Construcción DNA recombinante

1

Práctica 1
CLONAJE DE GENES EN PLÁSMIDOS BACTERIANOS: Construcción del
DNA recombinante
Introducción
Los plásmidos bacterianos son moléculas de DNA extracromosómico capaces de
replicar autónomamente. La mayoría están constituidos por un DNA bicatenario circular
cerrado de tamaño muy variable (1 a >200 kb), que se puede aislar de la bacteria en
forma superenrollada. Se encuentran en una gran variedad de especies bacterianas, pero
suelen tener un rango de hospedador estrecho. La replicación y transcripción de los
plásmidos dependen, en mayor o menor extensión, de proteínas codificadas por genes
de la bacteria. A su vez, los plásmidos contienen con frecuencia genes que codifican
enzimas útiles para la bacteria hospedadora como genes de resistencia a o producción de
antibióticos, de degradación de compuestos orgánicos, de toxinas, y de producción de
enzimas de restricción y modificación, entre otros.
Los plásmidos pueden utilizarse como vectores de clonaje y amplificación de
fragmentos de DNA que se hayan insertado en los mismos mediante técnicas de
Ingeniería Genética. Estos fragmentos replican y se transmiten a las células hijas
conjuntamente con el resto del plásmido. Los primeros plásmidos usados como vectores
eran de origen natural, pero en la actualidad se usan plásmidos modificados en los que
se han introducido características útiles para el clonaje, a expensas de eliminar muchas
secuencias innecesarias del plásmido original. Por ejemplo:
1. Marcadores de selección. Generalmente genes de resistencia a antibióticos como
ampicilina, kanamicina, tetraciclina, etc.
2. Un sitio de policlonaje que es una secuencia sintética que contiene las secuencias
reconocidas por varias enzimas de restricción.
3. Este sitio de policlonaje puede estar insertado dentro de un gen marcador lo que
permite la selección directa de los recombinantes. Por ejemplo, existen plásmidos en
los que el sitio de policlonaje se encuentra dentro de una secuencia de DNA que
codifica un fragmento () N-terminal de la -galactosidasa. En la Práctica 2
usaremos este gen marcador para la selección de transformantes.
4. El origen de replicación deriva normalmente del plásmido ColE1. Este origen
permite conseguir un número de copias elevado del plásmido. Muchos plásmidos
que se usan en Ingeniería Genética, como el que usamos en estas prácticas,
contienen un segundo origen de replicación derivado de un fago con DNA
monocatenario (M13, f1), que permite replicar una sola de las cadenas del plásmido
originando copias monocatenarias del DNA clonado, útiles para secuenciación,
mutagénesis, etc.
5. Promotores de fagos (T7, SP6) delante del sitio de policlonaje. Útiles para la
transcripción in vitro del DNA clonado, o para su expresión regulada in vivo si el
plámido recombinante se introduce en bacterias que expresan la RNA polimerasa
viral.
6. En los vectores de expresión, se suelen introducir además de promotores regulables,
para expresar el gen clonado en respuesta a cambios en las condiciones de cultivo, la
secuencia Shine-Dalgarno (“ribosome binding site”, RBS) que confiere alta
eficiencia de traducción, y una secuencia de nucleótidos que codifica un pequeño
polipéptido (una “etiqueta”) que puede ser reconocido por anticuerpos específicos.
El gen clonado y la etiqueta se expresan conjuntamente originando una proteína de

Construcción DNA recombinante

2

fusión, fácilmente detectable con los anticuerpos. También existen “etiquetas” (p.ej.
6 His) que permiten la purificación rápida de la proteína de fusión por cromatografía
de afinidad.
7. Muchos plásmidos vectores contienen secuencias complementarias a “primers”
universales que permiten secuenciar cualquier inserto introducido.
Las enzimas de restricción del tipo II constituyen la herramienta enzimática esencial
para la construcción de DNAs recombinantes. Se trata de endonucleasas que reconocen
secuencias cortas y específicas en el DNA, cortándolo por dicha región siempre que
determinadas bases de la secuencia no estén metiladas. Existen enzimas de restricción,
denominadas isoesquizómeras, que reconocen total o parcialmente la misma secuencia.
El corte puede producir extremos protuberantes (también denominados cohesivos) o
romos. Se denominan con varias letras y un número romano. La primera letra se refiere
al género, las dos siguientes a la especie y la última a la cepa de la bacteria de donde se
aisló. Los números se usan cuando hay más de un sistema de restricción-modificación
en la misma bacteria. Otras enzimas importantes en la construcción de DNAs
recombinantes son las DNA ligasas, que catalizan la formación del enlace fosfodiéster
entre los extremos 3´-OH y 5´-P adyacentes en un DNA, utilizando como cofactor ATP
o NAD+. La más usada es la DNA ligasa del fago T4 que puede unir extremos
cohesivos e incluso romos en presencia de ATP/Mg2+.
El fraccionamiento, identificación y purificación de moléculas de DNA se hace
normalmente mediante electroforesis en geles de agarosa (o de poliacrilamida cuando se
quieren resolver pequeños fragmentos de DNA de tamaños muy parecidos ya que tiene
mayor nivel de resolución). La agarosa es un polímero lineal constituido por unidades
alternantes de D- y L-galactosa unidas por enlaces glicosídicos -(13) y -(14). Se
funde bien a temperaturas elevadas y al bajar la temperatura gelidifica formando un
entramado tridimensional con poros de un diámetro entre 50 nm - >200 nm. En estos
geles, las moléculas lineales de DNA migran hacia el polo positivo con una velocidad
inversamente proporcional a su tamaño, dentro de ciertos límites. Estos geles también
son útiles para distinguir diversas estructuras que puede formar una misma molécula de
DNA bicatenaria, como DNA lineal, DNA circular cerrado superenrollado o DNA
circular abierto. La movilidad del DNA lineal depende principalmente de su tamaño, de
la presencia o no de agentes intercalantes, del voltaje aplicado, de la concentración
iónica del tampón de electroforesis y de la concentración de agarosa, ya que a mayor
concentración menor es el tamaño del poro formado. Por lo tanto, se deben usar
concentraciones más altas a medida que se desea analizar moléculas más pequeñas de
DNA. A los geles de agarosa se suele añadir bromuro de etidio (3,8 diamino-6-etil-5fenilfenatridium bromuro) para visualizar el DNA. Este compuesto, que es un mutágeno
y carcinógeno muy potente, se intercala entre las bases del DNA. Absorbe radiaciones a
302 y 366 nm (emitidas por las fuentes comerciales de luz ultravioleta), reemitiendo
parte de la energía absorbida a 590 nm, que corresponde a la región rojo-naranja del
espectro visible.
Para la construcción de un plásmido recombinante que contenga el fragmento de
DNA que deseamos clonar, el plásmido vector elegido se digiere con una o dos enzimas
de restricción y, posteriormente, se incuba con el DNA que se desea clonar, conteniendo
extremos compatibles con los extremos generados en el vector, y DNA ligasa.

el plásmido pRSET no permite esta doble selección. Este cDNA fue aislado a partir de una genoteca de expresión de D.Construcción DNA recombinante 3 Objetivos En esta primera práctica se pretende que el alumno obtenga una visión global de los pasos experimentales que hay que realizar para construir un plásmido recombinante constituido por el plásmido vector y un fragmento de DNA insertado en el mismo. el protocolo reducido no ofrece ninguna desventaja significativa pues los alumnos siguen realizando todas las técnicas previstas en el protocolo inicial ya que una cromatografía similar a la suprimida en esta Práctica se realiza en la Práctica 3 y en las Prácticas 3 y 4 se hacen dos electroforesis adicionales en geles de agarosa. 3) Aislamiento y purificación del cDNA(eIF4E) mediante electroforesis preparativa en gel de agarosa.invitrogen. que se resume en los siguientes apartados: 1) Digestión del plásmido recombinante pBluescript-cDNA(eIF4E) con EcoRI. Por otra parte. 2) Purificación de los productos de la digestión (pBluescript y cDNA) mediante extracción con fenol/cloroformo y precipitación con etanol. b) La ligación del DNA vector (pBluescript) con el cDNA no se hace en una relación molar óptima lo que nos permite introducir al alumno aspectos de cuantificación de DNA. 2) Purificación del pRSET-T7 digerido mediante extracción con fenol/cloroformo y precipitación con etanol. el proceso de construcción del plásmido recombinante en esta Práctica consistiría en: 1) Digestión del plásmido recombinante pBluescript-cDNA(eIF4E) y del plásmido vector pRSET-T7 con EcoRI.genomics. a los que está poco habituado. por tener unas características muy interesantes que se discutirán en prácticas. se ha optado por hacer un protocolo experimental alternativo al anterior mucho más reducido. Análisis cualitativo de los productos de la digestión mediante electroforesis en gel de agarosa.com).stratagene. elución de la banda correspondiente al cDNA del gel y cromatografía. 5) Ligación de los dos DNAs lineales en presencia de DNA ligasa del fago T4. e interpretativos del resultado obtenido (% de bacterias con plásmido recombinante). y como fragmento de DNA a insertar un cDNA que codifica el factor de iniciación de la traducción eIF4E de Drosophila melanogaster. que se resumen en: a) La utilización del plásmido pBluescript nos permite hacer una doble selección (resistencia a ampicilina y color de las colonias) para distinguir los clones bacterianos que contienen el plásmido recombinante de los clones que contienen el plásmido recircularizado sin inserto según se verá en la Práctica 2. y posteriormente clonado en el sitio EcoRI del plásmido pBluescript (www. Sin embargo. se reconstruye el plásmido recombinante original. http://www. melanogaster construida en el fago lambda. como vector elegimos inicialmente el plásmido de expresión pRSET-T7 (http://products. Es decir. Es importante destacar que esta modificación del protocolo experimental tiene varias ventajas. adicionales al objetivo de reducción del tiempo. En concreto. 4) Cuantificación de las concentraciones de ambos DNAs lineales purificados (pRSET-T7 y cDNA) mediante electroforesis analítica en gel de agarosa.com.agilent. 3) Ligación de los dos DNAs lineales en presencia de DNA ligasa del fago T4. dado el tiempo oficialmente permitido para el desarrollo del conjunto de prácticas (experimentales y de ordenador) de esta asignatura. En consecuencia. . Por el contrario. Análisis cualitativo de los productos de la digestión mediante electroforesis en gel de agarosa.com).

referencia original: Hernández. Fuentes de alimentación (1/mesa). Asas de siembra (6-12). Mecheros de gas (2-4/mesa) y cerillas (2/mesa). Jabón y escobillas.427-31) clonado en el sitio EcoRI. 1 mM EDTA. . Parafilm (1/mesa).agilent. Pipetas Pasteur de plástico. J. Equipo y Materiales generales ubicados en las mesas y vitrinas laterales:  Papel para secarse las manos. vasos y matraces de vidrio/plástico de diversos tamaños. Equipo PCR. Maquina de hacer hielo y contenedores para hielo. Bloque térmico.genomics. Gradillas acero para tubos dilución (2/mesa). Frigorífico con congelador. Papel de aluminio para pesar.com) con el cDNA(eIF4E) (http://www.com. 2/mesa para las Prácticas 3+4). Estufa a 30-37ºC. Equipo y Materiales generales ubicados en las mesas (3) de los alumnos:  Papel de filtro (1/pareja).stratagene. Material de vidrio y plástico se esteriliza en autoclave. Balanza/granatario para equilibrar tubos con dos vasos. Propipetas. Sin diluir y diluido 1/20.  EcoRI y tampón H para la reacción de digestión. Agarosa (Hispanaagar. Espátulas. H2O estéril (2 botellas de 50 ml /mesa).  Bromuro de etidio (5 mg/ml). Gradillas para tubos eppendorf de 0. & Sierra. Pinzas. se esterilizan en autoclave o por filtración.5 ml y 0. Consultar características en la información de la casa comercial que tiene el Profesor. Transiluminador luz UV y gafas protectoras (y/o pantalla protectora). Guantes tres tamaños (1 juego/mesa). Guiones de prácticas (1/alumno). Espectrofotómetro y cubetas de plástico. Cinta adhesiva de colores y para autoclave. Asas de extensión de plástico estériles (o de vidrio y vasos con etanol para esterilizarlas). M. Probetas. cloroformo. Microondas y guantes aislantes(2). low electroendosmosis). Pipetas estériles de 1 ml y 5 ml. Equipos de electroforesis (1/mesa para la Practica 1. Bolsas de plástico grandes para desechar material contaminado con Bromuro de Etidio (1) y placas de Petri usadas (1). Microfugas (1-2/mesa). Contenedores para desecho de las puntas (2/mesa). Bolsas con tubos eppendorf de todos los tamaños y puntas de pipeta para reponer. Dos baños termostatizados con agitación a 37ºC: uno con gradilla para tubos de dilución y flotadores para tubos eppendorf. Balanza de precisión. Tubos eppendorf estériles en botes de vidrio de 1. etanol).1 ml (2 juegos/mesa).5 ml. y el otro con abrazaderas para matraces de 100 ml y 25 ml.  Tampón TAE: 40 mM Tris-acetato. Otros materiales necesarios para la Práctica 1:  Plásmido recombinante pBluescript www.  Marcadores de masa molecular de DNA del fago 29 digerido con HindIII. Matraces de 250 ml (1/mesa) y probetas de 100 ml (1/mesa).1 ml (2/mesa). Medios líquidos.nlm. Puntas de pipeta estériles de tres tamaños (2 juegos/mesa). 1995 Biochim Biophys Acta 1261. Papel de filtro. Rotuladores para tubos (2/mesa).nih.gov/ . “for”: U16139.Construcción DNA recombinante 4 Materiales Nota: Se utiliza material estéril. Pipetas automáticas (1 juego/pareja). Rotuladores para pizarra de varios colores y borrador. G. Garrafa con H2O destilada (1/laboratorio). “search: nucleotide. Gradillas plástico (1/pareja). http://www. Centrifuga de mesa con rotor para tubos Falcon de 50 ml.ncbi. Tijeras (1/mesa). a excepción de compuestos orgánicos (fenol. 0.

4. 3. así como sacarosa o glicerol en agua. cubetas. Detener la reacción elevando la temperatura del termoblock a 65ºC e incubando las muestras durante 5 min. Consultar características en la información de la casa comercial que tiene el Profesor. 2. Procedimiento A) Digestión del plásmido recombinante pBluescript-cDNA(eIF4E) con EcoRI.  3 M NaAc. 5. Notas de advertencia importantes sobre posibles peligros:  El bromuro de etidio es un agente mutagénico y carcinogénico muy potente. Las concentraciones superiores al 5% de glicerol en la mezcla de digestión pueden afectar a la actividad enzimática por lo que el volumen de EcoRI no debe superar 1/10 del volumen final de la mezcla de reacción. Antes de la práctica preparar alícuotas de 0.5 ml.5 ml en tubos eppendorf (2/mesa). Es obligatorio usar guantes para su manipulación y la de los geles. puntas de .2.  Fenol (Sigma). añadiendo los componentes en el orden indicado (el alumno debe calcular previamente los volúmenes a añadir de DNA. pH 5. Varias botellas conteniendo etanol absoluto y etanol al 70% en agua destilada estéril.Construcción DNA recombinante 5  Tampón de carga de electroforesis (6X) que contiene los colorantes bromophenol blue y xylene cyanol FF.  Etanol (Merck). preparar la mezcla de incubación siguiente. rotulado con el número de la pareja. Antes de la práctica preparar alícuotas de 0.  Cloroformo (Merck).  DNA ligasa del bacteriófago T4 y tampón de ligación.5 ml en tubos eppendorf (2/mesa).5 ml en tubos eppendorf (2/mesa). B) Análisis de los productos de la digestión mediante electroforesis en gel de agarosa en presencia de bromuro de etidio. Se guardan en el congelador del frigorífico. Poner los tubos en el termoblock e incubar a 37ºC durante 60-90 min. En un tubo eppendorf de 1. 1. tampón H y H2O estéril): Componente Concentración del stock Concentración o cantidad requerida en la mezcla de incubación Volumen a añadir H2O estéril l Tampón H 10X 1X l DNA (pBlue-4E) 4000 ng 0. Antes de la práctica preparar alícuotas de 0. Mantener las muestras en la nevera hasta su uso. Preparar el termoblock a 37ºC.8 g/l l EcoRI 10 unidades/l 2 l* Volumen final 25 l * EcoRI se suministra en un tampón que contiene 50% glicerol.

2.. En todo caso. Nota: Normalmente el tampón TAE (1X) usado en la electroforesis se suplementa con bromuro de etidio (concentración final 0. Aplicación de las muestras y electroforesis:  Preparar ocho tubos eppendorf de 0.  Verter inmediatamente en el soporte preparado según el apartado 1. Si fuese necesario manipular la cubeta durante la electroforesis hay que desenchufar previamente la fuente de alimentación. Sacar el matraz usando guantes aislantes. Está absolutamente prohibido mirar el gel sin la debida protección con gafas y/o pantalla protectoras para evitar que la luz UV dañe la retina del ojo. Si hubiese que preparar una disolución stock habría que usar mascarilla para pesarlo. nosotros no lo añadimos para evitar la generación de grandes volúmenes de material de desecho que no pueden ser eliminados por la pila. Preparar el soporte donde se colocará la agarosa sellándolo con cinta adhesiva en los dos laterales abiertos y colocar el peine adecuado en la posición indicada. Sin embargo.  Retirar con cuidado la cinta adhesiva y el peine e introducir el soporte con el gel en la cubeta de electroforesis (¿dónde deben quedar situados los pocillos del gel con respecto a los electrodos de la cubeta?).  Añadir suavemente tampón TAE (1X) hasta sobrepasar el nivel del gel. Una pareja de alumnos se encargará de preparar 2-3 litros de tampón TAE (1X) a partir de un stock TAE (50X) y de distribuir a todas las parejas y mesas. Se preparará un único gel por mesa por lo que las operaciones que se indican a continuación se deben distribuir entre los alumnos de cada mesa como se considere más oportuno: 1. que hayan estado en contacto con este compuesto. Dejar unos 10 min en reposo para que el gel polimerice. la visualización de las bandas de DNA en nuestras condiciones es adecuada. La electroforesis se realiza con corriente continua a 100 voltios por lo que una descarga eléctrica es peligrosa.Construcción DNA recombinante   6 pipeta. etc. Mantener encima de un papel de filtro fuera de la cubeta de electroforesis.  Calentar en el microondas hasta que la agarosa quede fundida (unos 2 min). Preparar el gel de agarosa al 1%:  Pesar 0.  Dejar enfriar unos minutos y añadir 7 l de una disolución stock de bromuro de etidio de 5 mg/ml (concentración final en el gel: 0. 4. 3.  Añadir 70 ml de TAE (1X). La visualización de las bandas de DNA en el gel de electroforesis se hace haciendo pasar luz ultravioleta a través del gel.5 g/l) para mejorar la visualización de las bandas de DNA.7 g de agarosa y ponerla en un matraz de 250 ml.5 g/ml).5 ml según se indica en la Tabla siguiente: .

. Cada alumno debe aplicar una muestra. El bromophenol blue migra aproximadamente como un DNA bicatenario lineal de 300 bp (prácticamente con el frente) y el xylene cyanol FF como un DNA bicatenario lineal de 4 kb. NO mirar el gel sin gafas o pantalla protectora. 11) Mezcla de digestión Parejas 4 (8. 12) pBlue-4E sin digerir (dilución 1/20) o Mezcla de digestión de una pareja Marcadores DNA (29) o Mezcla de digestión de una pareja H2O (ajustar hasta 10 l) 7 l Tampón de carga (6X) 2 l 2 7 3 4 5 6 7 8 3 l 6 l 4 l 3l 3 l 4 l o 1 l 3 l o 1 l 7 l 4 l 6 l 7 l 7 l 2 l 2 l 2 l 2 l 2 l 6 l o 9 l 2 l 7 l o 9 l 2 l Nota: Calcular los ng de DNA total presente en la mezcla de digestión y en la muestra del pBlue-4E sin digerir que ha puesto en cada tubo. Sacar el soporte con el gel escurriéndolo bien y ponerlo encima de un papel de filtro doblado. Parar la electroforesis y desconectar la cubeta de la fuente de alimentación.      Aplicar suavemente los 12 l totales de cada muestra en los pocillos correspondientes del gel. Llevar el soporte con el gel al transiluminador y visualizar los DNAs haciendo pasar luz ultravioleta. Hay que evitar perforar el fondo del pocillo o que la muestra se salga por la parte superior del mismo. Analizar los resultados obtenidos y contestar a las preguntas que se formulan en el apartado de “Resultados y cuestiones”. Se pueden sacar fotografías con ayuda de un teléfono móvil que tenga cámara fotográfica. 10) pBlue-4E sin digerir (dilución 1/20) Marcadores DNA (29) Mezcla de digestión Parejas 3 (7. Cerrar con cuidado la cubeta de electroforesis y conectarla a la fuente de alimentación. Correr la electroforesis a 100 V durante 90-120 min (hasta que el colorante azul esté próximo al final del gel).Construcción DNA recombinante 1 3 l Mezcla de digestión Parejas 1(5. 9) Mezcla de digestión Parejas 2 (6.

1.Construcción DNA recombinante 8 C) Purificación de los productos de la digestión (pBluescript y cDNA) mediante extracción con fenol/cloroformo y precipitación con etanol. añadir un volumen igual de cloroformo. Centrifugar a 12000 rpm en microfuga durante 2 minutos a temperatura ambiente.5 ml. estimando el volumen recogido. 9. como mínimo. Mezclar suavemente y guardar en el congelador del frigorífico hasta el día siguiente. con cuidado de no recoger la interfase que contiene la proteína desnaturalizada. Los tubos deben seguir marcados con el número de la pareja. Si el volumen de esta fase acuosa es superior a 15 l (si es inferior NO es aconsejable hacer la extracción con cloroformo). una razón molar inserto/vector de 3/1. Dejar secar a temperatura ambiente unos 5 minutos. Resuspender el DNA en 20 l de agua destilada estéril. 1. 5. Marcar la posición del tubo en la microfuga. 4. sacar los tubos del congelador y centrifugar a 12000 rpm en microfuga durante 15 minutos. marcado con el número de pareja. Pasar la mezcla de digestión restante conteniendo los dos DNAs a un tubo eppendorf de 0. 6. Al día siguiente. mezclar bien y repetir la centrifugación y obtención de la fase acuosa como antes (pasos 3 y 4). Precipitar el DNA añadiendo a la fase acuosa final (la obtenida después de la extracción con fenol o con cloroformo) 1/10 vol final de 3M NaAc.1 ml marcado con el número de cada pareja conteniendo los componentes siguientes.5 ml al que se ha cortado previamente la tapa. y pasar a otro tubo eppendorf de 0. Los alumnos deben .5 ml son mas pequeños que los huecos de la centrifuga hay que ponerlos DENTRO de un tubo eppendorf de 1. 8. Decantar el sobrenadante sobre un papel de filtro. Decantar el sobrenadante sobre un papel de filtro y con golpecitos suaves para eliminar el resto de líquido. manteniendo el tubo abierto entre los dedos. 10. 2. 7. Agitar suavemente y centrifugar de nuevo en la microfuga durante 5 minutos. Eliminar la proteína contaminante añadiendo un volumen de fenol saturado y mezclar bien. Preparar un tubo eppendorf de 0. añadidos en el orden que se indica: Componente Volumen H2O estéril 7 o 5 l Tampón para la ligasa (10X) 1 1 l Mezcla de DNAs resuspendidos 1 o 2 l en 20 l de H2O estéril (*) DNA ligasa de T4 (1 U/l) 1 o 2 l Volumen final 10 l (*) Hay que tener presente que para favorecer la formación de moléculas recombinantes se debe usar. estimando el volumen remanente. El tubo debe estar marcado con el número de pareja. Retirar la fase acuosa (la superior).5 ml. Guardar en nevera hasta su uso. pH 5. NOTA: Como los tubos de 0. Lavar el precipitado de DNA añadiendo 300 l de etanol al 70%.2 y 2 volúmenes de etanol absoluto (enfriado a –20ºC). El cloroformo elimina los restos de fenol que queden en la fase acuosa. 3. D) Ligación de los DNAs linearizados y desproteinizados (cDNA del eIF4E y plásmido pBluescript).

Explique su respuesta. Explique la respuesta. b) ¿Cuáles son los tamaños aproximados (en pb) de los DNAs obtenidos en la digestión?. usado en esta práctica. canales 2. Fragmento Tamaño (pb) Cantidad (ng) 1 2 3 4 5 6 1 4370 227 2 2899 150 3 2498 130 4 2201 114 5 1933 100 6 1331 69 7 1150 60 8 759 39 .nih. 5). 3) En la Figura se muestra un gel semejante al obtenido en esta Práctica: plásmido recombinante pBluescript-cDNA(eIF4E) digerido (canales 2. Resultados y cuestiones 1) a) Buscar la secuencia de nucleótidos del cDNA del eIF4E de Drosophila melanogaster usado en esta práctica en la base de datos del NCBI (http://www. “for”: U16139). c) ¿Cómo buscaría vd el codón de iniciación de un mRNA que codifica una proteína eucariótica?. ¿Fue una digestión parcial o completa?. canales 3. la cantidad de DNA presente en las bandas correspondientes al cDNA(eIF4E) y al pBluescript linearizado resultantes de la digestión?. con ayuda del programa informático accesible en la dirección: http://tools. lo hará en las prácticas de Bioinformática de esta asignatura. Explique la respuesta. 5) (160 ng. d) ¿Podría vd estimar. c) ¿Puede vd deducir alguna conclusión al comparar la movilidad del plásmido recombinante no digerido con respecto a la movilidad de los dos DNAs linearizados?. ¿Esperaría vd encontrar una diana para EcoRI dentro de este cDNA?.php . 4 y 320 ng. b) Fíjese en la secuencia de aa de la proteína codificada y deduzca los codones de iniciación y terminación de la traducción usados.gov/ .neb. 2. 3) o sin digerir (canales 4.Construcción DNA recombinante 9 determinar la razón molar que usamos en este experimento y qué implicaciones tendrá en relación con los porcentajes de colonias bacterianas que se obtendrán conteniendo el plásmido recombinante y el plásmido recircularizado sin inserto. En su cuaderno de prácticas dibuje un esquema del resultado real obtenido en su mesa y conteste a las preguntas siguientes: a) ¿Hubo digestión del plásmido recombinante?.nlm.ncbi. ¿Por qué disminuye la cantidad de DNA presente en las bandas al disminuir el tamaño del fragmento?.com/NEBcutter2/index. ¿Podría aplicar el mismo criterio para un mRNA procariótico?. “search: nucleotide. marcadores de DNA de 29 digerido con HindIII (canales 1. de forma aproximada. Incubar a temperatura ambiente durante 60 minutos (normalmente la incubación se hace a 16ºC durante toda la noche). 2) Busque los mapas de los plásmidos pBluescript (Stratagene). Nota: El mapa de restricción de este cDNA. ¿Son los tamaños esperados?. 6) cuyos tamaños (en pb) y cantidades (en ng) se indican en la Tabla. y pRSET-T7 (Invitrogen) y explique de forma concisa en su cuaderno de prácticas las características que le parecen más significativas y útiles de los mismos.

6) En el laboratorio de prácticas hemos usado para la digestión 5 l de un stock 0. ¿cómo podría vd distinguir experimentalmente cada una de estas posibilidades?. El DNA precipitado se resuspendió en 20 l de agua estéril.2 kb). b) Por qué se recomienda que la proporción molar inserto/vector sea al menos 3/1 para una reacción de ligación?. c) Las preguntas anteriores tienen varias contestaciones posibles. c) ¿Cuántos nanogramos de pBluescript linearizado y de cDNA(eIF4E) estima vd que tenemos en los 20 l de disolución acuosa de DNA teniendo en cuenta el % de recuperación indicado?. b) ¿Y en una banda que migra más rápidamente?. Razone con detalle sus respuestas. se usaron 3 l para analizar los productos de la digestión y 22 l para la extracción con fenol/cloroformo seguida de precipitación con etanol. c) Escriba la secuencia diana de EcoRI. b) En el caso de que hubiésemos usado el pRSET como vector ¿con qué enzima de restricción lo hubiésemos digerido?. ¿Qué ventajas tienen este tipo de extremos para la clonación de fragmentos de DNA?. Explique la respuesta. b) ¿Cuántos nanomoles de pBluescript linearizado y de cDNA(eIF4E) hemos obtenido después de la digestión con EcoRI?.8 g/l de pBluescript-cDNA(eIF4E) (4.Construcción DNA recombinante 10 4) En el canal 5 de la Figura anterior. 5) a) ¿Por qué hemos tenido que usar EcoRI para hacer la digestión y no otra enzima de restricción?. La mayoría de estas bandas parece que han desaparecido en la muestra digerida correspondiente (canal 3). se vislumbran bandas minoritarias con menor o mayor movilidad electroforética que la del plásmido recombinante. 7) a) ¿Cuál es la proporción molar cDNA(eIF4E) / pBluescript que hemos usado en la reacción de ligación realizada en esta práctica?. 10 l) hemos usado 1 o 2 l de los 20 l de disolución acuosa de DNA. ¿Y nanogramos de estos dos DNAs?. que corresponde a una muestra en la que se puso un exceso de plásmido recombinante sin digerir. Finalmente. d) ¿Qué cantidad (en nanogramos) de DNA total estima vd que tendremos en la mezcla de DNA ligado?. c) ¿Qué otras dos estrategias se le ocurren para resolver los problemas que acaba de comentar?. ¿Y nanomoles?. De los 25 l de la mezcla de digestión. . a) ¿Qué tipo de DNA puede estar presente en una banda minoritaria que migra más lentamente que el plásmido recombinante sin digerir?. Suponga que durante todo el proceso anterior hemos recuperado solamente el 30% del DNA presente en los 22 l iniciales. Otros datos: la masa molar de 1 pb es 660 g/mol. en la reacción de ligación (volumen final. ¿Qué tipo de extremos genera esta enzima?. a) Calcule los nanomoles del plásmido recombinante pBluescript-cDNA(eIF4E) añadidos a la mezcla de digestión.

Natl. Este método requiere que el vector usado (por ejemplo.Transformación de bacterias 1 Práctica 2 CLONAJE DE GENES EN PLÁSMIDOS BACTERIANOS: Transformación de células competentes de Escherichia coli y selección de transformantes. En los plásmidos recombinantes. Consiste en exponer las células de E. Uno de los más conocidos es el de la complementación del fragmento  de la -galactosidasa. Todos los métodos químicos de transformación que se utilizan actualmente derivan de la observación de Mandel y Higa (1970. Acad. encaminadas a optimizar la eficiencia de transformación de cada cepa bacteriana. en células en fase activa de crecimiento. Las bacterias . USA 69. Las bacterias que contienen este tipo de plásmidos se pueden seleccionar creciéndolas en presencia de ampicilina. Los métodos actualmente en uso son variaciones del original. Proc. La ampicilina es una aminopenicilina con actividad antimicrobiana de amplio espectro. presente normalmente en el profago 80 o en F´). se han desarrollado métodos químicos y físicos que facilitan este proceso al menos en E.html Por otra parte.org/resources/animations/transformation2. el plásmido pBluescript pero no así el plásmido pRSET-T7) contenga el sitio de policlonaje dentro de la región codificante del fragmento y la bacteria hospedadora exprese el otro fragmento de la -galactosidasa necesario para la complementación (lacZM15. Este método se extrapoló posteriormente a DNA de plásmidos (Cohen et al. de entre los métodos físicos de transformación de bacterias podemos destacar la “electroporación”. 159-162) según la cual las bacterias tratadas en frío con una disolución de CaCl2. Sci. como por ejemplo E. inactivándola. que induce la formación transitoria de poros en las membranas por donde penetran las moléculas de DNA. coli a una descarga eléctrica. coli. 2110-2114). se hacen “competentes” y permiten la entrada del DNA del fago lambda. Para diferenciar las bacterias que han incorporado el plásmido recombinante de las que han incorporado el plásmido recircularizado sin inserto se pueden usar varios métodos. coli. 1972. La mayoría de las bacterias. Mol. 53.. Biol. Una posible explicación sobre el mecanismo molecular por el que las células se hacen “competentes” a la entrada de DNA exógeno lo puede ver en el siguiente enlace: http://www. Inhibe la síntesis del péptidoglicano. la incorporación del inserto inactiva el fragmento  de forma que las bacterias que contienen estos plásmidos carecen de actividad -galactosidasa. Los plásmidos que estamos usando en estas prácticas de clonaje (pBluescript o pRSET-T7) tienen el gen de resistencia a ampicilina (bla). constituyente de la pared bacteriana. J. Sin embargo. Este gen codifica una lactamasa que hidroliza el anillo -lactámico de la ampicilina. Introducción Para el clonaje y amplificación del plásmido recombinante preparado en la práctica anterior es necesario introducirlo en una bacteria mediante un proceso que se denomina “transformación”. y a continuación sometidas a un choque térmico a 42ºC.dnalc. las bacterias que no han incorporado el plásmido no crecerán en este medio de cultivo. Obviamente. originando colonias blancas en un medio de cultivo que contiene el sustrato incoloro X-GAL. son impermeables a la entrada de ácidos nucleicos exógenos en condiciones normales de crecimiento. que suele oscilar entre 106 a 109 transformantes por g de DNA plasmídico.

 Plásmido recombinante pBluescript-cDNA(eIF4E) sin digerir y diluido 1/80. Objetivos Preparación de bacterias “competentes” de E. coli. su transformación posterior mediante un choque térmico con los plásmidos obtenidos en la Práctica 1.  Placas de Petri con medio LB (Luria-Bertani) sólido CON AMPICILINA (0. y agua destilada hasta 1000 ml) SIN ampicilina.8 M) IPTG (isopropil-tio--D-galactósido).  E. coli XL1-Blue (ver características en www. Procedimiento A) Adición de IPTG y X-GAL a placas de Petri con medio LB + ampicilina 1. 3. Materiales Equipo y Materiales generales: ver Práctica 1 Otros materiales necesarios para la Práctica 2:  2% (p/v) X-GAL (5-bromo-4-cloro-3-indolil--D-galactósido) en dimetilformamida.  20% (p/v. 15g de bacto agar. Para cada mesa preparar en un tubo eppendorf de 1.1 mg/ml).com ) (1-2 placas de Petri con colonias/mesa).Transformación de bacterias 2 transformadas con plásmidos sin inserto aparecen como colonias azules en este medio pues son capaces de sintetizar -galactosidasa. el “premix” que se indica en la última columna de la tabla siguiente: Componente l / placa l / 15 placas (1 mesa) X-GAL (2%) 40 600 IPTG (20%) 7 105 Volumen final 47 705 . hielo). Para crecer la bacteria antes de la transformación. Para crecer bacterias transformadas.1 M CaCl2 estéril (2 botellas/mesa). Uno de estos clones se utilizará en la Práctica 3. 0.  Medio LB líquido (igual composición que el LB sólido pero sin agar y SIN ampicilina): Tubos de dilución con 2 ml de medio y matraces de 100 ml con 25 ml de medio.  Tubos Falcon de 50 ml (1/pareja). 5 g de extracto de levadura. Cada pareja marcará en la base sus 3 placas con el número de pareja seguido de 1. 10 g de NaCl. La tarde anterior al inicio de la práctica (día 1º) distribuir 3 placas de Petri conteniendo medio LB + ampicilina por pareja mas 2 placas por mesa.  Placas de Petri con medio LB (Luria-Bertani) sólido (10 g de triptona.  0. Las dos placas sobrantes se marcaran con el número de la mesa. respectivamente. Estas placas las utiliza el Profesor para crecer la bacteria usada en la transformación. 2. Mantener en frío (nevera.5 ml. 2. y selección de los clones bacterianos conteniendo específicamente el plásmido recombinante pBluescript-cDNA(eIF4E) de Drosophila melanogaster.stratagene.  Mezcla de ligación realizada en la Práctica 1.

La tarde anterior al inicio de la práctica (día 1º) cada pareja picará una colonia de bacterias E.1 M CaCl2 frío y después en 1. Decantar el sobrenadante rápidamente en la pila. 5.1 M CaCl2 frío usando la propipeta P1000. medir la A550 nm del cultivo. 4.5 ml de 0. Si no se usaran este día se guardarán en la nevera. Después de unos 20 min en hielo. transferir 0. Mezclar con suavidad con ayuda de la pipeta eliminando completamente todos los agregados de células.0 ml. Nota: En estas condiciones de crecimiento el número de bacterias duplica en unos 20 min. Parar el crecimiento cuando se alcance un valor 0. Notas: a) Dado que la centrifuga que disponemos en el laboratorio sólo tiene capacidad para 6 tubos Falcon de 50 ml. 2. marcar con el número de pareja e incubar en baño a 37ºC con fuerte agitación durante toda la noche. Sujetar el tapón del tubo con cinta aislante sin bloquear la entrada de aire al tubo.5 ml de esta última suspensión de bacterias. las bacterias se resuspenderían inicialmente en 10 ml de de 0. Resuspender las bacterias en 0. Poner 47 l del “premix” anterior en el centro de cada una de las placas de Petri y extender uniformemente con ayuda de un asa de plástico estéril. A la mañana siguiente (13:30-13:45 h). B) Crecimiento de Escherichia coli. Recuperar las bacterias por centrifugación a 5000 rpm durante 10 min.32. coli XL1-Blue de un placa de Petri conteniendo medio LB preparada recientemente y la transferirá a un tubo de dilución con tapón conteniendo 2 ml de medio LB (sin ampicilina). Dejar el tubo invertido sobre el papel de filtro durante 1 min con objeto de eliminar los restos de medio. C) Preparación de células competentes. 3. cada pareja recuperaría 0.1 M CaCl2 frío y mantener en hielo. 3. Tener cuidado de poner enfrentados los tubos que se han equilibrado previamente en parejas. Finalmente.Transformación de bacterias 3 3. 7. 1. congelar rápidamente y conservar a –70ºC siguiendo el protocolo siguiente: A 1 ml de bacterias añadir 35 l de DMSO (dimetilsulfóxido) y mezclar suavemente.5-0. Añadir otros 35 l de DMSO. mezclar y volver a poner en hielo. A las 15:30-15:45 h. poniendo el matraz con el cultivo en hielo. b) En el caso de que las bacterias competentes no se vayan a utilizar inmediatamente para la transformación se pueden dividir en alícuotas. Enfriar tubos eppendorf en hielo . Incubar con fuerte agitación en baño a 37ºC. se puede reducir el número de centrifugaciones a la mitad mezclando los cultivos crecidos de dos parejas en un tubo Falcon. y decantar de nuevo el sobrenadante como antes. Dejar secar las placas boca arriba y tapadas hasta el día siguiente. recuperar las bacterias por centrifugación a 5000 rpm durante 10 min.28-0. manteniendo la suspensión en hielo durante 15 min. En este caso.8 ml del cultivo crecido en cada tubo a sendos matraces de 100 ml conteniendo 25 ml de medio LB fresco precalentado a 37ºC. y el número de parejas por grupo es de 12. 2. 4. 6. 1. Resuspender las bacterias en 5 ml de 0. Equilibrar tubos de dos en dos con ayuda de una balanza/granatario. Transferir el cultivo enfriado a un tubo Falcon de 50 ml estéril y mantener en hielo.

Las alícuotas se mantienen congeladas a -70ºC.) conteniendo medio LB sólido CON ampicilina + IPTG + X-GAL preparadas el día anterior. 1. 4. Si la incubación se hace sin agitación.5 ml por pareja en hielo. . Extender uniformemente la suspensión de bacterias sobre la superficie de la placa con ayuda de un asa de plástico estéril (usar un asa distinta para cada placa). Detener el choque térmico transfiriendo los tubos a contenedores con hielo. Cuando se necesiten. Mantener en hielo durante 30 min agitando suavemente la suspensión de vez en cuando. Plaquear alícuotas de 100 l de cada uno de los tubos en las placas de Petri correspondientes (es decir. Preparar 3 tubos eppendorf de 1. Una vez secas. b) ¿Qué resultado esperaría vd encontrar si nos hubiésemos olvidado de añadir ampicilina al medio de cultivo?. 3. invertir las placas. Mantener las placas boca arriba y tapadas hasta que sequen bien. 2) ¿Para qué se crecen las bacterias en medio LB líquido sin ampicilina durante una hora antes de pasarlas al medio sólido que contiene ampicilina (+IPTG + X-GAL)?. Transferir los tubos a un bloque térmico a 42ºC y mantener 2 min. respectivamente. comprobar que están debidamente marcadas e incubarlas en estufa a 37ºC durante unas 24-36 horas. Resultados y Cuestiones 1) a) Busque las características de la cepa bacteriana usada en esta práctica e interprételas brevemente en su cuaderno. 3. etc. Marcarlos con el número de pareja y los números 1. etc. Añadir a cada tubo 500 l de medio LB SIN ampicilina e incubar a 37ºC con agitación intensa durante 1 hora. 2. conviene agitar las células a intervalos de tiempo para resuspenderlas. D) Transformación de las bacterias. descongelar el tubo con la mano y mantener en hielo durante 10 min. 2 y 3. 4. b) ¿Cuál le parece más imprescindible para la selección de clones recombinantes que hemos realizado en este experimento?. E) Crecimiento y selección de los transformantes.Transformación de bacterias 4 seco/etanol (o nitrógeno líquido) y poner alícuotas de 100-107 l de la suspensión de bacterias con DMSO en cada tubo. 3) a) ¿Por qué se crecen las bacterias durante toda la noche en un medio sólido con ampicilina?. Recoger las placas de la estufa y analizar los resultados: número y color de las colonias. Añadir a cada uno de ellos los componentes que se indican en la tabla siguiente: Componente Células competentes Mezcla ligación (práctica 1) pBluescript-eIF4E sin digerir (dilución 1/80) H2O estéril Tubo 1 100 l 2 l ---------- Tubo 2 100 l -------2 l ---------- ----------- Tubo 3 100 l ----------------2 l 2. tubo 1 a placa 1. 1. uniformidad de las colonias en la placa.

b) ¿Qué tipo de colonias (blancas o azules) aparecen mas frecuentemente en su placa 1?. 5) El método de selección de bacterias conteniendo plásmidos recombinantes basado en la complementación del fragmento  falla en ocasiones. ¿A qué se pueden deber estos resultados?. 7) ¿Podríamos hacer una estimación de la cantidad de DNA (plásmido recombinante + plásmido sin inserto) presente en la mezcla de ligación de la Práctica 1 usada en la transformación del tubo 1 observando los resultados de la placa 1?. d) ¿Para qué nos sirve el análisis de la placa de Petri número 3 procedente del tubo 3?.Transformación de bacterias 5 4) a) ¿Para qué usamos IPTG y X-GAL en el medio de cultivo?. 6) Determine la eficiencia de transformación (número de colonias/g de DNA) utilizando la placa de Petri número 2 procedente de la transformación con el plásmido recombinante pBluescript-cDNA(eIF4E) no digerido y diluido 1/80 (tubo 2) suponiendo que en esta placa ha obtenido 100 colonias. Explique su respuesta y haga los cálculos en su cuaderno de prácticas suponiendo que en esta placa ha obtenido 70 colonias. Interprete los resultados que vd ha obtenido en dicha placa. c) ¿De qué color son las colonias que aparecen en la placa 2?. observándose resultados contrarios a lo esperado: colonias azules de bacterias transformadas con el plásmido recombinante y colonias blancas de bacterias transformadas con el plásmido sin inserto. ¿Por qué?. . ¿Por qué?.

Poner 1. Introducción La aparición de colonias blancas en placas con ampicilina. NO DEJARLO MÁS DE 5 min. Materiales Además del material general descrito en la Práctica 1. . 250bp ladder Solución de carga de electroforesis conteniendo azul de bromofenol y xylene cyanol FF. 1% SDS). pues el DNA desnaturalizado es mucho más frágil que el nativo. Objetivos Los clones recombinantes seleccionados en presencia de ampicilina y de color blanco debido a la inactivación de la -galactosidasa.com/tbs/tb225/tb225. Tirar el sobrenadante. 1 mM EDTA.5. no garantiza que contengan el vector recombinante. como sería el caso de dímeros de vectores religados o la presencia de mutaciones en la -galactosidasa. si bien es un buen indicio.Resuspender en Vortex o con micropipeta el sedimento celular en 250 l de solución R (50 mM Tris-HCl pH 7. Bam HI y Kpn I. 10 mM EDTA. Recoger las células por centrifugación a máxima velocidad en minifuga 3 min. Todo ello se llevará a cabo mediante análisis de restricción del DNA plasmídico e identificación de los fragmentos resultantes por electroforesis en agarosa. ya que puede tratarse de falsos positivos.Lisar las células con 250 l de solución L (0.5 ml del cultivo crecido durante la noche en un tubo eppendorf.promega. . se crecerán en medio LB en presencia de ampicilina y se aislará el DNA plasmídico para su posterior análisis. Por esa razón es imprescindible. IPTG y X-gal con un asa de cultivo e inocular un erlenmeyer con 5 ml de LB conteniendo 100 µg/ml de ampicilina. El análisis estructural de los plásmidos recombinantes tiene un doble objetivo: 1) la identificación y confirmación de la presencia del inserto en los clones que contengan el vector y 2) la determinación de la orientación del mismo. Información suministrada por el fabricante en: www.2 M NaOH. escurrir el tubo boca abajo sobre papel de filtro. QUE NO QUEDEN GRUMOS. y sus correspondientes tampones. Observar el aumento de viscosidad. . mezclar suavemente por inversión.Erlenmeyer con 5 ml de medio LB conteniendo 100 µg/ml de ampicilina. . Una vez comprobada la presencia del inserto. hacer un análisis de los clones para comprobar la presencia del inserto digiriendo el DNA plasmídico con enzimas de restricción y analizando los fragmentos resultantes por electroforesis en gel de agarosa. .Práctica 3 CLONAJE DE GENES EN PLÁSMIDOS BACTERIANOS: Aislamiento de DNA plasmídico y análisis del mismo por digestión con enzimas de restricción. (dia 2) Coger una colonia blanca seleccionada de placas con ampicilina.pdf Para ello se seguirá el siguiente protocolo: .Para la electroforesis necesitamos: Agarosa Tampón TAE: 40 mM Tris-acetato. B) Aislamiento del DNA plasmídico (Miniprep). Los vectores de clonaje tienen secuencias flanqueantes al sitio de policlonaje complementarias a primers denominados universales. 100 g/ml RNasa A). Procedimiento A) Crecimiento de clones bacterianos. pues sirven para cualquier inserto. (dia 3) Al día siguiente se aislará el DNA plasmídico a pequeña escala por el método de la lisis alcalina utilizando el Kit comercial Wizard® Plus SV Minipreps (Promega). Crecer a 37°C con agitación durante la noche. en esta práctica utilizaremos: .Kit Wizard® Plus SV Minipreps (Promega). . GelRed DNA Molecular Weight Marker XVI. en algunas ocasiones hay que secuenciarlo para asegurarse que no contiene mutaciones.Enzimas de restricción Eco RI. después de la selección.

Bam HI y Kpn I. adaptado a un tubo colector. 60% etanol). devolverlo al tubo y centrifugar otra vez. El DNA plasmídico se distribuirá en tres tubos marcados E. Debemos coger CUANTO MAS SOBRENADANTE MEJOR PERO EVITANDO QUE NO CAIGA EL PRECIPITADO BLANCO. y cargar todas las muestras en el gel de electroforesis.Determinar la orientación del inserto. B y K para digerirlos con Eco RI. Eco RI y Kpn I. En estas condiciones el DNA plasmídico queda retenido en el filtro. Previamente dar dos o tres pulsos (centrifugación muy corta).Repetir el proceso lavando con 250 l de solución W. mezclar por inversión.7% (0.Extraer el plásmido del filtro con 60 l de agua sin nucleasas (H). . . respectivamente. .04 mM EDTA. . que queremos eliminar.En este paso hay que tener especial cuidado. . . asegurándose de que no tiene solución W. D) Separación de fragmentos de restricción por electroforesis en geles de agarosa (día 4) Los fragmentos obtenidos en las digestiones enzimáticas se analizarán por electroforesis análogamente a como se describió en la práctica 1 Procedimiento B). 250bp ladder). con un volumen total de 20 µl. Aparecerá un abundante precipitado blanco correspondiente al DNA bacteriano. según el siguiente protocolo en el que cada enzima se incuba con su propio tampón recomendado por el fabricante para optimizar la digestión: tubo DNA Tx10 enzima plasmídico E 17 µl 2 µl TE 1 µl E B 17 µl 2 µl TB 1 µl B K 17 µl 2 µl TK 1 µl K Los tubos. Cargar en un extremo. . 2. utilizando el peine de 15 pocillos.Centrifugar 1 min el material del filtro adaptado al tubo colector. NO DEJARLO MÁS DE 5 min. Repetir el proceso. E) Análisis y discusión de los resultados. . . Transferir cuidadosamente por decantación o con micropipeta el sobrenadante claro conteniendo el DNA plasmídico al filtro suministrado en el Kit. La tapa la guardaremos para después de las centrifugaciones.3 mM Tris-HCl. se incubarán a 37ºC al menos durante 1 h. lavar el filtro con 750 l de solución W (8. mezclar por inversión. 60 mM acetato potásico. Dejar unos instantes y dar dos o tres pulsos antes de centrifugar 1 min. El filtro no se tapa.759 M acetato potásico. . centrifugar 2 min.Calcular.Vaciar el tubo colector.Degradar las proteínas del lisado con 10 l de solución P (proteasa alcalina). 0. el tamaño de los fragmentos obtenidos tras la digestión con las distintas enzimas de restricción.Correr el gel a 100V. . 18 µl de marcadores de tamaño (Molecular Weight Marker XVI. a partir de la posición de las bandas en el gel.Añadir 4 µl de solución de carga a las muestras correspondientes a las digestiones enzimáticas.12 M acido acético).Poner el filtro. hasta que el azul de bromofenol esté a 1/3 del final del gel. . en un eppendorf nuevo al que previamente habremos cortado la tapa.Preparar un gel de agarosa de 70 ml al 0.49 gr) en TAE 1X. . centrifugar 1 min. . visualizarlo al ultravioleta. 0. Añadir a la agarosa fundida 2 l de GelRed. En caso de que esto ocurra.09 M hidrocloruro de guanidina. pues la fuerza centrífuga impide que se salga el líquido. C) Análisis de restricción del plásmido: El análisis se realizará mediante digestión con tres enzimas de restricción: Bam HI.Neutralizar con 350 l de solución N (4. pues es el más crítico..Centrifugar 10 min. .

determinar: a) el nº de aminoácidos de la proteína. . 6) Teóricamente el inserto se podría colocar en cualquier orientación. diseña un primer de 10 nucleótidos para obtener por mutagénesis dirigida el cambio Arg7-Ser. Teniendo en cuenta la fase de lectura y el código genético. b) la secuencia de los 5 aminoácidos N-terminales. y detalla el procedimiento a seguir en el clonaje. sin embargo en el análisis de los recombinantes mayoritariamente se obtiene una. 7) Diseña los primers para insertar de forma unidireccional (empleando dos enzimas distintas) el cDNA de eIF-4E en el plásmido pBluescript IIKS. Bam HI y Kpn I (ver Apéndice.Cuestiones 1) Deducir el número y tamaño de los fragmentos obtenidos tras la digestión con Eco RI. considerar despreciable el tamaño del sitio de policlonaje). ¿Qué condiciones deben cumplir las enzimas seleccionados?. 2) ¿Con qué otros enzimas podríamos determinar la orientación del inserto? (ver Apéndice) 3) Buscar en el Apéndice la secuencia codificante del eIF-4E (primer ATG). 4) Con los datos obtenidos en la cuestión 3. En caso negativo a) ¿Cuántos aminoácidos tendría la proteína de fusión resultante?. ¿Podrías proponer una hipótesis para explicar este resultado?. 5) Determinar si en el recombinante con la orientación correcta el gen de la proteína eIF-4E está en fase con el de la -galactosidasa (ver Apéndice). c) la secuencia de los 5 aminoácidos C-terminales. b) ¿Cómo se podrían poner en fase el gen de la -galactosidasa y el cDNA del F-4E ?.

permite detectar cantidades minúsculas de RNA. Utilizando agentes intercalantes fluorescentes podemos monitorizar la amplificación en tiempo real y. En algunas ocasiones no existe una total complementariedad. Si la elongación se efectúa con una DNA polimerasa termoestable. la desnaturalización de los productos elongados y la repetición cíclica del proceso permite una enorme amplificación de la secuencia inicial. Esta amplificación se lleva a cabo mediante una serie de ciclos. nuevamente para mayor estabilidad. marcadas una de color rojo y otra azul. obteniéndose múltiples productos. vulgarmente conocida como prueba del ADN). de ahí que. En primer lugar es esencial la elección de los primers. que han de hibridar con una secuencia única. esta técnica. Los mejores resultados se obtienen con primers distantes entre si. generalmente 30. La reacción en cadena de la polimerasa es la técnica estándar para la amplificación de un fragmento de DNA incluido en un DNA molde. En esta práctica se explicarán las bases teóricas de la técnica y se indicarán los parámetros a tener en cuenta para el diseño de los primers de la reacción. Los campos de aplicación de la PCR son enormes. si se amplificasen fragmentos de mayor tamaño debe aumentarse dicho tiempo. unos 5-10°C por debajo de su temperatura de fusión (Tm). donde el nucleótido cambiado. se le concediera el Premio Nobel en 1993. Otro paso importante a tener en cuenta es el tiempo de extensión empleado. lo que se logra con un tamaño suficientemente largo (20-25 nts). la deleción o inserción presente en el primer. aunque existían precedentes. dado que la mayoría de las DNA polimerasas elongan en un minuto alrededor de 1 Kb de DNA. RT-PCR (reverse transcripcion PCR) de amplia utilización. Kary Mullis. éstos son solo algunos ejemplos: en investigación es una herramienta imprescindible de uso cotidiano. por el contrario una temperatura demasiado baja podría dar lugar a hibridaciones inespecíficas con secuencias similares. utilizando oligonucleótidos de secuencia única (primers) complementaria a ambos lados del fragmento que se desea amplificar. 2) Hibridación de los primers y 3) . de 100 a 500 nucleótidos. la hibridación de unos primers flanqueantes a la secuencia a amplificar y su posterior elongación. objetivo de esta práctica. pruebas de paternidad y aplicaciones forenses. . Otro parámetro crucial es la temperatura de hibridación de los primers. la detección de agentes infecciosos. debe colocarse en el centro de la secuencia.PRÁCTICA 4 DETECCIÓN DE AGENTES INFECCIOSOS POR PCR (REACCIÓN EN CADENA DE LA POLIMERASA) Introducción Pocos avances en genética molecular han tenido tantos campos de aplicación como la PCR (reacción en cadena de la polimerasa. con DNAs de concentración conocida utilizados como estándar determinar la concentración inicial de nuestra muestra. y a ser posible con pares GC en sus extremos para una mayor estabilidad. La idea es muy simple. la mutagénesis dirigida mencionada antes. A pesar de su simplicidad hay ciertos parámetros que hay que tener muy en cuenta para una correcta amplificación. Igualmente se puede amplificar una secuencia de RNA utilizando previamente la transcriptasa inversa para copiarla a DNA. Objetivos El objetivo de esta práctica es el aprendizaje de la técnica de la PCR y su aplicación en la detección de agentes infecciosos. la PCR cuantitativa permite determinar la concentración inicial de un DNA (qPCR) ó un RNA (qRT-PCR) en una muestra. Una temperatura demasiado alta daría lugar a una pobre amplificación. una infectada con el virus y otra no. 1012 veces después de 40 ciclos. no han de presentar complementariedad inter o intra-molecular. a quien la desarrolló en su forma actual. En este caso el agente infeccioso es un peligroso virus que contamina unas muestras de agua (en realidad esto es una simulación. como es el caso de la mutagénesis dirigida. cada uno de los cuales consta de tres etapas: 1) Desnaturalización del DNA. tanto de identificación de restos biológicos como de pruebas criminalísticas. si la roja o la azul. Se suministrarán dos muestras. pues el virus utilizado es el bacteriófago Ø29 que infecta a Bacilus subtillis y por tanto totalmente inocuo). La PCR no solo sirve para amplificar una secuencia. diagnosis de enfermedades o riesgo potencial de padecerlas. Tms similares. y mediante esta técnica se determinará cuál de las muestras está infectada. permite la duplicación de su secuencia.

dTTP. Los controles son dos: uno positivo con DNA viral. . Cada pareja deberá poner 18 l de mezcla de reacción en 2 tubos Eppendorf de 0.Preparar las mezclas de reacción para las muestras control y problema. Procedimiento A) Preparación de las mezclas de reacción (día 3) . dTTP.5 mM dNTPs 2. dGTP. Taq polimerasa. El desarrollo de la PCR está basado precisamente en el descubrimiento de esta polimerasa.4 min de desnaturalización previa a 94°C . para comprobar que todo se ha realizado correctamente y uno negativo sin él. Materiales - DNA de virus 4 dNTP Taq polimerasa Tampón de reacción de PCR (Tris-HCl 100 mM. KCl 500 mM) MgCl2 Primers Termociclador El material necesario para la electroforesis se describe en la práctica 3. DNA molde del virus infeccioso (control positivo) o H20 (control negativo). pH 8. a diferencia de las previamente conocidas. MgCl2.3. cada uno consistente en:  60 sec-desnaturalización a 94°C  60 sec-reanillamiento a 59°C  60 sec-extensión a 72°C . Adicionalmente una pareja de cada mesa añadirá 2 l de H20 como control negativo. CERRAR BIEN LOS TUBOS y ponerlos en el termociclador B) Programación del termociclador y realización de la PCR Programar el termociclador. teniendo en cuenta las concentraciones inicial y final de cada uno de los reactivos utilizados. es termoestable y actúa a altas temperaturas.Extensión mediante el uso de la enzima Taq polimerasa (u otra DNA polimerasa de características similares). que. a partir del protocolo indicado.10 min de extensión a 72°C En la práctica el termociclador está ya previamente programado.30 ciclos de amplificación. dNTPs: dATP. -Componentes: Muestra problema.2 ml numerados (pequeños de 200 µl. Si los controles son correctos se determinará si nuestra muestra problema está contaminada o no. Tampón de reacción (10X): Tris-HCl 100 mM. Primers: GCCCACATACTTTGTTGATTGG AAAGTAAGCCCCCACCCTCACATG Para ello se seguirá el siguiente protocolo: Mezcla de reacción Concentración Stock Concentración final Tampón de la reacción 10X 1X MgCl2 25 mM 2. añadiendo 2 l de muestra problema (tubo rojo o azul) a uno y 2l (20 ng) de DNA molde (10 ng/l) como control positivo a otro. pH 8. pues de lo contrario no caben en el termociclador). KCl 500 mM . para comprobar que no ha habido ninguna contaminación en los reactivos empleados.5 µM (cada uno) Taq polimerasa 5U/µl 1U Se preparará una única mezcla de reacción para toda la mesa (10 tubos). Calcular el volumen que hay que añadir de cada uno de los componentes para un volumen final de 200 µl completando con H20 hasta 180 µl. de acuerdo a las siguientes condiciones: .3.5 mM (cada uno) 250 µM (cada uno) Primers 5 µM (cada uno) 0.

está contaminada Cuestiones 1) Calcular la Tm de los primers utilizados (ver la fórmula en el guión de prácticas). la simplicidad de la fórmula es útil para tener un valor aproximado. . utilizando el peine de 15 pocillos. Procedimiento B). C) Análisis de los productos de PCR mediante electroforesis en geles de agarosa. ¿ A partir de qué ciclo se obtienen fragmentos de DNA de doble banda del tamaño requerido? 5) En algunos casos. c) hay un solo corte en banda simple en el DNA molde entre los primers. En un extremo cargar 18 µl de marcadores de tamaño (DNA Molecular Weight Marker XVI. (día 4) Análogo a lo descrito en la práctica 3.-Una vez finalizados los ciclos las muestras se mantienen a 4ºC hasta su posterior análisis. hasta que el Azul de Bromofenol esté a la mitad del gel. Cargándose distintas cantidades de DNA de los mismos marcadores (M) (60ºC>58ºC y 55ºC>52ºC). d) hay un solo corte en banda doble en el DNA molde entre los primers. Razona la temperatura de reanillamiento que utilizarías. Interpreta estos resultados. b) uno de los primers hibrida en varios sitios del DNA molde. .Preparar un gel de 70 ml de agarosa al 1% (0. -Comprobar que el DNA viral se ha amplificado correctamente (control positivo). así la muestra de 60ºC se corrió más que la de 55ºC y ésta más que la de 52ºC. 4) Razonar cuál sería el resultado en una electroforesis de PCRs realizadas en las siguientes condiciones: a) se te olvida añadir uno de los primers a la mezcla de reacción. . . 3) Diseñar los primers (20 nucleótidos) para amplificar 400 pb del extremo izquierdo del DNA del virus (ver Apéndice).Determinar cuál de las muestras. La Tm se calcula por la fórmula Tm=(G+C)x4+(A+T)x2.Correr el gel a 100V.Añadir 4 µl de solución de carga a cada uno de los tubos y cargar la totalidad de las muestras en los pocillos del gel de electroforesis. se observa una banda difusa de mayor movilidad.7 gr) en TAE 1X. visualizar el gel al ultravioleta. D) Análisis de los resultados -Comprobar que la mezcla de reacción no está contaminada (control negativo). 2) Calcular el tamaño del DNA amplificado por PCR a partir de la secuencia del extremo del DNA de Ø29 (ver Apéndice) y las secuencias de los primers utilizados (ver guión de prácticas). Añadir a la agarosa fundida 2 l de GelRed. Procedimiento D) y práctica 1. Los tiempos de desnaturalización. e) si se desea amplificar solo una zona incluida en un DNA de mayor longitud. . Las electroforesis se corrieron durante tiempos distintos. Una vez concluida la misma. 250bp ladder). sobre todo cuando la PCR ha fallado. ¿A qué puede corresponder esta banda? 6) La figura muestra los resultados obtenidos en cuatro PCRs realizadas a las temperaturas de reanillamiento indicadas. la roja o la azul. reanillamiento y extensión varían según el termociclador y las muestras utilizadas . aunque no es muy exacto.

posición de la diana y tamaño de los fragmentos generados. G o C y= C o T . pero están en el fragmento al estar originado por digestión con EcoRI Sitios únicos de restricción. Enzyme Site <-. --> Eag I c/ggccg HgiE II accnnnnnnggt Sty I c/cwwgg EcoO109 I rg/gnccy PpuM I rg/gwccy BsmA I gtctc 1/5 Cfr10 I r/ccggy Nae I gcc/ggc Fsp I tgc/gca BspH I t/catga Asp718 g/gtacc Ban I g/gyrcc Kpn I ggtac/c Rsa I gt/ac Pvu I cgat/cg PflM I ccannnn/ntgg BstN I cc/wgg EcoR II /ccwgg ScrF I cc/ngg Gsu I ctggag 16/14 Xcm I ccannnnn/nnnntgg Bgl I gccnnnn/nggc Hae I wgg/ccw Stu I agg/cct Bgl II a/gatct BstY I r/gatcy EcoR V gat/atc Drd I gacnnnn/nngtc Ban II grgcy/c Bsp1286 I gdgch/c Mme I tccrac 20/18 Mae II a/cgt Cla I at/cgat Rsr II cg/gwccg 160 243 310 316 316 327 372 372 388 418 439 439 439 440 452 460 466 466 466 518 664 706 718 718 739 739 782 900 917 917 921 925 932 978 161 244 311 317 317 328 373 373 389 419 440 440 440 441 453 461 467 467 467 519 665 707 719 719 740 740 783 901 918 918 922 926 933 979 1043 960 893 887 887 876 831 831 815 785 764 764 764 763 751 743 737 737 737 685 539 497 485 485 464 464 421 303 286 286 282 278 271 225 claves r=A o G w= A o T n= A. enzima. T.APENDICE cDNA de eIF-4E (nº acceso U16139) AATTCGCTCTCTCGCACACACACGCACCAACCAACTATCAACTATCACAAACA CCGCGACAGAGAGAGAGCGGCAAGTGAATCACGGCGAATCGAAACCGATC CGAACCCACTCCGGAGCCGAAAAAGAACTGATCCTACCATCAAACGCATCC AATAAACACGGCCGCCAACATGCAGAGCGACTTTCACAGAATGAAGAACTT TGCCAATCCCAAGTCCATGTTCAAAACCAGCGCCCCCAGCACCGAGCAGGG TCGTCCGGAACCACCAACTTCGGCTGCAGCGCCCGCCGAGGCTAAGGATGT CAAGCCCAAGGAGGACCCACAGGAGACTGGTGAACCAGCAGGCAACACTG CAACCACTACTGCTCCTGCCGGCGACGATGCTGTGCGCACCGAGCATTTATA CAAACACCCGCTCATGAATGTCTGGACGCTGTGGTACCTTGAAAACGATCG GTCCAAGTCCTGGGAGGACATGCAAAACGAGATCACCAGCTTCGATACCGT CGAGGACTTCTGGAGCCTATACAACCACATCAAGCCCCCATCAGAGATCAA GCTGGGTAGTGACTACTCGCTATTCAAGAAGAACATTCGTCCCATGTGGGA GGATGCAGCCAACAAACAGGGCGGTCGTTGGGTCATTACCCTTAACAAAAG CTCCAAGACCGATCTGGATAACCTATGGCTCGATGTGCTGCTCTGCCTGATT GGCGAGGCCTTCGATCACTCCGATCAGATCTGCGGCGCTGTTATAAACATTC GCGGCAAGAGCAACAAGATATCCATCTGGACTGCCGACGGAAACAACGAG GAAGCTGCCCTTGAGATTGGTCACAAGCTGCGCGATGCCTTGCGTCTGGGA CGCAACAACTCGCTGCAGTATCAGTTGCACAAGGACACGATGGTCAAGCAG GGCTCCAACGTGAAATCGATCTACACTTTGTAGGCGGCTAATAACTGGCCG CTCCTTACTCGGTCCGATCCCACACAGATTAGTTTGTCTTTCATTTATTTATC GTTATAAGCAACAGTAGCGATTAATCGTGACTATTGTCTAAGACCCGCGTA ACGAAACCGAAACGGAACCCCCTTTGTTATCAAAAATCGGCATAATATAAA ATCTATCCGCTTTTTGTAGTCACTGTCAATAATGGATTAGACGGAAAAGTAT ATTAATAAAAACCTACATTAAAACCGG NOTA: las dos primeras As no aparecen en la secuencia del banco de datos.Pos.

250bp ladder) TCCGTCGATC ATAGACCTAC TAGCGCTTCG TTGACAACCA CACATGACAA TGTCAAACAT TTAGATGGAC .TTT TTC TTA TTG phe phe leu leu F F L L TCT TCC TCA TCG ser ser ser ser S S S S TAT TAC TAA TAG tyr Y tyr Y STOP STOP TGT TGC TGA TGG cys C cys C STOP trp W CTT CTC CTA CTG leu leu leu leu L L L L CCT CCC CCA CCG pro pro pro pro P P P P CAT CAC CAA CAG his his gln gln H H Q Q CGT CGC CGA CGG arg arg arg arg R R R R ATT ATC ATA ATG ile ile ile met I I I M ACT ACC ACA ACG thr thr thr thr T T T T AAT AAC AAA AAG asn asn lys lys N N K K AGT AGC AGA AGG ser ser arg arg S S R R GTT GTC GTA GTG val val val val V V V V GCT GCC GCA GCG ala ala ala ala A A A A GAT GAC GAA GAG asp asp glu glu D D E E GGT GGC GGA GGG gly gly gly gly G G G G Secuencia del extremo izquierdo del DNA del fago Ø29 (nº acceso V01121) 1 61 121 181 241 301 361 421 AAAGTAAGCC CTCGGCATAC TAGATAGGTT TCTGTGTCGC ATCAACAAAG TGGAAGTACC TAATAGTTAA TC CCCACCCTCA CATGATCAGG TGTCAATGAA ATGTAAAAGG TATGTGGGCT GTACCATTGA TTCTCCCATT CATGATACCA GAGGGAAACT CAACATAAAA TTATCAAAGT GAACTCAATC TACTACCATT CTAAAACGAT TTCTCCTAAT ACTACTTAAT CGACACAGAA AGCGTGCACT AGGGTTTAAT ATAGCATACT TTGATCGTTT ATCGACATAA ATATCAATCT TCCCACGTTT TTTGCCATGA CCCCAACATA CTGTAATAGT ATTTCTACAA Marcadores de tamaño (Roche DNA Molecular Weight Marker XVI.