullanımı sonucu. çıngırakların. Varolan bir örneğin yıkımından ve birbiri ardına gelen kaoslardan. yeni bir örnek ve daha yüce bir düzen bulunabilir. bulunup getirilmiş. Bu ilke bugün. Çok popüler bir deyim olan “Fırtınadan önceki sessizlik” m eca­ zını hatırlasak. Kanı şudur ki. yerliler arasında­ ki en mistik. davulların. susuz ve canlı . isterse de yepyeni bir kariyerin kapılarını açan geçici bir işten çıkarılma hakkında olsun. leyerek cevap veren ev hayvanları .aç. \ <$j / D e ğ iş im in Y a p ı T a ş la n Doğa bize bir düzen seviyesinden diğerine geçmek için arada bir kaos döneminin yaşanması gerektiğini gösterir.Tanrı ’nın Şifresi zehirli duman içinde yaşamlarını riske atan kişilerin ödülü hikayeyi yazan ve ileten muhabirlerin gözlerini yaşartmış. her iyi şey belirsiz bir d e ­ ğişimi takiben gerçekleşir. gongların. “hayat” sağlığın mavi kopyasının m irasına sahiptir ve kaos kendini hastalık şeklinde gösterse bile o h er zaman varolmaya devam eder. bu dönem de yaşanan kaosun da “fırtınadan önceki sessizlik” olarak görebiliriz. 11 Eylül’ü takip ed en saatler ve günlerde.tek tek. zillerin. . Şarkı söylemenin. Olay şudur ki. bunu yapm a­ dık: Temel doğamızla ilgili bir şey hayvan hayatını kurtar­ mak için çabasında insan yaşamını riske atmayı kabul edile­ bilir buldu. fakat en etkin değişim fomlarından birinde n et olarak gösterilmiştir: sesin kullanımıyla bedeni ve zihni iyi­ leştirmek. bir tür olarak. böylesi bir felaketin bir sonucu olarak hayvan yaşamının kaybını kabullenmek kabul edilebilir bir şey olabilirdi ve kesinlikle trajedinin büyüklüğünden dolayı haklı çıkarılırdı. Bir kez daha. Söz konusu ister m utlu bir evlilik öncesi yaşanan boşanm anın kaosu hakkında ol­ sun.

modelin daha geniş dünyasında. varolan inançlar sistemimizin yaşamlarımızda neyin gerçek olduğunu yeniden oturtmak için kaosun karışıklığını deneyimi emesi ge rekir. Tarih değişim isteğimizin doğamız olduğunu gösterm ekted ir. gerçekleşti­ receğim iz değişimin başarıyla tamamlanabileceğine inanacak bir n ed en e ihtiyacımız vardır. 2. var­ lığımızı tehdit eden inançlar. 2.Gregg Braden Hastalığın mavi kopyası olmadığı için “kendisini bulamaz” ve yeniden kurulamaz. kopyası olmayan bir “hastalık” gib idir. Uzun süren ve yaşamı ifade eden değişimin m eydana gelmesi için. Geriye kalan gerekli element aynı zamanda en aşikar olanıdır. 3. hükümler ve hoşgö­ rüsüzlük mavi. Onun yapıla­ bilir olduğunu gösteren bir işarete ihyiyacımız var! . D eğişimin m üm kün olduğuna inanmamız lazım. Fark­ lılıklarımızın dayanılmaz olduğunu düşünmeye bizi iten inançları iyileştirmek için. fater bireysel. ya­ şamlarımızda değişiklik yapmadan önce. Değişimin yapmaya değer olduğuna inanmamız la­ zım. Değişmeyi istememiz gerekir. önyargılar. değişim net olarak doğam ızın bir parçası olan kaosun bir şeklidir. dünyamızda anlamlı bir farklı­ lık yaratm ada tek bir parça bilgi için gerekli etm enlerden ikisi hali hazırda mevcuttur: 1. üç unsurun var olması gerekir: 1. Böyle bir çalışma içinde. Çok benzer şekilde. Varoluşumuza karşı gittikçe tırmanan tehlikeler ti. isterse de toplumsal olsun. Dolayısıyla yok olur ve sonuç olarak kişi “iyileştirilmiş” olur. Bu açıd an bakıldığında.im d ü n y ad a değişim ihtimalini yaratmaktadır.

çoğu doğrudan yaşam tarzı ile ilgili . ırk ve sınıf ayrımını. beslenme ve yaşam tarzının sağlıklı seçimleri) y a­ şamın bize gösterdiklerine tepki gösterelim ve ondan sonra seçimimizi yapalım. bizlerin inançlarımızdan ve derim izin renginden çok daha fazlası olduğumuzu fark etm eden ö n c e deneyimlemeliyiz.T a n ı ’nın Şifresi Tanrı ’nın İmzası: İn a n m a k için bir Neden \ il ) y Geçtiğimiz aylarda. İs­ tatistikler ABD nüfusunun yarısı kadar çok kişinin klinik o la ­ rak aşırı kilolu olduğunu göstermektedir. yaşam kalitelerine ve daha . bilimsel ve mesleki olmayan dergiler Amerika'nın “obezite” salgını dedikleri şeyi tanımlıyordu. Kişisel d e n e ­ yimlerinin meydan okuması sonucu. aynı şekilde öğrenebiliriz. bu tür çalışm a­ ların sonuçları ve bu tür haberler şaşırtıcı değildir . yaşamlarımızda istem e­ diğimiz şeyleri deneyimlemeliyiz ki onları gerçekten istem e­ diğimizi bilelim! Yaşamayı tercih ettiğimiz tarzı seçm ektense (örneğin.sağlıklı ilişkilere k a t­ kıda bulunabilecek değişiklikleri yapm ak için gönülsüzler. u lusu istila etmekte olan bu salgına katkıda bulunan ana faktörler arasında sayılmıştır. Ulusal obezite örneği öğrenmemiz gereken bir yolu g ö s­ termektedir. Tarihsel olarak. Bir ulus olarak. h ep si de nispeten kolay değişebilecek alışkanlıklar olsa da. ancak kişisel sağlık krizleri . eg zer­ siz. alkol ve sigara içme gibi yaşam biçimi faktörleri. G üneşin . inanmak için bir n e d e n keşfediyorlar.(11) Diyet. Amerikalıların çoğu için.kilom u­ zu ve bu kilonun nereden geldiğini zaten biliyoruz! En net bilgiye sahip olan pek çok birey bile uzun öm ürlülüklerine.deneyimledikten sonra değişimin g erek ­ li olduğuna inanmak için bir neden buluyorlar. Kat­ liam ve küresel zulmü destekleyen politikaları kınam aya başlamadan önce onları deneyimlemeliyiz. Herşeyden daha fazla. Küresel bir toplum olarak. bunlar değişim ve olana­ ğın yeni dünyasına sonuna kadar açılmış bir kapısı olan y e ­ ni fikirlerdir ve taın olarak gerçeğe dayalıdır. Maalesef.

farklı­ lıklar yüzünden kendimizi ayrı tutma ihtiyacım zamanla . geçmişte. Kopernik ye van Leeuwenhoek’in keşiflerin­ den çok farklı bir ölçekte ama son derece benzer bir şekil­ de de boş yere. Her bir kişinin her hücresinde bulunan Tanrı’nın isminin tanınması. doğanın güçlerinden faydalanma hakkımızı yaşamlarımıza nasıl uyduracağımızı öğrendiğimiz evrimsel yolum uzda istikrarsız bir döneme geldik: Carl Sagan’ın tek­ nik ergenlik diye tanımladığı yere. Ancak. Hayatta kalmamızın anahtarı yaşamla ilişkimizdeki temel ilkeleri ve öğrendikle­ rimizi uygulam adan önce kozmosu bir bir tanımaktır! Kesinlikle. “orada bir yerde” inanılacak bir şey olduğuna da­ ir inancımızı yenilemeye de yardımcı olacaktır. ço­ ğu için. acı çekme ve zalimlik gerçeği Yaratıcı ve birbirimiz ile ne kadar yakın bir ilişkide olduğumuzla ilgili şüphe ya­ ratmıştır. böylesi bir kanıt. Tür olarak. Değişen bir dünyanın belirsizliğin­ de. Antoni van Leeuwenhoek’in kendi yaptığı büyük gösteren lensler sayesinde bakteriye şahit ol­ duktan sonra. dünyanın güneşin etrafında döndüğünün kanıtını sunan Kopernik’e kadar. kendimize inanmak için bize bir neden sunarken. değişim çağımıza yeni bir bilgelik akıtmak için zam anın doğru olduğu görünmektedir. bugün ve gelecekte. Kesindir ki. şüphelerimizin gücünü gü yenmeni n gücüne çevirmek için gerekli olan ka­ talizörün büyüklüğüdür. aksine inanmak için bir neden yoktu. inançlarımız ve yaşam tarzlarımız kendimizi dışsal olarak nasıl tanımladığımızın bir parçası iken. Farklılıklarım ızın Ötesi Dinlerimiz. çıplak gözler görülmeyen mikroplar dünyası ciddiye alındı. onların varolduğuna inanmaları için bir neden yoktu. Onlar görene kadar. Dünyanın bü­ yük çoğunluğu yüce bir güce inandığını itiraf ederken. bir değişi­ min zahm ete değer olduğuna inanmak için benzeri görül­ memiş bir neden sunmaktadır.Gregg Braden dünyanın değil.

bireyler olarak eşsiz­ liğimize. ilkinde yanlış olan ortak yanıtımız. tür o la­ rak hayatta kalmamızın en büyük şansını elinde tutanın bi­ zim farklılığımız -görünüşte anlamsız olan korku -ve n efret davranışlarım haklı çıkarmak için kullanılmış olan farklılık­ lar . k a ­ yalık bir bölgede olan pervaneler kayalar ve çevresi ile b ü ­ tün haline gelmek için renk değiştirmişlerdi. Çalışma için serbest bırakıldıkları bölgede b u ­ lunan ağaç gövdelerinde yaşayan pervanelerin kanatları. y e ­ m ek arayan kuşların onları görmesini zorlaştıran “kabuğa benzer” bir görünüm e dönüşmüşlerdir. güvelerin uyum sağlam a yetenekleri tarafından yapılan bir değişimdi ve değişebilm enin sağladığı kolaylıkla hayatta kalıyorlardı. Tanrı’nın isminin aynı harflere çevril­ mesi ve aynı anlama gelmesi . onları yarattığımız zam anki düşünce seviyemizle çözülemezler.olduğunu öğretmektedir.Tanrı ’rnn Şifresi bırakacağımız bir çağın eşiğinde olabiliriz. (12) ' Çok benzer bir şekilde. Örneğin. kanat renklerini değiştirmemiş olan pervanelerin daha k ısa hayatları oluyordu.çok daha büyük bir saygı ve hoşgörü duygusuna yükseltebilecek bir mesaj taşımaktadır.bugün dünyamızın en farklı . Bu gün herkes tarafından bilinen ifa­ desinde. Bu. b e ­ denlerimizdeki Tanrı’nın isminin keşfi. O zaman. Benzer şekilde. Einstein bu kavramı şöyle özetlemiştir: “Bugün kar­ şılaştığımız önemli problemle. belki de. netlik için d o ­ ğaya bakalım. Öte yandan.» Eğer hepimiz dünyayı tamamen aynı şekilde algılasaydık ve sorunlarımız içinde ta ­ mamen aynı çözümlere sahip olsaydık. aynı türdeki kanat renklerinin bulunduğu çevreye göre değiştiğini böylece insanların onları tanıyamadıklarını keşfedilmiştir. 1950’lerde pervaneler üzerine yürütülen bir ça­ lışmada. değişme fırsatına sahip olduğum uzdan so ­ nuncusunda doğru olabilir. En azından. Doğa bunun. Bir kez daha. zira kuşlar ve diğer böcekler için çok kolay bir yeme dönüşüyordu. farklı düşünm e ve değişen d ü n ­ yamızın şartlarına uyum sağlama yeteneğimiz tür olarak h a ­ yatta kalmamız sağlar.

Bedenlerimizdeki Tan­ rı ’nın isminin harfleri.tesadüf değildir. bu şüphe gerçeğe dönüşmüştür. Ortadaki kolon aynı şifrenin İbrani alfabesindeki eş harflerini göster­ mektedir: Yod. Bedenimizdeki her bir hücrede. tekrar­ lanan ve doğrulanan değerlere dayalı olduğu içirl. /^ & z \ Gregg Braden . nitrojen. Soldaki ilk kolon yaşamın şifresini DNA’nın elementleri ile . İbrani ve Arap alfabe­ lerinin saklı sayı şifreleri bedenlerimizdeki Tanrı’nın ismini tam olarak aynı değerde açığa çıkarmakta ve tam olarak ay­ nı sırrı ortaya koymaktadır. Böyle yaparak. inancı ve ırkın ötesine geçmektedir.dinlerini ve inançlarını destekleyen dillerde bile . Böylesi değişikliklerin varlığında bile. Vav ve Gimel (YHVG). aynı mesajı veren ay­ nı şifreyi buluruz. anlamları çok büyüktür. nasıl köprü kurduğunu göstermektedir. Bu ilişki grafik olarak bizlerin sezgisel boyutta halihazır­ da n e algıladığımızı göstermektedir. H er ne kadar pek çok kişi böyle bir mesajın biryerlerde olduğu n d an şü phele nmiş olsa da.1 bu güçlü bağın bu farklı dini geleneklerin ara­ sında bile . hem Musevi hem de İslami geleneklerin Hz İbrahim aracılığıyla ortak bir so­ yu paylaştıklarını kabul etseler de. her harfin değeri tam sağlarında. Hey. hücrelerimizdeki şifre sa­ yesinde . “Değer” kolonu altında not edilmiştir. örneğin. Her ne kadar uzmanlar.göstermektedir. şifre dünya nü­ fusunun itibar e tt iği üç din için aynı olasılık ve umut m esa­ jını taşımaktadır: Musevilik. yüzyıllar boyunca geniş çapta değişmiş olan İbrahim’in öğretilerinin yorumlarıdır.hidro­ jen . bireyin dil i. DNA'larımızdaki mesaj her Arap hem de jbrani dillerde tam am en aynı okunur. Sonuç çok net. Şekil 9. varlığının gerçekliği nettir Mecazın ya da istekli düşüncenin ötesinde ve m esajı yorumlama şeklimize bakmaksızın. oksijen ve karbon . farklılıklarımıza bakmaksızın evren­ seldir. Şifre tutarlı. ve hiçbir ön yargı ya da istisna olmaksı­ zın. İslam ve Hristiyanlık. Sağdaki kolon ise şifreyi bir kez daha ama bu sefer Arapça göstermektedir. (13) Ortadaki ve sağ taraftaki kolonlarda. içimizdeki şif­ renin varlığı inkar edi leme z.

d eğ işk en çözüm leri olan gruplar için ye­ ni ve farklı çözüm ler ü re tm ek için tasarlanmış olan Alternative Dispute R esolution (ADR)’dır (Alternatif Uyuşmazlık Çözümü). Her ne kadar m esajın keliınesi kelim esine karşılığı olan “Tanrı/Ebedi bedenim izde” şüphesiz çeşitli yommlara tabi tutulacaksa da. Bu alanda belkide en hız­ lı büyüyen bölüm . B a ş la m a k iç in b ir Y e r Geçtiğimiz yıllarda. sadece m esajın varoluş gerçeği bile pek çok şey anlatacaktır. mesaj tarafından ima edilen düzenin m uhteşem seviyesi “orada bir yerde" başka bir şeyin olduğunu söylem ektedir. G enetik şifremizin kaynağı olan ‘‘kim e” ve­ ya “neye” inandığım ıza bakm aksızın. Bu bize. O regon E yalet Ü n iv ersitesin d e asistan profesör olan Asron T. Sonuçta. altlarında yatan sayı şifreleri aynıdır ve her iki dil­ de de aym mesajı verir. bizlerin çok da­ ha büyük bir resm in ve belki d e çok daha yüce bir planın parçası olduğum uzu hatırlatır.Tanrı ’nın Şifresi Şekil 9. Wolf. uyuşm azlık çözüm ü çalışması gelişen bir uzmanlık bilimi olarak tanındı. International N egotiation adlı bir gazetede yayınla­ nan.1: Yaşamın elementlerinin ve İbrani ve Arap alfabelerindeki eşdeğerlerinin kar­ şılaştırması. Bu nedenlerden dolayı. b e­ den terimizdeki m esajın. Dış diller farklı da olsa. farklılıklarımızın çözüm ünde ortak bir platform oluşturm adaki rolüyle eşi benzeri yoktu r. ADR'ı “ortaklaşa kabul edilmiş bir karara ulaşmak için çatışm a h alindeki grupların gönüllü olarak . ADR’ın hedefi belki de en iyi günümüz yerlileri arasındaki su çatışm aları ü zerine bir yazıda anlatılamakdır.

her iki tarafın da sonuca kat­ kısı olmuş ve sürece dahil edilmiş olduklarım hissetmişler­ dir. Wolf araştır­ masında. (15) Tıpkı. vizyonları. varlıklarını tehlikeye sokan etm enlerden kurtulmak için. Buna ek olarak ortak vizyon.aradıkları” bir dizi yaklaşım olarak . Buna ek olarak. Vizyon­ ları kullanarak. Vizyonu n amacı birlik­ te ney i başarmak istediklerinin özüne katkıda bulunan bir forum üretmektir.tanımlamıştır. çatışan gruplar o anın çatışma­ sı ve daha güzel bir geleceğin imkanları arasında bir köprü kurarlar. Bu şekilde. gruplar bir araya gel­ diklerinde sıkl ıkla patlayan öfkenin fitilini çözmek için ve sürece inanmada bir neden olarak kullanılabilmiştir.bildiğimiz bir uygulamadır. (14) Her ne kadar bu terim yeni de olsa. her bir kişi eğer başarılı bir şekilde çözümlenirse çatışmanın neye benzeyebileceği ve aynı zamanda da pazarlıklar başarısız olursa ne olabile­ ceği h akkında bir görüş bildirmiştir. bin olmasa da yüzlerce yıl boyun­ ca yerli insanlar tarafından kullanılmış olduğunu” ileri sür­ mektedir. hakim (her iki grubu da onurlandıran gele­ nek ve göreneklerin bir birleşimini kullanan bölgesel bir ha: kim) “tartışmayı ortak tarihleri ve değerlerinin daha geniş bir / <îszN\ Gregg Brcıden . öfke patlamaları olduğun­ da ve çözüm gerçekleşmeyecek gibi göründüğünde. Pozitif sonucun neye benzeyeceği ile ilgili umutlarını ve hayallerini paylaşma yoluyla. Bu geleneksel metodlar içinden en net olanı bizlerin ortak-vizyon olarak . bu teknikleri.(l6) Ortak vizyonları sayesinde. başlan­ gıçta onları bir araya getiren ortak tehdidi tekrar bildirerek geri adım atmak için bir baçvuru noktası görevini görür. Wolf pek çok m odern tekniğin köklerinin aslında yerli toplumlara uzana eski kökleri oldu­ ğu nu ve “görünüşe göre. küresel bir toplum olarak bugünkü bulunduğu­ muz durum gibi. eski toplulu klar da bunun gelece klerini teh­ dit eden konuları çözümlemede birlikte çalışmanın en bü­ yük ortak çıkarları olduğunu keşfetmiştir. Fas bölgesindeki M’goun Vadisi ’n de yaşayan Berber insanları arasındaki su kavgaları ile anlatır.

Bu insanlardan ortak bir geleceğin vizyonu­ nu yaratmalarını istemek duyarlılıklarının limitlerini zorlar. aynı zamanda öylesine güçlü nefret örneklerine şahit oluyo­ ruz ki. ortak bir geçm işin ve başlamak için bir yerin gerçeğini yaşamaktadır. paylaşılan ve barış dolu bir geleceği kendi haline bı­ rakmak zordur. güvensizlik ve acı öylesine derin ki. değişmez kanıtın parçası bir ailenin.her bireyin aynı Tanrı'nın silinmez imzası ile aşılanmış olduğu­ nu bilmek . ortak bir kimliğin onayı . Bu tek. hücrelerim izdeki mesaj daha bile büyük bir iyiye hizmet etmektedir. M’goun Vadesindeki kabileler arası tartışmalar çok nadir olarak daha yetkili bir kişinin önüne çıkarılmıştır. ortak bir iyiyi h a­ yal etmek sanki imkansız olanı istemektir.Tanrt ’m n Şifresi bağlamından bakarak değerlendirir. Bedenim izin dokumasında bulunan daha yüce bir varlığın bilgisiyle. sadece günün sonunu şiddet olmaksızın getirmenin hayalini k u r­ mak. Kosova'nın M üslüman ve Sırpları’ndan İsrail’in Filistinlileri ve Yahudilerine kadar. ya­ kın zamanda yaşanmış olan zulüm ve şiddetin anısı barışa küçücük bir yer ayırmış olan karşıt gruplar arasında güven­ sizlik duygusu yaratmıştır. Aldatıcı bir şekilde basit olan. savaş yaşamış olan insanlar da güvensizliklerini yenip iyileşmeye başladıkları bir yerden başlama noktası aramaktadırlar. D ünya barışının ortak geleceği bugün pek çok kişinin um uduyk en. çok fazla sayıda yaşam a malolan en şiddetli çatışmaların pek çoğu dini yazıların aşırı . Hastalığın gücünün iyileşme olasılığından daha büyük göründüğü zamanlarda insanların bedenlerine olan güveni kaybedişine benzer şekilde. paylaşılan vizyonun tem a­ sı paylaşılan bir deneyimin olasılığını da temsil eder. or­ tak bir geleceğin vizyonu anlam kazanmaya başlar.inkar edilemez bir gerçek sunmaktadır. -Buna benzer örneklerde. Bitm eyecek gi­ bi görünen çatışmaların ortasında. İşte tam da böyle koşullar içinde. Yeni yüzyılın ilk yıllarında. ortak bir geleceği hayal etmek güç görünmekteyken.” (17) Konuların çeşitlili­ ğine göre uygulanan ortak vizyonun başarılı bir şekilde kul­ lanımı ile.

çocuklar öksüz bırakılmış ve uluslar yıkıma bırakılmıştır. Okunan Hristiyan. Böylece. Affetme töreni ve kutlama sayesinde. /^ s z \ Gregg Braden . hem Berber hem de Bedouin toplumlarında. af­ fetmenin herkese açık dinsel bir törenini düzenlerler. affet­ m enin dışsal işaretinin gücü sanki kaybedilmiş gibi görülür. Dinleri tarafından haklı gösterilen nedenlerden dolayı birbiri ile savaşan bireyler ve uluslar için . tüm deneyim sona ' erer ve yeni bir yaşam başlar. Gücün böylesine onurlu bir hareketinin kalıcı bir bitirişe karşı sunuç vermesi küçümsenemez bir durumdur. Bu şekilde. İdeal ola­ rak. Tanrı adına ça­ tışma halinde olanlar için birleşmenin daha büyük bir olası­ lığını taşımaktadır. çatışmanın çözümünün ardından çoğu zaman sulha adı verilen.tıpkı yaşamın kendisi gibi var oldu­ ğunun silinmez bir notu olarak dikilmektedir. hücrelerimizdeki mesajın çok bile daha büyük bir gücü olabilir ve çok daha derin bir anlamı bile üstlenebilir.savaşlar anlamsızlaşmaya başlar. geçmişte yapılan hatalar “temizlenir” ve anlaşma yasal olarak zorunlu hale gelir. Vatandaşlarının. İşte böyle bir çatışma için­ deyken. bir kutlamanın takip ettiği.ve küresel toplumumuzun iyiliğini tehdit eden çatışmalardan kendilerini geri çeken uluslar için.ilkeleri Tanrı’nın kendilerininki kadar “düşmanlarının” bedenlerinde de yaşa­ makta olduğuna dayalı olanlar . Sulha anı sadece günler ya da haftalar önce çatışma halinde olan gruplar arasındaki ilişkinin dönemecini ifade eder. diye yazısında anlatır Wolf.yonımları sayesinde haklı gösterilmiştir. Musevi ya da Müslüman kutsal kitaplarının belli cümleleri temel alınarak. aileler katledilmiş. Bedenlerimizdeki T ann’nın isminin varlığı tek bir varlığın “doğru” ve “yanlış” hakkında sürekli değişen fikirlerimizdan daha güçlü bir kuvvet . İlginçtir ki. hücrelerimizdeki mesaj. tören sadece her iki grup da çatışma halinin çözümlen­ diğini hissettiklerinde gerçekleşir.

uçağa bindiğim de yanıma oturmuş olan kadının beraber oturm ak istediği bir arkadaşı olduğunu anladım. Ulusal gü­ venliğin yani boyUtlarını ve terörizmin nasıl ordudaki rolunü nasıl değiştirdiğini ayrın tısıyla anlatırken. Soğu k Savaş sırasında ha­ vacılık endüstrisindeki dönemimi tak ib en . . neredeydin. kendimi New Mexico’daki askeri ü sd en eşi ve çocukları­ nın yanına dönen bir Hava Kuvvetleri subayının yanında oturur buldum. Bu. Subayın işi ordunun tarihi n bilinen en güçlü kaynakları­ nı. Uçak yerden yükselmeden önce.adam diz üstü bilgisayarını açtı ve LCD ekranından yansıyan bilgiye dikkatle odaklan­ dı. b en im odaklandı­ ğım şeyse tam da böyle bir savaşa ihtiyaç duym aktan bizi kurtarmaya yardım etmesi için. Elektronik aletlerin kullanımına izin verilir verilmez. Konuşmanın parçalarını dinlediğimde. sohbetin . nereye gidiyorsunve oraya gittikten sonra ne yapacaksın gibi bilinen kibar “uçak so h b etin i gerçekleştirdik. tüm karışıklıkların ne hak­ kında olduğunu görmek için dizim deki kağıtlara gör attım. Diğer taraftan.Tann ’nm Şifresi V254^ Tek Değişmeyen Gerçeğimiz Pencerenin kenarına oturm uş. silahlarını ve teknoloji sistemlerini alıp bu gücü evlerimi­ zi ve yaşam şekillerimizi tehdit edenlere karşı m ücadele et­ mede kullanmaktı. Arkadaşının yanında oturan adama koltuklan değiştirmeyi teklif etti ve şim di uçak hare­ ket etm eden önce yeni koltuklarına g eçm ek için birbirleri­ nin önünden geçiyorlardı. Herşey söylenip yapıldıktan son­ ra. beni etkileyen şey konunu kendisi değil bu adam ın sorum luluklarını arttı­ ran inandığı ve gurur duyduğu şeyle ilgili tutkusu olmuştu. O anda bu ironiyi düşünmeye başladım. geçm işim izin bilgeliği-ile bu­ gün bildiklerimiz arasında köprü kurm aktı. Kendini biraz önce yapmış olduğum konuşm adan dola­ yı net bir şekilde rahat hissederek b an a işini ve onun Dün­ ya Ticaret Merkezi ve Pentagon’a yapıl a n 11 Eylül saldırıla­ rını takiben nasıl değiştiğini anlatm aya başladı.

“Yapmanız gerekeni yaptığı­ nızdan ve bunu çok iyi yaptığınızdan dolayı memnun ol­ dum. Mesleğine yaklaşım şeklinden dolayı onu tak­ dir ettiğimi söyledim. sohbetimiz değişti. çünkü ben sizin işinizi asla yapamazdım. Subay yeni sorumluluklarını anlatmayı bitirdikten sonra.tamamen “şans eseri" gerçekleşmesine neden olabilecek ka­ rışıklık ve yer değiştirme olasılıklarını kendi kendime merak ettim. Siz ne yapıyor­ sunuz?” diye sordu. Bu adamın işinde çok iyi olduğu belliy­ di. aramızdaki bu küçük sohbet sırasında subayın ve kendimin bilincin çok daha geniş bir açı ile çalışmakta olduğunun bîr yansımasını deneyimlemiş olduğumuzu fark ettim. Sonra ona yaptığım komplimanı dönüp bana yaptı. nasıl yapılacağını bildiğimiz S sa\ Gregg Braden . Yürüyen merdivenlerden aşağı inerken. dünyadaki olaylar ortaya çıktıkça “onlar” ve “biz” diye bir şeyin olamayacağını görürüz. Bizi birbirimize bağlayan birleşmiş bir bilinç alanı oldu­ ğunu varsaydığımızda. aileleri­ miz ve dünya için aynı şeyi istemiş olduğumuz ve bu ortak hedefe son derece farklı yollardan katkıda bulunduğum uz her ikimiz için de çok büyük netlik kazanmıştı. Ne farklı bir düşünce şekli!” Yaşamlarımızın ironisinden dolayı birlikte bir kahkaha at­ tık ve uçuşum uzun geri kalanında dünyanın sonınlarını çöz­ meye devam ettik. Sa­ dece bir “biz” vardır. Birlikte. “Yapmanız gerekeni yaptığınızdan ve bunu çok iyi yaptığınızdan dolayı m em nun oldum .” diye başladım. O gece. kararlılık ve bu çabaların daha büyük bir çabaya katkıda bulunduğunu bilmenin gururundan kay­ naklanıyordu.” “Sahi mi?” diye karşılık verdi. Bagajlarımı­ zı almaya giderken birbirimize iyi şanslar diledik ve veda et­ tik. Savaştan kurtulmak için gerekli olan bil­ gelik üzerine yaptığım araştırma hakkında kısa bir açıklama yapmamın ardından bir an kahkaha attı. AIbaquerque’e inerken. Orduya katkıda bulundunduğu şeyler kendi içindeki ki­ şisel profesyonellik. “Çünkü ben sizin işinizi asla yapamazdım. “Bu ilginç.

Bu mesajla. geçmişimizi ve geleceğimizi paylaşmaya ek olarak. acıyı ve zulümleri haklı gös­ termek için cehaleti artık bir neden olarak suçlayamayız. onu artık “görmememiz” imkansızdır. tarihte her iki b a ­ kış açısının da bir arada olması gereken bir dönem de yaşa­ maktayız. Geçtiğimiz yüzyıla damgasını vuran nefreti. etrafımızdaki kişilerin. bir şeyden kesinlikle emin olabiliriz: en uzak akrabaları miras­ larının bilgisi ile birbirine bağlayan”kan” gibi. bir başka parçamız savaşı mümkün kılan silahlar ve ordulara ihtiyaç duymamıza n e ­ den olan düşünceyi değiştirmek için çabalar. bu geçişte hayatta kalabilmemizin anahtarı pekala da olabilir. Subay ile yaptığım konuşma. çarpışmalar ve m odern tek ­ noloji tarafından yerine getirilmiş olan eski fikirler . gezegenimizi.Tanrı 'nın Şifresi tek yolla. Siyah ve beyazın kanıtını gördüğüm üz zaman.güve­ nir. her birimizin aynı tarihi ve aynı Yaratıcı­ nın aynı imzasını taşıdığımız bilgisi sayesinde bizi birbirimi­ ze bağlamaktadır. hücrelerimiz­ deki mesaj da bizi. bildiğimiz tek ailenin seçimlerinin ağına takılmış olduk. Bunun. b el­ ki daha farkına varmadığımız ya da tam olarak anlam adığı­ mız şekillerde. Öte yandan. Bir parçamız. İnsan ailemizin gerçeğini bildiğimiz zaınan. Tarihin bu zamanının ironisi her iki düşünce şeklinin de daha iyi bir dünya için çalışan iyi insanlar tarafından. Geleceğim izde takip edeceğimiz yolu birlikte seçmişken. geçmişimizin denenmiş ve kanıt­ lanmış metodlarına . Eski yöntemler bize değerli bir zaınan kazandırsa da. farklılıklarımızı çözümleri z ve s orunlarımızı bizier çözeriz. “Aile ağacımızın” köklerinin gerçekten ne kadar deri­ ne uzandığını keşfetmeye devam ederken.savaşlar. öte yandan. sonı savaşın farklılıklarımız için tek çözüm olduğuna inanan düşünceyi değiştirmek için o zamanı akıllıca kulla­ nacak bilgeliğe sahip olup olmadığımızda. insanlar ve uluslar arasında ortaya çı­ kan somniarı çözmek için. artık onu “bil­ memeyi” yapamayz. aynı zamanda. birlikte çalıştığımıza olan inancımı güçlendir­ mişti. küresel bir aile olarak. . farkına varıl­ ması. anla­ dıkları tek yol olarak desteklendiğidir.

Hücrelerimizdeki mesajın gücü işte budur. onlarla küresel bir aile olarak yüzleşeceğiz. sadece keşfimiz ve dünya ile bir olduğu­ muzu kabul etmemiz sayesinde. bir şey kesindir: Sınavlarımız neyi gerektiri­ yorsa. Bu tek değişmez gerçekten şüphe ettiğimiz an­ larda. Yerli. her birimiz beden­ lerimizdeki Tanrı’nın ismini hayal edilebilecek en özel şekil­ de paylaşmaktayız. Yüzlerce nesil için. siyah. Ta­ rihsel olarak. kızıl ya da sarı. geniş ve farklı toplumların or­ tak bir amaç etrafında bir araya gelmesinde en büyük fırsatı sağlamaktadır. kökle­ rimizin arayışının bizi yaşamın özüne götürdüğü günü göz önünde tutarsak. İnsanlar olarak. bir kez öğrenildikten sonra hataya yer bırakmayacak olan kendimize bir mesaj olarak taşımaktayız. insanın ya da ulusun başına nasıl bir akıbet gelirse gelsin. bu diğerleri içinde mümkün olacaktır. Bir toplu­ luğun. Shinto. Hristiyan. her birimiz hayatta kalışımızın anah­ tarını. Belki. /" S N Gregg Braden . onu tekrar hatırlamak için bedenimizdeki hücrelerden daha uzak bir yere bakmamız gerekmiyor. kadın ya da çocuk. Her kas lifi. mesaj açığa çıkabilecektir. BÖLÜM 9 Ö ZET • Deneyim göstermiştir ki.hepsi Tanrı’dır. ay­ nı ataları paylaşıyoruz ve aynı Yaratıcı’mn çocukları olarak varoluyoruz. Budist. trajediler. erkek. insanoğlunun ortak ihtiyaç anlarında inanılmaz bir birlik olma yeteneği vardır.Her türlü mantıki şüphenin ötesinde. Müslüman. her kemik kristali. döktüğü­ müz her gözyaşı ve “israf’ dediğimiz yaşamın tüm yan ürün­ leri . beyaz. Bu basit ama güçlü farkındalıkta birliğimizin ve hayatta kalmamizın anahtarının ipliği yaşamaktadır. Aborjin. Musevi. mesaj bize insan olduğumuzu hatırlatır. Ortak geleceği­ mizde karşılaşacağımız zorlukların ne olduğunu tam olarak bilemesek de.

Zaman u m udun g ü ç lü ve birleştiric i m e­ sajının . • Doğa şiddetli rekabet yerine b irlik v e işbirliğinin tür­ leri hayatta kalmasına nasıl d a h a b ü y ü k bir şans veriğinin bir mavi' kopyasını su n ar. hücrelerim izdeki evrensel bir m e­ sajın keşfi farklı kültürler ve in an çlara sahip insanlar arasında aynı tür bir birliği sağlayabilir. p e k çok kişi din. İn san tarihi. • İnsanoğlunun “insana insanlık dışı davranışının” kanı­ tı ile yüzleşen tarih ve bilim.- . A &y ' • 20.inanılacak bir şeyin . Kuzey Amerika’nın keşfi sırasındaki k ü ltü rle r arası çatışmal ar gibi. h e r n e kadar aşın şartlar altında şiddet içeren d avranışlarda b u lu nm a yeteneği­ ne sahip olsak da. bu fikri destekler. • Bir çok bakımdan. miras ve inanç bakım ından farklılıklarım ızın daha ö n ­ ce sanki hiç bu kadar büyük olm am ış olduğunu his­ setmektedir. bizlerin te m e ld e “iyiliğin” bir türü olduğu mu zu öne sürm ektedir.k a b u l edilm esi için ye­ terince olgunlaşmıştır. yüzyılı tarihteki ‘‘en kanlı 100 yıl” olarak ayrı tutul­ masına neden olan pek çok şey y e n i milenyumda da devam etmektedir. insan bilincin de güçlü bir birleştirici etken olarak katkıda bulunacağım ileri sür­ müştür. Aynı zam an d a. birli­ ğin evrensel bir deneyimini yaratm anın bedeli nedir? • Dünya Dışı Zeka üzerine Araştırm a (SETİ) üzerine ü n ­ lü yazısında.Tanrı 'nm Şifresi e Farklılıklarımız yüzünden bizi b ö le n ve daha büyük bir amaç duygusu uyandıran trajedi olmaksızın. bir mesaj ın bulunmasının. yaşlı Carl Sagan dünyam ızın ötesinden.

Gregg Braden • Türümüzün hücrelerindeki Tano’nın e. hücrelerimizdeki mesajın gücü budur.ski adının imza­ sı farklılıklarımızı çözümleyeceğimiz eşi görülmemiş bir ortak birim sunmaktadır. Bundan şüphe duyduğumuz anlarda. sınırdan ya da teknolojiden daha fazlasıyız. • Çatışmanın çözümü konusunda yerli gelenekler tür olarak hayatta kalmamızı tehdit eden farklılıkları aş­ mak için uygulanabilir bir model sunmaktadır. İşte. Böyiesine somut bir kanıt aynı zamanda bize barışın ulaşılabilir ve herşeye değer olduğuna inanmak için bir neden de vermektedir. • Dünyamızın vatandaşları olarak. yaşam tarzından. onu hatırlamak için be­ denlerimizdeki hücrelerden daha uzağa bakmamız ge­ rekmiyor. . bizler bizi bölen her­ hangi bir dinden. inançtan. mirastan.

.

E k A - G İR İŞ Ş İF R E L E R İ N u m a r a d e ğ e r l e r i ile g ö s te r ilm iş tir (David Allen Huîse’nin izniyle kullanılmıştır1) ..

.

.E k B - E L E M E N T L E R İN P E R İY O D İK TA B LO SU .

. 269 272 27..9 1373 Dh ■BIı.t*®.Ü * töSI 98 1.73. ı i i f c ı t i m 91. H-' ■Mt. 121. .2 190.Atom Değeri il A * 10.266. ■İ&Îk*& M S j j | •Ar.9 1312 B e ’f i l i ®tfe| p i l I S I 20? 2lu . Uub m w t «• 261 p iiı ■ •:2Ğ3İ. öun ■Uuu. mlmk 3.8 Vt'l U t ! 5-19. ~0^!OX'VvXC.Element İsmi 1?jP*l ^ ---.0. 178. ■Cd “ ■i118.iP^5: f ”*8 ^ m < HgSİESsa Sb le> -x “ .7 « i » ■T.4 10% M i IMS.0 VIIIB Na M?~ İİ^ P il + H IB 1 V B V B V IB V IIB IB I1 B ■ H lfll T i f|î®f .01.4 •iBiS 183 4 186.8 58-9 M 63 *) S S İ « 7 ü t j |t ı ^ Ru ^ Pd' mm.Zn Sc İ P İ p i l Fe ■ Ç ı> G? ■i p i i p t * İg588$gk 9 wMm Ö l! Ü S l ü i 47. 262 Ig ü .EFSANE lA İHA IVA -----.7 127.i .2 i â i i ü m ı İÜ® Wğ3: 2072T '132.p.9 59-9 As .0 102.2 l i p üs ■ t Çs Ba • Hf ' S p a'mm iÜ İ .222.emî.9 106.8 j j j j M 9. Re Ds l i ı l ı ..6 126.7 i m 226 ||j j IIA Si âı \* iS o VA VIA VIIA i t t i P îp f F Ne:j j j j \ıso ) < 8 8 A ..

inanılmaz sayıdaki deği­ şimler. Geri kalan esaslar buna göre değişirler ve aşağıda gösterilmişlerdir.Ek C D Ö R T D N A E S A S IN IN H E R B Ü IR IN D E K İ Hidrojen. Aşağıdaki şema dört DNA esasını ve her esası eşsiz yapan her bir elementin atom sayısını göstermektedir. Dr. iki oksijen atomu ve beş karbon atomu vardır. Bu yolla. iki nitrojen JJPJLılinLatomu. sadece aynı dört elementin farklı düzenleri kullanıla-' rak müm kün hale gelmiştir. Nitrojen. Oksijen Ve Karbon Atomlarının Sayısı IT^TIkT A esaslı timinde altı hidrojen atomu. bir oksijen ve dört karbonla tamamen aynı elementlerin farklı miktarlarınden meydana gelmiştir.* Sitozin beş hidrojen. Todd Ovokaitys bilgi üzerine açıklamamı teyid etmiştir. . üç nitrojen. *Lebringer's Biochemistıy Textbook (Tıbbi bir standart) tarafından hesaplanmış atomsa­ yısı.

H e r D N A E s a s ın d a k i H id r o je n . sitozin. adenin ve guanin’de. Sitozin tem elin in yüzde 66’sı için. Buna ek olarak.E k D - İb ra n i H a rfle r O la r a k E ş d e ğ e rle ri G ö s te rile n . şifrenin ebedi doğasının n e ­ reye yöneldiği ya da nerede yer aldığı gibi herhangi b ir şart olmaksızın. . YH[ temelde üç kez tekrarlanırken. N itr o je n .. eş­ Şemada sizlikten sorumlu harflerin/elementlerin her esasta de-. Bu örneğin aşırısı T anrı’n ın isminin dört örneğinin yer aldığı adeninde görülebilir. şifrenin içinde YI-I o la­ rak bulunan Tanrı’nın isminin varlığının h e r zam an “b e d e n in içinde”yi (VG) DNAnın o bölüm ünde tuttuğunu garantilem e­ diğini kaydedelim. olan Tanrı’nın “Ebedi” ismi. “be denin içinde”yi işaret e d e n VG tarafından şifre tamamlanır. Örneğin. b u ra ­ da bedenin içinde yöneltilmiş Ebedi varlığın bu esasında h iç­ bir örnek yoktur. sadece varolmaktadır. sa­ dece bir kez. ilk örnekte. sitozinde. ğiştiğini görüyoruz. O k s ije n V e K a rb o n A to m la r ın ın G E N İŞ L E T İL M İŞ Ö ^ ^ Ğ Î görülen timin.

.

Time Warps. s. 5. Metin Almaliah Gad'm İbrani elyazmasını sanatsal olarak yommlamasından alınmıştır. Gad İsrail hükümeti için madeni para ve madalyalar. Hobsbawrn'un istatistikleri yüzyılın sonunda 187 milyon kişinin . Penzias and Wilson’s Discovery Is One of the Century's Key Advances. Palm Springs.com. 6." Scientific American (Haziran 2000): s. 4. The Prophet's Conference Aralık 200l)'dan alıntı. s.N o tla r \jz68y Önsöz 1. s. Ph. 5. 3. Selected Death Tolls for Wars. Hyperspace: Scientific Odyssey Through Parallel Uni~ mısras. Twentieth Century Atlas. 5. Website: ^^w. online makale. California. 1995). Michio Kaktı Visions: How Science Will Revolutionize the 21st Century (New York: Anchor Books.bell-labs. 1995). Kısım. 1998 ve 2000 yılları arasında. quoted from article in National Geographic’deki maka­ leden alıntı.1913 yılındaki dünya nüfusunun yüzde lO'undan fazla savaşlarda hayatlarını kaybettiğini göstermektedir. 19. Bölüm 1 1. and the Tenth Dimension (New York: Anchor Books. Şubat 1998. 2. I Giriş 1. Who Wrote the Bible Code? A Physicist Probes the Current Controversy (Colorado Springs: WaterBrook Press. 12. .com/mwhite28/warstat0/htm. Zbigniew Brzezinski. and Atrocities Before the 20th Century. Randall Ingerrnanson. 51. en az 50 ulus ya da işgal edilmiş bölgeler silahlı çarpışmalarla işgal edilmişti. "A Scourge of Srnali Arms. 3. Out of Control: Global Turmoil on the Eve of the 2lst Century (New York: Simon and Schuster. Bkz "Historical Body Count. Out of Control. 4. Rîchard Leakey. araştırmacıların biyografisini ve keşiflerinin anlamını da içermektedir. Klare. 1998)." Website: http://users. Website: ^^w. 289. Brzezinski.D.kirjastotscifii/leakey. Michio Kaktı.erols. "War and Peace in the 20th Century. AltıGün Savaşları için de amblem tasarlamıştır. Manhew White. Aynı yerden 7. s.. s. Massacres. 2. Çalışması Boca Raton. Florida’daki Ahava Galerilerinde sergilenmektedir. Jeffrey Boutwell ve Michael T. 4." London Review of Books (Şubat 2002). Aynı yerden 6. Eric Hobsbawrn. Barbara•Marx Hubbard. 1999).

Website: www. 1959 yılındaki yükselişi takiben yaklaşık 1. 14. "War Isn'tThis Century's Biggest Killer. "Five Million Forgotten: Non Jewish Victims of the Shoah.bigear.un." Smithsonian. 15. "Contact. R. R. 12. Craig ve E. Website: http://users.tibet. Cart Sagan. Ruminel. A Geologica! Miscellany (New Jersey: Princeton Univ. /» T \ 8. Statistics of Democide: Genocide and Mass Murder Since 1900 (Charlottesville: Transaction Publishers ve Rutgers Univ. Aynı yerden 20.uk.2 milyon Tibetli yirmi yıl için­ de öldürülmüştür.org. Out of Concrol. G. org/foıgotten/ 9. Jonathan Steele. Website: ^^w. j. Rummel. 1982)." Guardian Unlimited (Aralık 12. Press of Kentucky." Bu istatistikler the Munich Reinsurance Company'ın 20 Aralık 1999 sayılı basımından alınmıştır.htm. J. Jones. Bu bölge nüfusunun yaklaşık beşte biridir ve muhteme­ len hapishanelerde ve 6000’cleb fazla tapınağın ve kültür merkezinin yıkı­ lışı sırasında ölenler dahil değildir. 11.guardian. ." Soykınm sırasında kurban olan beş milyon yahudi olmayan ki­ şi hakkında yazılmış devlet raporunda (1997) aşağıdaki kaynaklardan alın­ tılar yapılmıştır: Richard C. UNAIDS'den alınmış globai istatistiklerle birlikte AIDS salgını üzerine rapor: HIV/AIDS hakkında müşterek BM programı. Massacres. no. Are We Alone?" adlı makaleden alıntı. 12. Website: ^^w. Neil Armstrong. 16. Press. Disasters. 1997)." The Waü Street Journal (Temmuz 7. s.remember. Brzezinski. 1986). 1. 1998). 10.unaids.. 2 (Mayıs 1978). ^^wilatoday. J. Bkz !. Website:. Uzaydaki yaşam ile ilgili araştırmaya dayalı kla­ sik yazısı. Aynı yerden 21.com/mwhite28/warstat0/htm. School of Law. 17. Lukas. Matthew White.com. Twentieth Century Atlas.co. vol. Website: ^^w. 18. Terese Pencak Schwartz. bunlar 87 ülkeyi temsil eden toplam 46. Website: ^ww. "The Quest For Extraterrestrial Intelligence. 13. The Forgotten Holocaust (Lexington: Univ. The Jews and the Poies in World War II (New York: Hippocrene Books. Rummei.org/vollno2/sagan.erols.Bölüm 2 1. Florida Today 0999). and Atrocities. online olarak okunabilir. Konuşlandırılan yıi ve ülke tarafından 2002'de BM'nin aktif banşgücü görevlerinin özeti. Virginia Center for National Security Law.Worldwide Statistics of Casualties.org. Statistics of Democide. 19. Website: www. 1999).445 görevli ve sivilar polisti. University of Virginia. 1997) ve Stefan Korbonski.com. "The Century that Murdered Peace. Y.

11. Hadar yakınlarında bulunan genç bir kadına aittir. 2000): s.000 feet yukarısında kumlmuş köylerde sürekli olarak yaşa­ yanlar olsa da deniz seviyesinden aşırı yüksekte olan bölgelerde nüfus çok daha seyrektir. şimdiki klasik çalışması The -Prindples of Geology. 5. 115-151. vol. Deniz seviyesine oranla 5. Australo­ pithecus anamensis. 1830’de. Ek olarak. 12. Human Variation: Races. 3. yaklaşık 4. 490. 1992). Bu yazı gibi. Australopithecus’un en bilinen örneği 1974 yılında Etyopya.ac. Aksi not edilmediği sürece. en eski temsili. uzun zaman süreleri boyunca yeryüzünün üniforma süreçleridir: uniformitarianism ilkesi. Darwin' nin evrim teorisi Punctuated Equilibrium ola­ rak bilinen uygulanabilir bir alternatif ile karşı karşıyadır. Niles Eldridge ve Stephen Jay Gould tarafından öne sürülen te ori "Yavaş ve sürekli bir hare­ ket yerine. 12. bu tarihler Scientific . Eldridge. Igor V.904 ile 19. yaklaşık 1. yerkabuğundaki değişime neden olan kuvvetlerin zamanın başından beri her za­ man varolan aynı kuvvetler olduğunu öne sürmektedir. s. "Rare Tests on Neande rthal Infant Sheds Light on Early Human Devefopment. Australopithecus cinsinin fosilleşmiş artıkları zamanın geniş bir bölümü­ nü kapsar. Yaklaşık bir asır sonra ilk defa. 10. vol. bu neslin bilinen en genç temsili.gla.680 feet yüksekte olan yerier için deniz seviyesinden yüksek olarak tanımlanır. 7. Talma adı "Lucy. Darwin'in keşi flerini saklamaya ve yay­ maya kendini adamış bir kaynak. Australopithe­ cus boisei. 404 (Mart 30. et al. . Charles DaIVlin. daha yüksek oranlar ise de­ niz seviyesinden aşırı yüksek olarak kabul edilir. Hutton'nun fikirleri bir başka İskoç bilim adamı Charles Lyell’in çalıması aracılığıyla tanıtılan. 9. and Ethnic Groups (New Jersey: Prentice Hali.gct. 2) Temmuz 2003 Özel Basımındandır. Her ne kadar deniz sevi­ yesinden 19.Glasgow Üniversitesi basım bülteninden .uk. "Punctuated Equilibria: The Tempo and Mode of Evolution Reconsidered." olan bu örnek şu ana kadar bulunmuş en eksiksiz Australopithecus temsilidir. 6." Mart 28.4 milyon yıl yaşındayken. evrim yeni formların çok hızlı gelişiminin yer aldığı olaylarla “vurgulanan” uzun süreli fiili duraksamalarla ('equilibrium') tanımlanmak­ tadır” savını öne sürmektedir. 8. İnsan Evrimine Yeni bir Bakış.American (vol. 4. The Galapagos Conservation Trust tarafından söy­ lenmiştir.Galapagos Islands'dan.2. 2000." Nature. Gould and N. 3: s. Website: w^w. Stephen Molnar. Types. 218.org. 1859. Ovchinnikov. J. Hutton'un te­ oriye de ismini veren. no. "Molecular Analysis of Neanderthal DNA from the Northern Caucasus. Hutton volkanlar ve kıtaların kabarıp çökmesi dahil." Paleobiology. Website: ^^w. S. Genes in Chimpanzee chromosome 12 or 13 (correspond to humarı .1 million yıl yaşındadır. Bu.

Sözü edilen kaynak özellikle onun Book of Adam ile olan ilişkisi ile ilgilidir. . The Origin of Spedes. s. 168. Hopwood ve Hans Reck.B. s. Bu basit online bilgi ^^w. 18. R. 20 (Ekim 15. 9051-5’den tutanaklar. Avarelio. 19. GenBank International Nucleotide Sequence Database’den alınmış gen zinciri oranı. A. Francis Crick. Baal Shem Tov Foundati­ on Website: www. 88. teknik olmayan bir tanımı ve diagramıdır. 21. 1963).jp/silver/chimp/-chromosome-12/top-1213 html. Matter. Dickerson ve Irving Geis. 529. Darwin. Richard E. Tanganyika Territory. 724. 629.html. 128. Matter. 199D: s. 17. "Evidence for an Ancestral Alphoid Domain on the Long Arm of Human Chromosome 2/‘ Human Genetics. "An Inversion Between Man and Chimpanzee Chromosomes. 2 (Ma­ yıs 1992}s.” 15. Aynı yerden. Life Itself (New York: Simon and Schuster. aynı zamanda da atadan kalma centromerin de (ya da en azından onun alfoif dizilerini).baalshemtov. The Lost Books of the Bible and the Forgotten Books of Eden. Web kaynağı: http://sayerlab. Leakey.-Ööl«m 3 1. 89. 1976). saklanmış olduğunu götermektedir. no. and the Unimısra. atadan kalma iki primat kromozomunun telomerik birleşimin­ den olduğu varsaydığından. no.cs. s. vol. CA. l ve c29B'de kolnlanmış geometrik ye­ rin eski bir telomere-telomere birleşmenin kalıntısı olduğunu ve insan kro­ mozomu 2'ye dönüşmek için bileşen iki atadan kalma ape kromozomu işaret ettiği sonucuna vardık. The Lost Books of the Bible and the forgotten Books of Eden (New York: New American Library. 239-244. Crane. Sözü edilen. /^ u z \ chromosome 1). "Age of the Oldoway Bone Beds. insanların ve şempanzelerin DNA’sının farklı bölgelerindeki benzer genler olgusunun kısa. 13. 16. and the Unimısra: An Integrated Approach to General Chemistry (Menio Park." National Academy of Sciences of the United States of America. 193l}s. Baal Shem Tov'un hayatı." 14. tarihi ve öğretileri ve Israel ben Eliezer'den ge­ çişi hakkında çok iyi bir dizi kaynak vardır.ac. 13. 2. 88.247-9. s." Bu.nig." Nature. bir gaze­ te yazısından alıntıdır. Sözü edilen. 22.: W. "Origin of Human Chromosome 2: An Ancestral telomere-telomere Fusion. bir gazete yazısından alıntıdır. Benjarnin. 1981). vol. 'de mevcuttur. 20. LS.. Frank Crane. no. bu bulgular sadece telomerik dizileri değil. s. Chemistry. vol. Chemistry.com. 'Kozmid c8. s. Dickerson ve Geis. Arthur T. et al.colorado.edu/~lindsay/creation/inversion. Don Lindsay. “İnsan kro­ mozomu 2. 3234 (Ekim 24.

mısra 7. the Nag Hammadi Library. ve Edward Cook’un çevirisi ve yorumu ile (Califomia: HarperSanFrancisco. Karen Armstrong. s. 1998) 6. s. 1. Metinleri ve yaşam biçimleri geniş bir şekilde kırdırılmış ve Hıristiyanöğretilerinden çıkarılmıştır. Aynı yerden. mısra 1. iv“ 9. s. mısra 5. 77. 8. Aynı yerden. Hershel Shanks. 11. 1993). s. 1:1. Aynı yerden. Aynı yerden. 1983). 21. 13. 1996).edilip tanıtıldı. mısralar 1-2.3. 47. bölüm IX. Aym yerden. s. yüzyıl tarihli . 5. s. 22. James M. ed. Claremont. bölüm LXIII. Eski Çağlar ve Hı­ ristiyanlık Enstitüsü’nden Coptic Gnostic Library Project üyeleri tarafından '■ tercüme. Aynı yerden. s. vii. bölüm I. ed. mısra 2:2. s. Chtistianity and Islâm (New York: Alfred A.ile aynı zamanda başladı. 14. 14. Apocalypse of Adam. 1990). Califomia (HarperSanFrancisco. 46. Robinson.000-Year Quest of Judaism-. (San Diego: !lWizards Bookshelf. bölüm XLI. Nag Hammadi Libraıy gibi keşifler sa­ yesinde. Aynı yerden.. 11. 1984). s. (California: HarperSanFrancisco. s. s. 23. 1997). The Mysteıy and Meaning of the Dead Sea Scrolls (New York: Random House. 20. Aynı yerden. 26. Aynı yerden. ve Book of Enoch'un da aralarında olduğu nadir kitaplar bugün Gnostik bilgeliğin ve ebedi öğreti­ yi gelecek kuşaklar için korumaya olan bağlılıklarının derinliğinin bir ka­ nıtı olarak hayatta kalmıştır.100. 18. 22. bölüm XLII. ed. Aynı yerden. Martin Abegg. bölüm ^LXVHI.. The Dead Sea Scrolls. İlk Hıristiyan öğretisinin yeniden şekillendi­ ği ve tanımlandığı dönemde ortaya çıktı. Jr. xvi. mısra 1. s. s. Aynı yerden 19. The Nag Hammadi Library. (York Beach. The Book of Enoch the Prophet. 17. mısra 1:1. Aynı yerden. 12. Willis Barnstone. Gospel of Mary. 4. 16. s. İlk kuşaklar tarafından korunmuş olan öğretilerle tanınan Gnostikler Kilise tarafından önderlik edilen tren­ di takip etmek yerine ayrılmayı ve orjinal geleneklere saygı göstermeyi seçmişlerdir. s. the Dead Sea Scrolls yaprak­ lan. Aıyeh Kaplan. Richard Laurence tarafından Bodleian Library’deki bir Etiyopya l yazmasından tercüme edilmiştir. 85. iv-v. . s. mısra 2. 8. Michael Wise. 4. ME: Samue! Weiser. 7. s. 10. Sepher Yetzirah: The Book of Creation. Aynı yerden. 9. 216. The Other Bible: Ancient Altemative Scıiptures. 24. s. s. 15. Aynı yerden. A Histoıy of God: The 4. 5. 25. Knopf.. Aynı yerden.

1988). "The Creation of Adam. OH: Ahmadiyyah Anjuman Isha'at İslam Lahore. asla keşfedilmemiş olan genel ilkeleri muhakeme eden gerçekleri ortaya çıkaran. mısra 4. ^w. Sepher Yetzirah. bölüm 3. ed. . s. W. 4 1. 145. Romalı ta­ rihçi Kallimachos astronoi. 1981). kısım 1. Hail. Gunther Plaut. 13. 10. 1979). 29. mısra 9. 9.’deki yangında yok olan Büyük Alexandia Kütüphanesi’nde kaybolan 532. ek 1. tıp. s. 3. s." s. ek 1. 11. The Other Bibie. 26. bölüm 22. 288. bilim ve felsefe dahil Yunan medeniyetinin tüm bilgisinin kütüphanede saklandığını ve kaydolduğunu not etmiştir. Halevi. ed. Aynı. 289. Yaşam Ağacındaki Taç’ın he­ men altındaki noktalı çi2giye iliştirilmiş olan Sefirot. Bilginin “Sefirot olma­ yandı olarak bilinir. 68. Genesis 2:7. mısra 7. ■ bölüm 2.) Ortaçağ Avnıpa’nın ilk "gerçek" simyacı­ sı olarak kabul edilir. Modern bir Yorum. 2. 8. 14. her ne kadar Ağaç'da ona bir yer verilmiş olmasına rağmen yaradılış deneyimimizde ortaya konulmadan kalır. Ağaç’daki Tann’nın isimleri arasında eşsiz bir yeri tem­ sil etmektedir. s.C. Roger Bacon (1214-1294 C. Sepher Yetzirah. Emerald Tablets of Thoth ve daha sonraki Emerald Tables of Hermes ‘in orjinallerinin gerçekten nerede plduğı belirsizdir. 6. mısra 2. The Holy Qur'an. s. Aynı yerden Kısım JJ Bölüm. 648. bölüm 1.. Bilginler 48 B. s. mısra 54. Hermetic. (Los Angeles: The Philosophical Research Society. The Secret Teachings of Ali Ages: An Encyclopedic Outline of Masonic.17. s. mısra 7. yerden. (New York:Union of American Hebrew Congregations. Manly P. 7. O yangından önce. kısım 5. kısım 1. Çalışması onu "Deneysel bilim. mısra 2. 705. Sepher Yetzirah. 286.000 belgeden biri olduğunu tahmin etmektedir. 1995). Z'ev ben Shimon Halevi. translation. Aynı yerden. Kabbalah.25. mısra 6. bölüm 25. Aynı yerden. s.E. Aynı yerden. s. CUII. Aynı yerden. s. . Kabbalah: Tradition of Hidden Knowledge (New York: Thames and Hudson. 648. 4. s. s. Aynı yerden. Bizler sadece Thoth’un açıklamalarının bu belgeler arasında olduğuna var­ sayabiliriz. s. bölüm 22. mısra 5 (Columbus. The Torah.and commentary by Maulana Muhammad Ali'nin tercümesi ve yommu. mısra 5. s. 26. bölüm 4. Qabbalistic and Rosicnıcian Symbolical Philosophy. 15. 6. Aynı yerden. 7. 289­ 16.” sonucuna götürmüş olan bir Franciscan idi. 12. 152'.E.. 5.

‘ 22. En eski Mezo­ potamya ve Pers tabletleri ile örneğin modern Yunan. Her ne kadar başvtını kaynak­ ları çok olsa da. demir ve sülmür elementi de geri kalan http://imagme. . Explorer'daki aygıtlar aracılığıyla. çünkü yüzdelerin nasıl çıkarıldığı­ nı göstermektedir. İbrani ve Semitik di­ lin temelinde bu özellikler bulunmaktadır.html. Dünyanın at­ mosferi yüzde 78 nitrojen ve yüzde 21 oksijenden yapılmıştır.citycoHegiate. Hidrojen (yüzde 71) ve helyüm (yüzde 27. 19. 4.com/chapter3a. Dua edilen ve edilmeyen hastaların iyileşme süreçlerini ve sonuçları karşılaştı­ ran çalışmaların online raponı. nitro­ jen. Ocak 1958'de. kanıtlar pek çok ve farklı dünya dilinin 5000 yıl öncesinden gelen ortak bir “ana” dilden geldiğinini varsayılabileceğini göstermektedir. bilim adamları dün­ yanın atmosferi. 26.msfc. miktarda oksijen. Aynı yerden. s. ve geçmiş zamanların tabletlerini. s. mahnezyum.gov/docs/ask_astro/answers/96l112a. Arkeologlar eski yazı taun­ ları keşfederken. Şu an için. karbon. neon. 286.nasa. Kaku. s. Aynı yerden. 21. Visions. Aynı yerden. Website: ^^w.nayüzdeyi oluşturur. s. bunu özellikle-seçtim. ağacın asıl kökleri karanlıkta kalmıştır. mısra 9. 155.11 hidrojendir. 23.gov/academy/space/atmosphere.\ 1 J 18. silikon. Amerika Birleşik Devletleri IGY’nin bir parçası olarak at­ mosferimiz ve yeryüzü ile ilgili bilgi taoplamak amacıyla ilk insansız uydu­ su Ex!orer Pi fırlattı.gsfc. A2. 24.html. Aynı yerden.htm. 20.html. Atmosferimizin bileşiminin kesin miktarı genelde hava sıcaklığına ve ve deniz seviyesine oranla yükseliğine göre değişebilmektedir. bölüm 2. NASA’nın website 'ındaki “Atmosferin Bileşimi” adlı bir bölümde bu konu ile ilgili bil­ gi mevcuttur: http://lifto ff.com/prayerhelps 1 . " United Press International (1999). okyanuslar ve kıtalann bişleşimi ile ilgili yeni görüşlere sa­ hip oldular.1) birlikte Güneşimizin bile­ şiminin yaklaşık yüzde 98’ini oluştunır. Sonuçlar: su yaklaşık yüzde 88. Website: ^^w. s. Her na kadar araştırmacılar daha erken döneme ait dilbilimsel bir ağaç­ tan türettikleri noktadan pek çok eski alfabenin izini sürmede başarılı ol­ salar da. applesforhealth. Suda eriyen oksijenin miktarı ısıya ve tuzun yoğunluğuna (tatlı su/tuzlu su) değişiyor olsa da. 25. NASA Website: sa. ek 1. eski belgelerini ve ka­ ya yazılarını kimin yarattığı konusunda hemfikirken. mısra 8. 1. oranlar benzerdir. mısra 2. 154.89 oksijen ve yüzde 11. yazılı dilin tam olarak nerede ve nasıl başladığı ile ilgili bilgiler gizemini konmaktadır. 27. "Prayer Helps Patiencs Heal. Bölüm 5 1.

Gematrianın ilkeleri harf-rakam değerlerini basitçe birbirine eklemenin ötesinde. Reading the Past (Londra: British Museum. mısra 4. Paul. T. İngilizce’de bu. The American Heritage College Dictionary. 5. The Secrets of Hebrew Words (New Jersey: jason Aronson. s. Haggah. htm. bölüm 4. (71). aslında. 461-538. eski gelenekler İngilizce. Book Two: The Western Mysteries (St. 1221. İbranice. 1982). Website: ^^w. Üçüncü Basım. Gematria çalışması. Sacred Geometry: Philosophy and Practice (New York: Thames and Hudson. Arapça. Eski Mezopocamya-Persçe ve Tibetçe dahil temel alfabelerin harfleri ile rakam değerlerini birleştirmiştir. E "enerji”nin gücünü ve enerji matematik ve fiziği birleştiren tüm şanlı ilişkilerini temsil eden bir semboldür.129. The Key of It Al (bkz not 4 yukarısı).org/gematria/gematria. gematrianın kabul edilişi ve uygunalmasına en iyi örnek mistik İb­ rani Kabala bikinidir. anlamın pek çok farklı boyıtunda araştırıl­ malı ve indirgenmiş. s. 288. 1997). Bu konu hakkında bir kaç çok iyi metin olmasına rağ­ men. E harfi bir logogram örneğidir. entegral indirgenmiş. Robert Lawlor. s. s. Sepher Yetzirah. MN: Llewellyn Publications. Bu sembolü kullanarak belki de tarihte en çok bilinen matematiksel E=meÇ eşitliği haline gelmiş olan bu logogramdır. 1990). s. s. Rabbi Benjamin Blech. örneğin. Kelimeler ve çümleler rasında daha derin “saklanmış” ilişkileri öğrenmek için gematriayı kullanmak binlerce olmasa bile yüzlerce yıldır bilim adam­ ları ve filozoflar tarafından tanınmış. inner. David Alien Hulse. J. The Key of It All: An Encyclopedic Guide to the Sacred Languages df Magickal Systems of the World. mutlak ve sıra belirten değerler dahil edilmelidir. Sanskritçe. 25. hece işa­ retlerinin kullanımı sayesinde tarihin detaylarım koruma yeteneklerinde inanılmaz ilerleme kaydetmiştir. 1991). en iyilerinden biri içinde Rabbi Yitzchak Ginsburgh'un öğretilerin­ den bilgiler de olan Gal Einai Institute of Israel’in Web referanslarıdır. The Other Bible. 3. Lon­ dra Üniversitesi Yunan ve Latin dili Fahri Doçenti J. 8. 6. Burada.2. Çince. aynı zamanda “pi” kelimesinin tümüdür ve bir dairenin çevresi ve çapı arasındaki ilişkiyi temsil etmek için kullanılır. bir kez daha.T. Bu konu hakkında daha fazla bilgi için lütfen Hulse'un iki-ciltlik tezine bakı­ nız. Yunanca. 4. 10. Sillabogramlar bir kelimenin söylenirkenki hecelerinin sembolleridir. Latin Kopti. ek 1. tanım 2 (New York: Houghton Mifflin Company. Hooker heceleri tem­ sil etmek için semboller kullnamanın önemini “yazı tarihinin en önemli ge­ lişmesi" olarak tanımlar. Bel­ ki de. Neredeyse evrensel olarak. 9. 9. varoluştaki belki de en eski bilimlerden bi­ ridir. saygı duyulmuş ve uygulanmıştır. Her kelimenin bir hece olduğu Çince gibi eski diller. Hooker. Fizik biliminde. Burada. . matematik­ sel sabit sayı “pi” gibi bir sillabogram örneğini sunan bilimin dilidir. 7. 1993).

s.V1Z. 17 olasılıktan sadece bir özellik evrenin en çok bulunan elementlerini eski simyanınn saklı sayı değerlerine bağlamaktadır.Sh. "Yirmi iki harf..T. . Kimya açısın­ dan. Öte yandan. "Madde" boşluğu dolduran herhangi bir şey olarak tanımlanır ve bir kütlesi vardır. Örneğin.] . \ 13. Sepher Yetzirah'm Saadia ver­ siyonunda. Atomik ağırlık bir gezegenin kütlesel çekiminin gücünün ölçümü olarak tanımlanabilir. Sepher Yetzirah. Bu anahtar atomik kütlenin özelliğidir.O.’dir. Çiftler ve Elementler arasında bir ayı­ rım yapılmıştır.Y." [Yazar okunabilmesi için harfler arasına virgül koymuştur. 12.. 25. bu demektir ki kuşun kütlesi azdır.11. 10.N. 1997). The Bible Cocle (New York: Simon and Schuster. Michael Drosnin. Temel Olanlar (Ana). aynı hızla yol alan ağır silah donanımlı bir tanka esintinin pek bir etkisi olmaz. mısra 13.S. HER ELEMENTİ EŞSİZ YAPAN ANAHTAR ÖZELLİKLER Erime Noktası Atomik Kabuklar Atomik Sayı Elektro-negativite Atomik Yarıçap İonizasyon Potansiyeli Yoğunluk Atomik Kütle Atomik Ağırlık Özgül Isı Covalent Yarıçap Kaynama Noktası Oksidasyon Halleri Erime Isısı Termik İletkenlik Buharlaşma Isısı Yörüngesel Dolgu 16.’1"Doğanın oniki gücü H.D.L. saatte 10 mil uçan bir kuş hafif bir esintiden kolaylıkla et­ kilenebilir. aslında sorduğu­ muz o şeyin ‘‘kütlesi nedir?” dir. (Her ne kadar atomik kütle ve atomik ağırlık terim­ leri çoğu zaman birbirlereinin yerine geçebilir şekilde kullanılıyorsa da ve onlarla ilgili değerler çok benzer olsa da.T. her element atmomik kütle de­ ğeri ile belirlenmiştir. s. Bu ör­ nekte. "Atomik kütle" karbonun en çok bulunan şekli olan karbon-12’nin küt­ lesinin onikide birne orantılı bir atom kütlesi olarak hesaplanır.R. Aynı yerden. s. bölüm 1. varolan bir şey için “ne kadar?” diye sorduğumuzda." "Yedi Çift B. 15. tankın kütlesi bir kuştan çok daha büyüktür demektir.Q’dir.'dir. yedi Çift ve doğanın oniki gücü)1"Üç Esas Olan A. 80.Tz.Ch. Burada.K. Elementlerin Periyodik Tablosunda (Ek B).M.) 14. Aşağıdakiler tek Elementlerin Periyodik Tablosunun elementlerini ya­ pan anahtar özelliklerdir.G. ilk bölümde neredeyse derhal ima dilen üç Ana Harf ile karşılaşrnz.P. "Kütle" hareket eden bir nesnenin süredurumu ve nesnenin ne kadar kolay etkilendirilebileceği ya da durdurulabileceği olarak tanım­ lanır. üç Esas Olanın temeli. aslında iki farklı alanın ölçüleri­ dirler.

Bir ya da daha fazla olasılık ile karşılaşıldığı zaman bilimsel tanımlar arasında karar verme mantığında bir ilke kullanıldı. mısra 12. s. 1985). and the Universe. (Nashville: Southern Publishing.680 Kısım III Bölüm 6 1. Arthur Whitfield Spaukling. html.vub. Chemistry. Golden Treasury of Bible Stories. İsim bir ortaçağ filozo­ fu oan William Occam’a atfedildi ve çoğu zaman aşırı cimrilik ilkesi olarak söylendi. insan bedeninin etrafımızdaki dünyadan pek çok kere daha fazla element konsantrasyonları paylaştığı gösterilmektedir.M. Aynı yerden 19. Hey harfi ile nitrojen elementi (değer 5) ve Vav har­ fi ile oksijen elementi (değer 6) arasında bir eşleşme bulduk. 18. Matter. Chemistry. S. ilke “bir olgunun daima en basit tanımı. (?) Yod = 10 1+ 0 = 1 Periyodik Tabloda. 21.ac. Genelde. s. s.440 15 25. Sepher Yetzirah. be/asc/PRINCI_SIMPL.560 2. Torah. Kabbalah. bölüm 1. . Matter. s. (Dickerson ve Geis. kainattaki dört elementin çokluğı karşılaştırıldığında. 1954). and the Universe. Dickerson ve Geis. İlginçtir ki. 20. Gematria ilkelerini kullanarak. ciltli basımın ön kapağının içindeki grafikten. Halevi. Aynı yerden. = 1. Hidrojen A.000 atom başınadır) Tüm Kainat İnsan Bedeni 92. Exodus 3:14. 165. Tanakh: The Holy Scriptures (Philadelphia: The Jewish Publication Society.” ile ifade edilir.760 60. 88. 77. en az mantık sıçraması gerektireni seçilmelidir. 140.670 49 8 10. 1 sayısının değerini çözmek için İbrani harf Yod bulundu. Website: http://pespmcl. 3.17. ed.)123 Element Hidrojen Nitrojen Oksijen Karbon KAİNATTAKİ VE BEDENİMİZDEKİ ELEMENTLERİN ÇOKLUĞU (Gösterilen değerler 100. 2. tüm sayı değerinin Yod'un ‘T ’i ile tam olarak eşleşen bir elemem vardır: hidrojen elementi.008 Tüm Sayı (Tamsayı Değeri) = 1 Benzer bir yöntemle. 22.

ek 1.1' Biblical Archaeology Review (Maıt/Nisan 2002): s. bölüm sayısı 66. 15. s. s. 5.4. Exodus 20:7. 26. Paul. 23. "Linguistic Excursus on the Name YHVH. 6. açıklama. Giriş. bulabildiğim hem en iyi hem de en eski örnektir. 6." s. 9. The Torah. s. 405. 21. "Linguistic Excursus on the Name ^HVH. Sepher Yetzirah. açıklama. Aynı Yerden. YHVH isminde belge parçası. Kabbalah. Bu resim Oxform Üniversitesi tarafından yeniden basılmıştır. s. David Alien Hulse. 488. s. Geıshom Scholem. s. 15. MN: Llewellyn Publîcations. Halevi. s. “Hidden. Aynı yerden. İlk Isaiah Scroll (IQisa). Sepher Yetzirah. s. Dana M. ed. 12. “ 20. Aynı Yerden. The Torah. The Torah. Haggadah. 285. Exodus 15:2. Exodus 3:13. s. Aynı Yerden." s.“ s. (New York: Doubleday. "Publishing Every Last Fragment. 400. Tanakh. 24. The New Jerusalem Bible: The Complete Text of the Andent Canon of the Scriptures. 88. bölüm 1. 426. 426. 13. 70. 25. The Key of It Ali. The Torah. 408. Pike ve Andrew C. aynı zamanda tam anlamı “dört-harfli kelime” olan Yunan dil in­ den türemiş bir tanım olan Tetragrammaton olarak da bilinir. "The Divine Name Ehyeh. Torah. 22. Basım. dipnot 6: 3." s. Zohar: The Book ofSplendor.5 feet uzunluğundadır ve bu slayta Isaiah 38:8’den 40:28’e kadarki metni içeren kolonlar görülmektedir [Fo­ toğrafçı: John Trevor] 18. Exodus 3:15. Standard Edition. açıklama. Book Two: The Western Mysteries (St. Plates. Discoveries in the Judean Desert (İngiltere: Oxford Univ. Sepher Yetzirah. Aynı Yerden. . Qumran Cave 4. cvii. 17. s. 5. Sepher Yetzirah. 426. s. ^XXIII: Unidentified Fragments. (New York: Schocken Books. Aynı Yerden 14. "My Name YHVH. 19. 29. Hershel Shanks. İ6. Sepher Yetzirah. 11. 28. açıklama. dipnot 4. 1999). 32. Bu her ne kadar bir belge parçasındaki Tanrı’nın eski ismi ile ilgili tek olay değilse de. 10. s. The Torah. Bu resim 2001 yılında Ölü Deniz keşiflerinin içe­ riği belgelenen ciltler serisinin bir parçası olarak ortaya çıkmıştır. Bu fotoğraf Mağara I’de en iyi saklanmış kağıt belgelerin bir bölümü­ dür. 2001). Plate ^K. mısra 1. Belge 23. The Other Bible. Skinner. 405. 27. 8. 9. 19-22. 424-425. açıklama. 17. 7. s. s." s. 1949). 3. 1994). s.

İbrani harflerin sayı olarak sırasını "Ra­ kamsal açıdan. "Announcing the Completion of the First Suıvey of the Entire Human Genome. mısra 2. Her harf bir sayı değeri ile ilişkilendirildiği için. J. H. 36. harfler tarafın­ dan temsil edilen elementler için bir kısaltmadır.: Princeton Univ. Aynı yerden. bölüm 1. bölüm 2. ya da G harfleri ile anlamdırılmışlardır. N. T. GV’nin farklı çevirileri vardır. sayı 171 (April 1953): s. 426. 40. s. tıpkı 2 artı l'in 1 artı 2 ile aynı değeri vermesi gibi.time. Üçüncü Baskı. 203. s. (Ayrıca bkz.'126 Haziran 2000 günü yapılan bir Beyaz Sarat ba­ sın konferansından. (Pıinceton. bunlar kısaca A. D. Ek C. 41. GV arka (omurga) (Ezekiel 23:35) ve iç Qob 30:5) olarak vermektedir. DNA'mızdaki VG'yi de GV olarak düşünebiliriz. s. "A Stmcture for Deoxyribose Nudeic Acid. s. The Torah. (İbrani) harflerin sırasının arasında fark yoktur. mısra 9. 737. çift heliksdeki esasların düzenini anlamanın anahtarı. ed. 15. 31. Gv'nin değerlerinin toplamı = 9 (G (3) + V (6) = 9).GV “arka”. el merdiveninin diğer ta­ rafındaki zıt yöne giden dizinin tamamlayıcıları olduğunu anlamaktır. Başkan Clinton." Space flight Now (2002). Sepher Yetzirah. The American Heritage College Dictionary. C. Esas olan her kaydedildiğinde varolan ele­ mentin kaç kez meydana geldiğini yazmanın sıkıcı sürecinden geçmektense. “omurga. 100. s. 34. bir yöne giden. Alice Calaprice.J./^ 6 U \ 30. Bu kelimenin ve “Adam” kelimesinin İbranicesinin gematriası ilginç ve etkili bir ilişki açığa çıkarır. The Expande<l Çuotable Einstein.) 37. "Hubble Reads Age of Universe. Press. Bu insan türünün ilk . 1. Sa­ dece belli esaslar diğer esaslar ile eş olabildiği için. farklı olan her elementin miktarıdır.(' s. oksi­ jen ve karbonnun aynı elementleri her DNA esasında mevcutken. İbranicede. 35.com/time/timelOO/scientist/watsoncricklhtml. “Linguistic Excursus on the Name TOW. koddaki hata şansı bu yapıda inanılmaz şekilde düşüktür. Time 100: Scientists & Thinkers—-James Watson & Frands Crick. The Time Arşivi. 2000). Hulse bunun örneklerini Kutsal Kitap bağlamında. nitrojen. 42. Aşağıdaki kaynaklar benim bilgin ve yazar David Alien Hulse ile şahsi konuşmalarım ve yazışmalarımdır. açıklama. Crick. hepsi de aynı genel temayı destekler . 39. C. 38. DNA'nın dört esası aslında bir tür steno işaretler sistemi. 471. Robeıt Wright. NASA basın bülteni. Watson ve F. Hidrojen. Bu metne odaklanmak için gerekli olan anlama yetisinin ötesinde. Sepher Yetzirah. el mer­ diveninin bir tarafını oluşturan esaslar dizininin. 68." ya da “bedenin içi" olarak tercüme edilir. Website: ^^w. 32." Nature. tanım 1. 33.” diye açıklar.

iki oksi­ jen atomu ve beş karbon atomu vardır. 151-170. ve türümüzün ilk yaratılmış olanının isminin kökü­ dür. timinin (T) esasıda.D. Ek D. 3. Watkins. 1995): s. “The Effects of Emotions on Short-Term Power Spectnım Analysis of Heart Rate Variability. iki nitrojen atomu. Deborah Rozrnan. "The Impact of a New Emotional Self-Management Program on Stress. 187-192. ve Alan D.) Bölüm 7 1. Her bir DNA esası “bedenin içinin” farklı bir derecesini barındırır. William Tüler.temsili olan Adam isminin değeri ile aynıdır (A=l+D=4+M= 40. Blech. “Tann/Sonsuz” ifadesi VG olarak yani “bedenin içinde” olarak tamamlanmıştır. Burada kodlanan kapının değeri DM'dir ve anlamı İbranice'de “kan" demektir. 14 (Kasım 15. Esasın geri kalanı basitçe ko­ dun Y ve G’si olarak varolmaktadır. Watkins. Emotions. Böylece. Hulse GV/VG’mn anlamını Yaradılışın 44. The Secrets of Hebrew Words. 1089-1093.. Book One: The Eastern Mysteries. DHEA and Cortisol. vol. mısra 5. yaradtlışın 231 olasılığını (Kapısını) yaraunak için. hücrelerimizdeki mesajın son iki harfi mantıksal olarak bedenin ‘‘içi”ne bir gönderim olarak görülebilir. 22 İbrani harfin her birini alfabenin geri kalan harfleri ile tekrarlanmayan bir ardıllıkla birleştir­ me sürecini tanımlayarak bu alanlan işaret etmiştir (Sepher Yetzirah. 1984) adlı son kitabına a katkıda bulunmuştur. . VG ve GV harflerinin anlamlan ile ilgili yaptığım araştırmalara göre. 2 (1998): s. ADM (Adam). M. 4. 44. 2. 22. The Isaiah Effect: Decoding the Lost Science of Prayer and Prophecy (New York: Harmony books. Her elementi İbrani harfler olarak ' ele aldığımızda. (Bu ilkenin örneği için bkz. altı hidrojen atomu. 124). ve Alan D. ayrıca Israel Regardie'nin The Complete Golden Dawn System of Magic (Maiaysia: Falcon Press. Ör­ neğin. 2000). 43. vol. Rollin McCraty. 76. no. bö­ lüm 2. no. Ph. Heart Rate Variability. 2000) yer alır. The Key of It Al!. Ph. bunu indirgediğimizde ise 9 sayısı bulunur). toplamda 45 yapar. The Key of It Al. Rollin McCraty.D.." The American Journal of Cardiology. Kabala'nm geleneklerinde harflerin ters diziliminin yaradılışın diğer ya da “ters" alanları ile ilişkilendirilmiş olabileceği açıktır. s. timinde sadece iki kez. insan bedeni ve hücrelemizdeki VG/GV aynı şeyi tanımlamaktadır. Bob Barrios-ChopHn. bunlar arasında. Sayı ile ortaya çıkan bu daha derin ilişkinin ışığında. Kapısı ola­ rak tarfi eder. David Alien Hulse eski diller ve onların sayısal anlamları arasındaki mistik ilişkiyi deşifre etmede bir lider olarak ün salmıştır. Sayısız metinle­ rin yazarıdır. Gregg Braden. Mike Atkinson. 33. Book Two: The Western Mysteries ve New Dimensions for the Cube of Space (York Beach: Samuei Weiser. Glen Rein." Integrative Physiological and Behavioral Science.A. s. Örneğin Sepher Yetzirah.. Mike Atkinson.

The New Jerusalem Bible. Aynı yerden. alıntılarının ve felsefesinin online bir kaynaktan alınmış halidir. and the Universe.net. 26. I Corinthians 3:16. 3L Aynı yerden. Aynı yerden. Stephen Hawking. s.au. 6. Crick. 19. MI: World Publishing. "Scientists Conquer Laser Beam Teleportation. Braden. 26.htm. Cenevre Üniversitesi. Basın bülteni.com. "Genome Discoveıy Shocks Scientists. 23. 2002. The Isaiah Effect. Aynı yerden. 136.abc. Aynı yerden. Holy Bible. "Rough Map of Human Genome Compieted.htm. 1989. 2000.clı/entanglement. açıklama. 20. bu onun düşüncelerinin.5. 1006. 18. s. A-1. 67. 16. Haggadah. s. Website: ^^w.edu/physics/2000/bec. s. 14. Website: ^^w. 529. bölüm 6. 121. 25. 1-2. 34. Der Spiegel dergisinden alıntı. Aynı yerden. s.com/great-quotes. 207-211 ve 233-238. 529. Dickerson ve Geis. "Creation of the World and the Alien Man. 21.geneva. Tom Abate. Braden. s. The Other Bible. 9.colorado. "Geneva University Development in Photon Entanglement for Enhanced Encryption Security and Quantum Computers. Mandaean Gnosticism. 27.nobeliefs. Website: ^^w. Sir Fred Hoyle ve Chandra Wickramasinghe. s. s. 29. 2. 11. Ezekie! 36:27. Aynı yerden. Website: www. 22." Australian Broadcasting Corporation Online. 75. 13. s. Aynı yerden. s.com Health. 89-93. 30. Zechariah 12:1. 12. 8.sfgate. The Isaiah Effect. "The Hypostasis of the Archons. 119. Holy Bible: Authorized King James Version. Website: ^^w. 28. 28.134. Bose-Einstein Condensate Homepage: Evrendeki en soğuk ısıda mad­ denin yeni formu. Standart Baskı. The Other Bible. 88. Website: ^^w. 35. 2001): s. 1100. Haggadah. s. s." s. Aynı yerden. Haziran 26.com. 15. Aynı yerden. mısra 19. s. s. Aynı yerden. Aynı yerden. 32." San Francisco Chronicle (Şubat 11. 77. Chemistry. 2001. Haziran 18. Life itself s. 17. 25." s. 10.cnn. 33. 7. 1989). Metnin otjinali A1manca’dır. Aynı yerden. s." Fizik Bölümü. 25. s. evoiution from Space ." CNN. John 2:21. Matter. Genesis 2:7 (Grand Rapids. Aynı yerden. İngilizce bir kopyasını 'elde etmede başarısız olduğım için. 24. Aynı yerden. Sd-Tech.

5. Graham Hancock. . "Wherı to Jump In: The World's Other War$. 143. 1992). Uluslararası Transpersonal Konferansı’nda sunulan genel bildiri." Tablolar 1946 ve 1999 arasında dün­ yadaki 291 silahlı çatışma olaylarını göstermektedir. 69. Center For Systemic Peace. 1998. Opportunities. A.000 genç insan ölmüştür. Aynı yerden. Vietnam. 1977). The Expanded Quotable Einstein. 208.. Aynı yerden.AmISafe. Benjamin. 267-278. s. Website: www. 9. Monty G.worldwatch. 4-9. Richard Hoagland. Eko­ loji ve Doğuştan Bilgelik Teması üzerine Haziran 1995'de Killarney.C. Cari Sagan. The Prophet's Conference sırasındaki konuşma-' sından alıntı (Aralık 2001). Kaynak: Am I Safe? (Teen Driver Safety Program). Yönetici. Palm Springs." ABC^NEWS. M.net. s.org. Wacson." Ruhaniyet. 23. 11." News-week. Video. Aynı yerden. Basın bülteni. s. Marshall. 4.aol.Madine. 39. 8. Aynı yerden. Website: ^^w. joıgen Wouteıs. s. 43.members. The Secrets of Hebrew Words. 36." Time (Nisan 19. Samuei P. 23-27. Barbara Marx Hubbard. Hoagland’s Mars: Volume II." Smithsonian.(New York: Simon and Schuster. s. 30. Bölüm 8 1. 13.000 asker hayatını kaybetmiştir buna karşılık son on yıl içinde gerçekleşen araba kazalarında 60. Cremo and Thompson. 2 (Mayıs 1978).com. 1. vol. 138. 38. The UN Briefing. The Terrestrial Connection (video) (New York: B. s. "The Quest For Extraterrestrial Intelligence. "Major Episodes of Political Vioience 1946-1999. s. no. 41. 2001) s. 37.D. s. vol. 40." Worldwatch Institute (Ocak 16. Stanislav Grof. 1998). ‘The Age of Muslim Wars. 3. 2. 10. "Son on yıl içinde araba kazalarında. The Mars Mysteıy: The Secret Connection Between Earth and the Red Planet (New York: Crown Publishers. California. The Hidden History of the Human Race. Summary of Anomalous Evidence Related to Human Antiquity. Blech.com/CSPmgm/wariist. Ayni yerden. 1981). James D. 12. 3­ 7. 13.1999} s. 73-78. no. 42. Huntington..savaşında ölen askerler­ den çok daha fazla 13-19 yaş arası çocuk ölmüştür. İrlan­ da'da yapılan 13.1999)." Vietnam Savaşında yaklaşık 58. “New Century to 'Be Marked by Growing Threats.htm. The Molecular Bioiogy of the Gene (Menio Park: W. Nisan 22. “Consciousness Evolution and Planetaıy Suıvival: The Psychological Roots of Humarı Vioience and Greed. 6. 12. Aynı yerden.25 (Aralık 17. s. "The World's W&. Website: ^^w.

hardal gazı gibi yakı etkenleri ve Agent IS gibi psikoaktif etmen­ ler dahildir.gov/Tox/ChemWar.edu/bobk/maha/ mahbfr. 15. Aynı yerden. Çevirileri­ nin bir kısmı akademik ve araştırma açısından (ticari olmayan) elektronik olarak görülebilir. Metnin kendisini okumakla ilgilenenler için.harvard.uga.000 mısradan fazla). 16. and Their Destruction Kimyasal Silahlar Anlaşması 1993 yılında tamamlanmış ve 1995 yılında 159 ülke tarafından imzalanmıştır. 181. Aynı yerden.(kangren etkeni). Kimyasal ve biyolojik etkenlere ek olarak.htnil.html.libs. Aşağıdaki belgenin online halidir.edu/~hsp/chemical.nlm. Production. çeviriler genellikle en ünlü klasiği olan Bhagavad-Gita ile birlikte kısım kısım yayınlanmıştır.sis." Thomas Ott . ABD Hastalık Kontrol ve Önleme Merkezleri (CDC) yurtiçi bir biyolojik saldırı olayında bir tehdit olabilecek en az 16 madde listelemektedir. Mahabharata'nın çok sayıda çevirisi vardır. 20. 18.html. 22. 24. Resmi olarak Convention on the Prohibition. teknolojinin ge­ lişmiş formlarının geçmişte varolduğunu önesüren etkileyici kanıtlar topla­ mıştır ve bunları Technology of the Gods: The Incredible Sciences of the Ancients adlı kitabına koymuştur (Adventures Unlimited Press. (New York: Doubleday. bu uluslararası anlaşma kurtarma sistemleri olarak da kullanılabilecek olan nükleer tekno­ lojileri ve füze geliştirmelerine de değinmektedir. Anthrax bakterileri gibi. 2000). Clostridium perfringens . Çok uzun olmasından do­ layı (100. ayrıca ek olarak Botulinum (botulism). 17. Tam bir liste ve bu etmenlerin tanımları için. Harvard Sussex Program on CBW Armament and Arms Limitation Website: '^^w. özellikle de 446-447 ve 489-481 sayfalar: ^^w. Aynı yerden. Kurumun kimyasal etmenlerle ilgili de aynı şekilde de­ taylı bir listesi vardır. Hayatı boyunca araştırmacı ve gezgin olan Childress. s.14. Aflotoxins (ckansere neden olan zehirler). 23. ve Anthrax’ı da sayabiliriz. 19. The Expanded Quotable Einstein. Aynı yerden.nih. 21.fas. lütfen National Library of Medicine1nin "Chemical Warfare Agents" Websitesine gi­ rin: ^^w. 1972). bu etkenlerden bazılarının ABD Posta Servi­ simde 2001 yılında ortaya çıkmalarını takiben geniş medya araçlarının sa­ hip olduğu kelimeler haline geldiler. Bunlara Sarin ve gibi sinir etkenleri. Stockpiling and Use of Chemical Weapons. "The American Experience: Race for the Superbomb. Benim kullandığım alın­ tılar Charles Berlitz’in çevirisine dayalı olan yazar ve araştırmacı David Hatcher Childress'den ve onun Mysteries of Forgotten Worlds adlı kitabındandır. Aynı yerden. bulabildiğim en iyi çeviri­ lerden birinin Pratap Chandr Roy'unki olduğunu söyleyebilirim. Diğerlerinin isimleri çok nadir belge­ lenmiştir ve telaffuz etmesi bile çok daha zordur. Aynı yerden.abob.

vol. National Atmospheric and Acmospheric Administration (NOAA)’nm ik­ lim ve yangın kayıtlarının bulunduğu bilgi bankası. onu metne' eklemenin önemli olacağını hissettim. John Swomley. Visions. 1931) 28. Aynı yerden. 42. Riddles of Ancient Histoıy (Moscow: Soviet Publishers. Descent of. 25. 20. Yüksek kaliteli cam tabakalarının içinde eritilmiş geniş çöl kumu alanlannın sayısız keşfi edebitat eserlerinde yer alır. Frederick Soddy. The Indus Civilization (3d ed. Aynı yerden.world-mysteries. 1921. bunlardan bazıları: Giles Wright.PBS. Man. s. Palın Springs. Peter N. Prout Journal. s. 41. Dini Gelişimin Hümanistik İfadeleri Sempozyumunun Açılık Konuşma­ sı. 29. Her ne kadar bu demecin otjinal bir kaynağını bulamamış olsam da.ı. 37. 26. 40. 322-330. 94 33. Sir John Marshal. Bu çalışmalardan bölümleri w\vw. 31. 3 (Eylül 1993). 30. The Prophec's Conference’ındaki konuşmasından (Ara­ lık 2001). 39. 35. The înterpretation of Radium 0909). Michael Adas. ' 32. 'The Riddle of the Sands. de bulabilirsiniz. 1968).htm. Darvin. Kakt. Margarethe Casson. Kimya dalında Nobel Ödülü. "Violence: Competition or Cooperation. 396 0972). Bu program ilk kez Ocak 1999’da Public Broadcasting System’de halka açıldı. 110. Dr. Suretierini online olarak bu labilirsiniz. no. Gorbovsky. ^A. 1994).com/pex_6. Bölüm 9 1." New Sdentist (Temmuz 10. Aynı yerden. Mutual Aid: A Factor of Evolution (Boston. Technology of the Gods. Mohenjo-Daro and the Indus Civilization (3 Vol. lan K. no. 36. Aynı yerden. California. A. vol. s. Schwartz. 1 (Şubat 2000): s. 34.org. Peter Kropotkin. Website: ^^w. 1966).yazıldı. 27. s. 94. ' 14. Stuart B.: Porter Sargent Publishers. s. 6. s. Warpaths: Invasions of North America (Oxford: Oxford Univ. Rocks and Minerals." Christian Ethics Today 26. s. zira açık edebiyatta sık sık ona danışılmaktadır. Steams. 6. Press. World Civilizations: The Origins of Civilizations. 38. sahneye kondu ve yönetildi. 329. Aynı yerden. Website: . 28. Sir Mortimer Wheeler. Jean Houston. diğer saygın tarihçilerin bakış açılarını da içine almaktadır. Childress. no. 1999). Hindistan'ın eski yazılarının gelişmiş bilime daya­ lı silahlar kullanılarak yapılan bir savaşı anlattığını hisseden Kasari Mohan Ganguli gibi. 1902). Steele.

Aynı yerden." Centers for Disease Control.html. 17. Bu yazı için aktarılmış olan belge dergi­ de basımından önce görülebilir. Lovejoy.2002. 13. An Encydopedic Guide to the Sacred Languages & Magickal Systems of the World. 4. MA. 2. 16. 2001): s . "Indigenous Approaches to Water Conflict Resolution and Implications for International Waters.: Harvard Univ.Ek A David Alien Hulse.188-89. Book One: The Eastern Mysteries. . 11. Volume 11. Hulse.H. s. 286 (Eylül 12. 1999)'un üçüncü baskısındaki editörün girişinden uyarlanmıştır. Adults. Abraham H. Sagan.noaa. /^ £ Z \ www. Aynî yerden. s. The Key of It Ali: Book One.S. corn/World. 1195-1200. 188-189. vol.htmlftHISTORICAL. 12. Ağustos 14. Aynı yerden. Aynı yerden." International Negotiation. National Center for Chronic Disease Prevention ve Health Promotion'un raporu. 14. Dietz’s'den istatikler. Website: ^^w. no." Journal ofthe American Medicai Association. Aynı yerden. M. ve W. 6. A. Wolf. "The Quest For Extraterrestrial Intelligence. Thomas Aquinas. 8. "Second Thoughts About'Peppered Moths. 7. Website: ^^w. "Prague Faces 'Worst Moment. 357-373. Aaron T. 2 (Aralık 2000): s. The Great Chain of Being: A Study of the History of an Idea (Cambridge. Aynı yerden.ncdc. 15. s. Civi! and Moral” (Bölüm XJII) Harvard Classics serilerinin bir parçalı ola­ rak mevcuttur (1909-1914)."’ CNN. 5. 1999): s. 5. This özel bölüm. by Characteristics. 13. This Classical Story of Evolution by Natura! Selection Needs Kevising. Quotecl by Arthur O tarafından aktanldı. Serdula. 9.bartleby. 11 (Mayıs 24.com. Aynı yerden. Bu alıntı Francis Bacon’un insan doğası üzerine klasikleşmiş yazısından aktarıldı. vol.cnn. vol.com/3/i/13.” 3. _ 10. The Key of It AH. s.gov/oa/repons/weather-events. Toward a Psychology of Being (New York: Wiley. 45. Summa Contra Gentiles. Of Goodness and Goodness of Nature. Maslow. Press. "ABD’de devam eden Obezite ve Şeker salgınla­ rı. "Obezite Eğilimleri: ABD’deki yetişkinlerde obezitenin karakteristik ola­ rak yayılması Prevalence of Obesity ^rnong U. "Essays." The Scientist. St. 76. Jonathan Wells. 13. no. 1936). Modkad.

Her şeyden önemlisi. Todd Ovakaytis ve Maıy Kennedy. bana bilimin kar­ maşıklığını alıp güç veren bilgeliğin neşesine değiştirmede yardımcı olduğun için teşekkür ederim. tıp ve istatistikler üzerine olan uzmanlığınız araştırmamın bir sonraki nok­ tasına gidebilmem için bana zemin hazırladı. Ned. her ikinizi de çalışmamızın bizleri nereye götüreceğini bile bilmeden. Yaşamın şifresi içindeki bir mesajın sak­ lı olan anlamlarını düşündüğümüz ilk günden beri. Her zaman benimle olduğu n için sana teşekkü r ederim. Bu bölüm bu kişilere teşek­ kür etmem ve aynı zamanda da Tanrimın Şifresi’nin tamamlanmasın­ da bazen bilmeden bile olsa katkıda bulunan herkese minnettarlığımı sunmam için bir fırsattır. uzın saatler boyunca benim­ le çalışmaya olan isteğiniz için derinden müteşekkirim. Stephanie Gunning. Sîzler parlak fikirlerin. sana bu keşfi anlaşılır bir kita­ ba çevirmemde yardımcı olduğun ve onu basım dünyasına. moleküler biyoloji. bunun için her ikinizin de kutsanmış olduğunuzu hissediyomm ve size minne ttarım. bu alanlarda uzman olan kişilerin adanmışlıkları sayesinde çalışmamı kesinlik ve güven içinde paylaşabildim. editörüm ve artık dostum. yaşayan her şeyin içindeki tanrısallığın kıvılcımı. düıüstlüğün kusursuzdu ve bana olan güvenin sapasağlamdı. rehberliğin paha biçiimezdi. se­ vecen kalplerin ve paylaşmaya hazır olduğunuzu gösteren bir isteğin nadir bulunan bir birleşimini oluşturuyorsunuz. Paris Otelimde­ ki buluşmamızdan sonra geçen iki yıl boyunca. Ned Leavitt. adanmışlığın ve yaptığın herşeyde dı­ şa vurduğun yeteneklerin için ve sözlerim ve programlanma olan sab­ rın için çok teşekkür ederim. bulduklarını başkaları ile paylaşma isteğin ve sonunda bizi dost yapan o ilk e-mailine yanıt vermeni sağlayan sezgin için sana . din ve tarihin geleneksel sınırlamalarını geçmek söz konusu olduğunda. bu kitabın özünü ayrıntılarına girdiğimiz sohbetlerimiz boyunca bana her zaman doğıu soruyu en doğru zamanda ve şekilde sordun ve bu bizi en net seçim­ lere götürdü! Profesyonelliğin. taşıdığın için kalpten şükranlarımı yolluyorum. David Ailen Hulse. Bu kitabı yaratmak için bilim. Yüce Gizem’i çözme de göster­ diğin tutkun.T E ŞE K K Ü R __ayatta başarılarımızı mümkün kılan insanlara teşekkür etme ^İfırsattnı nadiren yakalarız. Dr. özellikle: Kendisinin yaradılışımız aracılığıyla bilinmesini sağlayan. sevgili d ostum. edebiyat temsilcim.

nihayet bir projede birlikte çalışıyoruz! Jil! Kramer’e. Beni en kötü ve en iyi halimle gör­ düğün zamanlar boyunca arkadaşlığın hiç değişmedi. rehberliğin. Sizin bana olan güveniniz sayesinde.ve özellilune de sa­ natçı görüşüne teşekkür ederim. Hay House’daki tüm harika insanlar. T. yıllar boyunca. Margarete Nielsen ve John Thompson'a çok özel teşekkürler. ve Apple Tree Restaurant'ın tüm harika personeline . bana olan sevecenliğiniz . Dinlemek. kendimi Hay House ailesinin bir parçası hissettim. Brillo (Brio diye okunur). İlginç dönemeçler ve beklenmedik dönüşlerle dolu beş yıldan sonra.. dek minnettar kalacağım ilham verici bir güvene örnek teşkil edi­ yor. Melissa’ya. bana olan inan­ cın hiç sarsılmadı../" Z s T \ teşekkür ederim. Tony. Bu kitabı desteklemek için daha harika bir insan grubu ya da daha fazla adan mış bir takım iste­ yemezdim. Olunmalarımız sırasındaki cesaretlendirici sözlerin tahmin edebileceğinden çok daha fazla önemliydi ve ben destek ve esin kaynağı olsun diye eleştiri yazmı ofisimde tutuyorum! Katie Williams. Eski diller üzerine uzmanlığının nasıl bir katkıda bu­ lunacağım kesin olarak bilmeden benimle çalışma isteğin sana sonsu­ za. Dört ayaklı tüylü köpeğimizin güzelim ruhuna. Çok daha yüce bir bilgel iğe karşı sen ine beraber çalışmak benim için bir şerefti ve birlikte çalışmamızın tamamlanmasına daha çok za­ man olduğunu hissediyoru m! Hank Weselman.. Charlene.K. Jacqui Clark. Jeannie Liberati. Sen gerçekten de kendi işinin ustasısm. sizlere en samimi şükran ve en derin minnetlerimi sunuyorum. vizyo­ nun ve çalışmama olan sarsılmaz inancın için sana teşekkür ederim. önermek için harcadığın zamana . Bu kitabı mümkün olduğunca kusur­ suz yapan evrimin ve geçmişimizin bu anlık keşiflerini paylaştığın için lütfen kalpten teşekkürlerimi kabul et Kabul ettiğimiz dünya göıüşünün ötesinden gelen çağrıyı takip etme isteğin bizlerin daha iyi insan­ lar olmamız ve daha iyi bir dünya yaratmamız için zemin hazırladı. desteklemek. muh­ temelen bilmiyorsunuz ama. “şu anda burada olma­ nın” anlamını bize hatırlattığın için ve ben yazarken masamın yanın­ daki yoga minderinin üzerinde uyuduğun o'sayısız sabahlardaki tu­ valet molalarında bana yoldaşlık ettiğin için sana teşekkür ederim. Sizin heyecanınız ve profesyonelliğiniz engel tanımazdı. yaşamımıza getirdiğin mutluluk için. ofisteki editörüm. ve Angeia. ve Bent Street Cafe’deki tüm dostlarımız. bu kitabı gözden geçirme teklifin kesinlikle doğ­ ru yerde ve zamanda bana ulaştı. bu büyüklüğün bir projesini üstlenmenin yarattığı ta­ lepler karşısında gösterdiğin sabır için sana minnettarım. dürüst fikirlerin ve soh­ betlerimizi besleyen deneyimin için çok çok teşekkürler. Başkan ve CEO Reid Tracy.

pek çok farklı düşünceyi daha iyi bir dünya için çalışmak amaçıyla bir araya getirme yetenekleri ve bu vizyona beni de dahil ettikleri için kucak dolusu minnettarlığımı yolluyorum. her zaman. çok da­ ha iyi bir dinleyici olmayı öğrendim ve umudun ve fırsatın güç veren mesajını paylaşmak için bana izin veren sözleri duydum. Birlikte. özellikle de önemli olduğunda. Dünyanın her yerinde çalışmamı paylaşmama yardımcı olan adan­ mış bir aileye dönüşen gerçek bir takımın parçası olmaktan gurur du­ yuyorum. Lauri Willmot'a. Annem Sylvia Braden ve kardeşim Eric. Size her za­ man minnettar kalacağım. Benimle öylesine ilgilendiğiniz ve beni güçlü tutan ve seyahatlerim ve yazma sürecim boyunca odaklanmamı sağlayan harika yemekler ha­ zırladığınız için en derin takdirlerimi ve teşekkürlerimi sunuyorum. Her ne kadar aile­ miz küçük olsa da. Herkese. Böylesine bir desteğin ge­ tirdiği özgürlükle. vizyonunuz ve adanmışlığınız için ve tutkumu paylaştığınız. Sharon Kreig. orada olduğun için sana olan hayra nlığımı ve sınırsız teşekkürü mü yolluyorum.288 her zaman doğru zamanda ve tam ihtiyacım olan şekilde oradaydı. Muhtemelen bu sayfalarda ifade edemeyeceğim. Robin ve Cody Johnson’a. Herkesin bir ermiş olduğu­ nu bana hatırlattıkları için de özellikle teşekkür ederim.timallere açık olduğunuz için te­ şekkür ederim. Kathalin Walker.Park'a ve Source Books/Sacred Spaces Productions'dan Robin Miner’e sevginiz. Çalışmamız gittikçe çoğalan sayıda insanın zihinlerine ve yüreklerine ulaştıkça. sözlerin ötesinde olan. değişen dünyâmızın belirsizliğinin etkisine karşı daya­ nırken işimizi ve ailemizi birleştirmenin yeni ve yaratıcı yollarını öğ­ rendik! M. The Conference Works’ün kuru­ cularına. desteğiniz ve bizi bir araya getiren ilkelere bağlanmaya olan isteğiniz için teşekkürlerimi yolluyo­ rum. Park Productions’dan Torn. . Bjarkman ve Rae Baskin’e. Sizin verdiğiniz karşılık sayesinde. birbirimizi daha sık gördük ve bugün bir aile ola­ rak her zamankinden çok daha fazla yakınlaştık. ve sahne gerisindeki tüm gruba. il). ve Carol Simmons. Prophets Conferences’ın kurucularına. hayatımın -her gününü dolduran herşey için size teşekkür ederim. birlikte kocaman aile sevgimizin hayal ettiğimiz­ den çok daha büyük olduğunu keşfettik. de­ ğişen dünyamızda birlikte çalışmanın yeni yollarını keşfetme arzunuz için en derin takdir ve saygımı kabul edin! Yaşam oyununu benimle paylaşmış olan herkesin bana duyduğu güvenden onur duydum. vazgeçmeyen sevginiz ve bana olan inancınız için teşekkür ederim. benim favori (ve tek) ofis müdürüme.A. Darrin Owens. her geçen yıl sizin değerinizi daha fazla anlıyorum.