You are on page 1of 12

UNIVERSIDAD COOPERATIVA DE COLOMBIA

SEDE SANTA MARTA


FACULTAD DE MEDICINA
GNETICA
PROFESORA: GISEL GORDILLO
CASO TALASEMIA
IV SEMESTRE
GRUPO B
INTEGRANTES:

Mara Camila Galindo


Mara Camila Marulanda
Sebastian Quintero
Silvana Salgado
Mara Carolina Zambrano

SANTA MARTA
2016

1. The predominant inheritance pattern for -thalassemia major and


intermedia is autosomal recessive. List the individuals in the chart who are
indicated as heterozygous for the -globin gene. Explain your answers.
(Note: wild-type is a normal allele).
El abuelo, la abuela, el padre, la madre y Tazswana son heterocigotos.

El abuelo de Tazswana es heterocigoto, pues tiene un alelo de tipo salvaje y


un alelo de Beta-globina defectuoso resultado de una sustitucin de
aminocidos.

La abuela de Tazswana al igual que su esposo es heterocigota, esta cuenta


con un alelo de tipo salvaje y otro alelo con una delecin de Beta-globina, lo
cual impide que sea expresado.

El padre de Tazswana es tambin heterocigoto, este cuenta con un alelo de


tipo salvaje y un alelo con una sola sustitucin base en el intrn, lo que
resulta en una unin defectuosa.

La madre de Tazswana al igual que sus padres y esposo es heterocigoto,


esta tiene un alelo de tipo salvaje y un alelo de Beta-globina defectuoso,
resultado de una sustitucin de aminocidos.

Tazswana es heterocigota, ya que tiene un alelo de Beta-globina defectuoso


resultado de una sustitucin de aminocidos y un alelo con una sola
sustitucin base en el intrn, el cual resulta en una unin defectuosa.

2. Explain why only Tazswana has the disease.


Tazswana fue la nica hija que present la enfermedad porque tiene en ambos
alelos una mutacin en la cadena Beta, y para que esta se presente debe ser
heredado el gen defectuoso de ambos padres. La talasemia surge como una
mutacin de las cadenas Alfa o Beta de la hemoglobina, y como se pudo observar
en la Figura 2-1 Tazswana cuenta con la mutacin.

3. Speculate on why a mutation in the non-coding, intron region of the globin gene could produce a defective -globin protein.
Como ya sabemos, el intrn es considerado basura y no puede codificar
protenas. SI se da una mutacin en el intrn se agregara aminocidos extras a la
protena, de tal manera que afectara la lectura de este y se alterara la secuencia
de aminocidos hacindola ms larga de lo que debera.
4. Compare the size, shape and color intensity of the red blood cells. Record
your observations in the chart below; remember to use the correct names for
the description of the anomalies:

Normal.

Normal.

NORMOCROMIA.

Anisocitosis

DIANOCITOSI
S

HIPOCROMA

Microcitosis

DIANOCITOSI
S.

HIPOCROM
A.

TAMAO DE LOS ERITROCITOS1:


-

ANISOCITOSIS: eritrocitos de diferente tamao.


MICROSITOSIS: Eritrocitos con tamao reducido.

FORMA DE LOS ERITROCITOS2:


-

DIANOCITO-CODOCITO: La verdadera forma circulante es la de campana,


en las extensiones convencionales sufre una redistribucin anmala de la
hemoglobina asumiendo la forma de clula blanco en diana (target cell).

INTENSIDAD DE COLOR2:
-

NORMOCROMIA: Trmino utilizado para indicar que el eritrocito contiene


una cantidad de hemoglobina igual al nivel normal determinado por la

concentracin de hemoglobina corpuscular media (PCHC).


HIPOCROMA: Se origina por una sntesis anormal de hemoglobina,
asociada a deficiencia de hierro, anemia sideroblstica, talasemia y anemia
de las enfermedades crnicas. Se observa el eritrocito con una mayor
palidez central.

5. Thinking about the function of -globin and the shape and color of
Tazswanas red blood cells, explain why Tazswana has severe symptoms
compared to her mother or a normal person.
El paciente presenta los sntomas graves debido a que la funcin de la
hemoglobina es el transporte de oxgeno al cuerpo para la respiracin aerbica, y
sus glbulos rojos de la sangre son pequeos y dbiles debido al color y a su
forma distorsionada. En comparacin a la madre y una persona normal, la forma
alterada produce que una protena no funcione correctamente o en absoluto,
produciendo los sntomas ms severos.
6. Tazswanas mRNA sample (extracted from her reticulocytes) has been run
in Lane 3.

a) Compare Lane 3 to Lane 5. In terms of pre-mRNA processing, explain why


Tazswana has an extra band. Include drawings of both the mRNAs shown in
Lane 3 versus the one band shown in Lane 5 (symbolize the two exons as
rectangles, and the one intrn as a single line).
El tamao largo se debe a una unin incorrecta de la beta globina del pre- ARNm.
En vez de tenr una beta globina ARNm con exones unidos directamente juntos, la
parte de un intron sera retenida entre las dos secuencias codificantes. En otras
palabras, parte de la informacin no codificante de la beta globina se volvera
parte del cdigo para la protena de su beta globina. Consecuentemente, la
protena beta globina no sera traducida correctamente y le causara los sntomas.
CARRIL3

CARRIL 5

b) Predict how the size(s) of her mRNA bands will affect the size and
aminoacid content of her -globin protein.
El tamao de las bandas del m ARN de Tazswana van a afectar el tamao y
contenido de aminocidos de su protena Beta-globina, esto es por un cambio en
la protena normal y no funcionar igual por el cambio de la forma.
c) Tazswana has one normal sized -globin mRNA. Explain why she has
severe symptoms and from whom she has inherited the intron mutation (you
may wish to refer to Handouts 2 and 4).
Tazswana tiene sntomas severos debido a un defecto de empalmar que ocurri y
una parte de un intrn se qued con los exones para hacer la cadena ms larga.
Esto causar que la protena Beta-globina funcione incorrectamente por la
alteracin. Esta protena no podr realizar las funciones que requieren de

hemoglobina para transportar oxgeno al cuerpo. La nia heredo el intrn mutado


de ambos padres. Tiene el alelo heredado de su madre defectuoso por esto no
tiene ninguna posibilidad de producir Beta-globina de forma normal y su segundo
alelo en la mutacin intrn, que ella consigui de su padre que tiene la banda
5

extra .

D) Based on these results, discuss Tazswanas treatment options.


Entre los tratamientos para la talasemia esta la trasfusin de sangre, la sangre
proviene de donantes voluntarios que sern cuidadosamente seleccionados. Los
pacientes con

B-talasemia

mayor deben

recibir glbulos rojos filtrados

(sedimentados con reduccin de leucocitos), con un contenido mnimo de


hemoglobina de 40 g. El tratamiento recomendado para la talasemia mayor
requiere transfusiones de sangre regulares de por vida, usualmente administradas
cada dos a cinco semanas, para mantener el nivel de hemoglobina
pretransfusional por sobre los 910,5 g/dl. Dado que el cuerpo humano carece de
mecanismos para excretar el exceso de hierro, es esencial el tratamiento quelante
y ste constituye el segundo brazo importante, adems del tratamiento
transfusional debe estar acompaado de la administracin subcutnea de
Deferroxamina para evitar la sobrecarga frrica.
La esplenectoma es la extirpacin quirrgica del bazo que se puede hacer de
forma parcial o total el rea daada o enferma, este procedimiento se realiza si el
paciente se le ha vuelto muy doloroso.
La idea de utilizar un tratamiento gentico para el tratamiento de las
hemoglobinopatas (talasemia y anemia falciforme) es, en principio, simple. Los
eritrocitos se reabastecen en forma continua por las clulas progenitoras
hematopoyticas (HSC) de la mdula sea. Por lo tanto, la transferencia estable
de una copia con funcionamiento normal de una unidad gentica teraputica de
globina en las propias HSC del paciente daran como resultado la generacin de

eritrocitos normales en lugar de enfermos, de por vida sin necesidad de un


donante de mdula sea.
Otro tratamiento es el trasplante de mdula sea de hermanos HLA idnticos se
adopt en forma creciente para la cura de las hemoglobinopatas. La terapia
gentica como una opcin a futuro como tratamientos ha tenido un gran nmero
de importantes descubrimientos y avances tcnicos en terapia gentica en los
ltimos 20 aos, particularmente desde el ao 2000, indican que, por fin, el
tratamiento gentico de las hemoglobinopatas parece ser una posibilidad sera en
4

un futuro no demasiado distante .


(Optional) Assume the -globin mRNA in Lane 4 is from Tazswanas
grandmother. How is it different from the normal mRNA shown in Lane 5?
Discuss the cause of this difference in terms of the mutation and why
Tazswanas grandmother is symptom free.
El carril 4 de la Abuela de Tazswana al contar con uno de sus alelos con una
mutacin de delecin de la Beta-globina esta se expresar un ARNm ms corto
(Por la prdida de una o varias bases nitrogenadas) que el carril 5 normal.
Adems, al no presentar una mutacin en ambos alelos ella ser heterocigoto y no
presentar sntomas.
7. Comparing and contrasting Tazswanas pre-mRNA intron to the normal
intron, answer the following questions (use terms such as 5 splice site, 3
splice site, etc.):
a. How is Tazswanas intron similar to the normal -globin pre-mRNA?
Dentro de las similitudes del pre-m ARN de la B- globulina normal y la de
Tazswana, podemos encontrar que ambos cerca al sitio de unin 5, comienzan de
la misma forma, con los nucletidos GU. Adems, cerca al sitio de unin a 3 estn

los nucletidos CAG, tanto en el pre- m ARN de la B- globulina normal como la


que presenta Tazswana, que esta mutada.
b. How is Tazswanas intron diff erent from the normal -globin pre-mRNA?
Las diferencias que se tienen del intrn del pre-m ARN de la B-globulina normal y
la de Tazswana es que en los nucletidos centrales hay una mutacin de tipo
sustitucin de U por G.
8. Assuming that the cellular splicing machinery will recognize sets of GU
and CAG together in the right context as marking the beginning and end of
an intron, and that an extra GU will be grouped with the next downstream
CAG as a complete set, predict how Tazswanas pre-mRNA will be
processed into mRNA. Show the resulting mRNA sequence from this
process.
El pre-m ARN de Tazswana se procesara de manera normal si la union se produce
en el sitio de union respectivo en 5 GU y en 3 CAG en su respectivo sitio de union
o de empalme. Esto es debido a que se reconocer a los nucleotidos de GU y
CAG como intrones, y por lo que GU sera el sitio de union aberrante en el centro
del intron y se va a agrupar con CAG en un unico intron. La cadena de ARNm
resultante seria AGG.
9. If the doctors could somehow trick the splicesome (the cells machinery
that splices pre-mRNAs into mRNAs) into ignoring Tazswanas extra splicing
sequence, could she have a normal -globin mRNA? Explain why or why not.
Si podria tener una B-globulina normal si la secuencia de union adicional de
Tazswana se ignora y siguiera la secuencia normal. Asi, el ARNm seria normal con
una B-globulina normal. Es decir, union aberrante no estaria interfiriendo con el
sitio de corte y el ARNm tendria la cantidad correcta y necesaria de ARNm del
intron cortado.

10. What is alternative splicing and how does it apply to Tazswanas case?
El Splicing alternativo es un proceso de edicin post-transcripcional que se
produce tras la obtencin del ARN mensajero primario. El ARN mensajero primario
es la transcripcin `literal` de ADN a ARN. En los genes de eucariotas no todo el
ADN que se transcribe en el mensajero primario va a ser traducido. En los
eucariotas existen regiones de ADN que no codifican aminocidos conocidas
como intrones que estn flanqueadas por seales de inicio y de parada de la
transcripcin. Los fragmentos que s van a codificar la secuencia de aminocidos
de la futura protena son los exones. Distintas combinaciones de exones darn
lugar a distintas isoformas de la protena madura. La generacin de las isoformas
se lleva a cabo mediante el splicing alternativo. El splicing alternativo permite que
en un mismo gen pueda estar codificada la informacin necesaria para sintetizar
distintas protenas ya que mediante este proceso a partir de un mismo mensajero
primario pueden obtenerse varias secuencias de ARN mensajero maduro
dependiendo de cules sean los exones que se combinen. El mecanismo de
Splicing alternativo es una de las maneras de originar distintas isoformas
funcionales de una misma protena en diferentes tejidos o compartimentos
celulares. Aplica al caso de Tazswana en cuanto que la talasemia le reduce la
sntesis de una o ms de las cuatro cadenas polipeptdicas de la hemoglobina, y
con el splicing directo se puede aumentar la sntesis de dichas cadenas
3

polipeptdicas de la hemoglobina .
11. Design Tazswanas gene therapy to force the splicesome into the
normal alternative splice pattern.
a. Propose a complementary DNA sequence to interact (hybridize) with
Tazswanas pre-mRNA. Draw the 10 nt DNA oligonucleotide that will
complementary base-pair to the pre-mRNA to specifically mask the extra 5
splice site (underlined). Dont mask the normal splice sites! Assume her
intron sequence for the premRNA is as shown here:

Pre- ARN
5GUAAGUCUAAUGUCCCCUCAGAAGAAGGUCACUCUAACGACUCUUCAG3
ADN COMPLEMENTARIO
CATTCAGATT
GTAAGTCTAA
b. Discuss the type of cell the oligonucleotides need to be delivered to, in
order to affect alternative splicing of the -globin pre-mRNA.
El tipo de clula al que deben ser enviados los oligonucletidos es a las clulas
que producen eritrocitos. Estas son las clulas progenitoras hematopoyticas que
se encuentran en la mdula sea roja de los huesos largos. Estas clulas deben
ser punto de mira porque, a diferencia de los eritrocitos que estn circulando en la
sangre, estos tienen ncleos donde el procesamiento de pre-ARNm apenas se
est produciendo.
12. Recall that splicesomes are composed of snRNA and protein. Explain
how hybridization (complementary base-pairing) of the DNA oligonucleotides
to the cryptic and aberrant pre-mRNA sequences would correct the splicing
defect.
La hibridacin de los oligonucletidos de ADN a las secuencias cripticas y
aberrantes del pre-m ARN podra corregir el defecto de unin conectando ambos
exones, como si el proceso nunca hubiera ocurrido. Cuando estos oligonucletidos
de ADN hagan esto, vuelven a escribir la informacin nuclear por lo que el
empalme de genes sera correcto.
13. If Tazswanas 5 splice site at the correct location (exon2/intron2
boundary) had a point mutation from G to U so that the original 5 splice site
read UU instead of GU, would the gene therapy correct her thalassemia? Explain your answer.

Si, la genoterapia podra corregirla si el sitio de empalme 5 se empalma en la


ubicacin correcta y se leyera UU en vez de GU. El proceso seria reescribir
la secuencia, haciendo el corte y el empalme de forma correcta, y eliminar el
defecto en el gen de beta-talasemia.
II. (Optional) Since the oligonucleotides target splice site consensus
sequences that are common to all introns, wouldnt they potentially cause
side-effects in many cell types? Discuss within your group and come up
with:
a. Potential side-effects
b. Plan to limit side-effects.
Ellos pueden ser la causa potencial de los efectos secundarios en muchos tipos de
clula, y unos de los posibles efectos secundarios seria que no se codifique una
protena correctamente, el plan para limitar estos efectos seria realizar una
secuencia de ADN complementaria al pre-ARN correctamente, haciendo estudios
previos en ratones antes de utilizarlos con ella. Pero la verdad es que, los
oligonucletidos que se dirigen a secuencias de consenso no causan ningn
efecto secundario. Esto solo se he ha hecho pocas veces y no ha demostrado
efectos adversos6.
14. If you were in Tazswanas family, would you want Tazswana to undergo
gene therapy treatment? Explain why or why not.
S querra que se sometiera a la genoterapia, porque est la ayudara a curar esta
enfermedad que tiene y Tazswana podra tener una vida normal. No me gustara
por los muchos efectos secundarios y que tendra una mala calidad de vida.

WEBGRAFA
1. http://es.slideshare.net/aureuzz/anomalas-eritrocitos

2. http://www4.ub.edu/LabFisio/descargas/pdf/sangre.pdf
3. http://medmol.es/glosario/93/
4. Lineamientos para el manejo clnico de la 2 edicin talasemia actualizacin
http://www.ukts.org/pdfs/guidelines/guidelines_spanish.pdf
5. Actualizacin en Medicina de Familia. Talasemias
http://www.elsevier.es/es-revista-semergen-medicina-familia-40-articuloactualizacion-medicina-familia-talasemias-13116853
6. http://tazswanadna.blogspot.com.co/