You are on page 1of 3

11/12/2016

Addgene:PlasmidCloningbyPCR(withProtocols)

PlasmidCloningbyPCR
Summary
PCRbasedcloningisincrediblyversatileandallowsfornearlyanypieceofDNAtobeplacedintoabackbone
vectorofchoicewithminimallimitations.

Background
Initssimplestform,PCRbasedcloningisaboutmakingacopyofapieceofDNAandatthesametimeadding
restrictionsitestotheendsofthatpieceofDNAsothatitcanbeeasilyclonedintoaplasmidofinterest.

Youmayalsolike...
RestrictionDigestof
PlasmidDNA
DNALigation
BacterialTransformation

Forthisexample,wewilldescribehowtocopyacDNAfromonevectorintoanewvectorthatisbettersuitedfor
analyzingthegenesfunction.Theprocessisshowngraphicallyinthefollowingcartoon,inwhichweareadding
EcoRIandNotIsitestoYourGeneofInterest(YGOI)forligationintoarecipientplasmid.

DesigningprimersforPCRbasedcloning:
ThebasicPCRprimersformolecularcloningconsistof:
LeaderSequence:Extrabasepairsonthe5'endoftheprimerassistwithrestrictionenzymedigestion(usually36bp)
RestrictionSite:Yourchosenrestrictionsiteforcloning(usually68bp)
HybridizationSequence:Theregionoftheprimerthatbindstothesequencetobeamplified(usually1821bp)
Whenselectingrestrictionsites,youshoulduseaDNAanalysistool,suchasAddgenesSequenceAnalyzer,toallowyoutoidentifywhichrestriction
sitesarepresentinagivensequence.Youwanttochooseenzymesthat:
Donotcutwithinyourinsert
Areinthedesiredlocationinyourrecipientplasmid(usuallyintheMultipleCloningSite(MCS)),butdonotcutelsewhereontheplasmid
Bonus:Itishelpfultochooserestrictionenzymesthatcanbothfunctioninthesamebuffer,asthiswillsavetimelater
Inourexample,wewilluseEcoRIandNotItoligateourcDNAintotherecipientplasmid.RemembertoinsertyourDNAinthecorrectorientationin
therecipientplasmidbyviewingtheMCSandfusingtheupstreamrestrictionsitetotheforwardprimerandthedownstreamrestrictionsitetothe
reverseprimer.
Next,weneedtoexaminetheDNAsequencethatwewanttoamplifyanddesignprimersthatwillbindtoandreplicateit.Thefollowingimageshows
theendsoftheORFandhowtheseareusedforprimerdesign:

http://www.addgene.org/plasmidprotocols/pcrcloning/

1/3

11/12/2016

Addgene:PlasmidCloningbyPCR(withProtocols)

BecausewearecloninganORF,wewanttoclonefromthestartcodon(ATG)tothestopcodon(TGA,inthisexample).Assumingyouare
amplifyingfromplasmidDNA(ratherthanfromgenomicDNAoracDNAlibrary),roughly1821bpisusuallysufficienttogivespecificityandtoalso
becompatiblewithastandardPCRreaction(seePCRVideo).Therefore,ourForwardPrimerwillusethesequence5'
ATGTGGCATATCTCGAAGTAC3'fortheregionthatbindstheORFandwewilladdtheEcoRIrestrictionsite(GAATTC)tothe5endofthisprimer,
makingourForwardPrimer5'GAATTCATGTGGCATATCTCGAAGTAC3'.
ManyrestrictionenzymesdonotcutDNAefficientlyattheendofalinearpiece(seeNEBformoreinformation).Thus,werecommendthatyouadd
36basesupstreamofyourrestrictionsitetoimprovecuttingefficiency.Youcangenerallyaddany6bases,butyoushouldensurethatthebasesdo
notresultintheformationofahairpinstructurewithinyourprimer.Inourcase,wewilladdTAAGCA,resultinginafinalForwardPrimersequenceof
5'TAAGCAGAATTCATGTGGCATATCTCGAAGTAC3'.
FortheReversePrimer,thedesignissimilar,butweneedtousethereversecomplementtogetPCRamplification.Wecanstartsimilarly,takingthe
final18basesoftheORF,includingthestopcodon(5'TGGCATATCTCGAAGTACTGA3'),thenaddingNotI(GCGGCCGC)andthenTAAGCAto
improverestrictionenzymedigestion.Thisgivesusasequenceof5'TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA3'(30bpwith18bpof
homologytotheORF).WenowneedtogeneratethereversecomplementofthissequencesothatwecansuccessfullyamplifytheORF.Youcan
generatethereversecomplementusingexistingsoftware(aquickinternetsearchwillleadyoutohereandmanyothers).Ifweputthesequencewe
choseforourreverseprimer(5TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA3)intothiscalculatorwegetafinalReversePrimer
sequenceof5TGCTTAGCGGCCGCTCAGTACTTCGAGATATGCCA3.

ExperimentalProcedure

RunPCRandpurifythePCRproduct:
RunPCRtoamplifyyourinsertDNA.Itisimportanttouseahighfidelitytaqpolymerasetominimizemutations.Thefidelityofthepolymerase
becomesmoreimportantthelongertheexpectedPCRproductis.Youshouldselectanannealingtemperaturebasedonthemelting
temperature(Tm)oftheportionoftheprimerthathybridizestothesequencetobeamplified(theORFinthiscase),nottheTmoftheentire
primer.Ifyouareamplifyingfromaplasmidorsimpletemplate,thereisverylittlechanceformispriming,soyoucanuseaprettywiderangeof
annealingtemperatures,butyoumayneedtoincreaseyourprimerlengthandincreasetheTmifyouaretryingtoclonefromgenomicDNA,a
cDNAlibrary,orbyRTPCR.
IsolateyourPCRproductfromtherestofthePCRreactionusingakit,suchastheQIAquickPCRPurificationKit.ThePCRproductisnow
readyforrestrictiondigestion.

DigestyourDNA:
SetuprestrictiondigestsforyourPCRproductandrecipientplasmid.BecauseyoulosesomeDNAduringthegelpurificationstep,itis
importanttodigestplentyofstartingmaterial.WerecommendusingyourentirePCRreactionand1gofrecipientplasmid.Itisalsocriticalthat
asmuchoftherecipientplasmidaspossiblebecutwithbothenzymes,andthereforeitisimportantthatthedigestgoesatleast4hoursandas
longasovernight.
Ifyouaregoingtouseonlyonerestrictionenzyme,orenzymesthathavecompatibleoverhangsornooverhangsafterdigestion,youwillneed
touseaphosphatasetopreventrecircularizationofthevector.Youshouldtreatyourdigestedrecipientvectorwithaphosphatasepriortothe
ligationsteporpriortothegelpurificationstep,dependingonthephosphataseyouchoose.CIP(calfalkalinephosphatase)orSAP(shrimp
alkalinephosphatase)arecommonlyused.Followthemanufacturersinstructions.

Isolateyourinsertandvectorbygelpurification:
http://www.addgene.org/plasmidprotocols/pcrcloning/

2/3

11/12/2016

Addgene:PlasmidCloningbyPCR(withProtocols)

RunyourdigestDNAonanagarosegelandconductagelpurificationtoisolatetheDNA.Whenrunningagelforpurificationpurposesitis
importanttohavenicecrispbandsandtohavespacetocutoutthebands.Becauseofthiswerecommendthatyouuseawidegelcomb,run
thegelontheslowerside,andskiplanesbetweensamples.InadditiontoaDNAladderstandard,itisalsoagoodideatorunanuncutsample
ofeachvectortohelpwithtroubleshootingifyourdigestsdontlookasyouexpected.
WhencloningbyPCR,itisespeciallyimportanttoruntheproductonagel.ThisallowsyoutovisualizethatyourPCRproductistheanticipated
sizeandthatyourbandisstrong(indicatingthatthePCRreactionworkedandthatyouhaveasufficientamountofDNA).
Onceyouhavecutoutandpurifiedyourinsertandvectorbandsawayfromthegel,itisimportanttodeterminetheconcentrationofrecovered
DNA.

Ligateyourinsertintoyourvector:
ConductaDNALigationtofuseyourinserttoyourrecipientplasmid.
Werecommendaround100ngoftotalDNAinastandardligationreaction.Youideallywantarecipientplasmidtoinsertratioofapproximately
1:3.Sincethenumberofbasepairsforeachvaries,itisdifficulttocalculatethisbasedonDNAconcentrationalone.Onemethodistoconduct
2ligationsforeachplasmidyouaretryingtocreate,withvaryingratiosofrecipientplasmidtoinsert.
Itisalsoimportanttosetupnegativecontrolsinparallel.Forinstance,aligationoftherecipientplasmidDNAwithoutanyinsertwilltellyouhow
muchbackgroundyouhaveofuncutorselfligatingrecipientplasmidbackbone.

Transformation:
Proceedwiththetransformationaccordingtothemanufacturersinstructionsforyourcompetentcells.
Formoststandardcloning,youcantransform12lofyourligationreactionintocompetentcellssuchasDH5alphaorTOP10.Ifusingmuch
lesstotalDNA(<1ng)orifyouarehavingtroublegettingcolonies,youmightwanttousehighercompetencycells.Additionally,ifyourfinal
productisgoingtobeverylarge(>10kb)youmightwanttouseelectrocompetentcellsinsteadofthemorecommonchemicallycompetent
cells.
Thenumberofbacterialcoloniesresultingfromyourtransformationwillgiveyouthefirstindicationastowhetheryourtransformationworked.
Yourrecipientplasmid+insertplateshouldhavesignificantlymorecoloniesthantherecipientplasmidaloneplate.Therecipientplasmidalone
controlwilltellyouyourbackgroundlevelormorespecificallyitwilltellyouhowmanycoloniesyoucanexpectonyourrecipientplasmid+
insertplatethatarenotcorrect.
Ifyouhaveahighnumberofcoloniesonyourrecipientplasmidaloneplate,youcantryligatingtherecipientplasmidaloneinthepresenceand
absenceofligase.Ifthecoloniesarearesultofuncutemptyplasmid,youwillstillhavecolonieswhenyoudonotaddligase.Ifthecoloniesare
aresultofrecipientplasmidselfligation,youwillseesignificantlymorecolonieswhenyouaddligase.
Ifyoudonotseeanycolonies,youshouldconductapositivecontroltoensurethatyourtransformationworked.Youcouldalsotryvaryingthe
amountofrecipientplasmidtoinsert.

IsolatetheFinishedPlasmid:
Finally,youwillneedtopickindividualbacterialcoloniesandcheckthemforsuccessfulligations.Pick310coloniesdependingonthenumber
ofbackgroundcoloniesonyourcontrolplate(themorebackground,themorecoloniesyouwillneedtopick)andgrowovernightculturesfor
DNApurification.
AfterpurifyingtheDNA,conductadiagnosticrestrictiondigestof100300ngofyourpurifiedDNAwiththeenzymesyouusedforthecloning.
Runyourdigestonanagarosegel.Youshouldseetwobands,onethesizeofyourvectorandonethesizeofyournewinsert.

VerifyyourPlasmidbySequencing:
PCRbasedcloningcarriesamuchhigherriskformutationthanrestrictionenzymebasedcloning.DNAreplicationbyPCRhaserrorratesthat
rangefromroughly1per500bptoroughly1per10millionbpdependingonthepolymeraseused.Becauseofthis,nomatterwhichtaq
polymeraseyouuse,itisimportantthatyousequencethefinalproduct.
ReferencePage|Top|Index

http://www.addgene.org/plasmidprotocols/pcrcloning/

3/3