You are on page 1of 500

SCIENTIFIC VETERINARY INSTITUTE „NOVI SAD“

INSTITUTE OF VETERINARY MEDICINE OF SERBIA

„One Health – New Challenges“

First International Symposium of
Veterinary Medicine
(ISVM2015)

PROCEEDINGS

Hotel "Premier Aqua" - Vrdnik
May 21 – 23, 2015

First International Symposium of Veterinary Medicine – ISVM2015

Publisher
Scientific Veterinary Institute „Novi Sad“, Novi Sad, Serbia

For the Publisher
Prof Dr Miroslav Ćirković, Principal Research Felow

Editor in Chief
Dr Tamaš Petrović, Senior Research Associate

Technical Editor
Dr Tamaš Petrović, Senior Research Associate

Printed by
Multidizajn, Novi Sad

250 copies
Novi Sad, 2015
ISBN: 978-86-82871-36-1

1

First International Symposium of Veterinary Medicine – ISVM2015

ORGANISERS
SCIENTIFIC VETERINARY INSTITUTE „NOVI SAD“
and
INSTITUTE OF VETERINARY MEDICINE OF SERBIA

CO-ORGANISERS and SUPPORTERS
MINISTRY OF EDUCATION SCIENCE AND TECHNOLOGICAL DEVELOPMENT
PROVINCIAL SECRETARIAT FOR SCIENCE AND TECHNOLOGICAL DEVELOPMENT
MINISTRY OF AGRICULTURE AND ENVIRONMENTAL PROTECTION

GENERAL SPONSOR

FISH Corp.2000 d.o.o.
SPONSORS
GLOBOS Osiguranje a.d.o.
NOACK
ALEA I.A.
SANO

ORGANIZING COMMITTEE
Dr Miroslav Ćirković, Principal Research Fellow - President
Dr Dobrila Jakić-Dimić,Principal Research Fellow

Dr Vladimir Polaček, Research Associate

Dr Branka Vidić, Principal Research Fellow

Dr Jadranka Žutić, Research Associate

Dr Sava Lazić, Principal Research Fellow

Dr Milica Živkov-Baloš, Senior Research Associate

Dr Tamaš Petrović, Senior Research Associate

Dr Jelena Petrović, Senior Research Associate

Dr Vladimir Radosavljević, Research Associate

Dr Dragana Ljubojević, Research Associate

Dr Sara Savić, Research Associate

Petar Bakmaz, secretary of Organizing Committee

TECHNICAL SECRETARIAT
Jelena Babić, DVM, MSc, Research Assistant
Biljana Božin, DVM, MSc, Research Trainee
Nikola Bakmaz, Secretary
Dobrisav Vuković, IT engineer
Vera Prokić, librarian

2

First International Symposium of Veterinary Medicine – ISVM2015

SCIENTIFIC COMMITTEE
Dr Tamaš Petrović, Senior Research Associate – President (Serbia)
Dr Miroslav Ćirković, Principal Research Fellow (Serbia)

Dr Dubravka Milanov,Senior Research Associate(Serbia)

Dr Dobrila Jakić-Dimić,Principal Research Fellow (Serbia)

Dr Tania Hubenova, professor (Bulgaria)

Dr Theresa Bernardo, Principal Research Fellow (USA)

Dr Igor Stojanov, Senior Research Associate (Serbia)

Dr Branka Vidić, Principal Research Fellow (Serbia)

Dr Sara Savić, Research Associate (Serbia)

Dr Tamaš Bakonyi, Principal Research Fellow (Hungary)

Dr Dejan Bugarski, Research Associate (Serbia)

Dr Sava Lazić, Principal Research Fellow (Serbia)

Dr Vladimir Polaček, Research Associate (Serbia)

Dr Dušan Orlić, Principal Research Fellow (Serbia)

Dr Marjana Todorčević, Postdoc.Research Assistant(UK)

Dr Juan Carlos Saiz, Principal Research Fellow (Spain)

Dr Jadranka Žutić, Research Associate (Serbia)

Dr Ivan Pavlović, Principal Research Fellow (Serbia)

Dr Miroslav Urošević, Research Associate (Serbia)

Dr Vladimir Radosavljević, Research Associate (Serbia)

Dr Jasna Prodanov Radulović,ResearchAssociate (Serbia)

Dr Aleksandar Mašić, Adjunct professor (Canada)

Dr Petr Kralik, Research Associate (Czech Republic)

Dr Stanko Boboš, professor (Serbia)

Dr Dragana Dimitrijević , PhD (Serbia)

Dr Maja Velhner, Principal Research Fellow (Serbia)

Dr Bojana Grgić, MSc (Serbia)

Dr Aymeric Hans, Senior Research Associate (France)

Dr Milovan Jovičin, Research Associate (Serbia)

Dr Vesna Milošević, professor (Serbia)

Dr Radomir Ratajac, Research Associate (Serbia)

Dr Dušan Lalošević, professor (Serbia)

Dr Dragana Ljubojević, Research Associate (Serbia)

Dr Ivan Bogut, professor (Croatia)

Dr Živoslav Grgić, Research Associate (Serbia)

Dr Milica Živkov-Baloš,Senior ResearchAssociate(Serbia)

Dr Diana Lupulović, Research Associate (Serbia)

Dr Miloš Kapetanov, Principal Research Fellow (Serbia)

Dr Aleksandar Milovanović, Research Associate (Serbia)

Dr. Corinna Kehrenberg, professor (Germany)

Dr Željko Mihaljev, Research Associate (Serbia)

Dr Slavica Košarčić,Principal Research Fellow(Serbia)

Dr Danka Maslić-Strižak, Research Associate (Serbia)

Dr Jelena Petrović, Senior Research Associate (Serbia)

Dr Dragica Vojinović, Research Associate (Serbia)

Dr Vladimir Savić, Senior Research Associate(Croatia)

Dr Ksenija Nešić, Research Associate (Serbia)

Dr Ivana Hrnjaković-Cevtković, professor (Serbia)

Dr Živka Ilić, Research Associate (Serbia)

Dr Sandra Stefan-Mikić, professor (Serbia)

Dr Božidar Savić, Research Associate (Serbia)

Dr Snežana Ivanović, Principal Research Fellow (Serbia)

Dr Branislav Kureljušić, Research Associate (Serbia)

Dr Nataša Golić, Principal Research Fellow (Serbia)

Dr Sandra Jakšić, Research Assosiate (Serbia)

HONORARY COMMITTEE:
Dr Srđan Verbić, prof dr Snežana Bogosavljević Bošković, prof dr Zoran Mašić, Vladimir Pavlov, Branislav
Bogaroški, prof dr Dragan Glamočić, prof dr Vlada Teodorović, prof dr Radovan Pejanović, prof dr Milan
Popović, prof dr Zora Mijačević, prof dr Brana Radenković Damjanović, prof dr Nikola Grujić, prim dr
Dragan Ilić, doc dr Vladimir Petrović, prof dr Dine Mitrov, prof dr Nihad Fejzić, doc dr Boris Habrun, prof
dr Željko Cvetnić, prof dr Andrej Kirbiš, prof dr Tadej Malovrh, prof dr Boris Stegny, prof dr Paul Pirsan,
prof dr Gheorghe Darabus, dr Teodor Dujin, dr Radovan Pavlović, dr Ivana Kovinčić, dr Marijana Galić, dr
Ksenija Stevanović, dr Milan Šurjanović, dr Mira Velhner, dr Dragan Milićević, Petar Matijević, prof dr
Dragan Šefer, dr Aleksandar Lončarević, dr Milenko Žutić, dr Vojin Ivetić, dr Snežana Janković, dr Vesna
Đorđević, dr Jovanka Lević.
3

First International Symposium of Veterinary Medicine – ISVM2015

PREFACE
Concept of „One Health“ is a strategy which enrolls several disciplines in all aspects of
human and animal health care and environment protection. This kind of approach to solving
different public health issues proved to be the best practice of preservation of public health on a
global level. For this reason a need for different, unique and multidisciplinary perspective has been
recognized.
In Vrdnik, from 21st to 23rd of May, 2015, First International Symposium of Veterinary
Medicine will be held, named „One Health – New challenges“. At the Symposium, the existence of
„One Health“ initiative in Serbia, our region and also broader international surrounding will be
analyzed and also current topics and different perspectives will be discussed. The main goal of
Symposium is primarily to gather all the people interested in the topic of „One Health“concept.
Also it would be essential to perceive a large number of issues of this platform, the possibilities of
improvement on national, regional and international level and to propose future activities and
recognized challenges which are possible at this moment. It is very important that the participants of
the symposium are researchers and experts of different occupations, because of the broader
initiative proposals and different perspectives for the same issues.
A successful implementation of „One Health“ concept cannot be done without cooperation
and exchange of opinions among doctors, veterinarians, agronomists, technologists, biologists, etc.
It is needed to perceive a particular problem from a perspective of different professions and
expertise, regardless if the topic is a zoonozis, emergent and infectious diseases, food safety,
antimicrobial resistance, etc. Only with a „One Health“ concept and approach there can be an
appropriate response to the challenges that come up with the aim of preservation of public health
and environment. Basically this concept represents a mutual effort of different disciplines which
operate locally on a national level, and also globally, so that optimal health of humans, animals and
ecosystems is achieved. Necessary interdisciplinary requires a continuous cooperation among
epizootiological and epidemiological service, infectologists, veterinary practitioners, doctors, food
safety experts, biologists, environmentalists and other above mentioned disciplines.
At the „One Health – New challenges“ Symposium, work of experts, researchers and their
collaborators of different occupations, profiles and research groups will be presented. The
Symposium is supported by the Ministry of education, science and technological development,
Ministry of agriculture and environment protection, Province Secretary of science and technological
development, Province Secretary of agriculture, aquaculture and forestry and our sponsors. I would
like to use this opportunity and express my great gratitude to the companies and institutions which
have sponsored our Symposium „One Health – New challenges“, or helped in any other way.
Special thanks, I owe to the stuff of Scientific Veterinary Institute „Novi Sad”, as well as the stuff
from Scientific Veterinary Institute of Serbia, for the help with organization and a successful
Symposium!
President of Organizing Committee
Prof. Dr Miroslav Ćirković
Director of Scientific Veterinary Institute „Novi Sad“
.

4

First International Symposium of Veterinary Medicine – ISVM2015

Content

Page №

PROGRAM

10 - 18

Key note speach: One Health Concept – role and importance of veterinarians.
Milijan Jovanović, Miroslav Ćirković

19 - 26

27 - 104

Session 1
DISEASES OF FARM ANIMALS
Plenary lecture: EIA and EVA two equine viral diseases present in Europe
Aymeric Hans

28 - 35

Invited presentation: The voluntary programme for control and eradication of bovine viral
diarrhoea virus infections in Slovenia.
Ivan Toplak, Peter Hostnik, Danijela Rihtarič, Jože Grom

36 - 41

Invited presentation: Comparison of macroscopic and microscopic lession in mesenterial lymph
nodes in pigs naturally infected with Mycobaterium avim subsp hominissuis.
Vladimir Polaček, Jasna Prodanov-Radulović, Dejan Vidanović, Sanja Kovačević-Aleksić

42 - 49

Immune response and protective effect of vaccine against listeriosis in sheep in Serbia. Dragan
Bacić, Blagoje Dimitrijević, Mila Savić

50 - 56

Oral fluid as a potential sample for viral diseases detection in pigs. Vesna Milicević, Branislav
Kureljusić, Jelena Maksimovic-Zorić, Ljubisa Veljović, Vladimir Radosavljević, Nemanja
Jezdimirović, Bozidar Savić

57 - 63

Mycobacteria in animals in Slovenia: from cattle to aquarium fish. Mateja Pate, Darja Kušar,
Urška Zajc, Vlasta Jenčič, Diana Žele, Gorazd Vengušt, Jože Starič, Jožica Ježek, Katarina Logar,
Tina Pirš, Petra Bandelj, Brane Krt, Matjaž Ocepek

64 - 70

Sanitary and quality conditions of imported bulls semen in Serbia analyzed at "NIV-NS"
(retrospective from 2010-2014). Aleksandar Milovanović, Tomislav Barna, Milovan Jovičin, Jelena
Apić, Sava Lazić, Igor Stojanov, Miroslav Urošević

71 - 79

The health status of breeding stallions for natural breeding and artificial insemination,
regulatory compliance in European Union, South America and West Balkan. Miroslav I.
Urosević, Luis Losinno, Aleksandar Milovanović, Dragisa Trailović, Slobodanka Vakanjac, Jelena
Petrović, Natasa Filipović

80 - 86

Sperm pathological forms and acrosomal membrane integrity in boar AI dose on pig farms in
AP Vojvodina (Serbia). Jelena Apić, Aleksandar Milovanović, Tomislav Barna, Milovan Jovičin

87 - 91

Echinococcus granulosus of domestic pigs: a case control study. Doroteja Marčić, Jasna ProdanovRadulović, Igor Stojanov, Siniša Grubač, Ivan Pušić, Vladimir Polaček

92 - 96

The prevalence of aspergillosis in poultry and control measures - our experience. Miloš
Kapetanov, Dragana Ljubojević, Igor Stojanov, Milica Živkov-Baloš, Miloš Pelić, Marko Pajić

97 - 104

Session 2 - Main Hall

105 - 188

FOOD AND FEED SAFETY AND QUALITY
Invited presentation: Game meat safety – wild boars.
Jelena Petrović, Milica Živkov Baloš, Živoslav Grgić

106 - 114

Invited presentation: The determination of qualities in cereals silages supplemented with pumpkin
and carrot.
Milica Živkov-Baloš, Sandra Jakšić, Milovan Jovičin

115 - 123

5

First International Symposium of Veterinary Medicine – ISVM2015
Invited presentation: Mycotoxicological assessment of feed in Serbia in 2014 in the light of new
legislation.
Ksenija Nešić, Sandra Jakšić, Milica Živkov-Baloš, Bojana Prunić

124 – 132

Effects of fed diets with a different n-6/n-3 PUFAs ratio on oxidative stability, and physicochemical properties of chickens meat. Dragan Milićević, Dejana Trbović, Zoran Petrović, Breda
Jakovac-Strajn, Ivan Nastasijević, Nenad Perunović, Mirjana Lukić

133 – 141

Ecological safe production of smoked common carp meat. Jelena Babić, Brankica Kartalović,
Jelena Petrović, Đorđe Okanović, Biljana Božić, Miloš Pelić, Miroslav Ćirković

142 – 147

Effect of diet on improving fatty acid composition of pig meat. Radmila Marković, Milica
Todorović, Srđan Pantić, Milan Baltić, Jelena Ivanović, Dobrila Jakić-Dimić, Dragan Šefer, Branko
Petrujkić, Stamen Radulović

148 – 156

Effects of some dieatary supplementation with phytonutrients on selected biochemical
parameters and growth performance in broiler chikens. Milanka Jezdimirović, Blagoje
Dimitrijević, Saša Ivanović, Nemanja Jezdimirović, Mila Savić, Dragan Bacić, Slavoljub Jović

157 – 165

The influence of climatic factors in Serbia on mycotoxin production. Sandra Jakšić, Milica ŽivkovBaloš, Nadežda Prica, Zoran Mašić, Ksenija Nešić, Igor Jajić, Biljana Abramović

166 – 172

Radioactivity of the soil in Vojvodina (northern province of Serbia). Željko Mihaljev, Dragana
Ljubojević, Miroslav Ćirković, Milica Živkov-Baloš, Sandra Jakšić, Brankica Kartalović, Nadežda
Prica

173 – 177

Physicochemical analysis as an indicator of the quality of honey originating from Vojvodina
region. Nadežda Prica, Milica Živkov-Baloš, Sandra Jakšić, Željko Mihaljev, Dragana Ljubojević,
Branka Vidić, Sara Savić

178 – 182

Effects of dietary hot red pepper addition on productive performance and blood lipid profile of
broiler chickens. Nikola Puvača, Ljiljana Kostadinović, Dragana Ljubojević, Dragomir Lukač, Sanja
Popović, Jovanka Lević, Olivera Đuragić, Rade Jovanović

183 - 188

Session 3

189 - 241

VECTOR BORNE INFECTIONS
Plenary lecture: Mosquito-borne flaviviruses in Europe: current perspectives.
Juan Carlos Saiz

190 – 195

Invited presentation: An overview of the recent studies on tick borne pathogens in Serbia.
Sara Savić, Branka Vidić, Aleksandar Potkonjak, Željko Čonka

196 - 203

Invited presentation: WNV in Serbia: update of current knowledge.
Tamaš Petrović, Dušan Petrić, Diana Lupulović, Ivana Hrnjaković Cvetković, Vesna Milošević, Sava
Lazić, Juan Carlos Saiz

204 – 212

Pathomorphological findings in organs of sheeps died of bluetongue disease. Ivan Dobrosavljević,
Milena Živojinović, Slavonka Stokić-Nikolić, Milica Lazić, Dragan Rogožarski

213 – 219

Species diversity and life stages dominance of hard ticks (acari: ixodidae) at Vojvodina hunting
resorts. Aleksandra Petrović, Aleksandar Jurišić, Ivana Ivanović, Aleksandar Potkonjak, Vuk Vračar,
Dragana Rajković

220 – 228

Cross-reactions in serological diagnosis of flavivirus infections. Ivana Hrnjaković Cvjetković,
Dušan Petrić, Tamaš Petrović, Gordana Kovačević, Jelena Radovanov, Aleksandra Jovanović Galović,
Dejan Cvjetković, Sandra Stefan Mikić, Aleksandra Patić, Nataša Nikolić, Vesna Milošević

229 – 233

Vector-borne infection (Ehrlichia canis) – clinical case. Zlatko Dimeski, Biljana Petrovska, Zivko
Gacovski, Goce Cilev, Elena Buntevska, Bojan Stamadziovski

234 - 236

6

First International Symposium of Veterinary Medicine – ISVM2015
Leshmaniasis in 12 years old male pekingese-clinical case. Zlatko Dimeski, Biljana Petrovska,
Zivko Gacovski, Goce Cilev, Blagica Trajanoska, Martin Kamceski, Bojan Stamadziovski, Elena
Buntevska

237 – 241

Session 4

242 – 311

WILDLIFE DISEASES AND PATHOGENS IN ENVIRONMENT
Plenary lecture: Influenza in Birds and Other Animals.
Vladimir Savić

243 – 250

Invited presentation: Virus infections of the honeybee (Apis mellifera l.) in central Europe.
Tamás Bakonyi, Petra Forgách, Aleš Gregorc, Ivana Tlak Gajger, László Békési, Miklós Rusvai,
Norbert Nowotny

251 – 259

Invited presentation: The most common health disturbances detected in wild boars in enclosed
hunting grounds in Vojvodina province.
Jasna Prodanov-Radulović, Radoslav Došen, Igor Stojanov, Tamaš Petrović

260 – 270

Contamination of public places at central Belgrade municipalities with dogs parasites in period
2013-2014. Ivan Pavlović, Dubravka Jovičić, Vladimir Terzin, Dragana Petković, Dragana Terzin,
Miloš Pavlović, Zoran Tambur, Snežana Radivojević, Borivoje Savić, Slobodan Stanojević

271 – 274

Risk factors in domestic and wild cycles of Trichinella species. Milena Živojinović, Ivan
Dobrosavljević, Ljiljana Sofronić Milosavljević, Budimir Plavšić, Zoran Kulišić, Sonja Radojičić

275 – 282

Insight into the present pesticide contamination and copepods status (Crustacea: Copepoda) of
surface water in irrigation canals in Vojvodina. Vojislava Bursić, Gorica Vuković, Aleksandra
Petrović, Maja Meseldžija, Tijana Zeremski, Aleksandar Jurišić, Dragana Rajković

283 – 289

A serological survey on Aujeszky's disease in wild boars in the region of Vojvodina in Serbia.
Sava Lazić, Vesna Milićević, Gospava Lazić, Ljubiša Veljović, Diana Lupulović, Jasna ProdanovRadulović, Jelena Maksimović -Zorić, Siniša Grubač, Radoslav Došen, Tamaš Petrović

290 – 294

Viruses in environment: situation in Vojvodina province of Serbia. Gospava Lazić, Siniša Grubač,
Bugarski Dejan, Diana Lupulović, Sava Lazić, Petar Knežević, Tamaš Petrović

295 – 300

Development of a multi-residue method for the determination of insecticides in animal fat by
LC-MS/MS. Vojislava Bursić, Gorica Vuković, Tijana Zeremski, Dejan Beuković, Miloš Beuković,
Aleksandra Petrović, Magdalina Cara

301 – 305

The unusual colony losses in the region of Vojvodina. Jelena Babić, Sara Savić, Miroslav Ćirković,
Igor Stojanov, Ivan Pihler, Nada Plavša

306 - 311

Session 5

312 – 389

AQUACULTURE
Plenary lecture: Converting waste landfill in pond areas.
Miroslav Ćirković, Brankica Kartalović, Miloš Pelić, Nikolina Novakov, Dragana Ljubojević, Sanja
Jovanić, Željko Mihaljev

313 – 320

Invited presentation: Rapid detection of important carp viruses by loop-mediated isothermal
amplification (LAMP).
Vladimir Radosavljević, Dragana Ljubojević, Vesna Miličević, Miroslav Ćirković, Dobrila JakićDimić, Jelena Maksimović-Zorić, Jadranka Žutic

321 – 326

Invited presentation: Link between lipid quality of cyprinid fish species and human health.
Dragana Ljubojević, Miroslav Ćirković

327 – 339

Seasonal variations of physico chemical parameters of the pond. Brankica Kartalović, Miroslav
Ćirković, Miloš Pelić, Sanja Jovanić, Nikolina Novakov, Biljana Božić, Željko Mihaljev

340 - 345

7

First International Symposium of Veterinary Medicine – ISVM2015
Nodular coccidiosis of carp fingerlings caused by Goussia subepithelialis. Nikolina Novakov,
Miroslav Ćirković, Dragana Ljubojević, Miloš Pelić, Biljana Božić, Jelena Babić, Dalibor Todorović

346 – 350

Drum-form fitoreactor in seawater recirculation system. Dmitry Dementyev

351 – 356

Body traits and chemical composition of carp grown in production systems with different level of
intensification. Liliana Hadzhinikolova, Angelina Ivanova, Tania Hubenova

357 – 361

Meat lipid quality in carps (Сyprinus carpio L) grown in production systems with different level
of intensification. Angelina Ivanova, Liliana Hadzhinikolova

362 – 368

Results of breeding of juveniles of huchen (Hucho hucho) obtained by insemination with fresh
and cryopreserved sperm in artificial conditions. Nataša Radojković, Aleksandra Milošković,
Simona Kovačević, Tijana Veličković, Snežana Simić, Miroslav Ćirković, Ákos Horváth, Vladica
Simić

369 – 373

Distribution and some ecological impacts of fluke Posthodiplostomum cuticola (Digenea,
Trematodes) in the fish assemblage of the Zapadna Morava River (Danube basin, Serbia). Goran
Marković, Nikolina Novakov

374 – 378

The effect of OTC and flumequine antibiotic in fresh feed for the control of erythrodermatitis in
common carp (Cyprinus carpio L.). Miloš Pelić, Brankica Kartalović, Dragana Ljubojević, Nikolina
Novakov, Dalibor Todorović, Biljana Božić, Miroslav Ćirković

379 – 384

Malignant anaemia of the carps. Biljana Božić, Nikolina Novakov, Miloš Pelić, Dalibor Todorović,
Miroslav Ćirković

385 - 389

Session 6

390 – 444

EMERGING AND RE-EMERGING ZOONOSES
Invited presentation: Important zoonotic viral diseases of wildlife and their impact on human
health.
Diana Lupulović, Gospava Lazić, Jasna Prodanov-Radulović, Tamas Petrović

391 – 400

Invited presentation: Influenza and international health regulations.
Dragana Dimitrijević, Slavica Rakić Adrović, Milunka Milinković, Jovanka Ćosić

401 – 404

Invited presentation: Comparation of Rhodococcus equi of human and animal origin.
Ljiljana Suvajdžić, Maja Velhner, Maja Bekut, Gordana Bojić, Tamara Krstić, Zoran Suvajdžić,
Milenko Lazić

404 – 413

The role of veterinary medicine in One Health concept. Branka Vidić, Sara Savić, Stanko Boboš,
Nadežda Prica, Miodrag Radinović

414 – 419

The concept “One World, One Health” in the Macedonian state institutions. Misho Hristovski,
Blazho Janevski, Martin Josheski

420 – 433

More than two years without detection of wild rabies virus in Slovenia. Peter Hostnik, Jedert
Maurer Werning, Breda Hrovatin, Danijela Rihtarič, Ivan Toplak

434 – 438

Epizootiological importance of Salmonella spp. isolated in different poultry farms in Southern
Bačka and Srem region. Marko Pajić, Dalibor Todorović, Maja Velhner, Dubravka Milanov,
Vladimir Polaček, Spomenka Đurić, Igor Stojanov

439 – 444

Session 7

445 - 484

ANTIBIOTIC RESISTANCE
Invited presentation: Potential spread of antimicrobial resistance via drinking water in livestock
husbandry.
Igor Stojanov, Jasna Prodanov Radulović, Miloš Kapetanov, Jelena Petrović

8

446 - 453

First International Symposium of Veterinary Medicine – ISVM2015
Invited presentation: Antimicrobial activity of the essential oils from some aromatic medicinal
plants cultivated in Serbia.
Radomir Ratajac, Marina Žekić Stošić, Aleksandar Milovanović, Igor Stojanov

454 – 461

Antimicrobial activity of blackberry juice from Serbia on animal pathogens. Tamara Krstić,
Ljiljana Suvajdžić, Srđan Stojanović, Tamaš Petrović, Maja Bekut, Nebojša Ilić, Zoran Suvajdžić

462 – 467

Antibiotic resistance to fluoroqionoles in Salmonella spp.: Recent findings in Serbia and brief
overview of resistance mechanisms and molecular typing methods. Maja Velhner, Gordana
Kozoderović, Zora Jelesić

468 – 472

Antibacterial susceptibility of mastitis pathogens to iodine-lithium complex in vitro. Marina Žekić
Stošić, Radomir Ratajac, Aleksandar Milovanović, Jelena Petrović, Igor Stojanov, Jelena Apić

473 – 478

Random amplified polymorphic DNA analysis – RAPD and resistance to antimicrobial agents in
Salmonella spp. isolated from poultry flocks in Southern Bačka and Srem region. Dalibor
Todorović, Maja Velhner, Bojana Prunić, Marko Pajić, Dubravka Milanov, Vladimir Polaček, Dejan
Bugarski

479 - 484

Supplement to Session 1: “Diseases of farm animals”
Detection of infected goats with CAE virus-control measures and prevention. Miodrag Radinovic,
Marija Pajić, Stanko Boboš, Branka Vidić, Sara Savić, Annamaria Galfi

485 – 488

Immunoglobulin G concentration and ultrasonography of the cows udder with subclinical
mastitis. Annamaria Galfi, Miodrag Radinović, Marija Pajić, Stanko Boboš, Branka Vidić, Sara Savić,
Dubravka Milanov

489 - 492

Supplement to Session 2: “Food anf feed safety and quality”
Remediation of by-products of slaughtered livestock. Djordje Okanović, Milutin Ristić

9

493 – 498

Novi Sad. Marija Pajić. Mila Savić 16:30 – 16:40 Listeriosis: a continuous challenge in veterinary practice. Environmental and Occupational Health & Safety) 15:50 – 16:05 Invited presentation: The voluntary programme for control and eradication of bovine viral diarrhoea virus infections in Slovenia. Majda Golob. University of Ljubljana) 16:05 – 16:20 Invited presentation: Comparison of macroscopic and microscopic lession in mesenterial lymph nodes in pigs naturally infected with Mycobaterium avim subsp hominissuis. Peter Hostnik. Katarina Logar. Ivan Toplak. Jelena Maksimovic-Zorić. Jože Starič. Darja Kušar. Jože Grom (National Veterinary Institute. May 21. Brane Krt. Danijela Rihtarič. Vladimir Radosavljević. Ivan Toplak. Bozidar Savić 16:50 – 17:00 Mycobacteria in animals in Slovenia: from cattle to aquarium fish. Igor Stojanov. Annamaria Galfi 17:10 – 17:20 Sanitary and quality conditions of imported bulls semen in Serbia analyzed at "NIV-NS" (retrospective from 2010-2014). Sanja Kovačević-Aleksić (Scientific Veterinary Institute Novi Sad. Nemanja Jezdimirović. Vlasta Jenčič. Aleksandar Milovanović. Jožica Ježek. Tomislav Barna. Stanko Boboš. Petra Bandelj. Diana Žele. Darja Kušar. Miroslav Urošević 17:20 – 17:30 Discussion for all presentations and posters in Session 1 10 . Aymeric Hans (ANSES . Branka Vidić. Milovan Jovičin. Irena Zdovc 16:40 – 16:50 Oral fluid as a potential sample for viral diseases detection in pigs. Gorazd Vengušt. Vesna Milicević. Tina Pirš. Matjaž Ocepek. Ljubisa Veljović. Jasna Prodanov-Radulović. Urška Zajc. Vladimir Polaček 15:30 – 15:50 Plenary lecture: EIA and EVA two equine viral diseases present in Europe. Branislav Kureljusić. Matjaž Ocepek 17:00 – 17:10 Detection of infected goats with CAE virus-control measures and prevention. Sava Lazić. Blagoje Dimitrijević. Vladimir Polaček. Miodrag Radinovic. Jelena Apić. Veterinary Faculty.First International Symposium of Veterinary Medicine – ISVM2015 PROGRAM Thursday. Mateja Pate.French Agency for Food. Dragan Bacić. Mateja Pate. Sara Savić. Serbia) 16:20 – 16:30 Immune response and protective effect of vaccine against listeriosis in sheep in Serbia. 2015 13:00 – 15:30 Registration of participants Main Hall entrance 15:30 – 17:40 Session 1 – Main Hall Diseases of farm animals Chairs: Sava Lazić.

Science and Technological Development. Miroslav I. Doroteja Marčić. Ivan Pušić. Maja Velhner. Urosević.10 Diseases of digestive system in suckling piglets detected on swine farms in Vojvodina province. Božidar Savić 1. Sara Savić. Marija Pajić. Dubravka Milanov. Igor Stojanov. Vladimir Polaček 1.5 Sperm pathological forms and acrosomal membrane integrity in boar AI dose on pig farms in AP Vojvodina (Serbia). Symposium Opening Session Main hall  Program dedicated for 65th Anniversary of Scientific Veterinary Institute “Novi Sad”  Symposium opening . Aleksandar Milovanović. Stanko Boboš. Milijan Jovanović. Doroteja Marčić.our experience. Nemanja Jezdimirović. South America and West Balkan.Welcome address: Tamaš Petrović (President of the Scientific Committee) . Vladimir Radosavljević. Blagoje Dimitrijević. Miroslav Ćirković 2 0 : 0 0 Welcome Coctail and party 11 . Dragisa Trailović. Jadranka Žutić. Diana Lupolović.welcome addresses: . Jelena Maksimovic-Zorić.8 The prevalence of aspergillosis in poultry and control measures . Jasna Prodanov-Radulović. Branislav Kureljušić. Vesna Milicević.7 Echinococcus granulosus of domestic pigs: a case control study. Igor Stojanov. Miloš Pelić. Miloš Kapetanov. Republic of Serbia Key note speech: One Health Concept – role and importance of veterinarians. Ivan Pušić. Dragana Ljubojević. Jelena Petrović. Miroslav Urosević. Ministry of Agriculture and Environmental Protection) . Jasna Prodanov-Radulović. Natasa Filipović 1. Marko Pajić 1. Jelena Apić. Luis Losinno. Marko Pajić. Božidar Savić.9 The influence of Aspergillus fumigatus infection on some hematological parameters in turkey’s poults. Ivana Čabarkapa 1. Jasna Prodanov-Radulović.2 Biosafety in laboratories for diagnosis of transboundary diseases. Milovan Jovičin 1. Igor Stojanov 1. Đorđe Cvetojević. Doroteja Marčić 17:30 – 18:00 Coffe break with posters 18:00 – 20:00 Welcome. Dubravka Milanov 1. Vesna Milićević. Tomislav Barna. Vojin Ivetić.Welcome address and opening: Representative of Ministry of Education. Autonomous Province of Vojvodina .3 Some facts of the rdar morphotype of Salmonella spp. Ljubisa Veljović. Branka Vidić. Danka Maslić Strižak. Aleksandar Milovanović. Dobrila Jakić-Dimić. Jasna Kureljušić. Ivan Pušić. and Escherichia coli. Radoslav Došen.Welcome address: Miroslav Ćirković (President of the Organizing Committee) . Milica Živkov-Baloš. Bojana Prunić.Welcome address: Dejan Bugarski (Director of Veterinary Directorate (CVO). Miodrag Radinović.Welcome address: Representative of local administration – Municipality Irig .6 Immunoglobulin G concentration and ultrasonography of the cows udder with subclinical mastitis. Annamaria Galfi.1 Serological survey for antibodies against morbus Aujeszky virus in pigs originating from unvaccinated herds. Radoslav Došen. Slobodanka Vakanjac. Danka MaslićStrižak.Welcome address: Representative of Secretariat for Science and Technological Development.4 The health status of breeding stallions for natural breeding and artificial insemination. Siniša Grubač. Milijan Jovanović 1. regulatory compliance in European Union. Igor Stojanov.First International Symposium of Veterinary Medicine – ISVM2015 Posters – Hall B (Piva) 1. Vladimir Polaček. Siniša Grubač.

Maja Tolinački. Milica Todorović. Brankica Kartalović. Nikola Popović. Zoran Petrović. Đorđe Okanović. Jelena Babić. Milica Nikolić. Milan Baltić. Jelena Petrović. Ivan Nastasijević. Milica Živkov Baloš. and physicochemical properties of chickens meat. Novi Sad. Ivana Strahinić. Breda Jakovac-Strajn. Biljana Božić. Djordje Okanović. Milan Kojić. Dragan Šefer. Miloš Pelić. Amarela TerzićVidojević 09:25 – 09:35 Effects of fed diets with a different n-6/n-3 PUFAs ratio on oxidative stability. Igor Mrvaljević.First International Symposium of Veterinary Medicine – ISVM2015 Friday. May 22. Sandra Jakšić. Marija Miljkovic. 2015 Morning Sessions – Main Hall 08:30 – 13:10 Paralel Sessions 08:30 – 10:30 Session 2 . Milovan Jovičin (Scientific Veterinary Institute Novi Sad. Milutin Ristić 09:45 – 09:55 Ecological safe production of smoked common carp meat. Jelena Petrović. Dušanka Popović. Jelena Petrović. Milica Živkov-Baloš. Dragan Milićević. Bojana Prunić (Institute of Veterinary Medicine of Serbia. Belgrade. Miroslav Ćirković 09:55 – 10:05 Development of starter cultures for fermented dairy products based on autochthonous lactic acid bacteria. Ksenija Nešić. Stamen Radulović 10:15 – 10:30 Discussion for all presentations and posters in Session 2 12 . Milica Živkov-Baloš. Milan Kojić 10:05 – 10:15 Effect of diet on improving fatty acid composition of pig meat. Sandra Jakšić. Serbia) 09:00 – 09:15 Invited presentation: Mycotoxicological assessment of feed in Serbia in 2014 in the light of new legislation. Mirjana Lukić 09:35 – 09:45 Remediation of by-products of slaughtered livestock. Branko Petrujkić. Jelena Ivanović. Miroslav Dinić. Serbia) 08:45 – 09:00 Invited presentation: The determination of qualities in cereals silages supplemented with pumpkin and carrot. Katarina Veljović. Serbia) 09:15 – 09:25 Development of probiotic cultures for domestic animals. Novi Sad. Radmila Marković. Katarina Veljović. Dejana Trbović. Sanja Mihajlović. Živoslav Grgić (Scientific Veterinary Institute Novi Sad.Main Hall Food and feed safety and quality Chairs: Dragan Milićević. Milica Živkov Baloš 08:30 – 08:45 Invited presentation: Game meat safety – wild boars. Amarela Terzić-Vidojević. Nataša Golić. Srđan Pantić. Nenad Perunović. Dobrila Jakić-Dimić.

Károly Erdélyi. Predrag Ikonić. Olivera Đuragić 2. Brankica Kartalović. Milanka Jezdimirović. Dragana Ljubojević. Slobodan Stanojević 12:20 – 12:30 Bacillus thuringiensis as the model for the development of reliable method for the detection and quantification of spore of Bacillus anthracis from environmental samples. Ksenija Nešić. Branislav Šojić. Effects of some dieatary supplementation with phytonutrients on selected biochemical parameters and growth performance in broiler chikens. Iva Kubikova. Tamas Bakonyi 11:00 – 11:20 Plenary lecture: Influenza in Birds and Other Animals. Rade Jovanović 2. Milica Živkov-Baloš. Red deer papillomavirus an odd pair in delta-papillomavirus evolution and ecology. Dragana Terzin. Sandra Jakšić.) in central Europe. Serbia) 12:00 – 12:10 Roe deer vs. Vladimir Tomović. Nadežda Prica 2. Mila Savić. Norbert Nowotny (Faculty of Veterinary Science. Dragomir Lukač. Ivan Pavlović. Budapest.9. Đorđe Okanović 2. Radioactivity of the soil in Vojvodina (northern province of Serbia). Nikola Puvača. Effects of dietary hot red pepper addition on productive performance and blood lipid profile of broiler chickens. Sanja Popović. Blagoje Dimitrijević. Jasna Prodanov-Radulović. Branka Vidić. Dragomir Lukač. Snežana Radivojević. Biljana Abramović 2. Nikola Puvača. Zagreb. Vladimir Terzin. Zoran Tambur.6. Nemanja Jezdimirović. Igor Stojanov.7. Miloš Pavlović. Fatty acid composition of two skeletal muscles from native Serbian swallow-belly mangulica pigs reared outdoors. Natalija Džinić. Petr Kralik 13 . Sandra Jakšić. Hungary) 11:40 – 12:00 Invited presentation: The most common health disturbances detected in wild boars in enclosed hunting grounds in Vojvodina province. Ivana Tlak Gajger. Dušica Čolović. Jovanka Lević. Igor Jajić. Dubravka Jovičić. Miroslav Ćirković. Đorđe Okanović. Vladimir Tomović. Jovanka Lević 10:30 – 11:00 Coffe break with posters 11:00 – 13:10 Session 4 – Main Hall Wildlife diseases and pathogens in environment Chairs: Tamaš Petrović. Ljiljana Kostadinović. Tatjana Tasić. Novi Sad.2. Alessandra Scagliarini 12:10 – 12:20 Contamination of public places at central Belgrade municipalities with dogs parasites in period 2013-2014. Zoran Mašić. Vera Sedlackova. Analysis of pesticide residues in vegetables on green markets in Novi Sad (Serbia). Some quality parameters of industrial kulen from market of Vojvodina. Influence of new product fitokokci-sto in broilers nutrition on productive characteristics and biochemical blood status. Borivoje Savić. Occurrence of selected foodborne pathogens in foods of plant origin.10. Dragana Petković. Petra Forgách. Dragana Ljubojević. Biljana Panin 2. Vladimir Savić (Croatian Veterinary Institute.First International Symposium of Veterinary Medicine – ISVM2015 Posters – Hall B (Piva) 2.1.8.5. Dragan Bacić. Szent István University. Ljiljana Kostadinović. Slavoljub Jović 2. Marija Jokanović. Željko Mihaljev. Radoslav Došen. Croatia) 11:20 – 11:40 Invited presentation: Virus infections of the honeybee (Apis mellifera l. Petra Vasickova.3. Maja Ivić. Saša Ivanović. László Békési. Aleš Gregorc. Nadežda Prica. Snežana Škaljac. Sanja Popović. Tamás Bakonyi. Milica Živkov-Baloš. Miklós Rusvai. Mira Pucarević. Željko Mihaljev. Petr Kralik 2.4. Predrag Ikonić. Natalija Džinić. Sara Savić 2. Sandra Jakšić. Dragana Ljubojević. Tamaš Petrović (Scientific Veterinary Institute Novi Sad. Jovanka Lević. Milica Živkov-Baloš. Nataša Stojić. Physicochemical analysis as an indicator of the quality of honey originating from Vojvodina region. Michal Slany. Vladimir Savić. Monika Moravkova. Nadežda Prica. Tatjana Tasić. The influence of climatic factors in serbia on mycotoxin production. Olivera Đuragić.

Vuk Vračar. Sara Savić. Borislav Čabrilo. Aleksandar Potkonjak. Gospava Lazić. Ivan Pihler. Aleksandra Petrović.3 Dermal fibromatosis of the roe deer. Milena Živojinović. Tijana Zeremski.and endoparasitic burden of apodemus mice (Rodentia: Muridae) at hunting resort Kamarište (Serbia). Gospava Lazić. Tijana Zeremski. Vojislava Bursić. Sava Lazić 4. Diana Lupulović. Tamaš Petrović 4. Siniša Grubač. Aleksandra Petrović. Serbia) 09:10 – 09:30 Invited presentation: WNV in Serbia: update of current knowledge. Sara Savić 08:30 – 08:50 Plenary lecture: Mosquito-borne flaviviruses in Europe: current perspectives. Vesna Milićević. Ivana Ivanović.2 A serological survey on Aujeszky's disease in wild boars in the region of Vojvodina in Serbia. Dušan Petrić. Novi Sad. Slavonka Stokić-Nikolić. Milena Živojinović.First International Symposium of Veterinary Medicine – ISVM2015 12:30 – 12:40 Occurrence of Toxoplasma gondii in domestic pigs and wild boars in the Czech Republic. Aleksandar Potkonjak. Madrid. Milica Lazić. Alena Lorencova 12:40 – 12:50 Risk factors in domestic and wild cycles of Trichinella species. Siniša Grubač. Gorica Vuković. Aleksandra Petrović.1 Ecto. Tamaš Petrović 4. Branka Vidić. Michal Slany. Zoran Ristić. Vojislava Bursić. Bugarski Dejan. Aleksandra Petrović. Vesna Milošević. Sava Lazić. Juan Carlos Saiz (Scientific Veterinary Institute Novi Sad. Sara Savić. Ivana Hrnjaković Cvetković.case report. Aleksandar Jurišić. Spain) 08:50 – 09:10 Invited presentation: An overview of the recent studies on tick borne pathogens in Serbia. Aleksandar Jurišić. Sonja Radojičić 12:50 – 13:00 Insight into the present pesticide contamination and copepods status (Crustacea: Copepoda) of surface water in irrigation canals in Vojvodina. Dragana Rajković 13:00 – 13:10 Discussion for all presentations and posters in Session 4 Posters – Hall B (Piva) 4. Gorica Vuković. Lea Jakubcova. Ljubiša Veljović. Miloš Beuković. Dušan Lalošević. Željko Čonka (Scientific Veterinary Institute Novi Sad. Nada Plavša 13:10 – 14:30 Lunch break and poster viewing Morning Sessions – Hall A (Tara) 08:30 – 13:00 Paralel Sessions 08:30 – 10:30 Session 3 – Hall A (Tara) Vector borne infections Chairs: Tamaš Petrović. Miroslav Ćirković. Dragan Rogožarski 09:40 – 09:50 Species diversity and life stages dominance of hard ticks (acari: ixodidae) at Vojvodina hunting resorts. Tamaš Petrović. Sava Lazić. Jelena Babić. Juan Carlos Saiz. Diana Lupulović. Ivana Ivnović 4. Diana Lupulović. Igor Stojanov. Jasna Prodanov-Radulović. Dina Tenji. Novi Sad. Olivera Bjelić Čabrilo. Sava Lazić. Zoran Kulišić. Petar Knežević. Budimir Plavšić.6 The unusual colony losses in Vojvodina Province. Ljiljana Sofronić Milosavljević. Dejan Beuković.4 Viruses in environment: situation in Vojvodina province of Serbia.5 Development of a multi-residue method for the determination of insecticides in animal fat by LC-MS/MS. Serbia) 09:30 – 09:40 Pathomorphological findings in organs of sheeps died of bluetongue disease. Jelena Maksimović -Zorić. Dragana Rajković 14 . Magdalina Cara 4. Maja Meseldžija. Ivan Dobrosavljević. Aleksandar Jurišić. Radoslav Došen. Ivan Dobrosavljević. Nikol Reslova. Juan Carlos Saiz (INIA.

Dušan Petrić 10:10 – 10:30 Discussion for all presentations and posters in Session 3 Posters – Hall B (Piva) 3. Sandra Stefan Mikić. Serbia) 11:20 – 11:35 Invited presentation: Rapid detection of important carp viruses by loop-mediated isothermal amplification (LAMP). Zivko Gacovski. Novi Sad. Miroslav Ćirković (Scientific Veterinary Institute Novi Sad. Goce Cilev. Gordana Kovačević. Hristovski Mišo 3. Miloš Pelić. Tamaš Petrović. Dmitry Dementyev 15 . Elena Buntevska. Novi Sad. Ozge Erisoz Kasap. Miroslav Ćirković. Yusuf Ozbel. Maria Forlenza and Geert Wiegertjes 12:20 – 12:30 Nodular coccidiosis of carp fingerlings caused by Goussia subepithelialis. Duško Ćirović. Biljana Božić. Zlatko Dimeski.1 Cross-reactions in serological diagnosis of flavivirus infections. Biljana Petrovska. Luigi Gradoni. Serbia) 11:50 – 12:00 Seasonal variations of physico chemical parameters of the pond. Biljana Petrovska. Vesna Janković. Vesna Milošević 3. Ratko Sukara. Gizem Oguz.First International Symposium of Veterinary Medicine – ISVM2015 09:50 – 10:00 Babesia spp. Sanja Jovanić. Miroslav Ćirković. in ticks parasitizing wild canids in Serbia. Vesna Miličević. Vesna Đorđević. Dimosthenis Chochlakis. Jelena Radovanov. Brankica Kartalović. Biljana Božić. Snežana Tomanović 10:00 – 10:10 Diversity and spatial distribution of sandflies (diptera: psychodidae) and possibility of reemergence of leishmaniasis in Serbia.2 Epidemiology of Bluetongue disease in Southeastern Europe. Dušan Petrić. Nikolina Novakov. Sanja Ćakić. Serbia) 11:35 – 11:50 Invited presentation: Link between lipid quality of cyprinid fish species and human health. Brankica Kartalović. Sara Savić. Zlatko Dimeski. Miroslav Ćirković. Vladimir Radosavljević. Martin Kamceski. Aleksandra Patić. Danka Spirić 12:10 – 12:20 A closer look at toll-like receptor 4 (TLR4) and toll-like receptor 20 (TLR20) of common carp (Cyprinus carpio). Bojan Stamadziovski. Darko Mihaljica. Miloš Pelić. Dragana Ljubojević. Jadranka Žutic (Institute of Veterinary Medicine of Serbia. Salem Juwaid. Miroslav Ćirković. Miloš Pelić. Goce Cilev. Sanja Jovanić. Vesna Đorđević. Trentina Di Muccio. Dejana Trbović. Dobrila Jakić-Dimić. Dragana Ljubojević. Miroslav Ćirković. Elena Buntevska 10:30 – 11:00 Coffe break with posters 11:00 – 13:00 Session 5 – Hall A (Tara) Aquaculture Chairs: Miroslav Ćirković. Dragana Ljubojević. Željko Mihaljev (Scientific Veterinary Institute Novi Sad. Bojan Stamadziovski 3. Bulent Alten. Josheski Martin. Belgrade. Slavica Vaselek. Nazli Ayhan.3 Vector-borne infection (Ehrlichia canis) – clinical case. Jelena Babić. Vladimir Radosavljević 11:00 – 11:20 Plenary lecture: Converting waste landfill in pond areas. Blagica Trajanoska. Vladimir Ivović. Jelena Maksimović-Zorić. Nikolina Novakov. Dragana Ljubojević. Nataša Nikolić.4 Leshmaniasis in 12 years old male pekingese-clinical case. Aleksandra Jovanović Galović. Dragana Ljubojević. Zivko Gacovski. Dejan Cvjetković. Ivana Hrnjaković Cvjetković. Danilo Pietretti. Nikolina Novakov. Željko Mihaljev 12:00 – 12:10 The impact of benthic and planktonic bacteria on microbiological status of the digestive tract of carp (Cyprinus carpio). Dalibor Todorović 12:30 – 12:40 Drum-form fitoreactor in seawater recirculation system. Radivoj Petronijević.

Danijela Rihtarič. Vladica Simić 5. Dalibor Todorović. Sara Savić. Breda Hrovatin. Branka Vidić. Nikolina Novakov. Milenko Lazić (Faculty of Medicine. Nikolina Novakov. Liliana Hadzhinikolova 13:00 – 13:10 Discussion for all presentations and posters in Session 5 Posters – Hall B (Piva) 5. Miroslav Ćirković 5. Simona Kovačević. Nadežda Prica. Department of Pharmacy. Serbia) 15:15 – 15:25 The role of veterinary medicine in One Health concept. Jovanka Ćosić (Institute of Public Health of Serbia – „Batut“. Dragana Ljubojević. Sara Savić 14:30 – 14:45 Invited presentation: Important zoonotic viral diseases of wildlife and their impact on human health. University of Novi Sad. Aleksandra Milošković. Angelina Ivanova. Angelina Ivanova. Petra Vasickova. Blazho Janevski. Serbia) 15:00 – 15:15 Invited presentation: Comparation of Rhodococcus equi of human and animal origin.2 Distribution of fluke Posthodiplostomum cuticola (Digenea. Miodrag Radinović 15:25 – 15:35 The concept “One World. Slavica Rakić Adrović. Dragana Dimitrijević. Ivan Toplak. Miroslav Ćirković 13:10 – 14:30 Lunch break and poster viewing Friday. Stanko Boboš. Maja Velhner. Peter Hostnik. Gordana Bojić. Dalibor Todorović. Tamara Krstić. Gospava Lazić. Biljana Božić. 2015 Afternoon Sessions – Main Hall 14:30 – 16:35 Session 6 – Main Hall Emerging and re-emerging zoonoses Chairs: Branka Vidić. Misho Hristovski. Ljiljana Suvajdžić. Ákos Horváth. Milunka Milinković. Snežana Simić. Goran Marković. Tijana Veličković. Zoran Suvajdžić. Biljana Božić. Liliana Hadzhinikolova. May 22.4 Malignant anaemia of the carps. Jasna Prodanov-Radulović. 15:45 – 15:55 Hepatitis E virus in the Czech Republic. Miloš Pelić. Novi Sad. Jedert Maurer Werning. Brankica Kartalović.3 The effect of OTC and flumequine antibiotic in fresh feed for the control of erythrodermatitis in common carp (Cyprinus carpio L.). One Health” in the Macedonian state institutions. Miloš Pelić. Martin Josheski 15:35 – 15:45 More than two years without detection of wild rabies virus in Slovenia. Tamas Petrović (Scientific Veterinary Institute Novi Sad.First International Symposium of Veterinary Medicine – ISVM2015 12:40 – 12:50 Body traits and chemical composition of carp grown in production systems with different level of intensification. Diana Lupulović. Nataša Radojković. Serbia) 14:45 – 15:00 Invited presentation: Influenza and international health regulations. Dobrila Jakić Dimić. Trematodes) in the fish assemblage of the Zapadna Morava River (Danube basin. Monika Kubankova.1 Results of breeding of juveniles of huchen (Hucho hucho) obtained by insemination with fresh and cryopreserved sperm in artificial conditions. Serbia). Nikolina Novakov 5. Miroslav Ćirković. Maja Bekut. Petr Kralik 16 . Tania Hubenova 12:50 – 13:00 Meat lipid quality in carps (Сyprinus carpio L) grown in production systems with different level of intensification.

Grozdana Čanak. Zora Jelesić 18:40 – 18:50 Research on the antibiotic resistance APEC strains isolated from broilers. Dajana Lendak. Živoslav Grgić. Ljiljana Suvajdžić. Vojin Ivetić 16:05 – 16:15 Epizootiological importance of Salmonella spp. Božidar Savić. Hannover. Yan Zhou. Maja Velhner. Tamaš Petrović. Tamara Krstić.3 Detection of L. Marko Pajić. Miloš Kapetanov.: Recent findings in Serbia and brief overview of resistance mechanisms and molecular typing methods. Marina Žekić Stošić. Vesna Kovačević-Jovanović.First International Symposium of Veterinary Medicine – ISVM2015 15:55 – 16:05 Seroprevalence of hepatitis E virus in commercial pig farms. Vesna Turkulov.2 Hemorhagic fever with renal syndrome in Serbia. Maja Bekut. Aleksandar Milovanović. Tamara Krstić 18:30 – 18:40 Antibiotic resistance to fluoroqionoles in Salmonella spp. Đorđe Cvetojević. Corinna Kehrenberg 17:00 – 17:30 Plenary lecture: Mechanisms of multidrug resistance in bacteria of animal origin. Maja Velhner. Zoran Suvajdžić 18:20 – 18:30 The concept of reserve antibiotic. Aleksandar Mašić. Germany) 17:30 – 17:45 Invited presentation: Potential spread of antimicrobial resistance via drinking water in livestock husbandry. Spomenka Đurić. Branislav Kureljušić. Gordana Kozoderović. Ljiljana Živanović. Siniša Sević. Jelena Protić 6. Irena . Serbia) 18:00 – 18:10 Antimicrobial resistance of Enterococcus faecalis strains from pork. Tamaš Petrović 16:35 – 17:00 Coffe break with posters 17:00 – 19:00 Session 7 – Main Hall Antibiotic resistance Chairs: Jelena Petrović. Nebojša Ilić. Bojana Prunić.4 Live attenuated swine influenza viruses as vaccine candidates. in the western part of Romania. backyard pigs and slaughtered pigs in the region of the city Belgrade. Isolated in different poultry farms in Southern Bačka and Srem region. Vesna Milićević. Novi Sad. Shawn Babiuk. Oliver Radanović. Iancu Ionica. Diana Lupulović. Dubravka Milanov. Siniša Sevic. Jasna Kureljušić. Igor Stojanov (Scientific Veterinary Institute Novi Sad. Maja Velhner. Novi Sad. Jasna Prodanov Radulović. Ljiljana Suvajdžić. Maja Bekut. Ljiljana Živanović 16:25 – 16:35 Discussion for all presentations and posters in Session 6 Posters – Hall B (Piva) 6. Jelena Petrovic (Scientific Veterinary Institute Novi Sad. Serbia) 17:45 – 18:00 Invited presentation: Antimicrobial activity of the essential oils from some aromatic medicinal plants cultivated in Serbia. Vedrana Petrić 6. interrogans serovar hardjo in experimentaly sub cutaneus infected rabbits by diferent diagnostical methods. Miloš Vujanović. Corinna Kehrenberg (University of Veterinary Medicine. Srđan Stojanović. Viorel Herman. Vladimir Polaček. Radomir Ratajac. Ivan Pusic 6. Danka Maslić-Strižak. Vesna Turkulov. Igor Stojanov 16:15 – 16:25 Sepsis and meningoencephalitis caused by Streptococcus suis bacteria – a case report. Cătană Nicolae 18:50 – 19:00 Discussion for all presentations and posters in Session 7 17 Majda Golob. Branka Vidić. Nemanja Jezdimirović. Igor Stojanov. Dobrila Jakić-Dimić. Sara Savić. Grozdana Čanak. Zdovc 18:10 – 18:20 Antimicrobial activity of blackberry juice from Serbia on animal pathogens.1 Listeria monocytogenes meningoencephalitis in humans. Dalibor Todorović. Mila Rajković.

Aleksandar Milovanović. Maja Velhner. Siniša Sević. Carsten Krischek. Sandra Prüller. Patrick J. Felix Reich.5 Comparison of agar dilution and broth microdilution susceptibility testing of Haemophilus parasuis isolates from Germany. Radomir Ratajac. Daniela Deus. Corinna Kehrenberg 7. Bojana Prunić. Conny Turni. Cornelia Frömke. Dejan Bugarski 7. Tamaš Petrović 09:00 – 09:30 Symposium Conclusions with discussions 09:30 – 09:40 Closing Remarks 09:40 – 12:30 Tourst excursion . Lothar Kreienbrock. Petar Knežević Dinner and free time 1 9 : 0 0 Saturday. Marina Žekić Stošić.First International Symposium of Veterinary Medicine – ISVM2015 Posters – Hall B (Piva) 7. Corinna Kehrenberg 7. Vesna Milošević.3 Quantification of viable campylobacter cells by qPCR after ethidium monoazide and propidium monoazide treatments of cells. Ivana Hrnjaković-Cvjetković. Günter Klein. isolated from poultry flocks in Southern Bačka and Srem region. Matthias Greiner.1 Growth competition experiments revealed a fitness cost in triclosan tolerant salmonella enterica mutants of different serovars. Sandra Prüller.8 Antibacterial susceptibility of mastitis pathogens to iodine-lithium complex in vitro.Visits of cultural and historical places . Vladimir Polaček.4 In-vitro susceptibility to eight biocides in extended-spectrum βeta-lactamase (ESBL) producing Escherichia coli–isolates of human and avian origin. Katrin Strutzberg-Minder. Carsten Krischek. Milivoje Petrušić.10 Resistance of Black-Headed gull (Chroicocephalus ridibundus) and mute swan (Cygnus olor) Escherichia coli to second and third generation of cephalosporins.6 Susceptibility of methicillin-resistant and susceptible Staphylococcus aureus isolates of various clonal lineages to eight biocides. Dalibor Todorović. Marko Pajić. Birgit Strommenger. Verica Aleksić.optional 1 End of Symposium 2 : 3 0 18 . Heike Kaspar. Diana Meemken.7 Surveillance of antimicrobial resistance at the clinic of infection disease in Clinical Centre of Vojvodina. Aleksandra Petrović. Jelena Petrović. Igor Stojanov. Corinna Kehrenberg 7. Jelena Apić 7. Heike Kaspar. Isa Adriana Kernberger-Fischer. Sandra Stefan-Mikić. Corinna Kehrenberg 7. Corinna Kehrenberg 7. May 23. Vedrana Petric. Diana Seinige. Günter Klein. Günter Klein. Blackall.2 Bordetella bronchiseptica: proposal for a modification of the broth microdilution susceptibility testing method. Günter Klein. Ulrike Rensch. Carsten Krischek. Günter Klein. Corinna Kehrenberg 7.9 Random amplified polymorphic DNA analysis – RAPD and resistance to antimicrobial agents in Salmonella spp. Yvonne Pfeifer. Günter Klein. 2015 09:00 – 09:40 Main Hall Symposium Conclusions and Closing Remarks Chairs: Miroslav Ćirković. Miloš Vujanović 7. Dubravka Milanov.

In the late 19th century. Novi Sad. One Health.THE ROLE AND IMPORTANCE OF VETERINARIANS Milijan Jovanović1*.bg. Serbia 2. We see One Health as a concept that would drive new research ideas and greater collaboration.between animal and human medicine there are no dividing lines –nor should there be". and said ". The phrase "One Medicine" was developed and promoted by an American veterinary epidemiologist Calvin W. coined the term "zoonosis". 2014). working locally. Veterinarians have opportunities and responsibilities to protect the health and well being of people. Serbia * Corresponding author: milijan@vet. ecosystem. to indicate the infectious disease links between animal and human health. but the concept extends back to ancient times and can be traced as far back as to the Greek physician Hippocrates. animals and the environment. severe acute respiratory syndrome (SARS).First International Symposium of Veterinary Medicine – ISVM2015 Key note speech ONE HEALTH CONCEPT .ac. but also wildlife specialists. University of Belgrade. It could be defined as the collaborative efforts of multiple disciplines. However... animals and ecosystems are interconnected. Miroslav Ćirković2 1. The concept One Health has been adopted with great enthusiasm by the veterinary profession. and comparative medical research. to reach optimal health for people. there appears to be some confusion as to what the term really means. food safety. zoonoses Introduction The One Health Concept is a worldwide strategy for expanding interdisciplinary collaborations and communications to improve all aspects of the health and welfare of humans. The term “One Health” is used in many different contexts. ecosystem protection.rs Abstract The One Health concept is defined as the collaborative efforts of multiple disciplines. economists and sociologists. Because in the early year of 21st century emerging zoonotic diseases created several international crises governments and scientists worldwide recognized that greater interdisciplinary collaboration was required to prevent and control diseases such as bovine spongiform encephalopathy (BSE). animals and the environment (Gibbs. Some authors consider the terms “One Medicine”. there appears to be some confusion as to what the term really means. However. anthropologists. nationally and globally. animals and ecosystems in all the areas in which they work: food security. The One Health concept recognized that the health and wellbeing of humans. humans. highly pathogenic avian influenza (HPAI H5N1) and etc. emerging infectious diseases. “One Health” and “One World-One Health-One Medicine” to be entirely synonymous. Keywords: animals. nationally and globally. and it is used in a 19 . animals and the environment.Faculty of Veterinary Medicine. It had highlighted the need for professional collaboration and that such collaboration should include not only physicians and veterinarians. One Health is a new phrase. Scientific Veterinary Institute „Novi Sad“. environmentalists. Belgrade. antibiotic sensitivity testing. working locally. to reach optimal health for people. among others. Schwabe (1927–2006). The tripartite group FAO/OIE/ WHO promotes and supports One Health approach. research on zoonoses. The term ‘One Health’ is used in many different contexts and by people with varying backgrounds. German physician and pathologist Rudolf Virchow (1821–1902).

One Health. in India on a stone edict. and Places". 2009) while others point out some differences. Along roads I have had wells dug and trees planted for the benefit of humans and animals (Lerner and Berg 2015). comparative medicine. 370 BCE) and his text "On Airs. Wherever medical roots or fruits are not available I have had them imported and grown. “One Health” and “One World. in which he promoted the concept that public health depended on a clean environment. . The recognition that environmental factors can impact human health can be traced as far back as to the Greek physician Hippocrates (c. I have had them imported and grown. Also. but the concept extends back to ancient times. Figure 1. Rudolf Virchow (1821–1902) 20 . a common concern about the health of humans and animals: . . which refers not only to infectious diseases but also encompasses the general public health. Wherever medical herbs suitable for humans or animals are not available. 2015). 304 BC-232 BC). Some authors consider the terms “One Medicine”. History One Health is a new phrase. (Anon. everywhere has Beloved-of-the-Gods. One Medicine” to be entirely synonymous (Gibbs and Anderson. written in the time of King Ashoka (ca. made provision for two types of medical treatment: medical treatment for humans and medical treatment for animals. laid down by the roadside. often including or bordering concepts such as infection biology. Waters. It is certain that the term One Health most commonly used today and has the widest and comprehensive meaning. which are subtly nuanced (Lerner and Berg. comparative medicine and ecology. zoonotic infections.First International Symposium of Veterinary Medicine – ISVM2015 wide range of contexts. evolutionary medicine. 2015). contagious diseases. and translational medicine. King Piyadasi. 460 BCE – c.

Another pathologist. The tripartite note clearly recognizes that addressing health risks at the human-animal-ecosystem interface requires strong partnerships among all stakeholders. 2014).First International Symposium of Veterinary Medicine – ISVM2015 In recent history. Schwabe proposed a unified human and veterinary approach to zoonoses in the 1964 edition of his monograph ‘Veterinary Medicine and Human Health’ which has reached the third edition that appeared in 1984(Cardiff et al. This series of recommendations became known as the Manhattan Principles. and a year later in 2007. The idea of greater collaboration between veterinary and medical profession over time more and more developed in the USA. animals and ecosystems are interconnected. but also he demonstrated anatomy and pathology on a daily basis to the veterinary students from the Montreal Veterinary College. the American Veterinary Medical Association (AVMA) established the One Health Initiative Task Force. in recognition of the fact that the meeting was hosted by Rockefeller University in New York (Gibbs. established a modern approach to the role of animals in human health which developed and promoted through concept One Medicine.2009). which was held in New York in 2004. William Osler (1849-1919). 2014. Virchow noted the link between diseases of humans and animals and coined the term ‘zoonosis’ to indicate the infectious disease links between animal and human health. In the middle of the twentieth century Calvin Schwabe (1927-2006). The World Veterinary Association (WVA) recognizes and supports the Tripartite Concept Note titled “Sharing responsibilities and coordinating global activities to address health risks at the animal-human-ecosystem interfaces” jointly developed and adopted by the World Organization for Animal Health (OIE). In 2006. Kaplan et al. The object is different but the experience obtained constitutes the basis of all medicine”. 2014). 1821-1902) (Figure 1) which is its position formulated in the following statement: “Between animal and human medicine there is no dividing line-nor should there be. The term One World-One Health was first introduced at the meeting of the Wildlife Conservation Society (WCS). domestic animals and public health. The goal of the concept The One Health Concept recognizes that the health and wellbeing of humans. 2008). His concepts of One Medicine were based on the close relationship between humans. multidisciplinary and cross-sectorial approach to address potential or existing risks that originate at animal-humanecosystem interfaces. He described the life cycle of Trichinella spiralis in swine and its zoonotic consequences. In the early 20th century Virchow concept is beginning to fade and lose interest in the medical and veterinary profession. It involves applying a coordinated. 21 . As an active participant in comparative pathology. 2008. Gibbs. a Canadian physician was also ardent supporter of unique medicine. the American Medical Association unanimously approved a resolution calling for increased collaboration between the human and veterinary medicine. which develop as an independent discipline. a veterinary epidemiologist and parasitologist at the University of California. World Health Organization (WHO) and the Food and Agriculture Organization of the United Nations (FAO) in 2010 (Anon. He lectured to not only medical students. the great advocate of a unique approach to medicine was the founder of modern pathology German pathologist Rudolf Virchow (Rudolf Virchow. collaborative. At this meeting were adopted 12 recommendations to embrace and protect both medicine and ecosystem health. The term ‘One Health’ had entered the medical and scientific lexicon (Cardif et al. He briefly studied in Germany with Virchow and after he got a lectureship in the Medical Faculty of McGill University in Montreal. The son of a butcher. he became vice president and later president of the Veterinary Medical Association. Davis School of Veterinary Medicine.

2015). and health economy. or the ecosystem level (Lerner and Berg.8%) and have been increasing in recent years. created several international crises (Gibbs. environmental chemistry. it is not difficult to understand because that about two-thirds (60. economic. 2008). and are a crucial part of healthy ecosystems. Health is a state of complete physical.3 %) of emerging infectious diseases (EID) result from zoonoses. “Nowhere is remote and no one is disconnected“(Frank. combating microbial resistance to antibiotics. Animals. is projected to reach 9 billion in 2050. to mention some of the most important ones. play a key role in the wellbeing of people and the future of our planet. Some believe that the One Health concept was just created and developed in fear of these diseases (Gibbs. including extensive human mortality. 2014). 2014). human medicine. The population of the world is increasing from the current 7 billion. Wellbeing and welfare reinforce health. environmental and ecological factors. Both also influence and are impacted by the health of the environment. A number of scientific fields are present under the umbrella of One Health (see the top row circles): biology. hantavirus infections and others diseases that had the potential to become pandemic. public health. The man and animals in a broader sense belong to the one multispecies animal world in 22 . The concept of health could be defined on at least three different levels: the individual level. mental and social well-being and not merely the absence of disease or infirmity.First International Symposium of Veterinary Medicine – ISVM2015 The importance of One Health concept in the modern world is increasingly gaining in. Global resources to combat the emergence of infectious disease are not well allocated as most of the research and surveillance activities are occurring in countries that do not fit the predicted sites from which new diseases are likely to emerge. Microorganisms can travel by plane across the world in time frames shorter than their incubation periods. Governments and scientists worldwide have found themselves facing a great challenge and recognized that greater interdisciplinary collaboration was required to prevent and control of these diseases. 2014). With the development of technology. A major finding was that there was a high correlation between EID origins and socio-economic. domesticated and wild. food. 2015). the majority of these have their origin in wildlife (71. Ebola. veterinary medicine. In the early years of the 21st century with the advent of diseases such as highly pathogenic avian influenza (HPAI H5N1) severe acute respiratory syndrome (SARS). environmental and ecological factors. They provide working power. Middle East respiratory syndrome (MERS). the world has continued to shrink. Bovine spongiform encephalopathy (BSE) AIDS. West Nile virus. the group or population level. The increase in population will require greater need for safe and quality food of animal origin (Wall. and equally animal health and welfare are strongly interlinked. air and water transport. 2008). Country borders do not exist for vector-borne diseases (Valčić et al. Health is a precondition for wellbeing and respectively welfare. climate change and wildlife conservation are further mega-concerns where One Health can make contributions. protection. companionship and enjoyment. socio-cultural. facilitate the advancement of biomedical research. People’s health and wellbeing. Humans serve as a primary reservoir for only 3% of known zoonotic pathogens (Frank. It is the outcome of a complex of several inter-dependent medical. As a starting point for an explanation of "One Health concept" many authors have taken symbolic umbrella model (Figure 2). Food safety. which was developed in Sweden and from which we can see the complexity of the concept. Keeping animals healthy is essential for the health and well-being of people and the environment (Mills and Hall. Special problems are caused by vectors transmitted diseases. thereby providing a mechanism by which areas (called “emerging disease hotspots”) where EIDs are most likely to originate. 2005).

demonstrated the feasibility and advantages of plant-based production platforms for various recombinant proteins with therapeutic use. Plant made therapeutic products are currently on the cusp of widely entering biotechnology markets. it follows that since our food sources are all derived directly or indirectly from plants we must protect plant life on this earth to maintain healthy humans and healthy animals. enterotoxigenic E.First International Symposium of Veterinary Medicine – ISVM2015 which in some cases shared a common pathogen. coli (ETEC) and porcine transmissible gastroenteritis coronavirus 23 . including. toxic agents from the environment. Recent advances in immunology and in biotechnology. We need human doctors (physicians) and animal doctors (veterinarians). The One Health concept presented in the form of an umbrella In the One Health concept. plant health is often perceived as a part of ecosystem health rather than as a separate entity and has essential impact on human and animal health Recognizing the basic fact that all humans and animals must eat to survive. How to plant health can affect the health of animals. as well as plant doctors (plant pathologists) – to work together for the common good of all species. vaccines been made against chicken infectious bronchitis virus (IBV) and infectious bursal disease virus (IBDV). animal products safety and health of people and which problems of that might arise. Figure 2. subunit vaccines. well you can see from our example from 2013 regarding the appearance of larger amounts of aflatoxin in corn grain and corn products. plant pathogens play a direct and indirect role in the ecological existence of human and animal species. Besides their role in the preservation of ecosystems and the importance as a source of food plants will be in the future more and more used in the protection of animal health. Thus. complex antibodies and immunogenic virus-like particles. To date. and also they are together exposed to harmful.

regardless of their field of practice. The veterinarian is the only health care professional likely to see both people and their animals. and the careful disposal of waste). asthma.g.. and human physical/mental health. diabetes. Comparative medicine Comparative medicine is the study of disease processes across species and is based on the study of naturally occurring diseases of animals that also afflict humans Comparative medicine is. There should be a good relationship and communication between public and private veterinary sectors as well as between veterinarians and animal owners and keepers. and chemicals. zoonoses..First International Symposium of Veterinary Medicine – ISVM2015 (TGEV). The 24 .g.. making comparisons that include several different species but not necessarily always including Homo sapiens. 2014). prudent use of medicines. Animals suffer from many of the same chronic diseases such as heart disease.  competencies in the use of antimicrobials and thus insuring their effectiveness in both animal and human medical practice.. comparative medical research. through treatment and prevention of diseases and promotion of animals’ physical and mental wellbeing). Hence. as veterinarians are also often interested in comparing different animal species with each other. through preventing foodborne diseases and food frauds. cancer.  ensuring sufficient food (e. and overseeing best practices for use of animal medicines). research on zoonoses. and arthritis as humans. In achieving the One Health concept veterinary profession has a special responsibility and prominence in the implementation of the following:  enhancing the health and welfare of animals (e. or the other way around. The ancient Greeks understood that dissecting and studying animals could yield important clues to understanding human diseases. emerging infectious diseases. The role of the veterinarians Veterinarians.  improving the health of people (e. all play a significant role in human health and animal health Veterinarians in all areas of the profession have opportunities and responsibilities to protect the health and well being of people in all the areas in which they work: food security..g.  ensuring safer animal products for human consumption (e. 2008). Fortunately. and public health. 2014). antibiotic sensitivity testing. Therefore veterinarians are in a better position to discover public health threats than are physicians. through conservation. bovine herpes virus (BHV) and bovine viral diarrhea virus (BVDV) (Kolotilin et al.  protecting the environment (e. that is. They are also in an ideal position for establishing a disease surveillance system using pets as sentinels of disease exposure in the home environment and in the wild (Frank. The concept of comparative medicine is very old. it has limitations from a veterinary point of view.g. veterinarians have considerable training in comparative medicine. based on the idea of comparing humans to one or more chosen animal species. food safety. Physicians on the other hand do not receive extensive training in comparative medicine and zoonoses. through technological and management advances).g. ecosystem protection. by definition. in the use of antimicrobials and thus preserve their effectiveness in veterinary and medical practice (Anon. so he/she therefore has an awareness of the potential threat of zoonotic disease and has the ability and responsibility for detecting zoonotic/emerging diseases. Sometimes a disease entity is recognized in animals long before it is recognized in humans. through detection and prevention of zoonotic diseases)..

it has been proven that mutations of one gene in one species cause a similar disease in other species. or anything else possibly relevant) that would be available to scientists who perceive certain problems from different aspects (Lerner. 2009). We have an optimistic attitude. it is essential to embed the One Health Concept into the curricula at colleges. the virus discovered to cause sarcomas in chickens by Peyton Rous and others. Comparative sequence analyses demonstrate extensive genetic homologies among species. public health. schools and faculties educating animal. As the genes and diseases are the same. Each was attended by several hundred professionals. or a paradigm shift that will lead to a wider and deeper commitment to interdisciplinary action addressing the protection and needs of society in the 21st century. fecal samples. the first in Australia in 2011 and the second in Thailand in 2013. both in the public and private sectors. blood. there is thinking about creating "Open access bio-banks" where will be kept biological material (be it tissue. aging and genetic disorders (http://www. In modern biological science is dominated by molecular biology and there is a need to learn more and more about less and less. and environmental health professionals. Conclusion The advancement of the health and well-being of people and animals depends on effective and sustained collaboration between varied professions and disciplines. recapitulates the disease in the mouse. animal and environmental health.org. such as a particular method of fixation in fractures were first applied in veterinary practice (Cook and Arnoczky. It is time to consider whether One Health will prove to be a short-lived response to a spate of emerging diseases that apparently threatened to the world. New communication technologies provide excellent opportunities to spread information and engage people in postgraduate education. Isolation and cloning of a gene associated with human disease. To enhance interdisciplinary scientific collaboration. In some parts of the world today is possible in this field to gain a degree MSc and PhD at the University (Gibbs. To familiarize professionals with One Health. One Health in education Given the importance of One Health to the enhancement of human. Clearly. Furthermore. effluent water. limited impact on solving global problems. 2015). human. and we hope that the future will most likely bring 25 . A third international congress is planned for 2015 in Amsterdam. the medicine will be the same: the genetic version of One Medicine or One Health approach (Cardiff. In the United Kingdom has been established the Comparative Clinical Science Foundation to fund comparative studies in cancer.First International Symposium of Veterinary Medicine – ISVM2015 musculoskeletal system is particularly well-suited to comparative medicine studies since acute and chronic disorders of bones and joints have the same counterparts in humans and animals. thereby advancing the diagnosis and treatment of musculoskeletal disorders.uk/). For example.onemedicine. Observation of animal health and welfare. when inserted into and expressed by the mouse genome. 2014). Information gained from one species can be directly translated to another. For continuous improvement it is necessary a broad interdisciplinary holistic approach to develop effective action that fully emphasizes One Health philosophy. zoonotic and environmental problems as a separate discipline and entities would have in a long term. like the existence of "Open access publishing". regional. numerous international. and workshops have been organized. symposia. and national conferences. Two international congresses have specifically addressed One Health. one gene can cause the same disease in another species. 100 years ago harbours the gene associated with cancers in rats. 2008). mice and human. Some of the solutions in orthopedic surgery.

v5. 2014. The Internet Classics Archive.3402/iee. Moore KA. 6(2): e0013715. Lõhmus M. Kaplan B. Cox E. and we are.: Transmission of Ebola viruses: what we know and what we do not know. 2. Stević N. Waters. 14. 11. http://www. Reusken C et al. 45(1): 9-18. 400 BCE. Anon. Ward MJ.mit." One Health Newsletter Florida Department of Health.html Anon: World Veterinary Association Position on One Health Concept. Summer 2009. 2015.27215.President’s Message. Hall S: Animal-assisted interventions: making better use of the human-animal bond Veterinary Record. and Places".org. http://classics. 12. Veterinaria Italiana. 7. 10. Kolotilin I. and wildlife. Valčić M. 2014. 174: 189-192. Canadian Veterinary Journal.3402/iee. Kelley S. Monath TP: The brewing storm.org. Joensuu J et al. Infection Ecology and Epidemiology 2015. Lerner H. 174: 269-273. vol.First International Symposium of Veterinary Medicine – ISVM2015 more collaborations of veterinarians from all fields with multiple professions such as public health. 9.one pathology’: are veterinary and human pathology prepared? Laboratory Investigation. Verner-Carlsson J. Gibbs EPJ:The evolution of One Health: a decade of progress and challenges for the future. 13. Veterinary Research 2014. Topp E. Cardiff RD. 5: 25300 http://dx. Veterinary Record 174: 85-91.v5. "On Airs. 49(11): 1063-1065. wiser. 5: 27215 . Anderson TC: “One World-One Health” and the global challenge of epidemic diseases of viral aetiology. Zbornik predavanja XXXVI Seminara za inovacije znanja veterinara. References: 1.http://dx.: First evidence of Seoul hantavirus in the wild rat population in the Netherlands. Brosseau LM. Frank D: One world. one medicine . www.edu/Hippocrates/airwatpl. Together. Barthold SW: ’One medicine .25300. Obrenović S. Strand TM. Vasić A: Vektori kao rezervoari I prenosioci infektivnih bolesti životinja. Verkerk M. Arnoczky SP. 2009. 2015.pdf. 5.doi. 88: 18-26. 15. 4. Hippocrates. one health. issue 3.1128/mBio. 2008. human medicine. 2009. "The One Health Concept in Comparative Orthopaedics. Wall P: One Health and the food chain: maintaining safety in a globalised industry.00137-15.doi. Berg C: The concept of health in One Health and some practical implications for research and education: what is One Health? Infection Ecology and Epidemiology 2015. 6. Cook JL. animal science. Mills D. 2008. Radojičić S.fl. Kahn LH. Wong G.: Plant-based solutions for veterinary immunotherapeutics and prophylactics. 3-18./10. 26 . Osterholm MT. 2. Veterinaria Italiana. bio-engineering.doh. 45(1): 9-18. Davriendt B.us/environment/medicine/One_Health/OHNLSummer2009.state. Conrad U.doi:10. 45: 117. Veterinary Record. Murphy FA et al. 8. 2014.org/10. Gibbs EPJ. indeed. Translated by Francis Adams. environmental science.worldvet. we are stronger to fight disease. Sundström K. 3. 2014. mBio 2015.

First International Symposium of Veterinary Medicine – ISVM2015 ________________________________________________________________________ Session № 1 DISEASES OF FARM ANIMALS Full Papers _______________________________________________________________________ 27 .

since EIAV positive horses are in general slaughtered and stallions shedding EAV in the semen lose their value. EVA cases are mainly sporadic in European countries with very few descriptions of “pathogenic” strains leading to death or abortion in pregnant mares. Equine infectious anemia is caused by a virus (EIAV) belonging to the retroviridae family. genus Lentivirus as the Human Immunodeficiency Virus (HIV) and has a worldwide distribution. Romania and Italy are the most European countries affected by EIA. notifiable diseases. the causative agent of EVA. is a member of the Arteriviridae family. Equine arteritis virus (EAV). Bovine and Feline Immunodeficiency Viruses (BIV and FIV) and the visna-maedi virus. EIAV causes a persistant infection associated to recurrent febrile episodes. These “shedder” stallions spread the virus in the horse population during breeding or when their semen is used for artificial insemination. Virology Unit. the infectious virus can remain in its mouthparts for several hours after biting. anemia. Equine. EAV infection may cause abortion in pregnant mares and the death of young foals. Asymptomatic infected animals are the viral reservoir and can transmit the virus to others equids.fr Abstract Equine infectious anemia (EIA) and Equine Viral Arteritis (EVA) are two equine diseases of importance to international trade listed by the World Organization for Animal Heath (OIE). Phylogeny Equine Infectious Anemia Virus Introduction Equine infectious anaemia (EIA) is a viral disease. To better understand and prevent the viral spread in equine population epidemiological surveys as well as molecular characterization of strains isolated in Europe are investigated. Clinical signs associated to the infection appear between one to three weeks after infection and are characterized by fever. EAV infects equidae and may be transmitted through respiratory and venereal routes. up to 70% of stallions can be persistently infected and shed the virus in their semen sometimes for life. which also includes Human Immunodeficiency Virus (HIV). Moreover. EAV can persist in the reproductive tract of stallions only. EIAV is bloodborne and transmitted primarily via biting flies. Keywords: Virus. edemas and various signs of listlessness and depend on the immune status of the host and viral load upon infection. Insects — mainly horseflies and stable flies — are mechanical vectors: although the virus does not replicate within the insect.First International Symposium of Veterinary Medicine – ISVM2015 Plenary lecture: EIA AND EVA TWO EQUINE VIRAL DISEASES PRESENT IN EUROPE Aymeric Hans1 1 ANSES-Dozulé Laboratory for Equine Diseases. Following the primary infection. The disease is endemic in Romania whereas only sporadic cases have been notified in others European countries. but also iatrogenically if non-sterile needles or surgical equipment are used. 28 . The financial consequences of these diseases are potentially huge. It is caused by Equine Infectious Anaemia virus (EIAV) belonging to the Retroviridae family.HANS@anses. EIAV causes a persistent infection in equids. Also. genus Lentivirus. France * Corresponding author: Aymeric.

If the semen is to be sent to another European Union country. The outbreak is considered to have been eliminated and the restrictive measures are lifted when the remaining horses have tested negative at least twice. 1983. The Agar Gel Immuno-Diffusion test (AGID) known as a Coggins test (Coggins et al. whereas the final stage is asymptomatic (Hammond et al. 1973). leisure horses not used for breeding purposes are barely tested for EIA. and monthly serological testing on the horses remaining at the outbreak site. The virus is disseminated most effectively by this type of mechanical vector-borne transmission when horses are gathered for equestrian events.. but also by contaminated instruments when non-sterile needles or dental equipment are used (Foil et al. any clinical suspicion or confirmation by the results of analysis by an accredited laboratory must be declared to the Directorate General for Food (DGAL) and sample(s) must be sent to the National Reference Laboratory (NRL) for confirmation. 2000. At the same time. thus initiating health control measures... those that had been in contact with the infected animal and those present within 500 m) are identified and placed under surveillance (restriction of movements and regular serological testing to ensure there is no seroconversion within 90 days of the last contact with an infected horse). 29 .. they remain a source of infection for other horses (Issel and Adams. 1981). In its acute phase. the infectious virus remains in its mouthparts several hours after biting (Williams et al. Any equidae testing positive with an agar gel immunodiffusion test (AGID. 1972) is the most widely used to confirm an EIA case. the horses at risk of infection (i. Basically. mainly horseflies and stable flies. the horse shows serious clinical signs that can lead to the animal death. three months apart. veterinarians and the network of laboratories accredited to perform serological analyses to detect EIA.. EIA test is required for horse importation/exportation and for stallions prior semen collection or in hand breeding.e. Moreover.First International Symposium of Veterinary Medicine – ISVM2015 The disease progresses and can be divided in three distinct phases. Recently. more and more outbreaks of EIA have been reported in Europe and USA. are mechanical vectors: while the virus does not replicate within the insect. This clinical surveillance relies on the owners. Review of EIA surveillance in France Outbreak surveillance As EIA is a Category 1 health hazard. the disinfection of facilities and materials. However. thus EIA outbreaks are often detected by a veterinarian following suspicious clinical signs in a horse farm. Since year 2000. 1982). 2013). Virus is transmitted mainly by infected blood through biting flies. also known as Coggins test) is considered to be infected. When EIA is confirmed. Leroux et al. Insects. a declaration of infection (APDI) is issued by state veterinary services.. EIA Control is based on identification of unapparent carriers by detection of EIAV antibodies using serological tests.All stallions used in artificial insemination are tested on a regular basis. some Enzyme Linked-Immuno Sorbent Assays (ELISA) have been developed as well as immunoblots (Issel et al. The chronic stage is characterized by a recurrence of clinical phases such as pyrexia and anemia. a negative Coggins result must be produced in the two weeks preceding the first collection. 2001) with no overt signs of disease. Hawkins et al. Control measures mainly consist of movement restrictions placed on the outbreak site and decontamination by euthanasia of the infected horses. Programmed surveillance Programmed (active) surveillance includes several different measures: • Breeding stallions are monitored systematically: .. these unapparent carriers never eliminate the virus and represent an economical threat for the equine industry.

These surveys revealed that some of the four infected horses had participated in an endurance race in September 2011 in Vaucluse. Furhtermore. A negative Coggins result must be produced in the three months prior to the first service then every three years. more than 180 horses were identified as being at risk of EIA infection. In the absence of subsequent improvement. definitive or readmission after temporary export) and the type of use (slaughter or other).First International Symposium of Veterinary Medicine – ISVM2015 - Stallions serving naturally in certain breeds must also be tested in accordance with their stud book recommendations. All exported equidae must be tested in accordance with the health requirements of the importing country. three of which were also diagnosed with an EIAV infection on February 6th. The index case. noting the poor state of its health (massive weight loss of about 100 kg). swelling of the lower abdomen. hind legs and the penile sheath. no cases of infection were detected among those 180 horses. The epidemiological surveys covered a six-month period from August 2011 to January 2012 and identified (1) all horses that had been in ‘contact’ and at risk for EIA infection and (2) all horses present within a 1 km radius of the outbreak site.). The surveys identified 378 at-risk 30 . after confirmation of the infection in a 16 year-old part-bred Arabian gelding that showed suggestive clinical signs such as fever. 2012. anaemia. the type of importation (temporary. and pale mucus membranes. the horse was euthanised. Belgium and France in 2009 and 2010 among equids imported directly from Romania. Vaucluse outbreak The primary outbreak was declared on January 30th. As a result. nasal bleeding. “voluntary” surveillance is recommended and a test for EIA should be performed whenever there is a change of ownership. and there was no secondary transmission to horses off site. etc. 2012 and all four infected horses were euthanised on February 9th. These two outbreaks were discovered following the appearance of clinical signs that were suggestive of EIA (listlessness. The 27 positive analyses involved eight equines in two distinct outbreaks in two counties: Vaucluse and Gard. the veterinarian suspected an EIA infection and. 2012. the French network of accredited laboratories carried out 15. the virus transmission was not demonstrated outside of the outbreak site. The APDI order for the outbreak site was issued on February 2nd. This site held seven other horses. and was treated for this disease. Despite the high number of at-risk horses exposed during the endurance race in late September 2011. which exhibited fever (40°C) and low haematocrit levels (16%). 2012 outbreaks In 2012. Screening is not mandatory for equids transported within the EU except for those from Romania. The epidemiological survey was first carried out on horses present within 500 meters of the primary outbreak site as well as on all horses that had been in contact with the infected horses during the four months period preceding the confirmation of the outbreak. requiring restriction of movements and testing of all horses on the site.691 serological analyses of which 27 tested positive. Imported equidae must also be screened for EIA according to the exporting country. nasal bleeding. was originally thought to be infected with babesiosis (for which it tested positive). Gard outbreak The primary EIA outbreak declared in September 2012 in Gard involved six horses of the Camargue. Pura Raza Española (PRE) Andalusian. This measure was introduced in 2010 (2010/346/EU) following several cases of EIA in the United Kingdom. Barb and Merens breeds. 2012. weight loss.

The 2012 EIA outbreaks led to the identification of eight seropositive horses. this hypothesis was not confirmed by phylogenetic analysis. However. data of this phylogenetic study show that Vaucluse and Gard outbreaks had two distinct origins because the sequenced virus isolates were not identical. The phylogenetic analysis. The obtained phylogenetic tree shows that the isolates from the outbreak declared in Vaucluse and Gard were not only different from each other but also from those identified previously in France. gag gene (1400 nucleotides long) was sequenced. the seropositive horses in the Vaucluse outbreak were infected by two different isolates (Figure 1). Virus isolates were characterised from five of the eight horses. 3 were tested positive for EIA. The isolate characterised from horse 12D134 shows that it was related to isolates sampled in 2007 on donkeys in Ardèche county (Reme et al. in particular those isolated in Var in 2009 (Ponçon et al. among which only 364 could be sampled..First International Symposium of Veterinary Medicine – ISVM2015 ‘contact’ horses. was used to compare and classify the viruses isolated in 2012 with respect to those isolated previously in France and those reported in the literature (Figure 1). Analysis performed using the full gag gene sequence (1400bp).0. Furthermore.0 software package. sale or trade of horses. 2009). 2011). Although there were indications from the epidemiological field survey that there was an epidemiological connection between the Vaucluse and Gard outbreaks via the purchase. Of these 364 horses. Molecular epidemiology To genotype the EIA strains isolated from various outbreaks. In contrast.. carried out using the MEGA 5. Figure 1: Phylogenetic analysis of 50 EIA isolates using MEGA 5. no epidemiological 31 .

Between 2010 and 2014. Following the 2006 EIA outbreak. Review of EIA surveillance in Europe 2010-2014 EIA is a notifiable disease in Europe. due to the use of contaminated plasma. Likewise. Since 2007. found in Gard county. the number of EIA outbreaks and the number of positive horses detected has steadily decreased over the past few years. corresponding to 4 400 equids only. whereas the 99% left are owned and kept by private individual who possessed in general only one equid. only two countries. Each country has to report any EIA cases. Italy and Romania. Italian authority decided to test also donkeys and mules. Croatia and Hungary during the last four years. These data. The western European countries (UK. It is only after the integration of Romania in European Union in 2006. The first description of the disease dates back to the 50’s in the Baragan region located in the South East of Romania. Finally. since Romania has very few breeding farms. Romania. and the implementation of the surveillance program in Italy. have implemented a national surveillance program to test the horse population registered for EIA. Indeed. Bulgaria. Since 2010. Umbria and Abruzzo) and a test every two year for equids living in area where EIA seroprevalence is lower. UK. Italy. Italy and the Balkans countries (Croatia. two times per year for stallions and sport horses and once a year for others. 10 000 donkeys and 1500 mules are tested each year. that the EIA problem has been seen. In Italy. were similar to viruses isolated in Italy in the past few years (Hans et al.15%. Belgium. Eighty five outbreaks were reported by central European countries (Germany. no epidemiological connection was demonstrated between these two outbreaks. Lithuania. Thus. Moreover. Finland Sweden and Denmark). 2012). The vast majority of outbreaks declared in Europe are sporadic cases without sanitary and economic consequences for horse industry. was kept in stud-farms. EIA outbreaks have been reported from France. Latvia. Belgium. showing that EIA is present all around Europe with different prevalence level. Poland. whereas prevalence is weak in donkeys and horse around 0. The majority (55%) out of 700 000 equids identified in 2010 in Romania are used for work in the fields and not for sport or leisure activity. between 2000 and 2004 Romania has declared 9 953 EIA outbreaks with 30 132 positive equids. even if no clinical signs are seen. a decrease in the number of outbreaks and of positive horses is seen since 2010. Officially. Slovakia. each AGID positive test has to be declared to the national authority then to the European authority. Less than 1 %. France. In Europe. Indeed. Romania has implemented a surveillance program aimed at testing all equids older than 6 months of age. the isolates characterised from horses 12D899 and 12D903. around 230 000 horse sera samples. 32 . no EIA outbreaks have been reported by Baltic and Scandinavian countries (Estonia. prevalence in mule is around 10%.08% and 0. Netherlands. Italy has decided to implement a surveillance program as follow: Annual test of all equids over 6 months of age kept in regions with high prevalence (Latium. Once again. Situation in Romania is totally different compare to Italy. Austria and Hungary) with a total of 105 horses tested positive for EIA during the last four years. Prevalence of the disease is different between horses. from Italy.. Slovenia) have reported more than 7 400 EIA outbreaks between 2010 and 2014 associated to around 10 000 positive horses for EIA. Ireland. respectively. donkeys and mules. Nevertheless. show that the main reservoir for EIA seems to be the mules. Incidence is still difficult to estimate in Romania. Czech Republic. the viral isolates characterised from horses 12D128 and 12D131 were similar to the virus isolated in 2010 in Dordogne county on a cull trotting horse. Germany. Romania. Spain and Portugal) have reported 16 EIA outbreaks with 35 positives horses during the last four years. Netherlands.First International Symposium of Veterinary Medicine – ISVM2015 connection could be established from the field surveys between horse 12D134 and the Ardèche donkey euthanised in 2007.

2013).First International Symposium of Veterinary Medicine – ISVM2015 Equine arteritis Virus Introduction Equine arteritis virus (EAV) is one of the major viral pathogens of horses (Rola et al. The vast majority of EAV infections are subclinical. EAV was initially isolated from an aborted foetus on a Standardbred breeding farm near Bucyrus. dependent edema (scrotum. It is the causative agent of equine viral arteritis (EVA). Bryans et al. conjunctivitis. The direct consequences of EVA outbreaks are financial losses mainly due to abortions of pregnant mares and death of young foals (Vairo et al. 1993b). 1957b). stiffness of gait. in 1953 (Bryans et al.. lacrimation and swelling around the eyes (periorbital and supraorbital edema). up to 70% of the stallions will carry the virus in their reproductive tract sometimes for years (Holyoak et al. 2011). and can infect horses.. Based on phylogenetic analysis of a portion of ORF5 encoding viral glycoprotein 5 (GP5). The latter can be further divided into two subgroups: European subgroup 1 (EU-1) and European subgroup 2 (EU-2) (9. Following primary EAV infection. USA.. The analysis involved 87 nucleotide sequences 33 . 1993). 2012). It has been previously reported that North American and European EAV isolates present 85% of nucleotide identity (Vairo et al... respiratory distress and leukopenia. Holyoak et al. Those stallions will shed the virus in their semen. Figure 2: Phylogenetic analysis by Maximum Likelihood method. EAV is an Arterivirus belonging to the Arteriviridae family in the order Nidovirales (Cavanagh. EAV isolates are classified into two groups: The North American and the European group. EVA is a respiratory and reproductive disease of horses that occurs worldwide (Glaser et al. mules.. 1993a. 1997). 1957a. 2012). 10).. and limbs). Timoney and McCollum. ventral trunk. 1996. Ohio. anorexia.. but acutely infected animals may develop a wide range of clinical signs including pyrexia. depression. and zebras (Balasuriya et al. donkeys..

.V. N.E.. Foil. Colenbrander.R. All of them have been collected between 2007 and 2010. Veterinary microbiology. Mechanical transmission of equine infectious anemia virus by deer flies (Chrysops flavidus) and stable flies (Stomoxys calcitrans). Maclachlan. Only draught and saddle horses were affected. Indeed. Crowe. Nidovirales: a new order comprising Coronaviridae and Arteriviridae. 6.D.L. 1972.J. E. Isolation of a filterable agent causing arteritis of horses and abortion by mares. W... 2013. The phylogenetic tree constructed shows that EVA viruses circulating in France belong to 3 groups defined as the American group (AG). U. 34 . 1957a.. The Cornell veterinarian 47. This genetic feature might explain the severity of the clinical signs and the pathogenicity of the virus that caused several deaths in 2007 This work gives a clear and precise view of equine arteritis viruses strains that are circulating in France. B. Nusbaum. A. 52 of them have retrieved from Genbank database and 35 were from viruses isolated in France between 2007 and 2010. In addition.T. Rottier. 4. 5. Glaser. Archives of virology 142. P.. Evolutionary analyses were conducted in MEGA5 (Tamura et al... Analysis was performed using the 3kb sequences covering ORF2 to ORF7 of the EAV genome. E. Doll.A.Y. EAV isolates belong to the 3 groups described in the literature AG. Investigations are in progress to understand and decipher the pathogenic features of this isolate. M.. L. C.H.. 3-41. 95-99. Diagnosis of equine infectious anemia by immunodiffusion test. C. Coggins. an outbreak of EVA occurred in Normandy. Bryans. Balasuriya.. W. 3. R. since only one virus from the American group has been isolated in France during these 3 years. A. N. Issel. 1957b. This genetic diversity might explain the severity of clinical signs and the higher mortality rate seen during this outbreak.R. 1983. France.R. The objectives of this study were to undertake a thorough epidemiological investigation to identify shedders stallions following the 2007 EVA outbreak as well as the molecular characterization of EAV isolates encountered in France. 69-75. This 2007 outbreak occurred following the used of semen contaminated by EAV for insemination. An outbreak of abortion caused by the equine arteritis virus. EAV viruses isolated during the 2007 outbreak grouped in the European subgroup 2 and are slightly divergent from the ones seen in France the past years. 2011)..J... 155-156. the European subgroup 1 (EU1) and European subgroup 2 (EU2). Y. D. Equine arteritis virus.. 7. Equine arteritis virus: a review of clinical features and management aspects. The Veterinary quarterly 18. L. References 1.. 1997.J. Horzinek.C. S. American journal of veterinary research 33. all viral isolates which are related to the 2007 outbreak formed a smaller group inside the European subgroup 2. J. Doll. de Vries. M.B. 2.. EU1 and EU2. Adams.E. Meek.. 1996. 11-18... Nevertheless the majority of them are from the European lineage.. Cavanagh. Knappenberger. The Cornell veterinarian 47. J.First International Symposium of Veterinary Medicine – ISVM2015 During the summer of 2007. virus responsible of the 2007 outbreak in Normandy belongs to the European subgroup 2 and seems to be slightly different from viruses that use to be isolated in France before the outbreak. Go. American journal of veterinary research 44. its differentiation from the equine abortion (influenza) virus.T... Norcross. 629-633.L. A total of 35 positive semen samples and 5 tissues samples from aborted foetuses were analyzed in this study. Nevertheless the majority of viruses belong to the European group.L.. The phylogenetic tree has been constructed using 87 sequences (figure 2). The evolutionary history was inferred by using the Maximum Likelihood method based on the Data specific model. Bryans. McCollum. Interestingly.

The Veterinary record 172.H. Issel. J.. 2013. Rola. W. 2011.. A. France 165. 295-309.. Equine practice 9. 276-278. Steukers. Kumar. Guix. S. W. M. S.J. M. 13. 17. C.. MEGA5: molecular evolutionary genetics analysis using maximum likelihood. 15. 14. Relationship between onset of puberty and establishment of persistent infection with equine arteritis virus in the experimentally infected colt. E. Montelaro. Autorino.. Caprioli. and maximum parsimony methods. McCollam. 1973. 21. Veterinary microbiology 148.H.... Hawkins.G. 1982.. 2012.... 1993b. A... G.F. Vairo. Glorieux. Napolitan.J.J. G..J. The Veterinary clinics of North America. 402-407. Journal of virology 75. McKeon. L. Wilson. M. Holyoak.. 20.. P. S. Roth.. N. N. evolutionary distance. J. W. 2731-2739.. A. 281-293. Equine infectious anemia virus genomic evolution in progressor and nonprogressor ponies.. Timoney. Ponçon.E.C. Zientara. 2009.. Sr.. Pathological changes associated with equine arteritis virus infection of the reproductive tract in prepubertal and peripubertal colts.) in transmission of equine infectious anemia to ponies in Louisiana.. Adams. Role of horse fly (Tabanus fuscicostatus Hine) and stable fly (Stomoxys calcitrans L. 19.. 5968-5981.. F. Steelman. S. Journal of the American Veterinary Medical Association 180.. Stecher.M. Montelaro.. American journal of veterinary research 34. Adams. Craigo. R. Reme. W..R.. Little... Ponçon. 29-46. 2000. W. Giles.T.. 27-34. Timoney.. Williams. 333-344.. 2012... S. J. Hans. S. L.L. 9.C. Studies with equine infectious anemia virus: transmission attempts by mosquitoes and survival of virus on vector mouthparts and hypodermic needles.. 11. 12. P. 16. Moutou. Nauwynck.V. R.M. L.J.V. I. A.L. Molecular biology and evolution 28. A. 18. Immune responses and viral replication in long-term inapparent carrier ponies inoculated with equine infectious anemia virus. B.. Journal of comparative pathology 109. Autorino. G. Nei.. T. Journal of comparative pathology 109. G. 2001. G.... Rosone.. Scicluna.. N. R. Cook.K. C.V. Detection of equine infectious anemia virus in a horse with an equivocal agar gel immunodiffusion test reaction. C. Rola. D. C. Klotz. Tamura. Hans. American journal of veterinary research 42. Issel.. Issel. E.J. F. S.. Bull. R. Cook. Epizotiology and phylogeny of equine arteritis virus in hucul horses... Moutou. Bilan de la surveillance de l’Anémie Infectieuse des Equidés en France en 2010: gestion de deux épisodes asymptomatique.. 2011..D. P. Adams.J.K. 2011. Benton. Anémie infectieuse des équidés: deux foyers récents en Ardèche et dans le var. K. B. Equine viral arteritis. Belak.R. N. Le Guyader. Timoney.. S. Gaudaire. Issel.. C. 210. McCollum.. 1981.H. T. Issel. Peterson. C. Li. Hans. Ponçon...V. A.. Peterson. D... 1993.. H.. F. Hammond. E. Journal of virology 74.J...C.L.C..J. Ricci.. Clinical and virological outcome of an infection with the Belgian equine arteritis virus strain 08P178. Van den Broeck. C.. Jr. J.. W. 1993a. Leroux. Bulletin épidémiologie santé animalealimentation BE 33. Craigo.V.J. Acad.. Little. Cook.. 10.First International Symposium of Veterinary Medicine – ISVM2015 8.A... Vandekerckhove. R. Challenges and proposed solutions for more accurate serological diagnosis of equine infectious anaemia. W. Veterinary microbiology 157. 1469-1473 35 . 1583-1586.. F. Montelaro. Vét. C. and in mosquito tissue culture. 54-55. Situation épidémiologique de l’anémie infectieuse des équidés en France et en Europe de 1994 à 2011...H..V. J. S. Larska. Jr. 4570-4583.... Cook. Bulletin épidémiologique santé animale-alimentation.A.. Holyoak. McCollum. D.

3 and 2. BVDV is distributed throughout the world.uni-lj. a member of the Pestivirus genus of the family Flaviviridae (Lindenbach and Rice. Danijela Rihtarič1. diagnostics. but levels of shedding are much higher in PI cattle. It is caused by bovine viral diarrhea virus (BVDV). while in some European countries such as Sweden.. eradication. We hope that voluntary programme is first step towards the eradication of BVDV at national level. The BVDV infection will persist for the life of the calf. a free status of BVDV for an individual herd can be achieved. BVDV is spreading by close contact (nose-to-nose) between cattle and produce heavy economic losses in infected herds. 1989). or PI.First International Symposium of Veterinary Medicine – ISVM2015 Invited lecture THE VOLUNTARY PROGRAMME FOR CONTROL AND ERADICATION OF BOVINE VIRAL DIARRHEA VIRUS INFECTIONS IN SLOVENIA Ivan Toplak1. For the recognition of officially BVDV free status of herd the breeder should provide two consecutives laboratory testing at intervals of at least six months in all animals which are during the sample collection in the age group of 7 to 13 months. With the beginning of year 2014. National Veterinary Institute. All herds with recognized BVDV free status are presented on web site of The administration of the Republic of Slovenia for food safety. Norway. Virus is shedding by both acutely and persistently infected (PI) animals.. The basis of voluntary programme is identification and certification of herds which are free of virus. veterinary and plant protection. with negative results for antibodies.Toplak@vf. cattle Introduction Bovine viral diarrhea (BVD) is a disease of cattle that reduces productivity and may increases death loss. 2005. acquisition and maintenance. according to new national rules. it can start with the acquisition programme through the identification and elimination of persistently infected animals and laboratory testing all newborn calf for BVDV during one year of period.6 % 36 . which are the natural reservoir for the virus. hence the term ''persistent infection''. the disease has already been eradicated (Obritzhauser et al. Ljubljana. and preventive measurements are implemented in a herd. The incidence of PI animals is estimated between 0. which prescribes the conditions for recognition. During last twenty years only limited progress towards the eradication was achieved. Jože Grom1 1. Houe et al. First herds with officially BVDV free status confirming. Foetuses that become infected between 30 and 125 days of gestation and survive the infection may be born as BVDV infected calves (Brownlie et al. that this practice is a good and cost effective solution for our farmers. Slovenia * Corresponding author: Ivan. based on laboratory testing. Finland and Austria.. 2001). Peter Hostnik1. with endemic areas detecting antibodies among 70–100 % of herds. 2006). The farmer will then maintained the status by the implementation of preventive measures and each year renewed this status with one laboratory testing of all animals in the age group of 7 to 13 months. Keywords: bovine viral diarrhoea virus.si Abstract In Slovenia the control of bovine viral diarrhea viral (BVDV) infection was started 1994. University of Ljubljana. If herd is recognized as BVDV positive. About half of the bovine herds were recognized with BVDV antibody positive animals. if specific requirement. Veterinary Faculty. At the beginning of year 2015 in Slovenia already 11 bovine herds are officially free of BVDV.

. 107/2013) were introduced. which are important preventive measures in a country to prevent spreading of BVDV by the semen. Although it is difficult to estimate the disease cost because of variable infection many cost-benefit analysis proved the positive impact of BVDV elimination at herd and eradication at national level (Houe.. 2009. Starič et al. 2014). we would like to present some experiences with new rules and some preliminary results. 2006). 37 . In this paper. Toplak.. With the beginning of 2014. This program is modification of the BVDV eradication programs successfully established at national level in Sweden. Fulton et al. Young bulls are tested for BVD antibodies and BVDV genome just before entering the breeding centres and later once per year in centres. 2004). Obritzhauser et al. 2004).. 2001. 2004). 1999. milk or even oral swab samples can be collected for detection of virus (Kenedy et al. 2010). 1d. By removing the source of infection (PI animals) from the population the disease can be controlled (Houe et al.. but also introduction of new strains from abroad (Toplak et al. Denmark and Austria (Lindberg and Alenius. Toplak et al. Molecular methods are used for molecular epidemiology studies to confirm the transmission of the BVDV between infected herds. new national rules determining the conditions for recognition.. 2006.. 2005). Toplak. 2005). Toplak et al. but the disease is likely to be present in breeding farms for centuries (Grom and Barlič-Maganja. The monitoring of herds infected with BVDV in Slovenia started in 1994. 1f. 2003. Toplak. 1g) as have been detected in years 1998 to 2004 confirming that the same strains have been circulating more than a decade in infected herds (Toplak. 2012). 2004. Finland. Since this time. Häsler et al. Before 2014 only few reports of successful elimination of BVDV was published for Slovenia (Toplak et al. all bulls in breeding and artificial insemination centers are under supervision based on the regular laboratory testing (Hostnik et al.. Comparison of the nucleotide sequences of BVDV strains obtained from different infected herds in the 5'-non-coding or Npro region of the viral genome reviled not only identical strains in different herds. 2002. After one year of experiences some breeders already achieved significant progress in health status. Blood tests are the most frequently used method to identify BVDV in live animals. Basic principles of voluntary program for control and eradication of BVDV infections in Slovenia The program is running on the voluntary basis and breeders can officially acquire the status of a herd free of BVD. but also other samples such as skin biopsies (taken from the ear). 1995). Recognition. acquisition and maintenance of status are based on the results of laboratory tests. During the period 1996 and 2003 from 260 to 312 breeding herds BVD were monitored for the detection of antibodies (Toplak et al. PI animals are the main source of infection in infected herds and tend never to reach their productive potential and growth because of reduced fertility and increased susceptibility to other diseases (Loneragan et al.. The results of genetic typing of 52 BVDV strains collected between 2004 and 2013 from infected Slovenian herds have shown that the identified strains of BVD virus were classified into the same subgroup of genotype 1 (1b. Norway.. BVDV strains of genotype 2 were not identified in Slovenia. free of BVDV (Uradni list Republike Slovenije no.. 2002. 1999. acquisition and maintenance of a herd status.First International Symposium of Veterinary Medicine – ISVM2015 (Baker.. Material and Methods 1. Toplak. 2002). implement preventive measures and maintenance of BVDV free status in the herds. 2004. as well as the farmer who is obliged to implement all measures to prevent re-introduction of BVDV into herd. Vaccination is not practiced as an option in the rules by the program running in Slovenia. the collection centres are free of BVDV. This new regulation helps Slovenian farmers to take a decision how they want to regulate the health status of their herds. Since 1994. 2015).

One year after the elimination of the last PI from the herd all animals in the age group of 7 to 13 months are tested for the presence of BVD antibodies by ELISA. The holder of the animals submits an application for recognition to the Regional Office of Administration for Food Safety. In addition to these conditions. If all animals in the age group of 7 to 13 months are negative and farmer implemented preventive measures. the veterinary administration made a decision which status is withdrawn. which are at that time aged 7 to 13 months. 1. other groups of animals. Sera samples were tested by ELISA 38 .free of BVDV Recognition of a herd free of BVD is granted for a period of one year. the herd owner may apply for recognition of the status free of BVD (Scheme 1).First International Symposium of Veterinary Medicine – ISVM2015 1.g.free of BVDV If the farmer decides to apply for recognition of status. are included. as in this case. must fulfill the conditions laid down for the recognition of BVDV free status. In addition.serum) in the first week of age should be sampled in a herd for a period of one year and tested for BVD genome. Veterinary and Plant Protection. for insemination only semen obtained from bulls free of BVD is used.2 Acquisition of a herd .4 Withdrawal the status . samples are collected in the next age group of animals.year period. The farmers successfully maintain the status by the implementation of preventive measures and status need to be renewed again after one . no animal shows clinical signs of disease. If the laboratory results of these tests are negative in all animals. If a farmer wants to renew the status. Sampling in the herd is repeating at intervals of 12 months.1 Recognition of a herd .138 samples were collected from 99 individual cattle herds and tested for antibody detection.free of BVDV For BVDV infected herds recognition of BVDV free status is possible on voluntary basis after removing BVDV positive animals from the herd. is deleted from the list on the website. the herd owner may submit an application for recognition of a herd free of BVD. Into the second sampling. animals shall be separated by a physical or natural barriers from herds with a lower status. If the results of all animals are negative. e. samples of all newborn calves (blood sample . Rules allow the recognition of the status also for herds that do not have young animals. the same herd is tested after six months again to prove the stability of the herd.free of BVDV If is determined that the herd has no longer qualifications for the status. thus confirming the absence of BVDV infection. PI animals must be immediately slaughtered. Farm. the herd owner should provide two consecutive BVD antibody ELISA testing at intervals of at least six months in all animals in the age group 7 to 13 months (Scheme 1). blood samples (serum) should be collected and tested from all animals in a herd to determine the presence of BVD virus (identification of PI). which has been deprived of the status.3 Maintenance of a herd . In the first step. All BVDV positive calves must be removed from the herd. the age group 14 to 20 months. it must comply with the following: during the past 12 months no BVD infection has been confirmed in the herd. List of herds free of BVDV is published on the website and it is free available to farmers. To keep the status farmer should ensure the laboratory testing for BVD antibodies in all animals in the herd. The most important measure is to eliminate all persistently infected animals (PI) from the herd. which at the time of samples collection are aged 7 to 13 month. 1. only negative animals may be introduced into herd through quarantine. 1. Results During the period between January 2014 and April 2015 in total 1.

First herd with BVDV free status was officially confirmed in July 15. more than hundred cattle farmers already started with first step for recognition of BVDV free status.. This is important information for farmers who covers all costs. including laboratory testing. 2014. According to herd size. number of animals which need to be tested. which want to apply for BVDV free status. still more than half of herds are free of BVDV. Scheme 1: The algorithm for recognition. which was started in Slovenia in January 2014. Between January 2014 and April 2015 in total 2. Until April 2015. Out of 2. Svanova) for detection of specific antibodies against BVDV and samples were interpreted according to producer instructions.186 tested animals 64 (2.First International Symposium of Veterinary Medicine – ISVM2015 (Svanovir BVDV® Ab.186 individual serum samples from newborn calf and cattle were collected from 86 different herds and tested for BVDV genome by RT-PCR as previously described (Toplak et al.the basic principles for voluntary program. For this reason. is usually between 5 and 10. The basic principle of first voluntary program is laboratory testing of young stock together with preventive actions of farmer to prevent reintroduction of BVDV. Veterinary faculty from Ljubljana together with Administration for Food Safety. Discussion The first voluntary program providing officially recognized BVDV free status for individual herds in Slovenia started in January 2014. Although the BVDV infection is endemic in Slovenia with about 30 % of infected cattle herds. official recognition of BVDV free status was confirmed already for 13 individual herds. acquisition and maintenance of BVD free status . Veterinary and Plant Protection and private practitioners prepared the conditions for farmers. After 39 .92 %) were detected BVDV genome positive animals by RT-PCR method. 2015).

because it will extended the circulation of virus in population and maintain the BVDV infection in the herds. The BVDV positive herds can take the actions through the identification and elimination of persistently infected animals from a herd. expressing clinical symptoms and get sick because of acute phase of the disease. the same herd needs to be tested after six month to prove the stability of herd. especially with nasal discharge. maintenance and withdrawal of BVDV free status. BVDV positive animal may not be sold. Breeders who are selling and buying animals will benefits based on BVDV free status. They can decide what kind of animals want buy for a fixed price. feces and urine. specific antibodies can be detected by ELISA and those antibodies are present in the blood throughout life. The identification of PI in infected herds was successful and 64 new PI animals were detected last year. only a small proportion of the entire herd need to be tested. because those animals are the main source for spreading BVDV infection into new herd. The new rules based on voluntary program have already been implemented and widely accepted and we believe that it provides a good solution for our farmers. Our neighbouring countries such as Austria. Farmer needs to be careful about this. usually with percent positive values between 10 and 20. Italy and Switzerland were already implemented or finished similar BVD national program. In the infected herd. The common aim for farmers and veterinarian is healthy herd and healthy animals. calves receive colostral antibodies. which allows lower costs and the recognition of the BVDV free status for many breeders. If the mother is positive for BVD antibodies. These animals secreted the BVD virus into the environment. private veterinary 40 . Acknowledgments Special thanks to Breda Hrovatin. BVDV is quickly transmitted between animals of all ages and this feature of BVD virus can be successfully used in laboratory tests. in rare cases up to 8 months of age. which remain in the blood up to 3 months. Conclusion New rules which were adopted for the first time in Slovenia define the conditions for recognition. acquisition. so we suggest retesting them after one month. Thus.First International Symposium of Veterinary Medicine – ISVM2015 first negative results in a herd. For the recognition and maintenance of BVDV free status. the next step will be moving from voluntary to national program. First 13 herds which have already been officially recognized with BVDV free status are promising. At the moment the action and responsibility is on farmer. Screening of the age group of young animals in the herd (aged 7 to 13 months) assures us that based on the results specific antibodies the current situation regarding BVDV infection in the whole herd is recognized. Our system is still without record of slaughtering those BVDV positive animals and these needs to be corrected as soon as possible. that new rules were accepted from farmers and recognition of BVDV free status have important value to improvement the production on a farm. If such BVDV positive animal is send to other herd this will act like a boomerang. Veterinary Faculty is offering to a breeder special package of discounts for laboratory testing of samples and reduced the time from sample reception to the results on one week. During the laboratory testing it was recognized that individual animals from the sampled age group of 7 to 13 months were low antibody positive in ELISA test. In BVDV infected herd newborn calf are constantly infected within a few months after the birth. The important preventive measure is also that animals must be separated by physical or natural barriers from herds with a lower status and only negative animals may be introduced into herd through quarantine. After two to three weeks. Program is on voluntary basis and gives no compulsion to breeders which can at any stage of the control decide to deviate from the target. The initial testing of herds for antibodies gives also opportunity for farmers to start with the control BVDV in infected herd. not to lose BVDV negative status. saliva. Jedrt Maurer Wernig and group from The Administration of the Republic of Slovenia for Food Safety. Veterinary Sector and Plant Protection. by sucking colostrum.

. v vzrejališčih in rejah bikovskih mater Vet. suppl. Obritzhauser W. Grom J. 2012. Howe KS. 2001. outcome and health consequences associated with persistent infection with bovine viral diarrhea virus in feedlot cattle. Houe H.). Slov Vet Res. 46. 23-30.: Economic impact of BVDV infection in dairies. Doctoral thesis. Powers B. J Am Vet Med Assoc 226: 595–601. Slov. Rice CM. Brownlie J. 5. Presi P. Sci.: The usefulness of two molecular methods for the detection of persistently infected cattle with bovine viral diarrhea using oral swab samples.: Reverse transcription-polymerase chain reaction on pooled samples to detect bovine viral diarrhea virus by using fresh ear-notch-sample supernatants. Hostnik P. vet. 1999 10. Laišček D. References 1.First International Symposium of Veterinary Medicine – ISVM2015 practitioners and farmers for collaboration in program. Hostnik P. Rihtarič D. Bovina virusna diareja (BVD) in opis zdravljenja okužene mlečne reje. Can J Vet Res 73: 117– 124. Res. Vet Microbiol 64. Predlog programa kontrole in izkoreninjenja okužb z virusom bovine virusne diareje v osemenjevalnih centrih. 197-222. This research was financially partly supported by the Slovenian Research Agency. 3: 97-102.: Genetic heterogeneity of bovine viral diarrhoea virus (BVD) strains isolated in Slovenia. 18. 52. 5. Häsler B. Lindberg A. 2005 12. Starič J. 162–173. Fulton RW. 2002 6. Hostnik P. et al.: Flavivirdae: the viruses and their replication. nov. Houe H. 1995 2. Moennig V. Lindberg ALE. Baker JC. Alenius S.: An economic model to evaluate the mitigation programme for bovine viral diarrhoea in Switzerland. Toplak I. Med. 3: 9-13. Raspor P. (Slovenian veterinary research. 2006 7.: Molekularna epidemiologija virusov bovine virusne diareje (BVD) ugotovljenih v Sloveniji med leti 1997 in 2014. Vet Clin Nort Am Food Anim Pract 11: 425–445. Ugotavljanje perzistentnih izločevalcev virusa bovine virusne diareje (BVD) v serološko pozitivnih rejah bikovskih mater v Sloveniji Vet. 2005 13. Kennedy JA. Toplak I. Environment and Food Safety).: Test strategies in bovine viral diarrhea virus control and eradication campaigns in Europe. Toplak I. Lindenbach BD. Grom J. Montgomery DL.: Multiple diagnostic tests to identify cattle with bovine viral diarrhea virus and duration of positive test results in persistently infected cattle. Prevent. Knipe DM. Barlič-Maganja D. 2015 41 . Prev. Grom J. Kosec M. res. Ljubljana: Veterinarska fakulteta. slovenski veterinarski kongres 2014 = 5th Slovenian Veterinary Congress 2014. 11: 449-456. nov.-15. Mortimer RG. Fuchs K.: BVDV infection risk in the course of the BVDV eradication program in Styria/Austria. Vestnik Veterinarske zbornice Slovenije.: Prevalence. J Vet Diag Invest 18: 89–93. 1-142. Ježek J. Portorož. 2003 8. Rihtarič D. 2006 9. 2001 15. November 2014. J Vet Diag Invest 18: 427–436. 991–1041 11. Philadelphia. program group P4-0092 (Animal Health. 14. Barlič-Maganja D. 2014. 2014. 2002 16. Vet. Toplak I. Thanks to Polona Berčon for technical assistance during sample testing. Köfer J. Lippincott Williams & Wilkins. KDC. Thomson DU. Howard CJ: Experimental infection of cattle in early pregnancy with a cytopathic strain of bovine virus diarhoea virus. 1989 3. Hessman BE. University of Ljubljana. Stärk. Hostnik P. Gašperlin B. Grom J. Ridpath JF. Gregor (ur. Loneragan GH. 2010 14. 72. 39: 113-123. Biologicals 31. 16). Veterinary Faculty. Toplak I: Molecular epidemiology of bovine viral diarrhoea virus (BVDV) in Slovenian breeding cattle herds. Toplak I. Med. Vet. In: Fields virology. 127–132. 2004 17. 23-24. 106.: The clinical manifestations of bovine viral diarrhea infection.: Principles for eradication of bovine viral diarrhea virus (BVDV) infections in cattle populations. Mrkun J. Howley PM. 307–311. V: MAJDIČ. Barlič-Maganja D. et al. PA. 4th ed. Clarke MC. 2009 4. Vet. Hostnik P. Toplak I. ed. 137–143.

Macroscopic lesions were detected in 43 pigs.. avium subsp avium has been further divided into M. Generalized disease is less common and can affect internal organs such as liver. avium subsp.ac. are found at the meat inspection in slaughterhouses. Hilbor et al. 2002. Granulomatous lesions compatible with mycobacterial infection were found in mesenterial lymph nodes in 88 pigs. Serbia Veterinary Specialized Institute „Kraljevo“.. Johansen et al. spleen or kidneys though not always.. Granuloma is a unique structure and within it the growth of mycobacteria is in accordance with anti-bacterial effector mechanisms of the host. Serbia * Corresponding author: vlade@niv. Matlova et al.ns. Alvarez et al. The most important morphological characteristic of infections caused by MAH and other mycobacteria is granuloma formation. Our results show that routine meat inspections at slaughterhouses may fail to detect microscopic lessons caused by M. M. paratuberculosis and silvaticum. 2005. avium and M.. Caseous necrotic areas were present in some granuloma. Polaček. Serbia 3 Faculty of Veterinary Medicine. Novi Sad. Turenne et al. Keywords: Mycobaterium avium subsp hominissuis. without a previous detection 42 . Yajko. 2007).rs Abstract Mycobacterium avium. mycobacteriosis. avium subsp. Belgrade. 2008. is divided into the subspecies avium. belonging to the Mycobacterium avium complex (MAC). The granulomas were composed of focal accumulation of inflammatory cells in which macrophages. is divided into the subspecies avium. belonging to the Mycobacterium avium complex (MAC). Numerous eosinophils and myofibroblasts were present within the granuloma.. 1995). Kraljevo. 2014. FFPE lymph nodes were also examined by real-time PCR for IS1245. More recently. 2004a. 2001. Domingos et al. avium subsp. 2001. 2010). 2005.. In our study we compared macroscopic and microscopic lessons in formalin fixed paraffin embedded (FFPE) samples of mesenterial lymph nodes from tuberculin positive pigs. 2009. epithelioid cells. meat inspections Introduction Mycobacterium avium. More recently. mostly in children and immunocompromised humans (Agdenstein et al. 2008. Falkinham et al 1996. no lesions were detected. granuloma. M. 2011. avium subsp. M. Biet et al. paratuberculosis and silvaticum (Inderlied et al. Post mortem examination was performed on 100 pigs. avium subsp hominissuis and in certain cases could pose a threat for consumer health. M. 2004. avium subsp avium and M. hominissuis (Mijs et al. Dejan Vidanović2 Sanja Kovačević-Aleksić3 1 2 Scientific Veterinary Institute „Novi Sad“. In 12 pigs. 1993). hominissuis (MAH) is a ubiquitous microorganism which lives both in water and soil and causes mycobacteriosis of pigs and human population. avium subsp avium has been further divided into M.. Hybia et al. multinucleated giant cells and lymphocytes predominated. Jasna Prodanov-Radulović1. while 45 pigs manifested only microscopic lesions. hominissuis.First International Symposium of Veterinary Medicine – ISVM2015 Invited lecture COMPARISON OF MACROSCOPIC AND MICROSCOPIC LESSION IN MESENTERIAL LYMPH NODES IN PIGS NATURALLY INFECTED WITH MYCOBATERIUM AVIM SUBSP HOMINISSUIS Vladimir Polaček1*. 2014. avium subsp hominissuis (MAH) is a bacterium which causes mycobacteriosis both in pigs and humans and most common diseases of children and immune-compromised humans. One of major hallmark of MAH infections in pigs are localized granulomatous lesions on lymph nodes of digestive tract or/and on lymph nodes in the head (Thorel et al..

Tirkkonen et al. Polacek. Results Macroscopic examination showed that mesenteric lymph nodes were enlarged with or without bordered areas of caseous necrosis. Then the 4-5 µmn thick sections were stained according to hematoxylin-eosin method (HE). the main source of information about the occurrence of tuberculosis is the data gathered at meat control in slaughterhouses (Cvetnić et al. 2010). calcification. 2011.. 2011). These tests were positive..e. The samples of mesenteric lymph nodes for pathohistological and molecular examinations were fixed for 24-48 hours in 10% buffered formalin. Material and Methods Examinations have been performed on the samples of mesenteric lymph nodes of 100 pigs (Norwegian Landrace breed). No necrosis 2. 2006). avium was detected (van Ingen et al. Distinctive necrosis and calcification. 2012). After the standard processing in automatic tissue processor they were embedded into paraffin blocks. Agdestein et al. a large number of infected animals may fail to detect by routine meat inspection at slaughterhouses since the changes at some stages of Mac infections aren’t macroscopically visible (Komijn et al. Euthanasia was performed by preparation T-61 (Intervet. Mesenteric lymph nodes of 10 healthy pigs were used as a control. 2007. Immediately after the euthanasia autopsy and sampling of mesenteric lymph nodes were performed. These included the granulomas with: 1. Molecular examination Real time PCR from FFPE for IS 1245 and lymph nodes has been performed by the Norwegian Veterinary Institute described in previous study (Agdestain et al..5% of examined lymph nodes of slaughtered pigs out of which 50% were infected with Mac (Komijn et al. This paper will present the results of macroscopic and microscopic changes on mesenteric lymph nodes of the pigs naturally infected with M.. 5-10 months old. 2010). The diameter of the limited areas of caseous 43 . The pigs originating from Lithuania were kept in quarantine. 2012. 2010). Thoen. followed by classification into two groups: A no macroscopic lesions detected B macroscopic lesions detected Microscopic examination Granulomas were classified into three following histological groups by microscoping. According to the ruling issued by Veterinary Directorate of the Ministry of Agriculture.. Macroscopic examination The analysis of macroscopic lesions has been performed by indentation of the nodes in several parallel sections.. Polaček. Holand) as described in previous study (Agdestain et al. As a routine tuberculin skin test is not performed on pigs in most countries.. swine euthanasia was authorized. I. The available data suggests that certain herds of pigs exhibited granulomatous changes in 30-50% of slaughtered pigs where M. On the other hand. Forestry and Water Management. An annual study of a slaughterhouse in the Netherlands shows that caseous changes have been detected in 0. 2007..First International Symposium of Veterinary Medicine – ISVM2015 of clinical symptoms of the disease (Agdestein et al. 2007).. 1999. During the quarantine period. tuberculin skin tests with bovine and avian tuberculin were carried out. homminissuis. Initial phase of necrosis 3. avium subsp.

44 . Macroscopic changes on mesentric lyph nodes infected with M. Polaček 2010).First International Symposium of Veterinary Medicine – ISVM2015 necrosis. although in some cases it was larger than 10 mm (Image 1. Picture 1. The presence of M. 2011. avium subsp. The results of pathohysiological examinations The microscopic examination of lymph node samples stained by the routine hematoxylin-eosin (HE) method showed the presence of granulomatous lymphadenitis. hominissuis has been confirmed in a previous study by real time PCR detecting IS1245 (Agdestein et al. i. According to morphological charactersitics. avium complex A limited area of caseous necrosis on the cross section of a mesenteric lymph node (A-B). calcification was most commonly 1-2 mm. Disseminated areas of caseous necrosis and dystrophic calcification on the cross section of a mesenteric lymph node (C-F).).e. granulomas were classified into three histological groups.

(Table 1) Morphological characteristics of the above mentioned granuloma types. 12 15 5 25 57 (45) - 4 3 36 43 12 19 8 61 45 . Group 3. The central part of the granulomas from the second group is modified by the areas of caseous necrosis. Caseous necrosis in granuloma centre was not detected in this group. They can even be found outside the belt. The criterion for classification in such situations was the presence of dominating changes on a sample. In order to expand phagocytic capacity. Eosinophil granulocytes were located between macrophages and lymphocytes. 25 of them were in the macroscopic group A (with no visible changes on lymph nodes). Morphological characteristics of granulomas from the second group were found in 8 samples. while 3 samples were classified into macroscopic group B (with visible changes on lymph nodes). The number of polynuclear cells is significantly smaller than in the granulomas from the first group. changes Group 2. Their distribution is distinctive on the periphery which is why these cells from the 3rd group are peripherally located. Necrotic area in the centre and clearly conspicuous connective tissue layer on the periphery narrow the zone of epithelioid cells and lymphocytes and form a layer where eosinophil granulocytes are found. with irregular shape in the connective tissue outer layer. Overall results of both macrocopic and microscopic examinations of pig mesenteric lymph nodes microSCOPIC changes No changes (Group A) scopic MACRO No changes With changes (Group B) Group 1. located on the periphery of granulomas. The second group contained granulomas with morphological characteristics of circumscript lesions with outer layer formed of myofibroblasts. which separates it from the surrounding tissue. The thickness of connective tissue capsule is more conspicuous in big granulomas in the areas of central necrosis. Granulomas with distinctive and ever-present caseous necrosis and/or calcification in the centre were in the third group. At this stage.5 of them belonged to the macroscopic group A (with no visible changes on lymph nodes). In some cases dystrophic calcification in the form of dark blue deposits of irregular shape and uneven size is detected.First International Symposium of Veterinary Medicine – ISVM2015 The first group included granulomas dominated by macrophages (epithelioid cells) and lymphocytes. These cells are commonly elongated or oval.15 of them were from macroscopic group A (no visible changes on lymph nodes) and 4 were from the group B (with visible changes on lymph nodes). Out of the total of 100 examined samples of swine mesenteric lymph nodes. Out of the total number of examined samples there were 12 pigs that showed neither macroscopic nor microscopic changes typical of tuberculosis. Giant polynuclear cells were not found in these granulomas. 19 belonged to the first histological group. diffusely dispersed in a granuloma. These lymph nodes were classified into macroscopic group A (Table 1). Epithelioid cells have light cytoplasm and vesicular nucleus with scarce chromatin. between myofibroblasts. A great majority of mesenteric lymph node samples (61) belonged to the third histological group. Table 1. several epiteloid cells are merged into polynuclear giant cells. while 36 were in group B (with visible changes on lymph nodes). granulomas contain 1-2 giant cells on average. in different stadiums of the same tissue samples overlap in some cases. Individual myofibroblasts with different phenotype are located diffusely in a granuloma.

multinucleated giant cells and Fmicroscopic group 3. B. E.D-microscopic group 2. avium subsp hominissuis genome.. Granulomatous tip of inflammatory 46 . Discussion This paper deals with morphological changes on mesenteric lymph nodes in pigs that were previously diagnosed with positive tuberculin skin reaction.First International Symposium of Veterinary Medicine – ISVM2015 Picture 2. Granuloma is a unique structure and within it the growth of mycobacteria is in accordance with anti-bacterial effector mechanisms of the host (Co et al. Microscopic changes on mesenteric lymph nodes of the pigs infected with Mycobaterium avium complex : A-microscopic group 1. 2004). Molecular method determined the presence of M. C.

Acknowledgements: This study was supported by Project TR 31084 of Ministry of Education. The analysis of the tuberculin skin test results and morphological examinations raises a question of the extent to which the test is an indicator of pathological changes in an organism as it certainly detects the existence of immune response to the presented mycobacteria. which respond with antigen presenting cells (APC). 2007. This implicates a low specificity of tuberculin skin test. Formation and sustainability of granulomas is a complex process undergoing several phases of immune response of the host (Hybia et al 2008). 2004). The results we have obtained suggest that the use of tuberculin skin test method is more reliable compared to a routine examination at the meat inspection in abattoir.. 2010. followed by a transformation of macrophage proliferation. 8 out of which showed a positive reaction to tuberculin B as well. one of them being the alternative citric acid cycle for using lipids found in necrotic centre of a granuloma in great quantities. In our opinion. 2010). tuberculosis which is in a ‘hibernation’ state changes the structure of cell wall in a granuloma since it loses the staining feature as an acid resistant bacterium (Co et al. Some researchers suggest that in such conditions mycobacteria activate the genes that initiate alternative metabolic pathways. Although imperfect. Neither macroscopic nor microscopic examinations of the samples detected changes in mesenteric lymph nodes in 12 pigs (12%) that were infected with tuberculosis. the control on the presence of tuberculosis cause needs to be tightened. The data about occurrence and extent of tuberculosis are most commonly obtained from the meat control in slaughterhouses or from a quarantine of imported animals a since tuberculin skin test is often one of the compulsory diagnostic measures during the quarantine period of most categories of imported pigs in the Republic of Serbia.. Republic of Serbia. All 12 pigs were positive to tuberculin. Microscopic examination of these animals also detected the changes typical of tuberculosis. mediated by T lymphocytes (Th1). These results unequivocally support the fact that tuberculin tests are highly sensitive. Polacek. The results of examination of 43 pigs with positive tuberculin reaction and visible macroscopic changes on mesenteric lymph nodes speak in favour of test sensitivity. 2012). which results in the failure to spot infected pigs during the control process (Polacek. Also we would like to express our grateful to 47 . avium). 45 (45%) had specific granulomatous lymphadentitis. having in mind that the number of positive tuberculin skin tests performed on imported animals in our country during quarantines is on the increase. Out of 57 (57%) pigs that had a positive reaction to avian turbeculin and which did not have any changes on mesenteric lymph nodes. Immune reaction against persistent bacteria is a sensitive and delayed reaction. Agdestein et al. particularly in cases when tuberculous changes are not macroscopically visible and detectable by routine meat control in slaughterhouses. Science and Technological Development. It is also assumed that M. The introduction of more reliable measures for determination of positive reactors and their restriction from food chain will significantly decrease the occurrence of disease in human population. In a large number of cases (25/45) the specific granulomatous lymphadenitis had the characteristics in the later stage of chronic granulomatous process with massive necroses and very conspicuous dystrophic calcification. tuberculin test is a significant measure in the control of micobacterioses in pig production (Cvetnic et al. according to histological examinations.. Mesentric lymph nodes of 7 pigs selected randomly from this group of animals were additionally tested using real time PCR method and one turned out to be positive to IS1245 (M. Mycobacteria found in a granuloma are affected by a low oxygen concentration and very restricted nutrition.First International Symposium of Veterinary Medicine – ISVM2015 reaction is a basic morphological characteristic of immune response of an organism to the infection caused by mycobacteria.

O. K. 15. Cvetnić Z. Impact of sawdust and wood shavings in bedding on pig tuberculous lesions in lymph nodes. Van der Laan T. Jørgensen A. Co. 2011.. Domínguez L. Álvarez J. 67(3):1225–1231. Mateos A. Mijs W. 8. Johansen TB. Molecular evidence to support a proposal to reserve the designation Mycobacterium avium subsp. Rigouts L. Factors influencing numbers of Mycobacterium avium. 2. Olsen I. 6:266–310. and other mycobacteria in drinking water distribution systems.. 13. Sandor. 2014.. 6. 2001. A Comparative study of Mycobacterium avium subsp. 2004.. Harris S. 2014. hominissuis outbreak in swine... Domingos M.. Jørgensen A.H. Boschiroli ML.. Spicic S. Jørgensen A.. Int J Syst Evol Microbiol. Hibiya. Veterinary Record. Portaels F. Johansen T. Applied and Environmental Microbiology. Nilsen S.. BMC Veterinary Research. Katalinic-Jankovic V.. de Juan L. Aleksić-Kovačević S. Johansen T. Covert T..I. Epidemiology of infection by nontuberculous mycobacteria. Jr. 7. doi:10.. Epidemiological investigation of a Mycobacterium avium subsp.. J.. Sugawara. Agdestein A.. 63. Agdestein A. Djønne B. Mycobacterial granulomas: key to a long-lasting host-pathogen relationship. Rodríguez S... 8: 11. Molecular comparison of Mycobacterium avium isolates from clinical and environmental sources. D. Falkinham J. 9. Djønne B. Mycobacterial infection of pigs in Croatia. W. Clin Microbiol Rev. Mycobacterium avium subsp. Kasumi. Kolbjørnsen Ø. Hilborn E. Epidemiology and Infection. 10. 2009. IS 1245 RFLP analysis of strains of Mycobacterium avium subspecies hominissuis isolated from pigs with tuberculosis lymphadenitis in Portugal. 2007. I. Aranaz A. Agdestein A. Vidanović D... Clin. 2005. BMC Veterinary Research. M. 347-366. Zoonotic aspects of Mycobacterium bovis and Mycobacterium avium-intracellulare complex (MAC) Vet Res. Investigation of an outbreak of mycobacteriosis in pigs. hominissuis of serotypes 6 and 8 isolated from pigs and environment. 2002.. B. Hogan.. avium for birdtype isolates and ‘M. and IS1245 RFLP analysis of Mycobacterium avium subsp. avium and Mycobacterium avium subsp.. Donnelly S.. Falkinham JO III.. de Haas P.74(15):4966–4968. Norton C. F. Mycobacterium intracellulare. 113. Matlova L. F. 102(3-4):227–236. Jørgensen A. Fujita.. Olsen I.. 2011. doi:10. 9:177–215. Yakrus M. Castellanos E.. Immunol. D. Žultauskas J. A. 55:1–9. Polaček V.. 2008.. Novel insights into transmission routes of Mycobacterium avium in pigs and possible implications for human health.1186/1746-6148-8-11.. S. B.. 14. Pate M... Johansen TB. 5. 48 . Bartos M. Histopathological classification of systemic Mycobacterium avium complex infections in slaughtered domestic pigs. Krt B. T.. 11. References: 1. Applied and Environmental Microbiology. Y.. 1996. Holstad G. Veterinary Research. L. Ocepek M.. Schmitt M. Benic M. Bailey S. Bezos J.. Djønne B. 52:1505–1518. avium subsp. C. Palecek K.1155/2014/189649. BioMed Research International. Van Soolingen D. 130-136. Veterinary Microbiology. 3. 4.. Biet F.139(1):143–148 Agdestein A. 7.. D. 2014:189649. 1993..36: 411–436. hominissuis’ for the human/porcine type of M. 45. Stelma G. Bermudez LE.. 2012. Dvorska L. avium. I.. Toney S.First International Symposium of Veterinary Medicine – ISVM2015 Tone Bjordal Johansen and her colleagues from Norwegian Veterinary Institute (Oslo) for help with molecular examinations and Danka Vukašinović for help with manuscript and translation. Guilloteau LA. N. Djønne B. Romero B. 12. hominissuis Infection in Swine Associated with Peat Used for Bedding. 164(4):116–120. Rossau R. Botelho A. 2008.. Comp Immunol Microbiol Infect Dis 31.. Clin Microbiol Rev. Kim. Lium B. Pavlik I. Kemper CA. 2004. Lium B. Acta Vet Hung. Lechevallier M. Thorel MF. hominissuis in experimentally infected pigs. Amado A... The Mycobacterium avium complex. 16. Maurenc L. A. Inderlied CB. III..O.

Tuberculosis. Schneider. Pavlik I.. M.. Hopewell P. 20:205–229. H. Komijn. 21. 43(3):1261–1268. N. J. J. J. Yajko D. L. A. M. T. Belgrade. van Soolingen. Huchzermeyer HF. 25. Blackwell Publishing Ltd.. Bartos M. D. Ali-Vehmas. C. Eger. D. J Clin Microbiol 37. Jr. 143.First International Symposium of Veterinary Medicine – ISVM2015 17. 2010. PhD thesis. S. Dvorska. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology. Comp. 49 . C. Nieuwenhuijs.E. Journal of Clinical Microbiology. High genetic relatedness among Mycobacterium avium strains isolated from pigs and humans revealed by comparative IS1245 RFLP analysis. Oxford. R. Nassos P.E.. Mycobacterium avium and Mycobacterium intracellulare infection in mammals. 2005.. 27. R. T. Vet Microbiol.. 379-388.Vaskovic.D. 23. Ostroff S. Horsburgh C. 1254-1259. F. Clin Microbiol Rev. 18. 19.. and soil samples collected from the environment of HIV-infected individuals.. K. de Haas.-Czech 49.. Bakker. Prevalence of Mycobacterium avium in slaughter pigs in The Netherlands and comparison of IS1245 restriction fragment length polymorphism patterns of porcine and human isolates. food. Pavlik.. V. Reingold A.. Rev Sci Tech. Makinen. 20:204–218. 2007. Faculty of Veterinary Medicine. M. Krnjaic. P. Gonzalez P. Polacek.. M. 9th Edition. Matlova. J. M. 326-326.. P. Polacek. 2006. Michel AL. van den Hoek. Hadley W.M. Soini. van Ingen J. 9(2):176–182. Distribution of Mycobacterium avium complex isolates in tissue samples of pigs fed peat naturally contaminated with mycobacteria as a supplement. Pakarinen. Pathol.. Tuberculous lesions in pig lymph nodes caused by kaolin fed as a supplement.. 144:250–253. Trckova.... I. 2004a. In: J. Docekal.. Transforming Growth Factor. C. Vet Microbiol 125. Wisselink HJ. Mycobacterium avium in the postgenomic era. Distribution of Myofibroblasts. 20. 22... 1999. 1995.G. Knezevic. Tirkkonen.... L.Vidanovic.. Moisander. Boeree MJ. 2010... L. Gledic... Ayele W..H. Amemori T. Thoen. T.. D. Dvorska L. Aleksic-Kovacevic. 2010.... S.β1 and Transforming Growth Factor. Wallace R Jr. Behr MA. Mycobacterium avium complex in water. 2001. 175-181. Van Soolingen D.. Matlova L. van Solt-Smits CB. Vet. 26. Diseases of swine. van Zijd Erveld.. Thorel MF. Turenne CY.O.. Chin D. A. Uloga miofibroblasta u morfogenezi granulomatoznog limfadenitisa svinja prirodno inficiranih uzроčnicima iz kompleksa Mycobacterium avium (in Serbian with English abstract). 2007.. Yakrus M. D.. Bartos.V.. Isolation of mycobacteria other than Mycobacterium avium from porcine lymph nodes. 24. Med. R..M.β1 receptor I in Granuloma Caused by Mycobacterium avium complex in Pigs. Y..M....J.

rs Abstract In this study the protective effects of two bivalent inactivated vaccines were evaluated. Keywords: Listeria monocytogenes. the disease is more frequent in winter and early spring. Listeria is widely distributed in the natural environment and has been isolated from soil surface.. Antibody titres were determined by microaglutitation (MAT) and complement fixation tests (CFT). in the rural environment through a continuous faecal–oral enrichment cycle (Picoux. inactivated with 0. Blagoje Dimitrijević1.0 ml x 106 cfu/ml (colony-forming units per milliliter) dosage shows a protective effect after challenge with L.. 2004. monocytogenes bacteria cells. 2000. University of Belgrade. Domesticated ruminants play a key role in the maintenance of Listeria spp. 2005). 2008). septicemia. Gasanov et al. it is strongly recommended to perform boosterisation two weeks after initial vaccination. The bivalent vaccine containing 0. a gram-positive. induced by vaccines A and B.First International Symposium of Veterinary Medicine – ISVM2015 IMMUNE RESPONSE AND PROTECTIVE EFFECT OF VACCINE AGAINST LISTERIOSIS IN SHEEP IN SERBIA Dragan Bacić1*. respectively. In general. show that the later (with saponine) significantly increased the level of antibody titres (p<0. Therefore. as the most frequent in our and surrounding epidemiological areas. Vaccine A consists of whole L. Vaccine B contains 0. a severe disease associated with a high mortality rate. blood samples were obtained every 14 days during the next 6 months. is the causative agent of listeriosis. The levels of immune response were also significantly impacted by the total number of bacteria and vaccine dosages (p<0. Ovine listeriosis has also been associated with mastitis. vaccine. facultative intracytosolic bacteria. protective effect. saponin. Listeriosis is also an important food-borne zoonosis (Farber and Peterkin. sheep Introduction Listeria monocytogenes. Antibody titres were significantly higher after boosterisation (p<0.. In ruminants.. listeriosis is usually represented by three distinct clinical syndromes.4% formaldehyde and aluminium hydroxide as a carrier. among which sheep are the more commonly affected.01).0– 5. and abortion. encephalitis (meningoencephalitis). The main source of infection in ruminants is poorly fermented silage with a pH above 5. This risk during the winter season is associated 50 .01). 2005). 1991. serotypes 1/2a and 4b. but animal listeriosis most commonly occurs in ruminants.1% saponin in addition to ingredients of vaccine A. Clark et al. Comparative analyses of antibody titres. Evaluations of these vaccines were performed in 60 sheep. Serbia * Corresponding author: bacicd@vet. immune response. monocytogenes. rotten vegetables and pasture herbage.01) and protective levels could be detected in sera of vaccinated animals during the next 6 months.1% saponin (vaccine B) in 5.5 and within pockets of aerobic deterioration (microaerophilic microorganisms). divided into four groups (n=10) with a corresponding negative control group (n=5). Otter et al. After 14 days. Vaccines were prepared from Listeria monocytogenes. Nearly all domestic animals are susceptible to L. monocytogenes infection. such as keratoconjunctivitis and gastroenteritis (Wagner et al. In order to evaluate the immune response. Faculty of veterinary medicine. boosterisation of all animals was performed. some ophthalmic lesions.bg. The protective levels of antibody were 1/80 and 1/16. Mila Savić1 1. 2004.ac. Regan et al.. determined by MAT and CFT.

2002). monocytogenes in our and surrounding epidemiological areas. which is the virulence determinant of the organism (Bennett and Weaver. 2002).1% saponin. Amagliani et al. 2007).4% formalin with the addition of aluminium hydroxide as a carrier (vaccine A). The recovery rate is higher if treatment is administered early in the course of the disease. 5% blood agar and tryptone agar. monocytogenes strains L. Serological reactions Titre determination of the antibodies after immunization was performed by the method of slow agglutination (MAT). according to the instructions of the manufacturer (Bioveta. 1997)..3 ml. 2006). serotypes 1/2a and 4b. During this period of monitoring. beside above mentioned constituents also. the dose being 0. Nevertheless. 2001. 51 . 2006). Belgrade-Serbia) according to the standard procedure. Briefly. inactivated with 0. the substrates were inspected on a daily basis. Taking into account all of the above mentioned. vaccination is not always an innocuos procedure. The toxicity of vaccines was also examined on laboratory mice. L. Two virulent serovars (l/2a and 4b) are most commonly isolated in farm animal diseases in Serbia (unpublished data). Examining the sterility and toxicity of vaccines The examination of the sterility of prepared vaccines was performed by sowing on nutritive agar. monocytogenes can be distinguished in 16 serovars on the basis of somatic and flagellar antigens and there is genetic diversity between serovars (Beumer and Hazeleger.. Treatment of severely ill or recumbent animals with listeriosis is rarely successful (George. After this period. Vaccine B. because recovery can take as long as one month (Low and Donachie. the mice were monitored daily for any possible changes in the general condition during a period of four weeks. no deaths of mice were recorded. Serotypization of the isolated strains was determined by the method of fast agglutination on the microscope slide coated with antiO and anti-H immunoserum of L. no growth of aerobic and anaerobic microorganisms having been detected. These strains can multiply in macrophages and monocytes and produce a haemolysin. Material and methods Isolation and serotypization of isolated L. Czech Republic). monocytogenes was isolated from samples of aborted fetuses or brains of dead sheep on tryptone agar (Torlak. after the subcutaneous application of the examined vaccine. contained 0.e vaccination) has proved itself over the past 120 years to be by far the most efficient and costeffective method of controlling infectious diseases. the mice were sacrificed and a suspension of parenhimatic organs was sown on tryptone and blood agar. Immunoprophylaxis (i. listeriolysin O (LLO). During the five day incubation period (37 oC). and its use must always be accompanied by a careful assessment of the risks and benefits of the procedure (Tizard. monocytogenes (Bioveta. Czech Republic). monocytogenes bacterial cells. Preparation of vaccines Vaccines were prepared from whole L.First International Symposium of Veterinary Medicine – ISVM2015 with the fact that Listeria can grow at temperatures where growth of other pathogens is inhibited due to excessive cold (psychrophilic microorganisms) (Radostits et al. the objective of this study was to evaluate the protective effects of two inactivated. Antibiotics (ampicilline and gentamicin) must be administered for a prolonged period. bivalent vaccines prepared from two of the most frequent serotypes of L.

0 ml during 24 weeks. while the lowest titre was in the animal group I which received the vaccine A.69 ± 1. It has been determined by statistical analysis that the average antibody titre was highest in the animal group IV which received the vaccine B. followed by a fall (Figure 2). no statistical differences were detected (p>0. respectively.01). Determination of the antibody titre in the blood serum after immunization was performed at fortnightly intervals. it has been detected that the titre gradually increases. employing the method of slow agglutination. Statistical analysis was performed using the Graph Pad Prism 5. USA. while in sheep which received vaccine B.5 ml (12. followed by the Tukey test.5 to 5. commencing from the second week and ending on the 24th week.11). reaching maximum values on the sixth and fourth week respectively. the second group with 5. Data were expressed as means ± standard error. December 1986). The first group of animals was vaccinated with 2. Results of sheep antibody titres obtained by the method of microagglutination Titres of agglutinized antibodies in sheep vaccinated with vaccine A ranged within the interval from 1/20 to 1/80.0 ml (17. Sheep from the negative control groups received subcutaneous injections of physiological solution (Hemofarm. 1). Before applying the analysed vaccines.0 ml × 106 cfu/ml of vaccine A. Results Examining the blood serum on day zero.96 ± 1.5 ml × 106 cfu/ml. L 358/1–358/6. serotypes 1/2a and 4b were used. (before commencing with the vaccination). blood samples from the sheep were obtained by puncture of v.25) (Fig. CA. the sheep were revaccinated according to the same protocol.0 Software. each group having its own negative control group (n=5). monocytogenes serotypes. a high statistical difference was determined between all the studied groups (p<0. Comparing antibody titre values between the groups that received different doses of vaccine B. with a average body mass of 30-35 kg. All experimental procedures were performed according to our institutional guidelines for animal research and principles of the European Convention for the Protection of Vertebrate Animals Used for Experimental and Other (Official Daily N.05. Comparing the average values of antibody titres. Two weeks after immunization. 18. after applying vaccine A in a dose range from 2. monocytogenes. Examination of the prepared vaccines on sheep The examination of vaccines (A and B) was performed on 60 sheep of the Würtenberg breed aged between three and four months. The third group was vaccinated with 2. personally prepared and standardized antigenes of L.0 ml × 106 cfu/ml of vaccine B. Analyzing the trend of agglutinized antibody titre movement. the dose being 5. Vršac). while the fourth group received 5.5 ml × 106 cfu/ml. The level of significance was set at p < 0. monocytogenes serotypes. the titres ranged from 1/40 to 1/320 (results not shown). jugularis with the aim of detecting the possible presence of antibodies of the studied L. Statistical analysis Statistical significance of differences of all examined parameters was determined by means of the ANOVA. subcutaneously into the knee fold. it was determined that the sheep included in the experiment were seronegative for 1/2a and 4b L. 52 .First International Symposium of Veterinary Medicine – ISVM2015 For performing serological reactions. The sheep were divided into four groups (n=10). the dose being 2.05).

5 ml. A very similar tendency of movement is shown by the antibody titre after applying the vaccine B with a dose of 2. followed by a gradual fall (Figure 3). reaching its highest level on the eight week after vaccination. Figure 1. determined by MAT. determined by MAT.01. Group II versus group III.5 and 5. during 24 weeks. followed by a downfall (Figure 2). p>0.First International Symposium of Veterinary Medicine – ISVM2015 A very similar tendency of movement has the antibody titre after the application of vaccine B with a dose of 2. Gruop III versus group IV. Group I versus group II. CI – Confidential Interval 53 .5 ml. Analyzing the tendency of agglutinizing antibody titre movement after application of vaccine B.0 ml. it has been determined that the titre gradually increases. p<0. The trend of agglutinized antibody titres movement during 24 weeks period following the application of vaccine A in 2. The titre gradually rises.5 and 5.05 Figure 2. p<0.01. The titre gradually rises and reaches its peak on the eigth week after vaccination.0 x 106 cfu/ml. reaching its maximum value on the sixth week followed by a gradual fall (Figure 2). Average titres of antibody following the application of vaccines A and B in different dosages. with doses of 2.

The animals were monitored daily the next 30 days for possible changes in their general health conditions. monocytogenes strains. it has been determined that serotypes 1/2a and 4b L. Since the therapy of listeriosis is currently under discussion and does not always offer good results. monocytogenes dominate on our epizootological region. 1989). determined by MAT. The key factors for the vaccine quality and adequate immune response are: the number of microorganisms in the vaccine..5 and 5. On the basis of isolation and serotypization. if there is an elicitation of effective. combination of bacterial antigens in the vaccine. have an effect on the immune response (Linde et al. The trend of agglutinized antibody titres movement during 24 weeks period following the application of vaccine B in 2. Second. degree of attenuation or means of inactivation. as well as the vaccine dose.0 ml x 106 cfu/ml of fresh bujon. 1995). 2006. Figure 3. chemoculture of blood. This is the reason why in our study we selected the above mentioned L. listeriosis being a serious zoonosis (Braun et al. applied subcutaneously in the knee fold. as well as in the surrounding countries (unpublished data). CI – Confidential Interval Discussion Vaccination is a very useful tool in preventing infectious diseases. 2007). It has been established that the total number of microorganisms in the vaccine. monocytogenes strains.. nasal and buccal smears were negative for the presence of the studied L. protective antibodies. First. the animals in our 54 . In the studied sheep. 24 h culture containing 1/2a and 4b strains. For this reason. the aim of this study is to evaluate the efficiency of our experimental inactivated vaccine in contributing to the control and suppression of listeriosis. we must be sure that the risks of vaccination do not exceed those associated with the chance of contracting the disease itself (Tizard.. Two major criteria must first be satisfied in determining whether vaccination should be used to control a specific disease. neither body temperature increase nor changes in the general health have been recorded. as well as the type of added adjuvant. before using a vaccine. it must be established that the immune system can protect against the disease in question. 2002). Sheep were infected with 5.First International Symposium of Veterinary Medicine – ISVM2015 Results of artificial infection Artificial infection was performed in five sheep from group IV with the antibody titre ranging within average values (1/80-MAT and 1/16 –CFT). time of vaccination and revaccination (Gudding. Radostits et al. Bacteriological analyses of fecal samples.0 x 106 cfu/ml.

These results are in agreement with those previously reported by Nowacki et al.0 ml 106 cfu/ml (Figs 4. 1989). Filippini G. Linde. Comparing antibody titres in animals immunized with vaccines A and B. the highest antibody titre was obtained.1%. in relation to the dose of 2.e. 1989. (1987) and Tzora et al. at a dose of 0. Weaver R. obtaining higher antibody titres (Tizard. The vaccinal titre obtained in this way was in the range of 1/80 to 1/320. with a dose of 5.E. (1998). i. Mencikova et al. who suggested revaccination for a more efficient protection from L. These results are expected due to the fact that saponin is a nonspecific activator of the immune system (Tizard. 2001 55 .: Serodiagnosis of Listeria monocytogenes. Taking into account that by applying vaccine B. 1/16 applying CFT. Bacteriological Analytical Manual. Merati G. 14 days after vaccination.... an artificial infection was initiated (Mencikova et al. The aim of revaccination is the boosterization. On the basis of the fact that we used pathogen L. 58-72.. their inactivation was achieved with formalin with the addition of aluminium hydroxide as the carrier (Szemeredi and Padanyi.. specifically with a higher titre after the application of vaccine B with a dose of 5. Regan et al. 2. Gudding. 1989. 1995).. 185–189. Giammarini E... Res Vet Sci.e. i. Since the studied vaccine has not shown toxicity and was efficient in the protection of sheep after artificial infection.C. Therefore. 2006). With the intention of checking the quality and efficiency of the prepared vaccine. the protective titre having a value of 1/80 for MAT.. it is strongly recommended to perform boosterisation two weeks after initial vaccination.. et al.G. Monitoring the health conditions of the studied sheep during the period of 30 days.0 ml × 106 cfu/ml.5 ml × 106 cfu/ml (Figs 1 and 3). Titre levels of agglutinated antibodies applying the vaccine containing saponin ranged from 1/40 to 1/320. it has been determined that the addition of saponin in vaccine B. protected the studied animals after artificial infection. 5 and 6). Omiccioli E.. 2005).. 2006). 81. 1985.5 and 5.R. significantly supports the immune response (Lhopital et al. Our results are in agreement with the results of other authors (Ivanov. 1989).First International Symposium of Veterinary Medicine – ISVM2015 experiment were vaccinated with various doses of vaccine. monocytogenes. 2006 Bennett W.0 ml 106 cfu/ml. The examination was performed on five sheep with average titre levels for this group of animals. while with vaccines lacking saponin.. Acknowledgements Financial support for this study was provided by the Ministry of Education Science and Technological Development. a revaccination has been performed. the values ranged from 1/20 to 1/80.0 ml × 106 cfu/ml. Antibody titres obtained by vaccines with saponin differ significantly when compared to titres obtained by applying vaccines without saponin. Republic of Serbia (Grant No 31085). we determined that the bivalent vaccine prepared from inactivated listeria serotypes with saponin and dose of 5. in this study.0 ml × 106 cfu/ml. monocytogenes serotypes. 1993.: A combination of diagnostic tools for rapid screening of ovine listeriosis. determined by MAT. It is evident that the agglutinated antibodies persisted in the serum of animals six months after vaccination. we demonstrated that antibody titres were significantly higher after boosterisation and that protective levels could be detected in sera of vaccinated animals during the next 6 months. References 1. such a vaccine with additional research and evaluation on a larger number of animals could find its application in the control of listeriosis in flocks where listeriosis appears more frequently resulting in greater economic losses (Ivanov et al. 1995). We determined that the antibody titre is significantly higher if the studied vaccine is applied as a dose of 5. In the present study. Amagliani G. Pezzotti G. Linde et al. 2. 1977. In conclusion.

Acta Microbiol Hung.. 293–297. Singh R. 21. Thomas M.S. Vaccine. Kaur K. Mara M.: Studies on the safety and efficacy of a live vaccine against Listeria infection in lambs. Swaney S. 946949.: Listeria monocytogenes. Vet Rec. 11. 2004 Farber J. Padanyi M. 8. 1989 Nowacki J. 36. Hansbro M. Medycyna Weterynaryjna.. Daniel R.: Veterinary Medicine. 2007. Dikova M.. 71. 18. Konopa M. 31... 55. 1995 Mencikova E.. 1977 Kumar H. Philadelphia.W. Berche P. Singh B. 1998 Wagner M. Linde K.. 5.. Gay C.. 15. Shock A.C... 851–875.. 1989 Tizard I.C. Fthenakis G.: Listeria monocytogenes: diagnostic problems. Constable P... St Louis... a food-borne pathogen... Mosby. Mitchell S. 2004 Radostits O. and Listeria monocytogenes... Regan E.G. Przymus J....... Hughes P. 3–6. Draganov T.. 13. 23. 55...: Experimental listeriosis in immunized sheep. Beumer R. Large Animal Internal Medicine. Microbiol.. In Smith. Rev.M.First International Symposium of Veterinary Medicine – ISVM2015 3. Kirby F. 229. 12. 207. Asperger H. Pigs and Goats (10th ed. 1989 Ivanov M. 35. 324–329. 157. 1991 Otter A. BP. Baumgartner W. 923–926.. Hazeleger C..: A ten years experience with inactivated vaccine against listeriosis of sheep. 245-253. Gill J.. 76. 7. 2002 Braun U.D. Small Rumin Res. 6. 479.. 2005 Szemeredi G. Vet Rec.: Listeria monocytogenes gastroenteritis in sheep.: Methods for the isolation and identification of Listeria spp. Houlihan M. 331–334...I.L. 2000 56 . 1991 Gasanov U. 1993 Linde K.. Sofia. 327–330. WBC Saunders 7th Ed. 52.: Ovine gastrointestinal listeriosis. 259–261.. Gubran D. 14. Cent Vet Res Inst. 46-47.R. Bal M.. A Textbook of the Disease of Cattle. 150. Abraham A. Horses.M. Small Rumin Res.. Harrison G. 2002 Gudding R. Ehrensperger F. Kinne J..: The efficacy of a live Listeria monocytogenes combined serotype 1/2a and serotype 4b vaccine. Tzora A. 13. 2005 George L.J.. Podstatzky-Lichtenstein L. 16. 36.G.B.C.. 1537–1540. 22. 2008 Clark R. Higgins R.A.: Ovine listeriosis. Sheep. NZ Vet J.W. 476– 511.G.. Smola J. Vet Microbiol.. 2007 Lhopital S.. Acta Microbiol Hung.. 12-20. Peterkin P. Hinchcliff K. McLauchlin J. Nesse L. Immun Med Microbiol.W.). 356-402. Lehner A.. 9. Lewandowska S. 46. 125. FEMS Microbiol Rev. 19. J Clin Microbiol. Lippmann R. 2006. (Ed). Saunders. Vet Rec. 365-392.J. Stehle C. 154. Marly J. In: Veterinary Immunology. et al: Pathological and epidemiological investigations into Listeria encephalitis in sheep. Vet Rec. Pardon P. 2002 Brugere-Picoux J.M..J. Butler S. Gronstol H.: Kinetics of antibody production against listeriolysin O in sheep with listeriosis.: Study on the active immunoprophylaxis of sheep listeriosis.:. Snirc J.. 10.: Listeriosis. 191–197.D. et al: Prolonged excretion of Listeria monocytogenes in a subclinical case of mastitis. Fthenakis G. 111–114...: The effects of inoculation of Listeria monocytogenes into the ovine mammary gland.: Primary cutaneous listeriosis in a veterinarian.D. Milchwissenschaft. 17. 38-42. 4.: Immunisation against infections caused by Listeria monocytogenes in sheep. 20.: Clinical findings and treatment of listeriosis in 67 sheep and goats. 42.

which are of high priority in high density farms. such as viruses. sampling for them is very stressful and affects their welfare. Traditional sampling methods require skilled personnel and is time consuming since is individually based. surveillance and monitoring purposes. In particular. used for infectious diseases diagnosis. Branislav Kureljusic1. Serum samples are. Serbia * Corresponding author: virusologija@nivs. working towards better productivity. Nemanja Jezdimirovic1. as it involves taking blood or swab samples which is very stressful for pig. Vladimir Radosavljevic1. Jelena Maksimovic-Zoric1. Keywords: non invasive sampling. bacteria. Belgrade. presence of maternal antibodies. molecular epidemiology and tracking disease back. 2013). By testing oral fluid more animals can be screened. The ropes are afterwards processed in the laboratory in order to extract oral fluid which then could be tested for the presence of different markers. making it important to detect them as early as possible. This method is welfare – friendly means of monitoring disease. Gold standard in infective disease diagnosis is agent detection. Collected oral fluid samples have been tested on PRRS. It is of same importance for early disease detection. PCV2 and SIV. Having in mind that most of viruses can be excreted before clinical signs. Permanent infectious disease monitoring. On the selected pig farms. PRRS. the need to handle and bleed animals presents a significant risk for further spread of diseases (Mur et al. this is a very useful tool for early detection of the disease.First International Symposium of Veterinary Medicine – ISVM2015 ORAL FLUID AS A POTENTIAL SAMPLE FOR VIRAL DISEASES DETECTION IN PIGS Vesna Milicevic1*. Initial results suggest that oral fluid sampling could provide a low-cost.. we installed the ropes in the pens. oral fluid. Many causative agents of infectious diseases are excreted even before onset of clinical symptoms. SIV Introduction Accurate and reliable laboratory diagnosis in modern swine production is the request. Bozidar Savic1 1. But there are many limitations in serology results interpretation that are linked with estimation of time when infection occurred. The results represent the status of the herd not of the individual animals. noninvasive method to assess the health status of pigs. to be easily accessed and attractive for pigs. the most often. Ljubisa Veljovic1. oral fluid started to be investigated as a potential sample for diseases detection. but also with early stages when antibodies are not detectable. Although pigs are intelligent animals which remember rewards.rs Abstract Diagnosing infectious diseases in pigs is laborious work. PCV2. There are many advantages of this kind of sampling. 57 . antibodies etc. it is time consuming. Institute of Veterinary Medicine of Serbia. Oral fluid is collected by giving the cotton ropes to the animals to chew it. and taking into consideration experiences in human medicine. Additional work on technique validation is needed. than by individual testing of blood or swabs. independently whether piglets or adults are meant to be sampled. Since the most of viruses are excreted orally. are possible only by capturing the virus or viral genome.

oral fluid specimens have been used for infective agents detection but also for hormones. There are many advantages of oral fluid collection: requires no catching or killing of animals and is feasible to get it from farmed pigs (Hoffman et al. Oral fluid is an alternative specimen that could potentially replace nasal swabs. toxins and drugs (Prickett and Zimmerman. In this case.. 2012). How much important control of infective disease. New techniques always arise suspicion on their improvement comparing to traditional ones.. PCV2 and SIV in 58 . backyard holdings. When sampling was performed in pens. Rope sampling and oral fluid testing is.. efficiency. even more sensitive than swab testing. despite almost perfect tools for disease control in developed countries. In human medicine.. However. we selected 2 farms where respiratory diseases were previously confirmed. 2004) and measles (Carr et al. 2010). but needs individual sampling. oral fluid samples are preferred because of it safety. classical swine fever virus (CSFV) and African swine fever virus (ASFV) are shed in oral fluid which has been proved to be accurate diagnostic specimen (Ramirez et al. people are distrust when ever new technique requires no contact with animals. However. In this experiment. at some circumstances. The objective of this study was to conduct a preliminary assessment of the feasibility of detecting PRRSV. this method has its limitations. This is possibly due to the demanding sampling but also to the cost of individual testing. Porcine reproductive and respiratory syndrome virus (PRRSV). in big farms is well known.. 2012). saliva swabs were positive 3 days before the rope samples (Vosloo et al. for HIV (Connolly et al. oral fluid samples are collected from individual pigs or pens of pigs by allowing them to chew on cotton rope placed in the pen for 20–30 min. 2008) and from wild boar (Chichkin et al.. swine influenza virus (SIV). foot and mouth disease virus (FMDV). swabbing is the most often used technique. It has been shown that oral fluid can be used also for antibody detection. 2012). majority of swine population in the world is kept in small size. 2013). The amount of oral fluid sample collected is dependent on animal behavior. Infective disease surveillance in swine sector in Serbia is at very low level. field conditions. For this purposes. so therefore there is no need for individual testing. porcine circovirus type 2 (PCV2). oral fluid must be cooled immediately and transported to the laboratory as soon as possible because of very active saliva enzymes which tend to inactivate viruses. Taking nasal swabs is not difficult. Basically. heavily can affect the risk of disease spreading (Depner et al. Sick animals show less interest in the ropes. 2015). Swine production is a kind of production where herd level of diseases status should be assessed. it has been seen that sick animals come to chew on ropes only after healthy pigs got bored (Vosloo et al. Once collected. 2013). cost effectiveness and large number of samples availability. we wanted to show that disease detection is possible with alternative sampling methods which do not require animal catching. It has been shown that rope sampling was able to detect FMDV 6 days prior to visual clinical observations in unvaccinated and infected pigs. Wild life plays the same role. Rope sampling is a non-invasive method of oral fluid collection which allows detection of various infectious agents and assists with disease surveillance. Oral fluid is extracted manually from the rope and further processed in the laboratory (Prickett et al. Such reactions were seen when surveyed owners were asked about oral vaccination (Mogner et al. 2008). Rope sampling of free ranging pigs and wild boar can possible overcome these limitations for disease control in this epizootic niche. group sampling sensitivity is the most important factor. Usually. Nowadays. 2009) surveillances. But. in local. in particular if virus isolation test is going to be performed... with low biosecurity that.First International Symposium of Veterinary Medicine – ISVM2015 For these purposes. live animals are needed to be sampled. It is less laborious to perform and causes less stress to animals. in particular transboundary ones.

1999). not treated with any chemicals or dyes. anorexia.5 µg/ml ethidium bromide. is still needed. The specimen was considered positive if Ct value was ≤ 38. farm I reported respiratory disorders in all age categories 6 weeks ago. Two pens with pigs showing different respiratory symptoms from each farm were chosen for sampling. There was no difference in behaviour and interest in ropes between different age groups. A PCR technique for PCV2 detection was performed. Clinically.First International Symposium of Veterinary Medicine – ISVM2015 oral-fluid samples. pigs were kept in pens capacity 510 animals. were used for viral genome detection. Oral fluids were extracted manually. The amplified products were run in a 2% agarose gel and visualised by staining with 0. On the both farms. 2 samples were tested. Cotton ropes have been fixed in pens at places easily accessible for pigs and left for 30 minutes that pigs could chew on it. 50 cycles of 15 s at 95 °C. Molecular methods. 2009) by real time RT-PCR (Verso I Step qRT-PCR ROX Kit. RT-PCR and PCR. Thermal cycling was done under the following conditions: 15 min at 50 °C. Pigs were observed during the all collection time and their reaction on ropes and how attractive ropes were for them were recorded. respiratory disease was in acute phase. One sample was taken from animals old 12-16 weeks. Thermo Scientific). The RT-PCR program included a reverse transcription stage at 50 °C for 30 min. replacing one another. sneezing and labored breathing. 50 cm length. followed by an initial PCR activation step at 95 °C for 15 min. and 40 cycles of 94 °C for 30 s. The fluid was centrifuged for 10 minutes at 1500 g and used in subsequent analyses. Fine tuning of the method. Results From each farm.. USA). Oral fluid collection on both farms.. All animals were clinically examined before oral fluid collection. depending on the disease stage and number of animals per pen. we selected 2 pig farms with recently reported respiratory disorders. 15 min at 95 °C. On second pig farm. and with high absorbance capacity. Each rope was quite well sodden with saliva which volume was enough for performing the laboratory tests. After exposure time.0. in the field conditions. Pigs had fever. The ropes that we used were made of pure cotton. cooled at +4° C and transported to the laboratory. and 60 s at 60 °C. Partial matrix gene of Influenza A virus was amplified using published primers (WHO. Pigs were very interested in a new object in their pens and chew on ropes continuously for 30 minutes. not damaged. All ropes stayed fixed in pens. occasionally coughing was heard and pigs were in recovery stage. Total RNA was extracted from 150 µl of oral fluid using commercial kit (Isolate RNA Kit. 60 °C for 30 s and 72 °C for 1 min and a final extension step at 72 °C for 10 min. squeezing cotton ropes. 59 . 2001). DNA was isolated using QIAamp® DNA Mini (Qiagen. Pigs were treated with antibiotics and on sampling day all pigs had no fever. Bioline. Material and Methods To test potential use of oral fluid for virus detection in the field conditions. and another one from pigs older than16 weeks. The primers and conditions used for PCV2 have been previously described (Sandvik et al. ropes were stored in plastic bags.5 µg/ml of ethidium bromide. For PRRSV genome detection one-step RT-PCR (Verso 1 Step RT-PCR Reddymixx Kit. nasal discharge. The RT-PCR products were visualized in 2% agarose gel with 0. Thermo Scientific) was performed using primers targeting ORF 7 (Donadeu et al. The reaction was carried out in a total volume of 25 µl. USA) according to the manufacturer’s instructions. using ropes was very easy.

genome of PRRSV was confirmed. and safe collection method for the detection of SIV with rapid testing methods such as real-time RTPCR (Detmer et al. Furthermore.. viral proteins (antigens). Another respiratory disease which heavily can affect health status of pigs is PRRS. 1978). Pigs from the pen in which we confirmed SIV showed typical clinical signs of SIV. RT-PCR and Virus isolation. The virus is shed via saliva. Table 1: Results of oral fluid samples tested on SIV. on real time RT-PCR genome of Influenza Virus A was detected. 2011). The infection was in acute phase when amount of excreted virus is at highest level. The results of the recent studies indicate that pen-based oral fluids provide an easy. 2011). Ct value 28. Carrier animals are rarely described but also considered as responsible for Influenza virus introduction into uninfected herds (Merck Manual. Oral fluid represents group sample and therefore its sensitivity should be considered. However. 60 . Preferred samples are nasal swabs. 2008). urine.7. Influenza A situation in Serbia is unknown. Influenza in pigs can be diagnosed confirming presence of virus itself or immune response of the host. swine influenza H1N1 virus has been recovered from pigs with no signs of disease (Hinshaw et al. In one oral fluid sample.First International Symposium of Veterinary Medicine – ISVM2015 Results of molecular tests showed that samples from the farm in recovery stage were negative on PRRV. infection can be asymptomatic. AgELISA. In the farm with acute respiratory disease. Romagosa et al (2011) showed that pen-based collection of oral fluids is a sensitive method to detect influenza even when within pen prevalence is low and when pigs have been vaccinated and highlight the potential use of oral fluids for influenza surveillance (Romagosa et al. 2009). lung tissue and serum samples (Janke. faeces. effective. PRRSV and PRV2 presence Virus Result (%) PRRSV PCV2 SIV 2/4 (50) 0/4 (0) 1/4 (25) Farm I Pen 1 12-16 w negative negative negative Pen 2 >16w negative negative negative Farm II Pen 1 12-16 w positive negative negative Pen 2 >16w positive negative positive Discussion Swine Influenza Virus was detectable in porcine oral fluids by real-time RT-PCR. milk. PRRS and SIV infections were confirmed. Diagnostic tests that detect virus. but the outbreaks are most common in cold weather time. In two samples. PCV2 and SIV. in direct contact between animals by droplets and aerosols of nasal secretions. Detection of circulating antibodies to SIV can be performed by Hemagglutination inhibition test or Ab ELISA. Though. SIV is transmitted via nasopharyngeal route. All samples. Cost of individual tests and labour to get samples for virology tests are possible reasons for this. The virus presence has been rarely reported although respiratory disorders are common in pig farms. in some herds.. colostrum. Since proven that viral RNA could be detected in oropharingeal region of growing pigs up to 251 days post infection nasal swabs are the sample of choice (OIE. detection of PRRS virus is the most reliable during the early stages of PRRS infection.. 2008). (1970) reported a case of a pig which had been shedding SIV over 4 months. 2009) although Blaskovic et al. 2000). Influenza A is present in pig farms year round. mainly in finishing pigs (OIE. from both farms were negative on PCV2 (Table 1). or viral nucleic acid are Fluorescent antibody (FA) test. Virus excretion begins within 24 hours from infection and lasts 7-10 days (OIE.

At some circumstances. 81. Kaplan. preferably lung. reproductive failure. For precise characterization of method sensitivity. 2005). 287-292. Detecting the virus itself doesn’t` mean that it caused the disease but only evidence of virus infection (Caprioli et al. Ellis. elimination. F. Rathova. lesions and moderate to high amount of the virus. faeces and serum (Shibata et al. Serology may be helpful in confirming the presence (seropositivity) and stage (high levels of antibody in recent infections) of PRRS infection in the herd. by direct fluorescent antibody test. Since the diagnostic window for PRRS is much larger than for SIV. World Health Organ. McNeilly. 771–777..2007). McKillen. Lagan-Tregaski. P..: PCR detection of porcine circovirus type 2 (PCV2) DNA in blood.. in many farms.. 1970 Caprioli. saliva. Detecting PRRSV and SIV in oral fluid.. References 1. Allan. I.. 2006). or eradication of an infectious agent and often requires large number of samples. D. Field data showed that this period can be prolonged up to 8 weeks (Prickett et al.: Experimental infection of weanling pigs with A-swine influenza virus. Bull. Immunity in piglets farrowed by antibodybearing dams experimentally infected a year earlier.. simply to be performed... O.. surveillance is abandoned or inefficient. Due to these restrictions. PMWS most commonly affects 2-4 month-old pigs. respiratory disease. G.. Making surveillance and disease control plans. sempling method sensitivity should be considered in order to be replaced with appropriate number of animals to be samples in order to achieve the aim of the plan. PRRS surveillance if individually based is very costly. 2006 61 . 42. 2008a). 3. A.. porcine dermatitis and nephropathy syndrome (PDNS) or a combination of these (Opriessnig et al..... more experiments are needed to be performed. Large number of samples requires labour and time associated efforts. Limited data on the amount of PCV2 in nasal fluid and saliva following experimental infection is available. Res Vet Sci. J. The internationally accepted criteria to diagnose PMWS include the presence of compatible clinical signs. D. enteritis. Ostanello. M. 2. McNair. Krakowka. more animals can be tested whereas number of samples and tests is less. showing that with these samples PCV2 is detectable longer than 8 weeks. PCR or in situ hybridization is used to demonstrate viral RNA. V. PRRSV can be detected in oral fluid for approximately 4 weeks after exposure ( Opriessnig et al.. Using oral fluid for surveillance purposes.M. Diseases surveillance is fundamental to the control. J.First International Symposium of Veterinary Medicine – ISVM2015 Viral antigen can be identified in infected fresh tissue. E. we believe that surveillance and disease control can be improved. Blaskovic. we showed that depending on stage. S. we didn`t detect PCV2 in oral fluid samples probably because of low level of excreted virus in the stage where no other disorders have been seen which we could linked to PCV2. Having available and accurate alternative sampling methods that are cost and time effective.. F. sera and swabs suggests that nasal and rectal swabs are suitable indicators of the level of PCV2 excretion (Lorenc et al. early disease detection in farm condition is feasible. Jamrichova. 2006) The positive and significant correlation found between amounts of PCV2 detected in lymphoid tissues. we succeeded to detect PRRV in oral fluid samples in both oral fluid samples from one farm. Sadecky. However. Porcine circovirus 2 is ubiquitous in domestic pigs. tonsillar and faecal swabs from experimentally infected pigs. PCV2 is transmitted horizontally excreting virus in nasal secretions. Kociskova. PCV2 cause postweaning multisystemic wasting syndrome (PMWS). 2009) Oral fluid sampling for PCV2 detection has been studied recently. 2004). 2003) and vertically (Pensaert et al.. although the disease has been also described in younger and older animals (Segalés et al. In experimental conditions.

Switzerland Detmer E. Poul Baekbod. 2000 Monger VR. 6: 26–28.: Epidemiology of HIV in South Africa – results of a national. Yoon. Prickett. Gallardo Carmina. D. Afr. J. D. Harmon KL. Marie R. Romero.M. 14. Stoker. C.13:923–929.J. Patnayak. J Vet Diagn Invest 23:241–247. 272–282. Joaquim Segalésa. J. M.B. 84: 51-62. Kristensend. 19. Vet Microbiol 98.J. 2008 62 . Jordi Casala.S. Dukpa K.. J. 18..12333.: Using polymerase chain reaction to obtain PRRSV-free piglets from epidemically infected herds. Milicevic.1111/tbed. Tsybanov. L. 2004 Depner.. Klaas: New Non-Invasive Methods To Control And Eradicate Transboundary Animal Diseases In The Back Yard And Free Ranging Pig Sector.. Hassan. Davos. Colvin. S. http://www. Sanchez..J. and intervention strategies. O. S. Charlotte K. Simer.Vivi Bille-Hansenc. Waters.: Non-invasive method of collecting saliva from wild boar infected with African swine fever. Y. Bean WJ . 2009 Janke H. J. Gramer.M. GRF One Health Summit 2013. Marina Sibila. pathogenesis. diagnosis.G. 1999 Hinshaw VS. M. Report of the OIE ad hoc group on porcine reproductive respiratory syndrome. 7..: Goyal Detection of Influenza A virus in porcine oral fluid samples.First International Symposium of Veterinary Medicine – ISVM2015 3. Proceedings of the 39th Annual Meeting of the American Association of Swine Veterinarians . K. W. Christopher-Hennings.W. C. Grau-Romaa. Aguero. Easterday BC: Prevalence of Influenca viruses in swine and the antigenic and genetic relatedness of influenca viruses from men and swine. Shisana. clinical manifestations. 2011 Donadeu. Transbound Emerg Dis.. Swine Health Prod. community-based survey. J. Halbur PG: Porcine circovirus type 2 infection decreases the efficacy of a modified live porcine reproductive and respiratory syndrome virus vaccine. McKeown NE. Diagn. Gazaev. J.. 4. Yin Jiang. Hall.19. Jr. Sanchez-Vizcaino Jose Manuel. R... T.J.Invest.. Paris.. R. 2015 Feb 7. Soler Alejandro.. J. R. J. excretion and seroconversion dynamics of porcine circovirus type 2 (PCV2) in pigs from post-weaning multisystemic wasting syndrome (PMWS) affected farms in Spain and Denmark. 2007 Pensaert.J. Invest. Arias Marisa: Potential use of oral fluid samples for serological diagnosis of African swine fever. Arias. P. 6.. its diagnosis.1 Devi P. 2013 OIE: PRRS: the disease.. Dietze. 13. 2004 Prickett. Anette Bøtnere.int/fileadmin/Home/eng/Animal_Health_in_the_World/docs/pdf/Disease_cards/SWINE _INFLUENZA. Conway. Vesna.. Virol. P. et al. Ladekjaer-Mikkelsen. Allan. 2012 Connolly.E. San Diego. 16. J. Klaus. Loeffen WL: Evaluation of Oral Bait Vaccine Efficacy Against Classical Swine Fever in Village Backyard Pig Farms in Bhutan.: Viremia and effect of fetal infection with porcine viruses with special reference to porcine circovirus 2 infection. Gomez-Tejedor. 2008 Lorenc.B. 20: 156–163. 9. Nieto Raquel. 15.pdf Opriessnig T. Charlotte S.Susan. 9 . pp. W. Nauwynck. I. Veterinary Microbiology 165: 135–139. 8 (2): 79-84. 2nd GRF One Health Summit 2013. Meng..Z and Kolbasov. Meng XJ. Vet. Virology. California. Sagar M. Evans. Connell. Gurung RB.V.. 11. 81: 125–129... M. Diagn. H. Webster RG. Hjulsager. J.. J. Zimmermman Jeffrey.: Detection of porcine reproductive and respiratory syndrome virus infection in porcine oral fluid samples: a longitudinal study under experimental conditions. Bruce: Diagnosis of Swine Influenza. USA.J. 10. 1978 Hoffman.oie. 175-183.: Porcine circovirus type 2 associated disease: update on current terminology. 301-302.11 June 2008 OIE Technical Disease Cards. Moran.Sergio LopezSoria.. Clin Vaccine Immunol. 2009 Chichkin. 2015 Mur. A. Med. Zimmerman..T. Implementation and validation of swine oral fluid collection in a commercial system. Vet. M. Lorenzo Frailea. 94: 77–781. Miquel Nofrar asa. 5. 8. Lina. Proceedings. Christianson. 17.. prevention and control. Lars E. Swine Health Prod. Veterinaria. Claes Enøec. A. Pelayo Virginia. M.. Med. 12.. X... Larsen: Infection.: Molecular epidemiology of circulating measles virus in Ireland 2002–2007. 7: 225–261. Last updated June 2009. 20. Veterinary Microbiology 135. Stegman JA. A. Halbur.. M. Doi 10. 17-20 November 2013. J. Carr.. SanchezVizcaino.. 591-615. Zimmerman. J. K.. 2006 Opriessnig. G.

Hoogland Marlin. Med. Le. Wonil Kim.. Vet.merckvetmanual. 2010 23. N. Jeff Zimmerman: Oral-fluid samples for surveillance of commercial growing pigs for porcine reproductive and respiratory syndrome virus and porcine circovirus type 2 infections: J Swine Health Prod.N. Ramirez Alejandro.: Detection and genetic typing of porcine circovirus DNA isolated from archived paraffin ambedded pig tissues. Pogranichniy Roman. P. Nakajima. Q.x 25. M.: The development of oral fluid-based diagnostics and applications in veterinary medicine. V. 2008. J.00276. John. Itagaki. T. Drew. J.. M. The Merck Veterinary Manual.htm. 2001 26. Rev. T.. Anim. Q. Segalés . Rademacherd Chris. Banks.. Robert Simer. Y..com/mvm/index. T.M. T. 2013 Dec 11. Le. Wang. T. 2008a 22. J. Shibata. John. Singanallur: Collection of Oral Fluids Using Cotton Ropes as a Sampling Method to Detect Foot-and-Mouth Disease Virus Infection in Pigs. Jerez de la Frontera.. T.1111/j.. Han Soo Joo. Morris. Dang. M. Vu.J. M. Kim. S. Spain. Ono. J. Hidejima. Vosloo et al: Using ropes to detect Foot-and-Mouth Disease Virus infection in pigs. I. 2012 30. Prickett J. Res. oropharyngeal swab. Romagosa Anna..P. serum. CSIRO. M. V. 405-408. Y. V. 16(2):86–91. Spencer. Quach.: PCR detection of Porcine circovirus type 2 DNA in whole blood. T. Australia EuFMD 2012. Virol. DOI:10. Comp. birds. Proceedings-ssDNA Viruses of plants..jsp?cfile=htm/bc /121407. D. X.. Y.. Yazawa. ISBN 1442167424. Health. Sci. Tran.First International Symposium of Veterinary Medicine – ISVM2015 21. Hung. Rev. P. 65. Zimmerman. T. H. Allan. S. Domingo. I.. Kurtz Ernest. T. Davis. Marie Gramer. Prickett. and feces from experimentally infected pigs and field cases. V. P.. Swine influenza. Rodger Main. Anim. T. Hoffmann Patrick. Retrieved April 30. V. H. B. Montserrat Torremorell: Sensitivity of oral fluids for detecting influenza A virus in populations of vaccinated and non-vaccinated pigs. P. WHO: CDC protocol of realtime RTPCR for swine influenza A(H1N1) 28 April 2009 revision 1 (30 April 2009) 63 . 2012 24. 2003 28.. DOI: 10. Tran.R. N.. Kyoung-Jin Yoon. P. Kyoung-Jin Yoon. A. http://www. 2005 27. Grierson.1111/tbed. M. H.. Health Res. 2009 29. Sandvik. Vosloo W. Kurtz Anne. Transbound Emerg Dis.. M. T.17502659. Johnsona K. 119142. J. Le and N. Prickett R. Okuda.2011. Nguyen. T. Okabe. Mai. Sasaki. Jeffrey Zimmerman: Efficient surveillance of pig populations using oral fluids. G.12196 31. 11: 207–216.H. 6.R. Wang Chong. pigs and primates. Nguyen. King.. Giles. nasal swab. J. Australian Animal Health Laboratory. Saint-Malo 24–27 Sept.: Porcine circovirus diseases.. Preventive Veterinary Medicine 104: 292– 300.

lepromatosis causing leprosy. including 306 apparently healthy free-range wild animals belonging to 13 species. followed by M. bovis. Gerbičeva 60. Two studies on NTM in ornamental fish in Slovenia (2001-2004 and 2009-2011). the most important zoonotic pathogen among NTM in fish. Petra Bandelj1. In the last two decades.g. Three main groups of mycobacteria can be identified. which included 142 fish from several pet shops. Darja Kušar1. tuberculosis. 2000). M. Tina Pirš1. University of Ljubljana. avium isolates were obtained from cattle. revealed that the majority (~80%) of aquarium fish harbour NTM. Diana Žele1. poultry. atypical. sporadic M. Matjaž Ocepek1 1. when compulsory slaughterhouse inspection of pigs was abolished. Jože Starič1. tuberculosis complex were not detected. with M. the first survey on mycobacterial infections in wildlife in Slovenia was conducted. SI-1115 Ljubljana. Their infections are notoriously difficult to treat due to the unique cell wall of mycobacteria and their natural resistance against many chemical or physical agents. Slovenia * Corresponding author: mateja. The predominant species was M. Urška Zajc1. respectively. reptiles and zoo animals. Paratuberculosis has become a common disease of ruminants in Slovenia. Veterinary Faculty. Keywords: Mycobacterium. opportunistic or environmental mycobacteria as being ubiquitous in soil and water (Dawson. wildlife. However. M. paratuberculosis. but a number of NTM were identified in 11. Aquarium fish are also an important reservoir of NTM. farm animals. bTB was detected recently in cattle imported from an EU member state with a relatively high prevalence of bTB. Between 2010 and 2013. Katarina Logar1.si Abstract Slovenia was officially declared free of bovine tuberculosis (bTB) in 2009 although the proportion of tuberculin test positive herds and animals in the past 40 years did not exceed 0. fish Introduction Bacteria of the genus Mycobacterium commonly cause pathologies or mortality in humans and animals worldwide. intracellulare. leprae and M. After 2003. 64 . peregrinum being the most prevalent. avium and M.8% animals. Vlasta Jenčič1. The proportion of M. caprae) causing tuberculosis. fortuitum. After a few seroprevalence studies showing relatively low prevalence of disease in cattle herds in the past. namely the obligate pathogens from the Mycobacterium tuberculosis complex (MTBC. and the nontuberculous mycobacteria (NTM) causing skin/soft tissue disease. Members of M. Some of the NTM were most probably reported for the first time in certain wildlife hosts.uni-lj.pate@vf. M. the obligate pathogens M.First International Symposium of Veterinary Medicine – ISVM2015 MYCOBACTERIA IN ANIMALS IN SLOVENIA: FROM CATTLE TO AQUARIUM FISH Mateja Pate1*. pulmonary disease. NTM are also called mycobacteria other than tuberculosis (MOTT).) avium which was mostly isolated from pigs. pet birds. Brane Krt1. These facts call for immediate implementation of measures necessary to control the disease. e. Gorazd Vengušt1.08% and 0. Jožica Ježek1. lymphadenitis or disseminated disease.07%. Among nontuberculous mycobacteria (NTM) in farm animals. avium subsp. it recently became clear that presumably a lot more dairy cattle herds are affected and that up to 89% of the animals within a herd may be infected with M. a single case of bTB in cattle of Slovene origin was confirmed by the culture method. marinum. the majority of isolates identified in the past 15 years belonged to Mycobacterium (M. was relatively high (~10%).

As a result.) and submitted to megablast classification accessed through NCBI. the release of potent immunomodulators during the immune system activation may result in downstream effects like allergies and irritations of the bowel (Primm et al. The processed samples are inoculated onto five selective growth media: Löwenstein-Jensen (one slant supplemented with pyruvate and one slant supplemented with glycerin). avium subsp. bTB control included ST in quarantine for all imported cattle. 2004). short DNA fragments which are capable of transposition and are abundant in the mycobacterial genome. They are widespread and typically found in water and food sources. Thacker et al. marinum group (Slany.. The inoculated Herrold’s egg yolk agar slants. PCR assays and 16S rRNA gene sequencing. PCR amplification using the mycobacteriaspecific primer pair 285/264. (2012). Stonebrink. The tubes are incubated for eight weeks at 37°C. and vancomycin (HEYA. Logar et al. In case of suspected paratuberculosis. Middlebrook 7H10 and BBL Mycobacteria Growth Indicator Tube (MGIT. nalidixic acid. providing basic principles of bTB eradication. 1991). PCR tests targeted at mycobacteria-specific insertion sequences (IS). Systematic monitoring came into force in 1962 and has been carried out ever since. Bovine tuberculosis: Slovenia is officially free of the disease The first records of bovine tuberculosis (bTB) in Slovenia date back in 1851. marinum from other members of the M. When 285/264 amplicons cannot be obtained or the sequencing generates poor or ambiguous results.05 program (DNASTAR Inc. After the 2nd world war a planned ST on the community farms started and a federal eradication program was established in 1954.. CM and AS. species can be divided into slow and fast growers. amphotericin B. M. follows the sample homogenization. Ribosomal PCR amplicons are sequenced in both directions. PCR-hybridization assays (GenoType Culture Identification Kits MTBC. between 1891 and 1900... Not to be overlooked. since the majority of human-mycobacteria interactions are self-curing colonizations (Primm et al.5. Kunze et al. avium (IS901. 1993). Cultivation and identification of mycobacteria Cultivation of mycobacteria. In 1968.First International Symposium of Veterinary Medicine – ISVM2015 They usually do not cause disease in the immunocompetent humans despite the continuous exposure to low levels. between 1974 and 1976 the proportion of positive herds fell under 65 . 1992). A real-time PCR assay targeting the erp gene and IS2404 is employed for differentiation of M. with the exception of obligate pathogens not found as free-living mycobacteria. the proportion of positive animals in abattoirs did not exceed 1% in the period between the world wars. is performed (Kirschner et al.. the OIE-generated animal health code was adopted. tuberculosis complex (IS6110.. For the detection of mycobacteria from fish. 2004). targeting a 1037-bp segment of the 16S rRNA gene. 2013). supplemented with mycobactin J. concentration and decontamination protocol described by Kent and Kubica (1985). Identification of the isolates is based on the colony morphology. the samples are processed as described by Logar et al. revealed 70% of animals as positive reactors. performed in our laboratory. Becton Dickinson) are then incubated at 37°C for over 16 weeks. Several decades later. 2011). Becton Dickinson). however. are used for identification of M. paratuberculosis (IS900. isolates are subjected to PCR amplification of ribosomal genes using the commonly employed eubacterial primer pair 27F/1492R (Lane. avium subsp. EzTaxon and RIDOM websites. Nevertheless. Some species of mycobacteria are very difficult to grow in vitro as they are fastidious and take long periods to develop in culture. Hain Lifescience). In addition to regular ST and examination of carcasses at slaughter. 2012) and members of M. To determine the phylogenetic affiliation of isolates. The retrieved forward and reverse sequence fragments are edited and assembled employing the SeqMan II v. the media are incubated also at 30°C and at room temperature. the disease was reported to be spread among cattle population and the first tuberculin skin testing (ST). which was performed on some large farms in 1922.

engbaekii.. avium subsp. With regard to domestic animals. Fish mycobacteria are capable of 66 . chamois. pigment alternation. M. M. the situation can change at any time. and signs of emaciation. fortuitum. caprae in a herd consisting of cattle imported from an EU member state with a relatively high prevalence of bTB (Pate et al. M. caused by M. tuberculosis infection was most frequently reported in cattle. wild boar. several cases of infections have been described also in domestic animals.. wolf. Mycobacteria in wildlife: evidence of a variety of nontuberculous mycobacteria One of the greatest threats to any control programme in domestic animals is infection in wildife maintenance hosts that cannot be controlled and can re-introduce infection in livestock. as the countries bordering Slovenia have all recorded cases of bTB in free-range wild animals. mouflon. M. M. A decade later it dropped to 0. M. tuberculosis to be proven by a modern genotyping method (Ocepek et al. avium subsp.. However. M. terrae. neoaurum. a variety of potentially pathogenic environmental mycobacteria (NTM) were identified: M. fallow deer. Slovenia was declared officially free of bTB only in 2009 due to administrative reasons even though a single case of bTB in cattle of Slovene origin has been culture-confirmed in the last 25 years (Ocepek et al. We described such a case ten years ago. tuberculosis primarily causes TB in humans. Several other species are listed in the literature but most isolates belong to one of the mentioned species. a case of bTB has already been detected. recognized by listlessness. Mycobacteria were isolated from 11. due to abolished quarantines in the European Union. marinum. avium. caprae outbreak in a zoo in 2004. In contrast. our case was the first human-to-cattle transmission of M.8% animals. lethargy. 2006). roe deer. nonchromogenicum and M. followed by M. open lesions and ulcerations. ibex. red fox. Even though M.First International Symposium of Veterinary Medicine – ISVM2015 0. which may sometimes develop classical form of TB.1%. celatum. a survey on mycobacteria in Slovenian wildlife was undertaken. Indeed. stone marten and jackal. badger.01%. wild boar. it seems that some of the NTM found in this study have not been described before in the respective hosts. M. peregrinum.. sluggish movements. Gross or microscopic greyish-white tubercles may be found scattered or grouped in any parenchymatous tissue. polecat. M. fortuitum and M. The study was conducted on hunting grounds across the entire territory of Slovenia. affecting bisons and dromedary camels (Pate et al. 2005). exophthalmia. skin inflammation. Nevertheless. Fish mycobacteriosis is also an important zoonosis and poses a significant risk to all human beings working with the affected fish or the aquaria. vaccae. particularly in deer and wild boar. Since their initial discovery at the end of 19th century. hominissuis. intracellulare. Until recently. 2014). using the most important game animals as target species with a particular focus on wild boar and red deer as potential reservoirs. Therefore. the only known significant mycobacterial infection in wildlife in Slovenia was an M. humans with active TB are regarded as the main source of infection for animals. The presence of the causative agents of bTB was not demonstrated in any wildlife species. Fish mycobacteriosis is a typically chronic progressive disease that may take years to develop into clinically noticeable illness. The mycobacteria generally accepted as fish pathogens are M. confluentis. M. However. the significance of their presence in wildlife hosts in the absence of evident clinical signs and gross pathology has yet to be assessed. mostly in those living in close contact with diseased humans. chelonae. but are usually seen on the liver. M. fish mycobacterial diseases have been reported to occur worldwide in more than 150 species. kidney and spleen. Mycobacteria in fish: the presence of potentially pathogenic species for humans Mycobacterial infections are one of the most common infections of aquarium fish. Despite their omnipresence in the environment. roe deer. 2012). fallow deer and jackal. namely from red deer. The survey included a total of 306 apparently healthy free-range wild animals of 13 species: red deer.

when paraTB was found in a sheep flock. marinum and M. chelonae usually cause superficial lesions via skin wounds. avium has been isolated from cattle in several other cases during 2000-2011. many could avoid a longlasting therapy with antimicrobials. M. avium complex. fortuitum and M. but pulmonary disease and cervical lymph node infection may also occur. A particularly striking fact is a relatively high percentage of M. gordonae. With this simple precaution. avium-induced disease in pigs usually manifests in the form of lymphadenitis. avium was the most frequently encountered NTM in samples from farm animals (especially pigs) sent to our laboratory. 2005). M. is a common disease of ruminants in Slovenia. Almost 80% of the investigated fish were positive for mycobacteria. M. marinum.. Environment (water. cattle. in addition to M. elephant. M. M. comprising M. In the last few years. Most M. infections caused by M. avium-related lung tuberculosis in a cow showing clinical signs and lesions closely resembling those due to M. bedding. arupense. M. avium complex are the most common in pigs and have been described worldwide. chelonae were discovered. avium complex. it is of great importance to increase the awareness of workers in fish industry. However. The first case was detected in 1961 in imported Jersey cows. Nontuberculous mycobacteria in farm animals: the predominance of M. M. M. fortuitum. avium subsp. setense (Pate et al. avium In the past. several outbreaks of the disease in cattle. Pigs are susceptible to infection caused by members of the M. even when preparing them for a meal. M. sporadic infections in various domestic and wild animals (goose. The results of our studies demonstrate that the vast majority of ornamental fish available in pet shops in Slovenia harbour mycobacteria. soil. as well as from poultry and pet birds. bovis (Ocepek et al. since then. feed. Therefore. deer.. avium was by far most frequently isolated from pig samples sent to our laboratory. peregrinum. Paratuberculosis: a threat to dairy cattle farming Paratuberculosis (paraTB). intracellulare. M. birds etc. a chronic granulomatous enteritis caused by M. avium is the causative agent of avian tuberculosis. with the hands being commonly affected (Dolenc-Voljč and Žolnir-Dovč. 2003). when 35 aquarium fish were investigated and 29 were positive for mycobacteria. paratuberculosis (Map) which affects many animal species. The most important step towards decreasing the possibility to acquire mycobacterial infections from fish is to wear waterproof gloves whenever cleaning the aquarium and handling the fish. marinum (Pate et al. 2010). gordonae were most frequently isolated. among which the potentially pathogenic species for humans are predominant. No other cases were reported until 1993. a disease due to M. followed by M. Systematic screening of paraTB was carried out 67 . cats and dogs). tuberculosis and M. In other farm and companion animals (horses. M. M. marinum infections are cutaneous. among which the common fish pathogens M. however. chelonae and M. goats and sheep have been documented. fortuitum. kansasii. avium is considered to be very uncommon. Approximately one fifth of fish harboured M. and by several opportunistic mycobacterial species. sawdust. ulcerans and M. Apart from this case. The latest study encompassed 107 apparently healthy ornamental fish belonging to 20 species that were investigated in the period from 2009 to 2011. The first study on mycobacteria in fish in Slovenia was conducted between 2001 and 2004.First International Symposium of Veterinary Medicine – ISVM2015 causing both localized and disseminated infections in man. peregrinum/septicum. snake.) is a risk factor for human and animal infections caused by the M. and jackal) were recorded. avium and M. M.. we described M. 2014). a chronic contagious disease of poultry and birds with a fatal outcome. aquarium hobbyists and medical staff. which is the main causative agent of cutaneous mycobacteriosis in humans. However. marinum and M. During 2000-2011. most isolates date before 2003 when the compulsory slaughterhouse inspection of swine lymph nodes was abolished.

The study showed that the true prevalence at the herd level was almost the same as in 1999 and that it was fairly low (18. However. the opinions on its use vary. using various serological tests and including different categories and numbers of cattle (Ocepek et al. 2012). hygienic measures are of crucial importance for controlling the disease. The results from our previous studies. 3913. a significant increase in the prevalence of paraTB in the majority of big dairy herds is expected in the forthcoming years.49%) compared to many European countries (Kušar et al. concerning the comparisons of different diagnostic tests for paraTB. milk qPCR and faecal qPCR. In addition to detecting a surprisingly high proportion of Map shedders within a herd (89%). Therefore. veterinarians. as it hampers diagnostics of paraTB and interferes with tuberculin skin testing. Dawson D. a seroprevalence study was conducted in which animals older than two years were screened for Map in randomly selected cattle herds... 1999. which included faecal culture. however. Vaccination prevents the occurrence of clinical signs and reduces the shedding of Map in faeces and milk. Furthermore. In the last study. However. 2014). 2000 68 . Lack of sufficiently sensitive. the vaccination contributed to increased annual milk yield (Ocepek et al. suggested that the specificity of the ELISA kits used is questionable and showed a need for highly sensitive and specific method to detect subclinically infected animals which are the main cause of maintained herd infection and of spread of infections between herds and premises.: Mycobacterial terminology. was performed on the samples of 141 subclinically infected dairy cattle of all age categories from a farm with a history of paraTB. Alenka Usenik and Nataša Peterka are thanked for their technical assistance over the years. in addition. we demonstrated a negative influence of Map infection to milk production already in the first lactation heifers (Logar et al. The latter was observed during our vaccination trial performed in two heavily infected dairy herds. The results suggested that the proportion of low-level Map shedders in cattle populations tested in the past was most likely underestimated. we then introduced a high-yield DNA extraction method coupled with quantitative realtime PCR (qPCR) to detect Map in cattle faeces.. reliable and fast laboratory tests can lead to underestimation of the proportions of Map shedders in herds. 2011).First International Symposium of Veterinary Medicine – ISVM2015 between 1995 and 2001. 38. specific. Economic losses faced by the Slovenian breeders of Black and White cattle due to paraTB are estimated at 1 to 5 million euro per year. Vaccination can be used as a measure to control the disease. The study. no data on paraTB prevalence are available. eight randomly selected big dairy herds were monitored for the presence of Map-antibodies. 2011). For the period between 2002 and 2007. later studies indicated that presumably a lot more dairy cattle herds are infected with Map. This would enable the farmers to buy non-infected animals and increase the animal value in trading.. Acknowledgements Mycobacteria research was funded by the Slovenian Research Agency (Grant P4-0092). 2002). milk ELISA. Journal of Clinical Microbiology. this goal cannot be successfully pursued without participation of the government.J. Certain EU member states have already implemented strict preventive measures which request paraTB negative status of the herds providing milk for public consumption. it would be reasonable to introduce the control and eradication program which would encompass systematic screening of the disease and certification of infection-free herds. Milojka Šetina. These were detected in all herds while in half of them culture-positive animals were found (Starič et al. cattle breeding associations and the cattle breeders themselves. References 1.. As Slovenia has not yet implemented any measures for the prevention and control of the disease. In 2008. Therefore.

Centers for Disease Control. Logar K. 1993 Kunze Z. Pogacnik M..C. 47-50. Ježek J. 2014 Primm T. Lucero C. 111-119. organized by British cattle veterinary association. June 22-26. Starič J. Pate M. Acta Dermatovenerologica APA. Paller T. Lapanje A.. Delegates handbook..: Akvarijske ribice v luči mikobakterijskih okužb ljudi = Aquarium fish in the light of human mycobacterial infections. 11. BMC Veterinary Research 8: 1-22. Svara T. New York.: Public Health Mycobacteriology. 48... Italy. 16. Dolenc-Voljč M.. US Department of Health and Human Services... USA. GA. 6. Wrede A. paratuberculosis in subclinically infected dairy cattle: comparison with faecal culture.: Seroprevalence of cattle paratuberculosis in Slovenia in 2008 and a comparison of data from current and previous studies. Meier A. 2014. 1.. A Guide for the Level III Laboratory. Žolnir-Dovč M. Ocepek M..M. avium: a case report. Ocepek M. Parma.. Logar K.. 64. Enboz. Public Health Service. Žolnir-Dovč M. Slovenian Veterinary Research.. Bandelj P.: Effect of vaccination against paratuberculosis on fecal shedding and productivity of heavily infected cattle herds. Pogačnik M. 20. Gombac M. 31. Kiekenbeck M. 363-369.. Žolnir-Dovč M. 1991 Logar K. 4..: A new cultivation-independent tool for fast and reliable detection of Mycobacterium marinum. Krt B. Falkinham J. 73 Ocepek M. Pate M.. VI International M. 37... 2005 Pate M.. Zajc U.. pp. Ocepek M. Bange F.First International Symposium of Veterinary Medicine – ISVM2015 2. Journal of Veterinary Medicine Series B. 2006 Pate M. Posedi J. Böttger E.: Detection of mycobacteria in aquarium fish in Slovenia by culture and molecular methods... 2014. UK... Žolnir-Dovč M. Vogel U. Pate M.. Jenčič V. Zbornik Veterinarske Fakultete Univerze v Ljubljani. 2011 Lane D.P. Kušar D... Logar K.: Tuberculosis in cattle caused by IS901+ Mycobacterium avium subsp. 30. 2010 Kent P. 387-392. Journal of Clinical Microbiology. 5. 48. 1992 Kušar D. Ocepek M. Journal of Clinical Microbiology. Pislak M.. Pate M.. Portaels F. Clinical Microbiology Reviews.. suppl. Ocepek M. Ocepek M. 2012 Pate M. III: Health impacts of environmental mycobacteria. Cvetnic Z.: Eradication of bovine tuberculosis in Slovenia.: Transmission of Mycobacterium tuberculosis from human to cattle. 2882-2889. Zadnik T. 3. Zdovc I.. 2014..A. 8. 15.. 21.. 179-185...C.: Biologically distinct subtypes of Mycobacterium avium differ in possession of insertion sequence IS901. 1999 Ocepek M. Kubica G. 2011 69 .: 16S/23S rRNA sequencing.: Genotypic identification of mycobacteria by nucleic acid sequence determination: report of a 2-year experience in a clinical laboratory. 2002 Ocepek M. Pirš T. Pate M. 11. 35-39. 39. 98–106. Bandelj P.. 4-7. 18. 2003 Ocepek M.. 7. Zolnir-Dovc M. Journal of Fish Diseases... 36. 2014. 115-147.J.: Prevalence of bovine paratuberculosis in Slovenia in 1997 and 1998.. Emersic I.P. 17. Atlanta. Starič J. milk real-time PCR and milk ELISA. NY. Pate M.. 2004 Slany M. Bartos M. Medicinski Razgledi 51 (Suppl. Jenčič V. Journal of Clinical Microbiology. USA. Diseases of Aquatic Organisms. Maurer Wernig J.. Veterinarska stanica 42.. 1985 Kirschner P. Kopinč R. 14.O. McFadden J. Springer B.: Delayed diagnosis of Mycobacterium marinum infection: a case report and review of the literature. Krt B. Slovenian Veterinary Research. John Wiley & Sons. Poljak M.: Tuberculosis as a zoonosis: importance and diagnostics. Program & abstracts... 6)..M. Prodinger W. bovis Conference June 16-19. In: Nucleic Acid Techniques in Bacterial Systematics.. 10. 43. 53.. 12th International Colloquium on Paratuberculosis.J..... 12. 2013 Starič J. 119-125.: Seroprevalence of paratuberculosis in Slovenia between 1999 and 2001. Veterinární medicína. Krt B.: Outbreak of tuberculosis caused by Mycobacterium caprae in a zoological garden. Pavlik I. Cvetnić Ž. 2366-2372.T..: Evaluation of combined highefficiency DNA extraction and real-time PCR for detection of Mycobacterium avium subsp.. 3555-3557. 19. 17. 29-35.. Cardiff. 148 Pate M. Zolnir-Dovc M. 2005 Ocepek M... 39-44... 2012 Ocepek M.... 9. 19... 78-81. Žolnir-Dovč M. organized by International Association for Paratuberculosis.: Diagnostic of paratuberculosis on 8 big dairy farms in central Slovenia. Ocepek M. 13.

R. Palmer M. 50.: Improved specificity for detection of Mycobacterium bovis in fresh tissues using IS6110 real-time PCR. Harris B.. 2011 70 . Thacker T.C.. 7.V.. BMC Veterinary Research.First International Symposium of Veterinary Medicine – ISVM2015 22. Waters W.

Semen of lower quality (up to dead-non motile semen) could be expected from imported semen.ac. semen traits were in accordance to relevant national and international standards (Official Journal of R. Novi Sad. First semen production and insemination started in 1951 with fresh semen (Perković.36-7.ns. E. CASA) and live sperm cells with intact acrosome (LIA) 4-55% (33.679. Serbia Scientific institute of reproduction and artificial insemination for domestic animals "Temerin".g. progressive motile cells 0. Serbia *Corresponding author: aca@niv. opportunistic pathogen bacteria (Citrobacter freundii).7-28.0106 (3.CFU/mL) and bacterial types. Complete analyses were performed on 550 semen samples of 248 bulls. virus gene presence of IBR/IPV. Dominantly. presence of the genome of Bovine viral diarrhea virus.485 imported doses in 710 batches from 248 bulls. but mostly were rejected because of low semen quality (10 of 15 cases). semen import..75%) and pathologic forms (5-65%) from cyto-morphological studies. quarantine. unpublished data). 43 batches (32 bulls from 15 imports). related to improper transportation (liquid nitrogen leaking). including many worldwide breeding centers and local 71 .22 to 64. EU semen trading policy is devoted only to sanitary conditions and semen quality is a matter of standard operative procedure (SOP) of breeding center.11106 (1. progressive motility 1. bulls semen production and semen import.8% (16. Jelena Apić1.30-56.20%).rs Abstract During the period from 2010 to 2014 Scientific veterinary institute "Novi Sad" (NIV-NS) was responsible for quality control of 44 quarantines with 344.826 straws (6.33% of all imported straws) were rejected/destroyed because of different and prominent discrepancy. together with Holstein breed from USA. storage. Semen quality was tested by CASA (Computer Assisted Sperm Analyzes). Serbia № 38/2014 and OIE).40106. breeding plans and distribution were a privilege and obligation of breeding centers. flow citometry and cytology sperm quality parameters. Miroslav Urošević2 1 2 Scientific Veterinary Institute "Novi Sad". LIA cells by flow cytometry were 15. Igor Stojanov1. with total of 21. Keywords: bull.26% with average of 39.70% (average 35. BVD and Schmallenberg virus. recorded sperm total motility ranged between 9.761. After 2011 first distributive centers were registered and semen import became more intensive and versatile.775. Tomislav Barna 1. elevated bacterial count (CFU from 40-780103). quality and sanitary condition Introduction Republic of Serbia has a long tradition of cows farming. However. Sava Lazić1. total motile cells per straw 8. and then continued with Simmental breed from West Germany and Austria. USA and Canada) and 18 different breeding centers. Commercial semen imports started from 1989-1990 with Montbéliarde frozen semen from France (Perković. semen. From that period.60%). originating from 10 different countries (EU countries.70-15.10106). Milovan Jovičin1. Temerin.First International Symposium of Veterinary Medicine – ISVM2015 SANITARY AND QUALITY CONDITIONS OF IMPORTED BULLS SEMEN IN SERBIA ANALYSED AT "NIV-NS" (RETROSPECTIVE FROM 2010-2014) Aleksandar Milovanović 1*. Samples were analyzed for bacterial count (expressed as colony forming units .709.2412. 2011) and first import of frozen semen in 1976 (frozen semen of Simmental bulls for insemination of sires’ mothers).02%.

stressing on semen quality traits (minimal producing requirements regarding hygiene and semen quality. 2. 4. fungi. None of this directive is regulating minimal hygiene conditions of produced semen (level of bacterial contamination and bacterial type) or minimal technical guidelines of produced semen (e. Generally. moulds and yeasts. General directives for intra-Community semen trading are regulated by 88/407/EEC directive.. flow cytometry analyses (Guava Millipore-IMV. Presence of opportunistic pathogen bacteria is not recommended. Invitrogen). minimal number of live motile cells. Republic of Serbia is following these positive EU recommendations. Official Journal of R. Intercommunity trading between non EU trading is regulated by Commission for implementing decision 2011/630/EU (bovine species from third countries). Material and Methods Before semen import. maximal percentage of pathology forms). bacterial and quality investigations. Regulations in some countries are even stricter (2). Method of sampling (number of batches to be tested and number of doses per batch) was determined to be in accordance of the criteria of the representing Institutes. Spain) for assessing concentration. OIE Terrestrial Animal Health Code from 2003 had guidelines related to count of saprophytic bacteria in semen doses. After import semen is held in quarantine during maximal period of 21 day which is provided for semen sanitary and quality control. In our case. and test of membrane and acrosome integrity 72 . Most of significant producers of semen from the globe are presented on our market now. less than 50 doses). but current status of non-EU country allow to have national regulations that more precisely regulate semen import.000 CFU per semen sample. and allows up to 500 CFU/ml of saprophytic microorganisms. ISAS. total and progressive motility and spermatozoa speed values.g. Proiser. selling semen of the best genetic value and those with commercial value. Current OIE Terrestrial Animal Health Code from 2010 is missing these paragraphs. Nowadays semen import in Serbia is carried out trough 3 registered breeding centers and 10 semen distributive companies. Explanation was that presence of opportunistic pathogen bacteria in the sterile uterus of potentially immunocompromised individuals or herd cattle may present a risk for the occurrence of reproductive and other health problems in animals or humans (3. Most batches imported in the province of Vojvodina (north Serbia) were directed by decision of Veterinary Directorate to be tested in Laboratory of Reproduction at Scientific Veterinary institute in Novi Sad. including saprophytic bacteria.First International Symposium of Veterinary Medicine – ISVM2015 companies involved in semen trading and several cattle breeds become available to our market. Bulls’ semen quality control consisted of: 1. all bulls from the list and almost all batches were subjected to analyses (exception was if the bulls had import of several batches and some batches were with small number of straws-e. Regulations of semen storage centers (semen distributive centers) are regulated with Directive 88/407/EEC. 5). Some countries had established their own health criteria for bulls' semen clearing semen quality and hygiene. Serbia № 38/2014). In most cases 3 straws per analyze were sampled for viral. importers have to acquire positive opinion from Scientific-expert Council and to fulfil veterinary requirements regarding Veterinary Health certificate of animal that were used to produce bovine semen as well as for frozen semen.g. CASA (Computer Assisted Sperm Analysis. Thawed semen should not contain more than 5.SCSA test (acridine orange. USA) for sperm chromatin structure assay . Control is under supervision of Republic veterinary inspectors and samples are submitted to reference veterinary institutions (Faculty of Veterinary medicine in Belgrade or to regional Veterinary Institutions). Reason for this is not stated and it is not known to this the first author of this article.

and 0. series of dilution (101-105) were prepared in buffered peptone water (CM1049. Tests for total aerobic microorganisms were carried out in accordance with the international standard (ISO 8607: 2003). For identification of BVDV and Scmallenberg agent in the bulls' semen realtime ART-PCR was used. 2014). or pathogen bacteria. 1000x magnification (Olympus BX-40.4. 38 from April 4. Basingstoke. For anaerobic and microaerophilic bacterial determination the thioglycollate broth was used. The spermatozoa morphology was assessed according to Barth and Oko (1989) and semen was classified according to quality criteria by Jovičin et al. OIE Terrestrial Manual. In the case that semen is not in accordance to relevant quality or sanitary requirement semen must be safely destroyed or turned back to producer. Before national directives for semen quality (declared in 2014) bacterial loads was tolerated up to 10. Invitrogen. Basingstoke. BVD and Schmallenberg virus. In cases with very good semen quality and less sperm cells in doses semen could pass analyses because some elite bulls breeding centers were producing doses not more than with 6-9 ×106 sperm cells per doses. Briefly. Invitrogen. MacConkey agar (Oxoid. USA) for milk or egg-yolk extenders. Importers and producers accepted semen destroying in such cases. III and „out of class“). MA. Novi Sad) under oil immersion with phase contrast objective. CASA progressive motile under 20%. Japan). 3) the number of (progressively) motile and morphologically normal spermatozoa in a dose after thawing: at least 10 million. Chapter 2. official guidelines for semen quality were established (Official Journal of Republic of Serbia" no.5 mL were inoculated on Petri dish and Tryptone Soya Agar (CM131. Imported semen was also subjected to virological testing for the presence of IBR/IPV (BHV-1).8. progressive motile cells less than 3×106.First International Symposium of Veterinary Medicine – ISVM2015 (PNA-FITC/PI. 2008) or molecular biological study PCR technique. From April 2014. (1992) in four class (I. Main quality parameters of bull semen extracted from this regulative are now more demanding and are as follows: 1) progressive sperm motility: at least 50% (for our sperm motility test that was performed by CASA. USA). Sexed semen is not covered by this quality regulation but all other regulations regarding bacterial and viral presence were done as for conventional semen. Oxoid) supplemented with 5% of sheep erythrocytes was poured over.000 of saprophytic bacteria). 73 . Doses also were discarded (scored as “out of class”) in the following situation: CASA parameters-total motility spermatozoa 30%. Identification of the virus was carried through susceptible cell culture (MDBK cell line. 3. UK) and Sabouraud dextrose agar (Torlak. Semen destroying was carried out by autoclaving at 128C for 1h and10 minutes. Also. Oxoid.000 of total CFU/ml at NIVNS. Basingstoke. Qualitative determination of bacteria was performed by cultivation onto the Columbia agar plates supplemented with 5% sheep blood (Oxoid. The plates were incubated for 48h at 37oC under aerobic conditions. There were rare cases of compensation of semen quality with higher number of spermatozoa. and PCR molecular method for IBR (Applied Biosystem 7500. total motile cells in a dose less than 4×106 sperm cells per doses. semen should have at least 40% of live normal sperm cells with intact acrosome and less than 40% of abnormal forms (cito-morphology after supravital staining). Serbia). Life Technology. II. we considered progressive motility at least of 30% and total motility at least of 50%). 2) the percentage of morphologically altered sperm up to 30%. or vitality test-membrane integrity (Sybr14-PI. UK). Detailed cyto-morphological examination of stained sperm sample with eosine-nigrosinetripan blue staining (Alfapanon. UK). USA) for synthetic extenders. Semen must be free of virus genome presence. 4) the total number of the bacteria up to 500 CFU/ml (if semen had good quality traits we tolerate up to 10.

455 1 7 5 114 37 54. Netherlands. Complete analyses were performed on 550 conventional and 22 sexed semen samples of 248 bulls. imported of conventional semen batches.376 1 1 502 8 10 4.100 20 52 7 55 27 22.485 248 550 № of rejected: semen bulls batches doses 14 23 13. Slovakia.950 54 78 15 225 73 115. Most often imports were from Croatia (15 times). Table 1. total bulls’ semen doses. Sexed semen represented only 3.15%).967 1 1 690 1 1 500 2 3 721 21. performed analyses and rejected semen doses by exporting countries subjected to analyses at NIV-NS during period 2011-2014. Germany. Imported Country Austria Canada Croatia Czech Rep. Semen originated from 10 different countries (Austria.464 73 207 1 10 2 4. Overview of the basic details of the number of quarantines.85% of all analyzed semen batches. Denmark. USA and Canada) and from 18 different breeding centers. Czech Republic. Croatia. Netherlands (7). 562 were analyzed (79.826 31 43 Table 2.910 25 45 44 710 248 344. Denmark Germany Netherlands Slovakia Switzerland USA TOTAL 10 Analyzed: № of imports Samples Batches bulls № of doses bulls (quarantines) (batches) 3 57 4 28. Switzerland and Canada (5).300 5 8 2 82 20 40. Breed Country Austria Canada Croatia Czech Rep.790 2 10 1 24 5 6. Denmark Germany Netherlands Slovakia Switzerland USA TOTAL Angus Belgian blue Brown Swiss Holstein Limousine Simmental 1 2 3 2 2 6 4 10 74 87 20 10 7 28 34 31 34 251 4 4 24 180 37 7 32 280 .070 4 4 1. Imported semen samples/analyses according to bulls breed and imported countries for conventional semen (N=550).350 37 67 4 50 25 14.First International Symposium of Veterinary Medicine – ISVM2015 Results During the period from 2010 to 2014 Scientific Veterinary Institute "Novi Sad" (NIV-NS) was responsible for quality control of 44 quarantines with 344.485 imported doses in 710 batches from 248 bulls.009 4 24 5 86 54 53.157 27 52 1 7 1 4. Out of 710 imported batches.

First International Symposium of Veterinary Medicine – ISVM2015 Table 3. representing 23. presenting incidence of 34..778232. in 29 batches and in 23 bulls.667 7. Badger et all. Imported № of imports doses % of all batches bulls № of doses (quarantines) rejections Viral presence (BVD) 1 1 1 502 2. 1999). low semen quality or improper transport (liquid nitrogen leaking). Table 4).916/21. Bacterial contamination with Citrobacter Freundii (an opportunistic microbe that is accountable for quite a few significant opportunistic infections) isolated in monoculture. Table 5). 75 . Imported semen samples/analyses according to bulls breed and imported countries (sexed semen). averaging 237. In 15 cases from 44 imports (quarantines) one of the mentioned reason for rejection were noted. 1992.485). Joaquin and all. Viral genome presence of BVD by RT-PCR technique was noted in one batch of one imported bulls' semen. N=22. 67. Bacterial unsoundness represented in 3 imports.30% Bacterial unsoundness 3 10 5 2.916 13. Basic details of the rejected bulls semen doses (main reasons for rejection. One quarantine had combination of low semen quality in 2 batches and high bacterial presence in 6 batches.826 rejected doses (76. in one a combination of high bacterial load and low semen quality was noted Reason for rejection Reasons for semen rejection were classified as viral presence. in concentration of 1.70%.000 CFU/ml. From all semen analyzes this is represented 1.826 *15 imports were rejected. imported batches.25% (10/43) of rejected batches and 13. This represented 5.36% of all rejected doses (2.313 CFU/ml).09%.826. number of quarantines/imports.741 76. Low semen quality was registered in 10 imports.741 doses from 21.. Main reason for semen rejecting was improper semen quality (29/43 cases.000 CFU/ml was noted in one case and rejected as a potential risk for uro-genital infections (Milanov and all. bulls and number of doses) that was subjected to analyses at NIV-NS during the period from 2011 to 2014.77%).85% of all imported semen. Other 9 rejections were because of high bacterial load of saprophytic and/or opportunistic microorganism (40. This was several times over technical normative for semen quality.36% Semen quality criteria 10 29 23 16.70% Improper transport (N2 leaking) 2 3 3 1. 2012. with total rejections of 16. bacterial unsoundness.64% TOTAL 100% 16* 43 32 21. on 5 bulls and 10 batches.81% of all batches (10/550) and only 0.741/344.000 to 780.86% of all imported semen doses (16. Breed Holstein Simmental Country Canada Denmark Germany Netherlands USA TOTAL 2 1 3 15 21 1 1 Table 4.27% of all imported semen batches (29/550) and 4.

10 2.02% sperm cells.000 Enterobacter aerogenes - Regarding CASA parameters. Staphylococcus sp.00% 35. and 130.80% 7.97 2..77 0.81 37.775. livedead). Enterobacter aerogenes. Bacillus sp.. ranging from 0.Dev.48 24.77% 3. On membrane permeability test (sperm vitality test.02 million in dose 8.36 28. intact sperm membrane was detected in 30.01 On cyto-morphological analyses of deep frozen bull semen (29 semen samples) average percentage of normal live sperm cells was 33.50% (from 1.90 33.000 Corynebacterium sp. Total motility after thawing 35.10% (from 2.6043.30% (ranging from 2.First International Symposium of Veterinary Medicine – ISVM2015 Table 5.70 15. Coef.70%).47% 9.30% 56.10106). Corynebacterium sp.24±12.10% 2. ranging from 1.70% 0.00%) and total abnormalities 42.6712. and 340.Var.01% (5.000 Enterobacter aerogenes and Bacillus sp.11 1. Number of spermatozoa million million in in ml dose 90.00% of spermatozoa. Progressive motility after million thawing in dose 16. bulls. Sperm chromatin structure assay (SCSA) of rejected deep frozen bulls' semen indicated average sperm chromatin defects in 9.52-65.01 (4.916 Bull B Import B Bull C Bull D Import C TOTAL: 3 Bull F 5 Bacterial load Isolated bacterial strain (CFU/ml) 1.509.00% ).000 Citrobacter Freundii 350. Bacillus sp.70%)..000 Bacillus sp. Bacillus sp. On sperm membrane and acrosome integrity assay (24 semen samples) live spermatozoa with intact acrosome was detected in 39. doses.90 22.70-15. 60. Total damaged acrosomes (DA) in sperm cells were present in 31.000 Micrococcus sp. bacterial load and isolated strains) during the period from 2011 to 2014.30 133. 80.80% (23 semen samples). 76 . Bacillus sp.30%.70% to 28.00 5. St.83% 35. average total motility of 29 rejected semen was 35.76 1.10% (29 semen samples) detected by flow cytometry. maximal 56. progressive motility 16. Staphylococcus sp.47 3.000 Staphylococcus sp.67% sperm cells.35 0.01 0.61% 27.08 0.56 24.24 4. Table 6.50 22.00-35.95 36. and Bacillus sp. Average total motile sperm cells were 8. Percent of fast moving spermatozoa 19.10 7.80%) and fast moving spermatozoa 19.7612.60-43.87 0.00-55.11106 (1.479.51 3..000 Enterobacter aerogenes 40.26 5.48±9.00-65.50% 1.32 0.40-32.70% 9.38%).6% (minimal value 9. Descriptive statistic of the CASA parameters of rejected deep frozen bulls' semen (29 semen samples) Descriptive statistic values Mean Minimum Maximum Std. and Staphylococcus sp.70% 6. and 160.51±14. Import Bull Batches Import A Bull A Batch 1 Batch 2 Batch 3 № of doses 300 375 150 Batch 4 410 Batch 5 325 Batch 6 375 Batch 7 260 Batch 8 Batch 9 Batch 10 10 185 300 236 2. ranging from 1. batches.000 Micrococcus sp. Error 1.40 32. and 780.72 29. Details of rejected bulls’ semen doses regarding bacterial contamination (number of imports. 200.80% (23 semen samples).000 Corynebacterium sp. booth detected by flow cytometry.

09 ( L=Total live/unstained spz.total. Coef.00 12. 8. 3.51 188. Error 2.00 55.42 64.67 Coef.51 Minimum 22.15 30.Var.40 Maximum 99.24 16.81 113.50 Minimum 67.64 90.  DA=Damaged acrosome .00 12. ( ABN= Total abnormalities). II АBN= Secondary abnormalities.75 28. I АBN=Primary abnormalities.02 2.Var.33 39.80 98.First International Symposium of Veterinary Medicine – ISVM2015 Table 6.73 14. 5. 77 .00 35. Descriptive statistic of membrane permeability test (sperm vitality test. Descriptive statistic of sperm chromatin structure assay (SCSA) of rejected deep frozen bulls' semen (29 semen samples) by flow cytometry Descriptive statistic 1.00 30. 7.97 9. St. 30.Dev.00 Coef.  PPD=Protoplasmatic droplet-total. LIA=Live spz.Var.09 33.71 95. LDA=Live spermatozoa with damaged acrosome.35 2. Error Normal sperm morphology Total Live spermatozoa LIА LDA L  DА Abnormal sperm morphology Total.Dev.30 Coef.98 ( L=Total live spermatozoa. Membrane status (%) values Undamaged Damaged (live) (dead) Mean 30. Table 7.00 26.10 46.38 Std.62 Table 8.10 2. Subpopulation of sperm cells (%) Descriptive statistic values  Mean Minimum Maximum Std.52 Minimum 1.76 5.10 Std.13 3. 8.02 59. 4.39 0.00 7. 9.00 9.48 69.00 8. Mean 43. Error 1.94 15.40 Std.88 27. with intact acrosome. 3. 42.00 0.72 13.26 47. 31.68 St.19 0. 9.76 5. 6.42 51. 2..Dev.88 2.34 31.03 16.52 Maximum 66.67 4.39 St.60 56. DDS= dead spermatozoa with damaged acrosome. Descriptive statistic of cyto-morphological analyses of deep frozen bull semen (29 semen samples).00 10.Var.11 1.72 2.02 15.60 0.06 12.Dev.18 65.05 12.45 1. 4.88 0.97 1.97 1.22 6. 13. live and death I АBN II АBN  PPD ABN 1.total).00 65.20 Maximum 43. live-dead) for rejected deep frozen bull semen (24 semen samples) by flow cytometry Descriptive statistic 1.51 3. DNA status values (DNA – %) undamaged damaged Mean 90.00 2. with damaged acrosome. Descriptive statistic of sperm membrane and acrosome integrity assay for rejected deep frozen bull semen (23 semen samples) by flow cytometry Descriptive statistic Detection of specific subpopulations of spermatozoa (%) values LIA DIА LDA DDS L  DA 1.93 0.97 Table 9.60 32.01 28.53 1.56 16.56 45. LIA=Live spermatozoa with intact acrosome. DIA=dead spermatozoa with intact acrosome.91 St. 6.51 9.01 28.36 42.  DA=Damaged acrosome .10 2.67 9.00 65.65 2.39 11.60 32. Error 1.67 13.34 2.79 32.26 113. 5.00 64.85 2.91 94.70 2.00 7.00 4. LDA=Live spz. 2.22 0.00 56.61 1.54 0.

semen rejection was accepted as normal issue. Quality of imported semen analyzed at NIV-NS dominantly was in accordance to relevant national and international standards (Official Journal of R.741 doses). opportunistic pathogen bacteria (Citrobacter freundii . this system is not working in most regions (lack of data collecting and data summering). With modern. Information of cows. Routine semen testing at the import and national recommendations of semen quality traits can be comprehended as a good method for reduction of fertility problem generated by male infertility on cattle farms in Serbia. Acknowledgements This work was supported by a grant from scientific project TR 031071 of Ministry of Education and Science of Republic of Serbia 78 . 43 batches (32 bulls from 15 imports). France has established automatically generated system of on field data collecting trough coding of cows and semen straws. Serbia № 38/2014. However. Practically. Intercommunity trading and EU to non EU trading is regulated by Commission for implementing decision 2011/630/EU on imports into the Union of semen of domestic animals of the bovine species from third countries. Other way to have better insight of semen quality is to test semen with up to date laboratory system taking in account that biology traits are not always in accordance with laboratory results (Milovanović and Barna. used semen.667 straws). insemination or rebreeding is automatically sent to main computers by internet on the moment of insemination which allows that fertility problems are quickly recognized. related to improper transportation (liquid nitrogen leaking – 1.First International Symposium of Veterinary Medicine – ISVM2015 Discussion Council directive 88/407/EEC is laying down the animal health requirements applicable to intraCommunity trade in and imports of semen of domestic animals of the bovine species. before declaration of national direction for semen quality (Official Journal of R. presence of the genome of Bovine Viral Diarrhea Virus.616 doses). photo and movie documentation. Complains often are coming directly from farmers instead of veterinarian practitioners. Serbia without this system is relaying on obligation of veterinary service to inform breeding or distributing center on pregnancy rate of purchased bulls' semen.300 doses). Conclusion EU semen trading policy is devoted only to sanitary conditions and semen quality is a matter of standard operative procedure (SOP) of breeding center. elevated bacterial count (CFU from 40-780103. but mostly were rejected because of low semen quality (10 of 15 cases 16. ISO standardized bacteriology and virology laboratories/tests). Council directive 88/407/EEC and OIE). with total of 21. and most domestic importers and foreign breeding centers as sellers are easier accepting reasons for semen destroying. at herd and individual level (diagnostic tests on the bull). up-to-date system of semen quality control and strong argumentation (semen quality tested by several methods. 2.826 straws (6. Semen of lower quality (up to dead-non motile semen) could be expected from imported semen. what was strong argument of importers when semen of low quality was established.33% of all imported straws) were rejected/destroyed because of different and prominent discrepancy. 2011). Serbia № 38/2014. AI station or quarantine). Bulls semen produced for artificial insemination should fulfil sanitary requirements before the quarantine period (requirements of the farm. In both cases no strict or any technical guidelines for intra community trade is mentioned that could serve as a general guideline regarding semen quality requirements or for bacterial count in extended semen.

sredstava za rad i stručnog kadra koje mora da ispunjava centar za skladištenje i distribuciju semena za veštačko osemenjavanje (Objavlјeno u „Službenom glasniku RS”. 6.. Steonost krava u zavisnosti od citološkog i mikrobiološkog kvaliteta zamrznutog semena bikova. 9.Frozen semen of breeding bulls -. Zbornik naučnih radova PKB Agroekonomik. Guest Editor Detlef Rath.prikaz slučaja. Мonografija. Chapter 2. Barna T. Glavonić L. opreme. 5. 60 godina rada stočarsko-veterinarskog centra „Krnjača“. Barna T. 1989. Oko RJ. Boroš I. OIE . Al Fayez N: Neonatal Meningitis and Bilateral Cerebellar Abscesses due to Citrobacter freundii. Minimalni pogoji za oploditveno sposobnost semena: http://www. Milovanović A.: The modified thermoresistance test is not siutable for fertility prediction of frozen-thawed bull semen. urednik Miodrag Lazarević. Badger LJ. 2012 (srp) Milovanović A. Bovine Viral Disease "ОIE Terrestrial Animal Health Code 2003". Str. publisher: Stočarsko veterinarski Centar Krnjača. Dr Stevan Perković. oktobar 2012. Naučni simpozijum Reprodukcija domaćih životinja i bolesti novorođenčadi. 17:23-4. 1997. Reproduction in Domestic Animals.. 1999. Jovičin M. Salma J.iso. Abnormal Morphology of Bovine Spermatozoa. Vol. 2010.. 2011.. Khan S.org Joaquin A. 3. Beograd. 7. 1951-2011.4.Chapter 4. 10.. Antalya. 4208-15. Citrobacter freundii Invades and Replicates in Human Brain Microvascular Endothelial Cells. Russell N. print. Jakovljević G. Zbornik predavanja. Barth AD. Beograd. US. Iowa State University Press.uradnilist.First International Symposium of Veterinary Medicine – ISVM2015 Reference: 1. Turkey 15-17 September 2011. 12. 67. IA. 13. 125129. 6. Str. Naučna KMD. 130-130. Infection and Immunity. 329-39. Stojanović D.8. Stins F. Kašić M. The 15th Annual Conference of the European Society for Domestic Animal Reproduction (ESDAR). Divčibare.oie. www. Berlin. broj 6/11 od 4.int/eng/normes/mcode/code2003/A_00127. Pediatr Neurosurg 1991/1992. 11. 2.Terrestrial Animal Health Code. Kim KS.: Izolacija Citrobacter freundii iz duboko zamrznutog semena bika . 8. http://www. 8. Ames. small ruminant and porcine semen. 4-7.htm Pravilnik o uslovima u pogledu objekata. Milanov D. 2011.jsp?urlid=200751&stevilka=2725 OIE Terrestrial Manual 2008. februara 2011. Monique. Naučna KMD. ISO 8607:2003(E): Artificial insemination of animals -. 4.. Wiley-Blackwell. godine 79 .si/1/objava.Enumeration of living aerobic microorganisms. Nemeš Ž. Collection and processing of Bovine.

Urosević1*. Luis Losinno2. On balance. we would recommend thoroughly planned control and primarily to make evidence of stallions used for breeding of mares in sport and rural areas. University of Novi Sad. Dragiša Trailović4. Agronomia y Veterinaria. Fac. we shall mention compulsory measures in Argentina about the obligation of examination of Equine Viral Arteritis on stallions. Serbia 5. Serbia 4. Jelena Petrović3.com Abstract Diagnostic and health condition control procedures of breeding stallions in Serbia are in accordance with Regulation on the establishment of animal health care measures for 2014. it is not recommended to “a priori” implement every EU model currently. Natasa Filipović5 1. when it comes to the number of stallions there are no official records. Serbia 2. According to the records from the Bureau for statistics of Serbia from 2014 here are 16. in relation to mentioned legal framework and de facto situation in horse breeding in Serbia. University of Belgrade.000 of mares and fillies. legislative. Faculty of veterinary medicine. Slobodanka Vakanjac4. it can be emphasized. Keywords: equine. those are the official records we consider them as not viable enough and they are 80 .miro2012@gmail. sport and nowadays increasingly more as a hobby. that in relation to further development of veterinary profession and horse industry in Serbia as well..First International Symposium of Veterinary Medicine – ISVM2015 THE HEALTH STATUS OF BREEDING STALLIONS FOR NATURAL BREEDING AND ARTIFICIAL INSEMINATION: REGULATORY COMPLIANCE IN EUROPEAN UNION AND WEST BALKAN Miroslav I. tests which are conducted on horse-farm prior to breeding season include serum neutralization test for Equine Herpes Virus -1 (EHV-1) and Equine viral arteritis. Aleksandar Milovanović3. Faculty of agriculture. Veterinary medicine Dep. EU Introduction The state of horse breeding and reproduction in Serbia Horse breeding as an animal husbandry branch has a long and significant tradition in Serbia through the use of horses in work. Serbia *Corresponding author: urosevic. Although. Serbia. Scientific Veterinary Institute “Novi Sad”. Rio Cuarto. and completely. Frozen semen samples imported from foreign countries must be checked by state laboratories for detection of viral presence by PCR before commercialization and insemination. Belgrade. Novi Sad. Universidad Nacional de Rio Cuarto. Diagnostic tests for breeding stallions are performed on each breeding animal one time in a year. Nevertheless. semen. Argentina 3. in justified cases of doubt solely it is. which include 8. Scientific institute of reproduction and artificial insemination for domestic animals "Temerin" Temerin. Examination of equine sperm for arteritis is not a common procedure . When it comes to stallions. Nevertheless. These are following: Every breeding association must submit a certification of negativity (serum neutralization test) for Equine Viral Arteritis of all active stallions before the annual breeding registration or AI. Novi Sad. What is the looming problem nowadays is that there is no existing system control whether would that involve certain institutions or associations (sport or breeding animals). On the other hand. due to the difference in horse breeding between our system and similar in EU countries. and those include only tests for Equine infectious anaemia. the majority of horse owners and keepers tend to follow their previous routines and preventive measures. However.000 horses. as an example of regulations in South America.however.

we cannot accurately determine the nature of epizootic situation for this contagious disease. In the continuation of this work we are going to describe what are the laws that should be obeyed regarding the health conditions of stallions. however the breeders are not completely adjusted to breeding programmes from the unknown reason whether they are not keeping records or they do not hand in breeding reports to basic breeding organisations. Moreover. Thus. 2014A). the additional records available to us are containing the information about the population size on the Province Vojvodina territory (Trivunovic. However. Diagnostic tests for breeding stallions are performed on each breeding animal one time in a year. Nevertheless. 2014). monitoring and prevention of Leptospirosis specific diagnostic examination (microscopic agglutination testMAT). as well as in every herd containing more than 10 horses. as well as the stallions provided and borrowed for breeding. is biannually conducted in stallions for natural mating and for semen production for artificial insemination. the present Program of measures states that in order to do establishment.First International Symposium of Veterinary Medicine – ISVM2015 taken with caution owing to the fact that those do not reflect the actual state especially regarding the breeding animals. What is the looming problem nowadays is that there is no existing system control whether would that involve certain institutions or associations (sport or breeding animals). in justified cases of doubt solely it is. there is existing risk of CEM transmission during the import of breeding stallions and mares from the neighbour countries and EU. with confirmation Coggins test in addition. The active population counts 184 animals. sports horse-farms. If the owner of an animal sells the animal or alienates it in any other way. from main breeding organisation in the animal husbandry at the Faculty of Agriculture of Novi Sad from 2014. In any case. Examination of equine sperm for EVA is not a common procedure . Nevertheless. if they are compared with the legislation in Serbia (West Balkan) and EU. includes only stallions that are registered. there is an assumption that for breeding is used a larger number of the breeding animals. forests and other places of work. Equine viral arteritis All newly purchased horses should be kept in quarantine and subjected to serological testing 81 . horse-farms owned by Serbian Military Force. In addition to those mentioned facts there have not been a proper number of scientific publications when it comes to fertility and problems in horse reproduction due to infectious disease in Serbia. tests which are conducted on horse-farm prior to breeding season include serum neutralization test in blood sample for Equine Herpes Virus-1 (EHV-1) and Equine viral arteritis (EVA). and are under the regular productivity control. the certificate about the examination of EIA must not be older than 30 days. there are no precise data about the number of breeding mares and stallions that are under regular serological control for Leptospirosis in the herds in Serbia. sporting competitions etc. the majority of horse owners and keepers tend to follow their previous routines and preventive measures. reviews. Diagnostic examination can also be done with ELISA test. exhibitions. Furthermore. fairies. Legislation about breeding stallions in Serbia Diagnostic and health condition control procedures of breeding stallions in Serbia are in accordance with Regulation on the establishment of animal health care measures for 2014 (Anonymous. Compulsory blood examination for EIA with the Coggins test has to be conducted in the following cases: once in a year in the breeding horse-farms. This report. Owing to that. 90 days prior their arrival to hippodromes. When it comes to stallions. stud sections. in our country no systematic control of breeding animals for CEM (Contagious equine metritis) is done which is hardening the insight on the field. and those include only tests for Equine infectious anaemia (EIA).however.

The term "official veterinarian" means that the veterinarian is appointed by the Minister in accordance with the provisions of the Veterinary Act. As in the whole EU veterinary certificate for trade of semen of the equine animal is issued or authorized by the official veterinarian and above all he specifies the type. it meets the health and hygiene conditions in accordance with recognized international standards. The official veterinarian confirms that the Centre for semen collection in which that semen was collected. and in a manner when it is possible at any time to determine the origin of semen and it is kept for at least five years from the date of placing on the market of the last batch produced. 2014B). as well as the time of collection of semen. Such records are kept for each production run of conserved semen. Certificate of the official veterinary organization claiming that standard clinical examination is conducted and that no symptoms are established responsible for causing diseases which can be transmitted by the semen of the donor animal. Regardless of its issuing in 2009. where the Regulations on traffic equine semen are in fact the provisions of Directive 92/65/ EEC (Anonymous. serological (in unvaccinated equidae) or epidemiological evidence of AHS have not been established in the past two years and in which in the last 12 months has not implemented a vaccination against this disease. race and identity of donor semen. meets the following requirements: that is situated on the territory or in the region of the Member State on the day of collection of semen until the date of dispatch of semen or until the expiry of a period of 30 days mandatory storage of frozen semen that is free of African horse sickness (AHS) in accordance with special regulations.First International Symposium of Veterinary Medicine – ISVM2015 (serum neutralisation test). 1992) on health requirements for trade and imports into the European Union (EU) of animals. that during the period commencing 30 days prior to the date of semen collection until the date of dispatch of fresh / chilled semen or until the expiry of a period of 30 days mandatory storage of frozen semen fulfil the requirements of the Ordinance on the veterinary conditions for the transfer of the equine animal and imports from third countries. In the first place. In relation to the regulations on the health status of breeding stallions in Serbia rules about semen quality ought to be mentioned (Anonymous. it is taken from the high in quality breeding animals with known health status over which are implemented the measures prescribed by a special regulation governing the program of measures of animal health care. The official veterinarian must during the inspection and on the basis of declarations by the owner or breeder to establish the absence of any reason to suspect that the equidae have been in contact with animals suffering from infectious or contagious diseases during the 15 days immediately prior to the 82 . or most precisely where no clinical. The semen meets the requirements in terms of quality if: it is produced in a centre for reproduction and artificial insemination. necessarily paired blood samples. it is taken from an animal that has been clinically examined and at which no symptoms of diseases which can be transmitted by semen of an animal which the semen is taken from. processed and stored for transport. But in the narrow sense of "third country" in relation to the status of AHS. the definition of "third country" means States that are not members of the EU. This Ordinance applies to most contagious animal diseases. in accordance with Council Directive EC. European Union legislative An interesting example of legislation is in Croatia. means a Member State of the EU free from AHS. It is necessary to obtain certificate of the official veterinary organization claiming that the samples are taken from studs with high in quality with well-familiar health status and that the standard measures are conducted which are in accordance with program of measures of animal health care. the mentioned Regulations came into force on the day of Croatia entering the EU in 2013. ova and embryos. semen.

During the completion of this certificate. This applies to a negative status of the animal from a disease which should be reported: Dourine. or with virus isolation test on an aliquot of the entire semen of the donor stallion. according to the information / check the official veterinarian of the 15 days immediately prior to collection of semen have not been in contact with equidae suffering from an infectious or contagious disease. rabies. AHS.First International Symposium of Veterinary Medicine – ISVM2015 examination. If it is about the import of equidae from the third countries to Croatia it is only allowed if those countries are officially enlisted by the European Commission. Glanders. during at least 30 days prior to collection of semen have been kept on farms where no equine animal showed clinical signs of EVA. EIA. In order to prevent forgery of documents. Discussion Unfortunately. in cooperation with the Ministry of Agriculture (as the competent body of the exporting country). in the language of the country of export of semen and at least one of the official languages of the EU. The competent body shall provide all necessary assistance to the experts referred to in paragraph in carrying out their work. anthrax. during at least 60 days prior to collection of semen have been kept on farms where no equine animal showed clinical signs of CEM. in Serbia some kind of diagnostics includes only sport horses or other categories of horses that are exposed to diagnosis because of bringing them to the event. That the stallions donors undergo one of the following testing programs: that at least 30 days prior to and during the collection of semen continuously resident in the collection centre of semen and in that period no equine animal in the centre has not come into direct contact with equidae of lower health status than the one in the centre. Equine encephalomyelitis (all types including Venezuelan encephalomyelitis). Certainly. fairs or export. urethra and urethral fossa with negative result in each case. the experts of the European Commission. The health certificate is valid for 10 days and consists of a single sheet. during at least 30 days prior to collection of semen have not been used for natural mating. That the above described semen comes from donor stallions. The conditions to be met by the Centre for artificial insemination in EU are: That during the period commencing 30 days prior to the date of semen collection until the date of dispatch of fresh / chilled semen or until the expiry of a period of 30 days of mandatory storage of frozen semen possessed only equidae which were free of clinical signs of CEM and EVA. the colour of the seal and signature of veterinarian should differ from the colour of the printed text. Interestingly. This approval relates to the whole territory of a third country or to only a part of its area. the exact date is stated when they carried out indicated tests on samples of semen or blood. that they are subjected to the following tests in a laboratory approved by the competent authority in accordance with a test program: Coggins test for EIA with negative result. Vesicular stomatitis. to the extent that is necessary to ensure the implementation of this Regulation. 83 . may do the examination on the spot. parts that are not related to the shipment must be crossed out. a test for CEM carried out on two occassions with an interval of seven days by isolation of Taylorella equigenitalis from preejaculatory fluid or a semen sample and from genital swabs taken at least from the penile sheath. We should not neglect the legislation of the third country which applies in relation to animal health and welfare. serum neutralisation test with serum dilution of 1 in 4. which: on the day of collection of semen have not shown clinical signs of an infectious or contagious disease. with the negative result. for now. The certificate of health in the case of a registered equine must be issued within 48 hours before loading or no later than the last working day prior to loading.

non-implementation of the prescribed veterinary measures and on the impossibility of monitoring the movement of animals. In addition. This example confirms that effective control of infectious diseases that occur occasionally involves primarily the establishment of effective communication between veterinarians. Regardless of whether it is possible titre of antibodies against influenza. manipulating and breeding animals. where the disease was diagnosed in the regions Sicilia and Campagna in 2011. particularly in countries with unreliable labelling and record-keeping of horses (i. interesting is the situation in Italy (Calistri et al. most sports horses are regularly controlled. Croatia and Serbia). Although the Ordinance on eradication EIA specifies the compulsory serological diagnostic measures in horses once in five years it is highly dubious that this is fully carried out. 2013). this prevention of Dourine has been used to detect a number of deficiencies in recording and registration of horses in the Central Database in relation to the situation on the field. There are some interesting experiences and research on the occurrence of EVA in Croatia in the period from 2009 to 2012 (Kolaković. The author concludes that this reduction in the number of stallions serologically examined presents a significant risk of uncontrolled spread of EVA in the horse population in Croatia. authorized diagnostic institutes and laboratories. completely loses the ability to control the disease with serological examination. These are following: Every breeding association must submit a certification of negativity (serum neutralization test) for EVA of all active stallions before the annual breeding registration or artificial insemination.434/01) in Argentina about the obligation of examination of EVA on stallions. . sometimes several times a year. but later seven outbreaks. without evidence of vaccination. and partly by sporting regulations. In Italy. Therefore. EVA is mandatory controlled with serological examinations of all stallions before the breeding season. and it is partly regulated by law. As an example of regulations in South America (Argentina). is not suitable to disease control implementing vaccination against EVA. 2013). Although Italy is considered the country with developed horse breeding. competent institutions have made a plan to eradicate and above all to provide the determination of the prevalence of this disease in Italy.e. All this made it difficult to implement measures on eradication Dourine and identify the source of infection. veterinary inspection. 84 . or EVA result of vaccination or infection it raises the question of what this finding means when we are aware that a large number of horses are positive to all these diseases. because the mentioned measure cannot eliminate the cause of the permanently infected stallions. together with the manner of keeping. In relation to the occurrence of Dourine. primarily because of the problems in differentiating infectious and vaccination titre. it is recommended to provide vaccination of only seronegative animals under strictly controlled conditions with the required stay in quarantine after the vaccination. This refers to an uncontrolled mating mares (without proper records). Having established five outbreaks of Dourine in spring 2011. Moreover. with the PCR method. In contrast. we would mention compulsory measures (National Animal Sanitary Service-SENASA. It underlines the need to careful approach when it comes to the implementation of vaccination against this disease.First International Symposium of Veterinary Medicine – ISVM2015 The impression is that the most widely implemented serological diagnosis is the one of EIA. According to the legislation in Croatia. epizootic situation in Serbia. It has been discovered that the infection is created directly from infected individual coitus. Serologically positive animals then are subjected to an overview of at least two semen samples for the presence of the virus. Consequently were found two. vaccination. herpes virus infection. Stallions with a positive test for EVA in the sperm must be excluded from breeding. This is indicated by the occasional discovery of seropositive animals in the past 5 years. Frozen semen samples imported from foreign countries must be checked by state laboratories for detection of viral presence by PCR before commercialization and insemination. the program of measures requires examination of about 4000 breeding stallions annually to this parasitic infection.

based on these data. and completely. it can be emphasized. as well as with evaluation of genital swabs for CEM. a crucial measure for combating infectious diseases. because we have no real information about their presence in horse studs in Serbia. Acknowledgements The presented work is part of the research done in the scientific projects TR-31084 and III-46005 granted by the Serbian Ministry of Education and Science. as well as diseases that can potentially introduce horses or otherwise from other countries. semen. those that are regularly or occasionally occurs in our country. as far as it is possible we would not recommend vaccination against EVA. the way of keeping animals. we would recommend thoroughly planned control and primarily to make evidence of stallions used for breeding of mares in sport and rural areas. of 13 July 1992 laying down animal health requirements governing trade in and imports into the Community of animals. Because of the introduction of legal solutions for immunoprophylaxis should enable simpler procedure of import of vaccines for infectious diseases of horses. and certainly with international organizations such as OIE and the relevant EU bodies. which are the most actual epizootiological problem in Serbian horse population. we propose appropriate measures. including the records and marking of animals. Conclusion It can be concluded that the aforementioned regulations differ significantly only in the control of CEM and EVA. are not appropriate and in accordance with control of the disease by introducing just these preventive measures.First International Symposium of Veterinary Medicine – ISVM2015 government and international institutions which are responsible for recording the occurrence of certain diseases and regular reporting when that is the case. We believe that more important would be consistent implementation of regulations related to the diagnosis of infectious diseases in stallions. breeding a horse and raising awareness of the importance of this issue. On balance. ova and embryos not subject to 85 . Reference: 1. Thus. Constant communication and exchange of information and experience would ensure effective coordination of all involved in the health care of horses. This mainly refers to identifying EVA in the sperm (PCR). First of all. Actually it is understood the free status of centres for artificial insemination and horse studs of especially dangerous infectious diseases. However. the use and breeding horses. it is necessary to review and offer laboratory analysis of all veterinary institutes related to infectious diseases of horses. The reason for this is that the disease situation in Serbia. such as AHS. Anonymous: Council Directive 92/65/EEC. due to the difference in horse breeding between our system and similar in EU countries. bearing in mind the epizootiological epizootiological situation in the country and the region. it should be the training of certified laboratories for fast and effective diagnosis of infectious diseases of horses. To ensure effective diagnosis. And last but not least. As a prerequisite. that in relation to further development of veterinary profession and horse industry in Serbia as well. it is not recommended to “a priori” implement every EU model currently. both for the owner or holder of the animals themselves and veterinarians who care about their health condition. audits (as amended) regulations and their alignment with the current EU directives. in relation to mentioned legal framework and de facto situation in horse breeding in Serbia. Nevertheless.

3. 8. 2013. Trivunovic S.rs/glavna-odgajivackaorganizacija/publikacije Urošević I.First International Symposium of Veterinary Medicine – ISVM2015 2. Anonymous: Regulation on the establishment of animal health care measures for 2014. 711-19 86 . 1992. 6. making evidence about producing semen. Science and Profession. Parey Verlag. p. as well as requirements when it comes to fulfilment of semen quality (Offizial Gazette of Serbia 38/14 from april 2014). year ("Off. 10. third Regional Symposium „Breeding.". Stuttgart. University of Novi Sad. 12. 7. 1-3 October 2012. 48-55. 26. Staroniewicz MZ: Abortogenic viruses in horses.google. Russia.: Infectious diseases of equine reproductive organs: preventive measures and erradication.54). Serbia. 2014. Gynäkologie – Andrologie – Geburtshilfe. 9. The Horseville.. . Gazette of RS" No. Ilić S. February 2008. Aurich Ch.: The Main breeding organisation in the animal husbandry of the Faculty of Agriculture. Gazette of RS" No 91/2005. 2012.1992. Anonymous: Ordinance on animal health requirements when moving and imports equidae from third countries ("Official Gazette of Croatia" No. reproduction and healt care horses’’. Croatia.com/a/stocarstvo. Trailović R. Petrović T. Jajić I. 2014A. Jackulak. 78/12). (OJ L 268.edu. Salajpal K. animal health requirements laid down in specific Community rules referred to in Annex A (I) to Directive 90/425/EEC.M. 2010. Novi Sad.. 33. Calistri P. Dimić-Jakić D. 2014. Faculty of veterinary medicine. Proceeding. 24/14). 30/2010). Đuričić B. Moscow. 2014B.9. 2013. 5. Urošević M. 83–89. Narcisi V. 4. Kolaković J: "Serosurveillance of equine viral arteritis in Croatia and evaluation of control measures during period 2009. Reproduktionsmedizin beim Pferd. Proceedings of the 10th International Congress of World Equine Veterinary Association. Bazanow AB. https://sites.D. Equine Vet Educ. – 2012. Appearance and spread of Equine Viral Arteritis (EVA) Republic in Serbia.. Regulation of marking semen. J Equine Vet Sci. Anonymous: Veterinary Law ("Off. University of Zagreb. 624. 14. Frącka BA.. 2010. AN. 11. Graduate thesis. Anonymous. 2. Atzeni M: Dourine reemergence in Italy.

Additionally. was used to determinate the percentage of live.. Aleksandar Milovanović1. are often produced (Stančić. 2011. detected in the boars used for AI on farms in AP Vojvodina (Serbia).rs Abstract The success of sows artificial insemination (AI) significantly depends on the quality of sperm used. Kommisurd et al. 87 . Sperm concentration. 2012. when expensive genetically superior boars is used in sowʼs artificial insemination (Gadea et al. 2014). the prediction of sperm fertilizing ability has a great economic importance. the aim of this study is to analyze the presence of sperm morphological abnormalities. Kalifa et al. For maximal reproductive exploitation of genetic quality boar. Introduction In modern intensive pig production. 1991. 2008. particularly sperms with acrosome damaged or disintegrated acrosomal membrane (Perez Marcos et al... Novi Sad.7% primary and 11.. 2011). morphological abnormalities. In conclusion. In average... Tomislav Barna1. *Corresponding author: jelena. 2004). 2004. from 111 AI boars. To selection of the boars with a good reproductive performance.a@niv. percentage of viable cells and acrosome morphology are the basic parameters of semen quality evaluation (Knox. Therefore. more than 90% of sows are artificially inseminated (AI). Caballero et al. it is necessary to accurately control the quality of each ejaculate and extended semen in AI dose. Therefore. Milovan Jovičin1 1. was tested on sperm and acrosomal membrane integrity by flow cytometry.First International Symposium of Veterinary Medicine – ISVM2015 SPERM PATHOLOGICAL FORMS AND ACROSOMAL MEMBRANE INTEGRITY IN BOAR AI DOSE ON PIG FARMS IN AP VOJVODINA (SERBIA) Jelena Apić1*. 2012). 2008. Keywords: sperm. must be determined in detail. by using liquid diluted semen (Stančić and Dragin. progressive motility. Stančić et al.. used for AI on intensive pig production farms in Vojvodina Province (Republic of Serbia). Damaged acrosome was found in 13% live and in 17% dead sperm.. large number of AI doses per one ejaculate. the presence of such sperms indicates on various diseases and disorders. AI. López Rodríguez.. factors that can affect AI dose fertilizing capacity. 2012). 2000.5% of sperm (20. These results indicate a very poor quality of examined AI doses. boars. 2002). live sperm was average 71%. Scientific Veterinary Institute "Novi Sad".ns. of which 59% was with intact acrosome.. while 49% of the AI doses were "outside of class" (not for use in AI). or adverse effects of unfavourable environmental factors. et al. Fertilizing capacity of AI dose significantly depends on the quality of used semen. Extended semen samples.. Serbia. to achieve high fertility rate in artificially inseminated sows. The aim of this study was to analyze the presence of morphologically abnormal sperm in the extended boar semen. Pathological forms (PF) were found in 32. 2012). Supravital staining (eosin-nigrosin) according to Bloom. overextension of semen is the most common cause of reduced progressive motility and increased number of abnormal sperm in AI doses (Maxwell et al. However. Mircu et al. in the on farm artificial insemination technology.ac. Stančić et al. This results in excessive semen extension (Johnson.5% secondary PF). 2007. Maes et al. dead and pathological forms of sperm. It is important to point out that only 19% of AI doses were categorized as a "first class". The presence of morphologically abnormal sperm significantly reduces the boar semen fertilization potential. as well as sperm with intact or damaged acrosome.

Flow cytometry (Guava-IMV Millipore.. Total live (L) 2. at +17oC. protoplasmic droplet. Novi Sad (Republic of Serbia). Percentage ratio of live and dead sperm. sperm with intact acrosome. Live with intact acrosome (LIA) Normal sperm 3.7% and abnormalities of middle or rear part of the sperm tail. are shown in Table 2. as well as on internal classification according to the number of progressively motile sperm cells (determined by CASA method). 1997). as well as pathological forms of spermatozoa was determined by cytomorphological examination of supravital stained sperm preparation (eosin-nigrosin staining method according to Bloom). Table 1. Scientific Veterinary Institute. After arrival to the laboratory. while only 19% of AI dose was a "first class". 1). II. Total with damaged acrosome (DA) 5. 88 . secondary abnormalities . Extended semen samples were transported from the farm to the Institute in thermo-box. Total with protoplasmic droplet (PPD) 6. in 20. From the total of 71% live (unstained) sperm. Novi Sad. in 11. Damaged acrosome was found in 13% of live and in 17% of dead sperm cells. Various pathological forms were found in 32.I ABN. Pathological forms total (PFT) Class of sperm qality1 I class II class III class 51-69% 40-50%  70% 46-59% 40-45%  60% 6-9% 10-15%  5% 11-20% 21-30%  10% 11-20% 21-30%  10% 6-10% 11-15%  5% 6-10% 11-15%  5% 16-30% 31-7. III or "out of class" (Milovanović et al.5%). 4. USA) was used to test the sperm cell membrane integrity and akrosome membrane integrity (a combination of fluorometric colors PNA-FITC and propidium iodide). AI doses were classified as class I. Reference values for classification of diluted boar semen* Sperm subpopulation in examined semen samples 1.0%  15% *Laboratory for Reproduction in Domestic Animal. 16% of AI doses was "second class" and 16% of AI doses was "third class" (Fig. From the total number of AI doses (n = 111).II ABN. the semen samples were prepared according to the usual protocol for testing by CASA (computer assisted semen analysis) and for flow cytometry methods.First International Symposium of Veterinary Medicine – ISVM2015 Material and Methods Quality testing of diluted boar semen was performed in the Laboratory of reproduction in domestic animals. Live with damaged acrosome (LDA) forms 4. 1 Semen samples with parameters above or below of these values are classified as "out of class" Results The obtained parameters of tested diluted boar semen samples (AI doses). Based on cytomorphological findings (according to Jovičin et al.2% of sperm cells (abnormalities of head and/or principal piece of the sperm cell. Total of 111 samples of diluted boar sperm (AI doses) during the year 2014 and 2015 was tested. Scientific Vterinary Institute. 2013). 49% of them was categorized as "out of class" (not for use in AI). 59% of them was with intact acrosome. Primary abnormal (I ABN) Pathological 7.. primary abnormalities . Secondary abnormal (II ABN) sperm forms 8.

2 20.Pathological changes of midle and/or rear part of the sperm tail..98 35.49. 1. sperm numbers and progressive motility. II ABN .22 0.85 Parameter of sperm subpopulation in examined semen samples 1. up to 49% of AI doses were categorized as "out of class" (not for use in artificial insemination).87.3 12.68.First International Symposium of Veterinary Medicine – ISVM2015 Table 2. (2002).2±13. Total with damaged acrosome (DA) 7.5±16.87 2 .2%) and the number of sperm with damaged acrosomal membrane (30%).6 . unstained (L) 2. The results which were obtained by Kommisurd et al. 2007). Secondar abnormalities (II ABN) 9. Live with intact acrosome (LIA) 3. 1.40 0.43 0. The parameter values of tested diluted semen samples (AI doses) Parameter value Average Variation 71. Based on the presence of pathological sperm forms (32. contaminants within the dose. Classes’ distribution of tested diluted semen samples Fig.. Stančić et al. Semen samples.3 .7±16. Classes distribution of tested diluted semen samples Discussion and Conclusion The results of our research show a very poor quality of tested AI doses.46.00 17.2±19. % 60 49 50 N = 111 40 30 19 20 16 16 Second Third 10 0 Out of class First Semen class Fig.91. Progressive motility and acrosomal membrane integrity are the main parameters of AI dose fertilizing capacity. Live with damaged acrosome (LDA) 5. 2012). Using over diluted AI doses is frequently demonstrated as a reason for reduced fertility in the artificially inseminated.0±16.7±17.64 11.2 . and even the amount of sperm cell agglutinatio) (Knox.2 . There are many factors that can influence AI dose fertilizing capacity: factors associated with the boar and factors associated with AI dose (volume.7 11. compared 89 . 2004. abnormalities (I ABN) Primar 8. the percent of abnormal sperm.Pathological changes of head and/or uper part of the sperm tail. Dead with damaged acrosome (DDA) 6. Total live.49 1 .8 .7±13.53. 2000.4±13.15 1. and can be significantly decrease by overdilution of ejaculate or by impact of inadequate storage and/or transport condition (darkness and temperature +17oC) (Johnson et al. indicate that the acrosome is more susceptible to damage during storage than the organelles being the structural basis of motility.68 32.3±13.7 30.33 0 . Pathological forms total (PFT) Total semen samples / boars tested (n) 111 I ABN . Dead with intact acrosome (DIA) 4.9 58. Yeske.7 17.0 .

. Jakovljević G. Martin Rillo S..: Boar semen evaluation using casa and its relation to fertility. 2003.. Milad Manafi. 2002. Fertil.. 2012... Mircu C. Vyt P. Lopez Rodriguez A.J. 2005. Advances in Pork Production. Theriogenology...: Effects of dilution rate on the motility and acrosome morphology of boar spermatozoa stored at 15°C.. Mac. 6. 1997. Reprod. Jovičin M..303–308. Andersson M. Cernescu H. 14.. In: Artificial Insemination in Farm Animals (Dr. Vazquez M. Glavonić L. Khalifa T. Milovanović A.A. following should be done: (1) evaluate boar ejaculate quality.: Practicalities and Pitfalls of Semen Evaluation. Palacio M.... 90 .. Pursel V. Knop I. 7. 3. Selle´s E.... Perez Marcos C. Marco A. 2004. 329-39.P. 2005. 6.-H... 41. Koskinen E. 2003b). Acta Vet... Zarcula Simona. Alm et al. Scand. Dom. 10..C. Barna T.First International Symposium of Veterinary Medicine – ISVM2015 to naturally inseminated sows (Zvekić. Zbornik naučnih radova PKB Agroekonomik. Anim. 63:431–444... Maxwell W.H. Ghent University.). 8...: Model for cooperation between boarstuds and laboratories for reproduction in boars’ semen quality control. 4955. Maes D. 203-212. Gadea J. Otava G. Roca J.E..E. 2011. Perez Garcia T..: Storage of boar semen.: Major proteins of boar seminal plasma as a tool for biotechnological preservation of spermatozoa. On the other hand. 57-70.C. and (4) check the storage and/or transport conditions of AI doses. Reprod.. 41. 2007.. Ghaoui R. 112-116. Peltoniemi O. Anim. Kašić M. 5. References 1. Kousenidis K. In conclusion: to detected the reasons for large number of poor AI doses. Gadea J. 37. (2) check the boars healt status. 2013.. Salma J.J. 2004.M. Evans G. 26. Anim. Maxwell W.F. 12. Sci. 80-94. Rijsselaere T.R. Parrilla I. 1994.. Weitze K. Milanov D.. Nemeš Ž. Sanz L. 13. (3) determine dilution rate of each AI dose. Dom.. 9. 2014. A. Frunză Ilinca. Dovenski T. de Graaf S...S. 1. 70. 1991. Lymberopoulos A.: Sperm factors related to in vitro and in vivo porcine fertility.. 2.. Ardelean V. Lazarević M. Dom.: The Predictive Value of Porcine Seminal Parameters on Fertility Outcome U nder Commercial Conditions.Violeta. P..... Boroš I. 5-34. 2008. Caballero I. Reprod. 43. 15.. Reprod.: Porcine Field Fertility with Two Different Insemination Doses and the Effect of Sperm Morphology. Ed. Sehested E. Sanchez R. Acknowledgments This work was supported by a grant from scientific project TR 031071 of Ministry of Education and Science of Republic of Serbia.. 3. 143-172. Bonca G. Lucrări stiinłifice medicină veterinară (Timisoara). 315-322.. Reprod.. 62. Anim. Ardelean A.. Samartzi F.: Highlights on artificial insemination (AI) technology in the pigs. Faculty of Veterinary Medicine... 39. Johnson L. it has been shown that there is considerable variation among boars concerning the fertilizing capacity of semen during storage (Waberski et al. 13–38. Alm K. Rekkas C. López Rodríguez. Vet. 15. Soc. 11.E. García M. Theriogenology.: Influence of Boar and Semen Parameters on Motility and Acrosome Integrity in Liquid Boar Semen Stored for Five Days. Gabriela Korodi Renate. Grevle I.M.... 4.: Fresh boar semen: quality control and production (PhD Thesis). Gadea... 2008.: Steonost krava u zavisnosti od citološkog i mikrobiološkog kvaliteta zamrznutog semena bikova. Martínez A. Calvete J.. Arhiv veterinarske medicine. 1352–1355. 2006). Rev. Paulenz H.M. 210-213. Fise. 1.: Seminal plasma effects on sperm handling and female fertility.T. Kommisrud E. Van Soom A. Suppl 64. 2000.G... Knox V.: Artificial Insemination in Pigs. 2006.A. Stančić et al.

: Uticaj godišnje sezone. Waberski D. 1. Dragin S. spermatozoa concentration. Sci. 2012. Novi Sad (Serbia). Jotanović S. Stančić I. Zvekić D. 2003б.: Health Problems That Affect Fertility. 21-32. 204-214. Stančić B... Meding S. 22. Dirksen G.. 18. Contemporary Agriculture. Weitze K.C..F. 15. 2011. Gagrčin M.. Nat. 60.: Fertility of long term-stored boar semen: Influence of extender (Androhep and Kiev). Belgrade. Anderson R.. Symp.: Effects of breed. 23. November 8 – 10. 19. Journal of Microbiology. storage time and plasma droplets in the semen. Radović I. Proc. Stančić I. 2012. Hog Farmer. Yeske P. Božić A. Anim. Božić A.: Increasing reproductive exploitation of AI boars (a review)... 2007. Jun. 19.: Modern technology of artificial insemination in domestic animals. Dragin S. 149-154. Erdeljan M. Stančić B. Proc. 3.. 287-295.. and storage on progressive motility of extended boar semen. Poljoprivredni fakultet... 21. 23rd Internat.. 17..: Fertilitet prirodno ili veštački osemenjenih krmača u proizvodnim uslovima (Magistarska teza).. Dragin S.First International Symposium of Veterinary Medicine – ISVM2015 16. Zvekić D. 2003 91 . 145-151. Stanković B. „New Technologies in Contemporary Animal Production”. Stančić B.. 19. rase i starosti nerastova na kvalitet sperme. Stančić I. Reprod. 25-29. 2013.. – 21. 3-4. 1st International Symposium on Animal Science. 36.. 1994. Biotechnology in Animal Husbandry. Leiding E.. Serbia. 20.. 1-2. Harvey R. 141-143.. Univerzitet u Novom Sadu.: Еffect of protein contents in seminal plasma on sperm motility in diluted boar semen. Radović I.. Hahn R. Biotechnology and Food Sciences.

penetrates the intestinal wall. Vladimir Polaček1 1 Scientific Veterinary Institute “Novi Sad”. egg-laden proglottids pass with the faeces. cestodes occur in carnivores.ns. with unspecific clinical signs. In the etiology of the disease. the presence of small parasitic cyst of Echinococcus granulosus (2-5 mm) was detected. two stages can be discerned: 1) hydatid stage (cystic echinococcosis). The aim of the paper is to present a finding of intensive parasitic infection (hydatic disease) in backyards pigs. 2008). Igor Stojanov1. and they present the most frequent way of pig production in villages. the larva (oncosphere) hatches in the small intestine. the gross pathology examination of 2 dead weaners was performed. However. pathomorphological examination. which occurs in intermediate hosts (domestic and wild omnivores.ac. The applied research methods included: anamnestical and clinical evaluation. Serbia * Corresponding author: dora@niv. where husbandry methods allow direct contact with domestic and wild carnivores. because biosecurity measuers are taken to prevent the contact of swine with carnivores. sometimes compromising production and occasionally the cause of clinical disease. where certain disorders and health problems in weaned pigs were detected. Adult Echinococcus spp. this is not a case with the backyards and free-range pigs. 1997). In Serbia. In carnivores. caused by the adult Echinococcus spp. The liver stops about 70% of the oncospheres. By parasitological examination of the liver and abdominal content. The material for this research included pigs from one backyard. and 2) echinococcosis stage. contaminating the environment. 92 . and enters the circulation. (Brunetti and Filice. domestic pigs. herbivores and humans). Ivan Pušić1. Echinococcus granulosus Introduction Hydatidosis in pigs is caused by larval form of Echinococcus granulosus. lung) derived from died pigs. Echinococcosis/hydatidosis is a zoontic parasitic disease that poses a major health as well as economic threat all around the world. parasitological laboratory testing for detection and determination the presence of parasites in the organs and tissue samples (liver. The percentage of infected pigs found on large swine farms (with biosecurity measures) is also not negligible and adds up to 10% (Pavlović et al.rs Abstract Internal parasites of swine are very common in swine worldwide. which occurs in the “dead-end” (definitive) hosts (animals from the families Canidae and Felidae). Based on the achieved results. The nacropsy findings revealed the presence of enormous number of hydatid cysts on and in the liver tissue. Novi Sad. When ingested by a pig. where they nidate and develop into hydatids.. Hydatic disease in pigs is not common finding on large swine farms. and their larval cysts (hydatids) occur in various herbivores and omnivores.First International Symposium of Veterinary Medicine – ISVM2015 ECHINOCOCCUS GRANULOSUS OF DOMESTIC PIGS: A CASE CONTROL STUDY Doroteja Marčić*1. it can be concluded that Echinococcus granulosus infection is present in the backyards and free-roaming pigs. a large number of free parasitic cysts were found in the abdominal cavity. Since in the evaluated backayard a sudden death in 10 weaners occurred. the highest percentage of infected pigs can be found in backyard and free-range pig production systems (up to 75%). Also. Keywords: backyards. One of the most important zoonotic parasites that can be found in swine is a larval stage of Echinococcus granulosus. including humans and swine. Jasna Prodanov-Radulović1. Siniša Grubač1.

especially in pig breeding practices. infectious larval forms of the parasite (Laaksonen and Paulsen. including humans. 2015). proceeding towards the lungs. through the left heart. the second most frequent implantation organ for hydatic cysts. where the free-range was also practiced. Contacts between wild boars and domestic pigs kept in outdoor farms may occur occasionally. from barely noticeable to cysts of 150 mm in diameter. The source of the Echinococcus eggs contamination is to be found in the faeces of “dead-end” (definitive) hosts. The infection of intermediate hosts occurs exclusively through the use of the contaminated water and food. there is a major concern to monitor the epidemiological situation of wild boars especially when control measures in domestic pigs are implemented (Prodanov-Radulović et al. The remaining hexacanths are transferred. Certain number of oncospheres that mash the liver. Since both animals have the same susceptibility to various infections including hydatidosis.. When oncospheres (hexacanths) are fixed to the mucous membrane. only 5 mm in length. 2015). towards the other parts of the organism – implanting kidneys. Since in the evaluated backayard a sudden death in 10 weaners occurred. The cysts are often pearly grey colour and contain clear liquid with thousands of small. from where. Uncharacteristically for tapeworms. The eggs produced by the parasite are very light and resilient (Laaksonen and Paulsen. eyes and seldom brain and bones. while a number of free-ranging populations are mainly unknown. oncospheres (hexacanths) are released from the eggs. the outcome is fatal. In most of the cases the disease in pigs is asymptomatic and the losses primarily occur due to organ failures caused by the implanted cysts. penetrating through the intestinal mucosa and reaching the capillaries. the primary implantation site is reached . depending on the duration of the infection. 2) the percentage (share) of the infected dogs as “dead-end” (definitive) hosts. 2011). which is continuously being released into the external environment and ultimately consumed by the pigs (Pavlović and Ivanović. Once the digestive tract is reached. arrive at the right heart via vena cava. The development process of the hydatic cysts is the same in all intermediate hosts. The cysts are continuously growing throughout the whole life of the intermediate host (Pavlović et al. One of the characteristics of outdoor swine production in some regions is raising free-roaming domestic pigs. the adult tapeworm is very small. where they share forest habitat with wild boars. the gross pathology examination of 2 dead weaners was performed. Material and Methods The material for the investigation included one small family owned backyards swine farm (capacity of 5 sows). The aim of this paper is to widen the awareness of the possibility of Echinococcus granulosus epidemic mostly among the pigs bred in backyard and free-range pig production systems. The Veterinary Inspection had informed the Scientific Veterinary Institute “Novi Sad” about the suspicion of the possible outbreak of classical swine fever in the family owned swine farm engaged in extensive swine breeding in the Srem region. and 3) hygienic circumstances. Their size varies.First International Symposium of Veterinary Medicine – ISVM2015 A certain number of wild boars in our country are reared in controlled and enclosed hunting grounds. 93 . the development of the cysts can begin. They are under considerable pressure and in the case of their rupture.. with unspecific clinical signs. The samples from dead weaners were tested by RT-PCR method. through vena porta.the liver (up to 70% share). in order to exclude the possibility of infection with classical swine fever virus. 2006). There are three main factors contributing to the spreading of this infection in pigs: 1) the lack of pig breeders’ and dog owners’ knowledge concerning the life cycle of the parasite and concerning its epidemic potential. 2014).

revealed an amber coloured. The mandibular lymph nodes were unchanged. Picture 1. almost translucent. free liquid. Mild palpebral oedema was also detected at one of the dead pigs. pharynx and larynx were also unchanged. an additional parasitological testing was performed. carried out in the backyard of the pig owner. In the abdominal cavity. the size of grain of wheat or rice. The internal gross pathological pathomorphological examination.First International Symposium of Veterinary Medicine – ISVM2015 Since gross pathology findings had indicated the presence of significant pathomorphological changes. The mediastinal lymph nodes were unchanged. Abdominal cavity: free liquid with fibrin strands and cystic formations Picture 2b. the free liquid mixed with large amount of fibrin strands and free whitish. cystic formations. Extremely yellow discolouration of endocardium was discovered. like “drops”. Abdominal cavity: free liquid with fibrin strands and cystic formations 94 . Picture 2a. on the other hand. as well as a strong cyanosis of the skin in the area of proboscis and earlobe base with visible yellow discoloration of the skin and mucous membranes. Tonsils. epiglottis. with fibrin strands in the chest cavity (Picture 1). A few examples of Metastrongylus spp. Chest and abdominal cavity: free liquid with fibrin strands The examined tissues were also remarkable for mucosal and serosal yellow discolouration. were found in the lumens of bronchi and bronchioles. Results During the external gross pathological pathomorphological examination of dead pigs. a dirty slimy discharge of the nostrils was discovered at both pigs. as well as the hepatisation of apical and cardiac lobes. also was found (Picture 2a and Picture 2b). Individual bleeding on the side parts of the diaphragmatic lobes were present in the lungs.

Slit bladder: dense. i. There was yellow discolouration of the kidneys with no changes either under the capsule or on the transverse section.6% (Ivanović and Pavlović. there are no official datasets of infection rates available for all the farms applying the backyard and free-range pig production systems. distinctly yellow liquid content and without changes in the mucosa (Picture 4). Liver: hemorrhage and cystic formations The stomach was nearly empty. 1999). The bladder was full of dense. Picture 4. According to some recent investigations. It has been established that around 75% of the infected pigs come from mini farms. e. with expressed folds of mucous membranes and without changes in the mucosa. infection rates vary widely across country between 4. applying the backyard and free-range pig production systems. Hepatic hemorrhage with considerable structural defects was present (Picture 3b). 95 . Socio-economic factors as well as the lack of breeders’ and dog owners’ knowledge concerning the epidemiological features of the infection and the lack of adequate cemeteries for disposal of the deceased animals all contribute to the spread of this zoontic disease.First International Symposium of Veterinary Medicine – ISVM2015 The liver was significantly enlarged with rounded edges and with a small but very numerous cystic formations protruding and dropping out of the liver tissue after cutting (Picture 3a).6 and 57. Liver: hemorrhage and cystic formations dropping out of the liver tissue after cutting Picture 3b. mostly not maintaining strict biosecurity measures. The small and large intestines were almost empty. distinctly yellow liquid content Discussion and conclusions In Serbia. the slaughter is often carried out nonsupervised by inspection service and without being reported. Picture 3a. with only a small amount of content and without changes in the mucous membrane.

Stojanov I. Beograd. Republika Srpska 6.. which makes it extremely important to maintain strict biosecurity measures. 1999. it is necessary to cut off every rout of transmission of the infection. Institut PKB Agroekonomik.: Ehinokokoza svinjaepizootiološki. that livestock slaughter process is always carried out in slaughterhouses. 2009).. on the occasion of a pig slaughter in Lithuania. which also means control on livestock movement. To this end. Srbija 96 . butchers and dog owners on how to prevent the infection. Deplazes P.. 2009 3. Republic of Serbia. Petrović T. 2014. Torgerson P. Dimitrić A. Srbija 8.. Grubač S. Vet Parasitol.First International Symposium of Veterinary Medicine – ISVM2015 Considering the fact that echinococcosis/hydatidosis poses a major global threat.: Hidatidoza aktuelan problem stočarske proizvodnje. Brunetti E.com/article/216432 . Došen R. Science and Technological Development. 40 (6). Lupulović D.: Ehinokokoza/hidatidoza. burning or handling in animal shelters). It is also of paramount importance to report every case of the infection to the veterinary inspection service from where animal originate and to document it. savetovanja veterinara Republike Srpske sa međunarodnim učešćem. the examination of 684 pig livers revealed that significantly more infected animals came from mini farms (applying the backyard and free-range pig production systems and thus not maintaining strict biosecurity measures) then from large-scale farms (Bruzinskaite et al. Anđelić-Buzadžić G. Through education. šumarstva i vodoprivrede. The importance of widening of the global awareness of the problem as well as widening the access to the knowledge of infection should also be emphasised. Lončarević A. Ivanović S.: Echinococcosis in pigs and intestinal infection with Echinococcus spp. in this particular case.. Pavlović I.17. Vaić D.overview. 302-303. Pavlović I.Hadžić I. Zemun-Beograd. Srbija 4. Žugić G.. Naučni institut za veterinarstvo Srbije i Ministarstvo poljoprivrede. Srbija 7.. epidemiološki i ekonomski značaj.. everyone should be familiar with the basic facts concerning this infection. 3-4. 160.. Beograd. in dogs in southwestern Lithuania. Vol. References 1.. 1997. the control of dog movement and secure disposal of the organs contaminated with hydatic cysts (by boiling.medscape. Wageningen Academic Publishers.. Teslić. Kulišić Z. Modern aspects of sustainable management of game population. izd. The hygiene of the pig production practices and methods also affects the spread of the infection. bolest životinja i ljudi. Zbornik naučnih radova sa XXV savetovanja agronoma..: Hunting hygiene. 2008 2.. financed by the Ministry of Education. 3-4.. Ivanović S. i. their faeces) would be made impossible. Beograd. Acknowledgements This paper is a result of the research within the project TR 31084. which should start from school and also encompass instructing livestock breeders. the contact between the pigs and the intermediate and definitive hosts (dogs. 2011.. it should be made mandatory... For example. 149-153. Bruzinskaite R. Ivetić V. 133-139.. Tehnologija mesa.. 1-32. 2006.: Echinococcus Hydatid Cyste Medicine Specialities „Infectious Diseases“ Parasitic Infections. In order to make progress in the fight against echinococcosis/hydatidosis.. Filice C. and under constant supervision of veterinary inspection services. 237-241. 116. R. Zbornik radova 4. in order to combat this zoonosis more successfully. Valter D. Polaček V..: Raširenost ehinokokoze kod svinja u ekstenzivnom držanju na području srednjebanatskog okruga. veterinara i tehnologa. Pavlović I. e... so that. Sarkunas M. This education also means making wider public familiar with measures that should be undertaken. and Paulsen P.. 2015 5. Jovčevski S. Mathis A.: Antibodies to selected viral disease agents in hunted wild boars in Vovodina region.. infection monitoring must be carried out with care and perseverance all over the world. 3rd International symposium on hunting. Laaksonen S. http://emedicine. Pavlović I. The measures also include the dog dehelmintisation. Prodanov-Radulović J.

The possibility to control the disease by introduction of prophylactic measures was also considered. Miloš Pelić¹. Application of proper sanitary-hygiene measures on poultry farms and hatcheries. Serbia * Corresponding author: milos@niv. Milica Živkov-Baloš1. as well as microbiological control of feed are considered essential for an efficient control of spreading of infection. A. Novi Sad. A. especially in young birds. Igor Stojanov¹. 2003. chicks.14% from unhatched eggs. feed Introduction Aspergillosis is a fungal disease of all poultry species. Poultry is constantly exposed to these fungi in its environment. and predisposing factors. such as long exposition. Certain infectious diseases may contribute to aspergillosis. During the years 2000. The fungal spores are ubiquitous in nature. respectively. infectious bronchitis. 97 . was isolated in the range of 3. The aim of the present paper was to examine the effects of some factors on the incidence and prevalence of the clinical form of aspergillosis in poultry. Exposure of poultry to fungi or spores occurs after the introduction of contaminated litter and feed. in poultry was analyzed based on the results of clinical and laboratory tests carried out during 2000. terreus and A. particularly in young birds. Keywords: aspergillosis in poultry. glaucus are the most common isolated fungi in the cases of pulmonary aspergillosis in poultry. while others like A. litter and environmental and hatchery swabs.ac. such as hatched eggs. young and adult birds. Aspergillus fumigatus.rs Abstract The fungi of the genus Aspegillus are ubiquitous saprophytic microorganisms which are. chronic respiratory disease. niger and A. 2004). 16 and 21 commercial flocks of chickens and turkeys. e. niger. humidity. acute aspergillosis was detected in 12. glaucus can induce the disease.85% to 36.First International Symposium of Veterinary Medicine – ISVM2015 THE PREVALENCE OF ASPERGILLOSIS IN POULTRY AND CONTROL MEASURES OUR EXPERIENCE Miloš Kapetanov¹*. 2010 and 2014. Dragana Ljubojević¹. responsible for clinical infections of respiratory tract in all poultry. Beytut et al. The presence of Aspergillus sp. The prevalence of aspergillosis was noted in poultry of different age. highly contaminated environment and litter. flavus. particularly of young birds. Incidence of the disease decreases on poultry farms with stringent hygiene and good nutrition management. Newcastle disease and fowlpox. coryza.g. high humidity in poultry houses. laryngotracheitis. 2000). Marko Pajić¹ 1 Scientific Veterinary Institute “Novi Sad”. poor ventilation. A. Most frequently it occurs in turkey poults. too. Aspergillus sp. It has been speculated that extremely dry air and dust can cause the infection with Aspergillus because they dry out the respiratory mucosa and protective effect of mucus is absent (Kristensen and Wathes. as well as malnutrition and stress contribute to the development of clinical manifestations of aspergillosis. in certain circumstances. Early infection is possible in hatcheries if fungal contamination occurs.. 2010 and 2014.ns. temperature. An increased trend in number of infected poultry flocks was observed. Some geographic and seasonal regularity are observed in relation to the distribution of aspergillosis outbreaks. ducklings and goslings (Kunkle. Aspergillus fumigatus is considered to be the most pathogenic and is the most frequent isolate from pathologic lesions.

tissue samples were cultured on solid media using standard methods. While resistant and healthy poultry can overcome the infection with high number of Aspergillus. Having been processed first. It is well known that the disease can occur in other young and adult poultry species. as well as for the comparison of mycological contamination with the environmental conditions. particularly if kept in intensive manner. pathologic wheese is observed. Besides the symptoms previously mentioned.48%) and in laying hens (1. Aspergillosis appears in two clinical forms: 1) acute form with high morbidity and mortality rates. while older are more resistant. then in broiler chickens (5. including depression. hatchery waste and environmental swabs taken from different surfaces in hatcheries were sampled in order to determine the presence of fungi and its frequency. In epizootiological investigation Sajid et al. were investigated in this paper. the disease persists from only few days to two weeks. thirst and hyperventilation with dyspnoe (Akan et al. 2010 and 2014. It is experimentally demonstrated that chickens up to three days of age are the most susceptible to the infection. respectively. Results and Discussion The spread out of aspergillosis was noted in poultry of different age. acute aspergillosis was detected in 12. Islam et al. which differs from other respiratory diseases. spreading and source of aspergillosis was investigated using data from the official report of the Republic Hydro meteorological Service of Serbia. for the purpose of comparison with the control period from 1961 to 1990. Poultry flocks were clinically observed and postmortem examination of chickens and turkeys of different age was carried out. wild and pet birds. from very young birds to adult ones. get weaker and. 2000. Litter taken directly from different surfaces in poultry houses and swabs was cultured on solid media. including poults. In 2010 and 2014 the disease was acute with high morbidity and mortality within only few days. Islam et al. Unhatched eggs. Chickens have ruffled feathers.First International Symposium of Veterinary Medicine – ISVM2015 Influence of certain factors on the outbreak and spreading.. Numerous flocks suffered detrimental losses in a short period of time and were destroyed because their further raise was economically unjustified. disease being persistent several weeks or rarely several months. (2006) found the majority of sick flocks at the age of 14 days. Mycological investigations were done in laboratory at the Veterinary Institute Novi Sad. 2010 and 2014. Material and Methods The presence of Aspergillus spp. and 2) subacute and chronic form in adult poultry. goslings. ducklings.03%). they drowse. in complicated cases of dyspnoe.. If aspergillosis was detected in the findings. inapetence. The possibility to control the disease by introduction of prophylactic and intervention measures was discussed. the attacked tissues were taken for microbiological investigations. regarding the outer temperature and rainfalls in 2000. swans. The influence of different factors on the occurrence. (2009) found significant differences in morbidity (up to 70%) and mortality rate depending on age and category.. 2010 and 2014. During the years 2000.92%). on poultry farms was analyzed from data collected after the clinical and laboratory investigations performed during the three selected years. 2009. as well as clinical features of aspergillosis. Clinical symptoms during the acute source of infection are described in literature. 16 and 21 commercial flocks of chickens and turkeys. the investigation of mass pneumomycoses 98 . aspergillosis was most frequently detected in cockerels (9. Stoute et al. The disease was clinically present in broilers at the earliest age (13 days) and in layers and cockerels at the oldest age (76 weeks). week and young birds generally become ill easily. 2001. 2009).

Islam et al. Cacciuttolo et al. The infected chickens from aspergillosis – prominent dyspnea. 2009) during the year 2010 and 2014 subacute and chronic aspergillosis was not detected. ruffled feathers and emaciation are common.. Clinical signs of depression. Figures 1 and 2). Granulomas. 2007.First International Symposium of Veterinary Medicine – ISVM2015 discovered one distinctive finding which was grouping of the chickens toward the source of fresh air ("hunger for oxygen". nodules are present in almost all tissues. Besides respiratory form. acute aspergillosis was clinically noted. Postmortem findings included nodules ... Mukaratirwa. Generally. Islam et al.. They are located in thoracic and abdominal cavity and on the liver surface. 2009. are typical section finding in Aspergillus infected birds. Stoute et al. Figures 3 and 4.. 2001). too (Martin et al.aspergillus granuloma. but with radial hyphae nets surrounded by reactive zone like granulation tissue. 2009). In that case protruding eye lids are observed because of formation of yellowish-cheesy small pellets around the membrane nicticans with central ulceration (Figures 3 and 4). inapetence. oval or round. at the age from 7 to 10 days. 2002. liver and intestines (Figures 5 and 6). 99 . In the investigated period. Figures 1 and 2. sometimes chronic bronchopneumonia. 2009. In subacute and chronic infection. single or in conglomerate. 2007. 2006.. single or in group of conglomerate. ocular infection with Aspergillus was determined in two broiler flocks.. Ocular form of aspergillosis . size of a pin head to pea. oval or round shaped. only one or several individuals in flock became ill. In our investigations. Martin et al.yellowish cheesy pellets around the membrane nicticans. located on air sacs. Their appearance resembles the one found in avian tubercullosis. lungs and on visceral serosae of abdominal cavity. infection of eyes can also occur (Akan et al. even in eyes and brain (Throne Steinlage et al..

2012.. 2010). Dust containing more than 800 colonies per gram leads to prospective embryo infection (Kozić. Infected embryos die between 15th and 18th incubation day. 2013). Warm and humid air in hatchery provides ideal conditions for the survival of Aspergillus. there are numerous sources of this important fungal infection. on standard media and at room temperature. infectious laryngitis. tuberculosis and fowlpox. 100 . which may cause a decrease in hatch-ability of up to 30%. post-mortem finding: disseminated nodulesaspergillus granulomas in the lungs and serosal surfaces of organs in the abdominal cavity.. can be contaminated with high number of fungi and moulds (Akanetal.. Kapetanov et al. such as infectious bronchitis. is necessary. The infected turkeys from aspergillosis. The growth of Aspergillus flavus colonies on Sabouraud agar.First International Symposium of Veterinary Medicine – ISVM2015 Clinical signs and pathologic findings are not sufficient for diagnose. The infection in poultry may occur if litter. Nešić et al. In order for the disease to be diagnosed other respiratory agents need to be excluded. Kapetanov et al. environment or hatcheries are contaminated.. Fertile eggs and embryos can be contaminated before or during the incubation. 2009. producing green to green-blue colour colonies that become darker. particularly mashed. Figures 7 i 8. The spores germinate well in laboratory conditions. Figures 5 and 6. even black over time (Figures 7 and 8). 1967). is found in tissues of unhatched eggs and hatchery waste (Jacobsen et al.. 2005. 2001. Feed. so laboratory confirmation by isolation of Aspergillus sp. chronic respiratory disease and Newcastle disease. and Aspergillus sp. Škrinjar et al. In intensive poultry keeping.. coryza.

(2009) could not clearly relate the incidence of aspergillosis to the type of litter used. mycological control of litter and swabs taken from surfaces in poultry houses points to oversights during sanitation and disinfection (Table 1). 2006) as they can impact the concentration of Aspergillus in the poultry house (Nichita and Tirziu.. 2008).91 Litter 39 9 . 2007). By using available data on meteorological conditions in the region. except in mountain regions. as well as the climatic factors. 2005... The spores are most frequently isolated from alanto-chorion liquid. abundant precipitations were also characterized. producing green colonies up to 2 cm in size. their total elimination is not realistic..3.First International Symposium of Veterinary Medicine – ISVM2015 Eggshell can be contaminated in case of inadequate collection and storage of eggs.85 268 15 . Sajid et al. Sajid et al. leading to flooding of the rivers from their banks and further to (some sort of) natural disasters.07 42 15-35.86 617 62 . (2006) found significantly higher rate of infected eggs in flocks kept on sawdust (67. Table 1 . However.71 112 32-28. However for 2014 besides the very hot days. under natural conditions.05 746 74 – 9. Gigli et al. Raising poultry under higher fungal contamination increases the risk of aspergillosis. During the summer of 2010 maximal daily temperatures were often above 30 C. The influence of particular outer and environmental factors to fungal survival are numerous (De Bey et al. this paper aims at establishing the connection between clinical aspergillosis and overall laboratory findings.14 171 31-18. and since the largest proportion of dust particles is inhalable. Karwowska. The official report of Hydrometeorological Service of the Republic Serbia. 2005. dust is considered to be the predisposing factor for aspergillosis outbreak (De Bey et al. like vaccination. shows extremely warm percentile distribution. especially in immune compromised or sick birds. During the years 2000.74%) in comparison to rice hulls (32. litter. for the year 2010. 1995. 2008). swabs taken from the poultry houses and hatcheries by Aspergillus sp.. GigIi et al. Nichita and Tirziu . The type of ventilation and air humidity are also relevant (De Bey et al. 1995). beek trimming etc. In our investigations.13 Hatchery swabs 182 7-3. and the total number of tropical days was higher than the usual in most parts of Serbia. With respect to year 2000.6. 1995. colonies were often detected in unhatched eggs and swabs taken from the hatchery (Table 1). Higher number of fungi.60 311 101 11 .. the total number of samples and the number of mycologically inadequate samples was nominally higher in 2010 and 2014. particularly in combination with stressing procedures. On the other hand. Sample type Year 2000 Number and Total number %of positive of samples samples Year 2010 Number and Total number % of positive of samples samples Year 2014 Number and Total number % of positive of samples samples Unhatched eggs 481 33 . In order to prevent the contamination of embryos and chickens at hatch.23..36 17 111 39-36. The spores of Aspergillus germinate better when the air is dry. infection is predominantly induced by air and orally. The sanitation programs are designed in such manner that the number of fungi and other potential pathogens is maintained at an acceptable level. some reports have brought the attention to possible infection of reproductive tissues of hens and concomitant disease (Egg Borne Aspergillosis or congenital aspergillosis). Lately. It is demonstrated that intravenous and inhalation infection is possible (Femenia et al. Using inadequate litter increases the possibility of infection at early age.10.57 Swabs from houses 94 34 .26%). different sanitation programs are applied (Ivanov. 2010 and 2014.5. is often isolated from dust. Still.Contamination of unhatched eggs. 2005. all contributes to aspergillosis. longer exposition. Aspergillus sp. Aspergillus sp.. 2008). Different types of litter may be contaminated unequally.53 . Islam et al.

and the percentile distribution was rainy. 2006). watery alluvium and relative humidity of air. during winter. particularly in broiler chickens (Vučemilo et al. Erginsoy S. 2010).First International Symposium of Veterinary Medicine – ISVM2015 The Hydro-meteorological reports also show rainfalls of totally 110 to 150% of the average values (taken from the period between 1961 and 1990) in most parts of Serbia. 2006. Science and Technological Development. Sajid et al. 2005). 2. Implementation of sanitary-hygiene measures in poultry houses and hatcheries. 2005). epizootiological and epidemiological conditions on farms and their environment.. During the selected years (2000... 46..: Immunohistochemical detection of fungal elements in the tissues of 102 .. Some daily aberrance in the number of Aspergillus in poultry houses was determined by Nayak et al. fungi need certain humidity and temperature level which is around and higher than 37°C (De Bey etal. On the other hand. Chate and Bhivgade . after emission into atmosphere (Škrinjar et al. Republic of Serbia References 1. Conclusions The global warming and high relative humidity induced increase of incidence of some diseases. 2010 and 2014) average outer temperatures were high throughout the whole year. (2): 497-501.. including aspergillosis.. The rainfalls were extremely rainy in all regions. The rainfalls. The distribution of the aspergillosis outbreaks is influenced by some geographic and seasonal differences. The success of therapy basically depends on the source of disease and degree of dissemination of process. certain species of fungi have toxinogenic and allergenic features so they can disturb the health of people.: A case of Aspergillosis in a broiler breeder flock. aspegillosis outbreaks are more frequent in areas northern from the rivers Sava and Danube. 1995. Madscn . so it is more frequent in areas with high outer temperature and rainfalls (De Bey et al. 2005. Sareyyüpolu B. contributes to the emission of biosol into atmosphere. Tunca R. In our country. It seems to be necessary to create and implement standards for adequate hygiene. 2001 Beytut E. financed by the Ministry of Education. in our case the "population" of Aspergillus sp. were significantly higher than usual. Ozean K. bacteria and fungi in poultry house are changes depending on the age of poultry. (1998). so high contamination and long exposal contributes to clinical aspergillosis. it would be wrong to rely on antifungal therapy solely. especially during the warmer months (Karwowska. in its environment. Akan M. Ihan Z.. Karwowska. Acknowledgement This paper is a result of the research within the project TR 31071. Also.. indirectly. Avian Diseases. as well as microbiological control of feed. Microflora in poultry houses and farms in general. 2005. aspergillosis incidence increases. The air pollution impacts the health and productivity of poultry (Nešić et al.. 2007). Chate and Bhivgade.. 1995. in case of farmers.. particularly in very young chickens. The concentration of unwanted and potentially harmful gasses. Poultry is constantly exposed to Aspergillus sp. Hazrolu R. due to inadequate environmental conditions and the fact that sometimes it is impossible to provide optimal ambient for poultry. 2006. Karwowska. 2009. dust.. either directly. very rainy and extremely rainy.. 2010). In acute cases. 2005. In order to survive and reproduce.. is essential for prevention of significant losses. Sajid et al. Gigli et al. or in case of the rest of the population.

.. M... In: Saif YM Ed.: Airborne fungal spores in an industrial area. K.. 22. 5. Brock M. P. Stojanov I. Polish Journal of Environmental Studies. Rima U. Rossi G. Huet D. Madsen A.. Meyer V. S.. Acta Vetcrinaria Hungarica. 11. Silva R. 2005 Kozić L. 7.. M.. Le Loc'h G. 304-309 Kapetanov M. Matica Srpska Journal for Natural Sciences.. 2006 Nayakv B.. 14: 59-67. Potkonjak D. Aerobiologia. Baracho M.. 2000 Kunkle R.. pathological and therapeutical investigation. 2008 Jacobsen I.137-143. 7. J. 19. 74.: Clinical. 10. H... 1967. Slesiona S.: Fungal injections. Lucrari stiintifice Medicina veterinara. Bouck K. Dall'Anese F. 2008 Regulations on the quality of animal feed: Official Gazette of the Republic of Serbia.: Anatomopathological aspects of avian aspergillosis..... A. Novi Sad. Legrottag1ie R. 2012. Proceedings.. Avian Diseases.: Embryonated eggs as an alternative infection model to investigate Aspergillus fumigatus virulence. Juli M. P..: Diagnosis and evaluation offungi presence in the air of two different ventilation systems for broiler houses.: Gajenje i zdravstvena zaštita živine. Stojanov I.: Pneumomycosis in chickens: Clinical.. I. Rashid S. 2007 Mukaratirwa S.: Disseminated Aspergillus flavus infection in broiler breeder pullets.. Journal of Veterinary Medicine. October 03-05. Granet O.: Microbiological air contamination in farming environment.First International Symposium of Veterinary Medicine – ISVM2015 3. goslings with pulmonary and systemic Aspergillosis. Odbor za izdavačku delatnost Saveza veterinara i veterinarskih tehničara SFRJ.. Richard J. M. Berndt A.. 2012. C. Wages D. Mani P. 14. Lair-Fulleringer S. Towanou N. Dykstra M..: Investigations on airborne fungi in poultry houses. 18. 2005 Islam M. 21. 4. Guillot J.. F.. M. N. Feed to Food Cost Feed for Health Joint Workshop Novi Sad. Cox D. 51. XLI: 932-935. 16.: Disinfection of eggs contaminated with some fungi and moulds.. Trakia Journal of Sciences. 36. Helm J.. 2005 Nichita I.. The Annals of Occupational Hygiene 50. Nardoni S. 2010 De Bey M..: Outbreak of disseminated zygomycosis and concomitant pulmonary aspergillosis in breeder layer cockerels. Bhivgade S. Khatun M. Nanda A.. 17. Hube B. J. Potkonjak D. Veterinary Research Communications. 78. 98-101. J.. P. J. (7): 2995-3006. Puhač I. (8): 821-831. Kristensen H. 6. 2009 Chate D.. Grosse K. W. A. Jakšić S. Živkov-Baloš M.: Ammonia and poultry welfare: a review.: Trovanja životinja izazvana sekundarnim metabolitima plesni. C. 33: 521-527.. Bundy D.. Diseases of poultry Ed.: Importance of clinical and pathological diagnostics of mycotoxicosis in fattening turkeys caused by T-2 trichothecene. organized by Institute of Food Technology. 11...: Effect of environmental variables in turkey confinement houses on airborne Aspergillus and mycoflora composition. Wathes C. Rakotovao F.. 15. 9. Iowa State University Press. 53: 51-53. (1): 71-84. Mašić Z. 2010 Kapetanov M. (3): 213-219. (4): 445-449. 1998 Nešić K. Barnes H. 463-471. Zago R... Hoffman L. Beograd..: Exposure to airborne microbial components in autumn and spring during work at Danish biofuelplants. W. 883-902. S. Veterinarski glasnik. 329-331. Serbia. Jakšić S. Sinovec Z. 4.. B. D... Poultry Science. Tirziu E. A. 2004 Cacciuttolo E.. Arne P. (3): 16-21.. 2006 Martin M.. (15): 10-11. (2): 626-631... Fontaine J. Živkov-Baloš M. 14.. World's Poultry Science Journal. 2003.. Revista Brasileira de Ciencia Avicola. 2009 Ivanov I. 1995 Femenia F.. K. 52. International Referred Research Journal II. 59. 23.. Berkova N. 13.: Clinical and pathomorphological diagnostics of mycotoxicosis in parent poultry flock caused by T-2 trychotecene. 12. 8. P. 20. I. Eds. S. International Journal of Sustainable Crop Production. 2007 Gigli A. 6. 2010 103 . L. Trampel D. 124. XV International Symposium Feed Technology. 2013 Karwowska E. (1-2): 41-57.. seasonal and diurnal periodicity. Nääs I. mycological and pathological findings in turkeys experimentally infected by Aspergillus fumigatus. 56: 235-245. Avian Pathology. Infection and Immunity. Behera N. Ames.: Fungaldisease incidence inside poultry farm at ALISA. (4): 205-208.

First International Symposium of Veterinary Medicine – ISVM2015 24. 2009 26. P. 2009 27...: Aspergillus fumigatus in commercial poultry flocks.. (6): 170-174. Pl.: Mycotic pododer mat it is and mycotic pneumonia in commercial turkey poults in northernCalifornia.. 2003 29.: Disseminated mycosis in layer cockerels and pullets.hidmet.rs 28. Sander J. (1): 229-233. A. Jaksić S.. M. Avian Diseases.. 16. Stoute S.. Anim... Sajid M. J. 3/4. Lobsinger C. Rauf U. Sci. The Republic Hydrometeorological Service of Serbia (2010): www. Throne Steinlage S.. 2007 104 . Đ. a serious threat to poultry industry in Pakistan. 47. Mas N. Martinez A. M. Walker R.T. Granić K. L.gov. R. 79-81. Thayer S. Brown T. Matković K.. Kenjveš. 21. L... Khan I. Czech Journal Of Animal Science. 52.. T. J. E. Škrinjar M.: The effect of animal age on air pollutant concentration in a broiler house. Bickford A.. Journal of Veterinary Diagnostic Investigation. A. 554-557.. Matica Srpska Journal for Natural Sciences.: A toxigenic and allergenic fungal species in milking cows feeds throughout one research year. 101-112.: Frequency of Aspergillus fumigates fres.. G. Charlton B.. Vučemilo M. A.. 2006 25. 116. Ač M. Vinković B.

First International Symposium of Veterinary Medicine – ISVM2015 ________________________________________________________________________ Session № 2 FOOD AND FEED SAFETY AND QUALITY Full papers _______________________________________________________________________ 105 .

it is missing in British Isles.. Two criteria were established for hazards identification: evidence of shared pathogens presence in wild boar population in specific geografical region and evidence of hazardeous pathogens spread during handling..First International Symposium of Veterinary Medicine – ISVM2015 Invited lecture GAME MEAT SAFETY – WILD BOARS Jelena Petrović*. Wild boars in Serbia are native and very abundant big game species. control measures during hunting and after shooting. i. but our results suggest that pollution of the biosphere with chemical contaminants should be systematically monitored to identify potential increasing contamination tendencies. Trichinella spp. Implementation of the concept "from forest to fork" encompasses epidemiological difference between wild animals and livestock. Scandinavia and northern part of the European Russia. meat inspection after shooting or transport etc. Game meat production chain is substantially different from the conventional production of meat from domestic animals. while the Trichinella spp. type of hunting. transportation etc. thanks to substantial changes of agricultural practice. Serbia *Corresponding author: jelena@niv. reduced number of natural enemies as well as game feeding policies in last four decades the game population has recovered and is still increasing. heavy metals Introduction Wild boar (Sus scrofa) distribution covers the entire continental Europe. identifying the epidemiological difference between domestic and wild animals and determining the criteria for evaluating the safety of wild game meat. field evisceration of hunted game. however little is known about other food borne pathogens in wild boar population. The concept “from forest to fork” encompasses the effects of hunting ground ecosystems. processing and consumption of wild boar´s meat. wild boar. Milica Živkov Baloš.Toxoplasma spp. The presence of Salmonella spp. life cycle is distinctly described and there are relevant data about epidemiology and natural reservoirs of the parasite in this part of the Europe. type of hunting/shooting. The objective of this paper was to identify biological and chemical hazards important for wild boar meat safety. microelements. evisceration in the field.ns.rs Abstract Wild animal meat harvesting and processing is significantly different from classical livestock meat production and represents a challenge by itself. Rumenacki put 20.e. control measures for carcass processing and surveillance of chemical residues. and heavy metals. The risk assessment regarding alimentary pathogens in wild boars implies elucidation of some basic issues.ac. not only in Serbia but also around Europe (Rippa et al. Živoslav Grgić 1 Scientific Veterinary Institute „Novi Sad“. 106 . Excessive and irresponsible hunting resulted in demographic decline in early 20th century... guidelines for official meat inspection... Programme for monitoring and control of game meat safety should include control measures for live animals. Alaria alata is identified in wild boar population in our region. influence of hunting ground ecology. Alaria alata. The research on the presence of food borne pathogens in wild boar´s meat is still scarce. Keywords: meat. 2012). However. food borne pathogens. meat inspection after slaughtering. Toxoplasma gondii.. thus presenting an unique challenge. Several hazards were analysed: Mycobacterium spp. Salmonella spp. The analysis of the results of the microelements and heavy metals in wild boar meat has shown that no samples exceeded legally set limits. Novi Sad. microelements.

The recommendations are implemented through Directive Regulations (EC) 853/2004 and 854/2004. The majority of the population consumes minor amounts of game meat.. Toxoplasma gondii  Low-priority hazards: chemical hazards. 2010). Wild boar can act as a direct source of human 107 . too. additional laboratory testing is recommended)  application of practical skills and knowledge aimed at preventing the spread or increase of biohazards (such as Salmonella spp. etc.. since the majority of criteria relies on the average daily food intake. i. three animals are considered major hosts of tuberculosis: badger.The opinion that complete eradication of infectious and zoonotic diseases among wild animal population is virtually impossible is nowadays widely accepted. wild boar and deer from the subfamily Cervinae. hazards that still lack sufficient data Campylobacter spp.e. coli The guidelines of Codex Alimentarius Commission (CAC. The measures are basically distributed into two groups:  identification of the diseases and all major changes by visual inspection ( in case of apparent pathological changes. The food safety criteria for assessing the safety of wild game meat are still lacking. 2005) put the emphasis on hygiene and inspection surveillance of hunted game at the primary stage of meat production chain (including transport) as the critical points for game meat control. Y. Salmonella spp. but small population consumes pretty large quantities of game meat. In that respect. They represent a complex food-safety issue.. pathogenic verotoxic E. The average consumption of game meat among hunters’ families is estimated to be some 4kg meat per person.. specific laboratory testing. Domestic animals are raised for food and food production in controlled conditions..) on/in edible tissues Mycobacterium bovis M.First International Symposium of Veterinary Medicine – ISVM2015 When speaking of wild animals. Alaria alata  Hazards of undefined priority. tuberculosis is considered the most important biological hazard in large game. Hazard identification and control options Our identification of hazards of importance for wild boar meat relied on two main criteria. thus restricting the proper evaluation of animals’ health status and prevention of their entrance into the food chain. Trichinella spp. family member (Ramanzin i sar. Among the wildlife population of Europe. enterocolitica.e. thus undergoing the range of measures for health status control and ante and post mortem examinations at slaughter. The objective of this paper was to identify biological and chemical hazards of importance for wild boar meat safety. Is there evidence for hazard transmission during handling. Moreover. game undergoes only a post mortem examination. preparing and consuming of wild boar meat and is there evidence of the presence of the pathogen among the game population in our region? The following hazards were categorized:  High-priority hazards: Mycobacterium spp. the disease control measures encompass the control of the diseases that are transmissible from wild to domestic animals or directly to humans. control measures for particular hazards are described. severe contamination from the environment or suspected specific biohazard. information on certain diseases or mortality rates is lacking as well as the veterinary treatment. which is highly specific in wild animals. i. Potential negative environmental impact of measures and actions taken to the purpose of disease control is a specific issue within the program of wildlife disease control. Contrary to that.

Some 90% of known-infected wild boars with tuberculosis manifest calcified granulomatous lesions in the mandibular lymph nodes.c). such as Danemark. thorax and abdomen. the surveillance is practically impossible. c). 2001). Wild boar experience much higher levels of exposure than deer (Vicente et al. b. Moreover. predominantly in the head. i.e.53%).. The analysis of recorded trichinellosis epidemics in Vojvodina in the period 2001-2011 identified domestic pig as the main reservoire of Trichinella. and mandatory slaughter of positive animals (Pušić et al. However.. So far. as well as the reservoir of infection in domestic animals (Gortazari i sar. so meat inspection is the only potential current source of information and measure for control of tuberculosis. Poland.. b).001%) (Enemark et al. France. 2013a. computed records and animal tracking. including contact via the raw meat (Ashford et al... Documented cases of human infections after consuming wild boar meat were reported in Serbia (Urošević et al. Drina and Kolubara in Serbia (Petrović et al. 2007.. Wild boar tuberculosis has been reported in the last decades in at least 10 European countries: Bulgaria. Transmission of tuberculosis to humans occurs mainly by inhaling infectious aerosols. affecting also the regions of Srem and river valeys of Danube. 2008). Some literature reports described potential infection routes from wild boars to humans.. 2008. The infection is commonly acquired by consuming raw or undercooked meat infected with living Trichinella larvae. In countries in which trichinellosis of domestic animals has been fully eradicated. by consuming meat products originating from infected animals. 2005). relevant data on the presence of tuberculosis in wild boars in this region are not available and the research is ongoing.b. consuming raw milk and.. M. Hence. 2013). 2009. an average infection rate in carnivores in Vojvodina (3 larvae/10g) is significantly higher than that recorded in Danemark (1 larva/10g).89%). 2013). Moreover. The percentage of infected animals in individual herds ranged between 11. In Europe.10% and 59. tuberculosis in wild boars is not manifested by specific clinical picture and only the pathoanatomical examination can reveal suspect disease.. Trichinella spp Trichinellosis is endemic in almost all European countries. even generalised tuberculosis in wild boar rarely causes visible loss of body condition (Martín-Hernando et al.76%) and wild boars (0.. Eradication programmes in domestic animals rely on annual diagnostic examination of cattle using the method of intradermal tuberculinization reaction.. Croatia. In some cases. lesions in multiple organs. 2008). the prevalence of sylvatic trichinellosis is extremely low (0. When speaking of wild animals. 2012). 2000). 2006).. three endemic foci of tuberculosis were recorded located in municipalities of Žabalj. extremely high infection rates has been established in wild boars in Vojvodina region.. high incidence of trichinellosis was established in the territory of Vojvodina among several animal species such as jackals (7. which suggests potential contacts between wild and domestic animals and thus presence of tuberculosis in wild game. (2012 a. though somewhat less frequently. Hungary. Spain and the UK (Gortázar et al. testing positive herds and those who were in close contact with them at short intervals.18% (Pušić et al. Pušić et al. Germany. According to Petrović et al..2012a). foxes (4. Portugal. wild animals are considered the main reservoir of Trichinella... 2008). Pušić et al.. 2009a. where this host is considered the main carrier of wildlife tuberculosis and a key factor in cattle tuberculosis eradication (Naranjo et al. which makes the eradication of the infection impossible in spite of its pretty low prevalence in wild game (Rafter et al. In the region of South Bačka. Pušić et al. Novi Sad and Titel. 2007). Slovakia. High incidence of sylvatic trichinellosis in some 108 . bovis prevalence in wild boar ranged from 46 to 52 % in three different surveys in the Iberian Peninsula (Gortázar et al.First International Symposium of Veterinary Medicine – ISVM2015 tuberculosis infection. ranging even up to 1100 larvae/g (Petrovic et al. The occurrence of tuberculosis in cattle was recorded in the village of Kovilj (the territory of Novi Sad municipality). 60% of these animals have generalized tuberculosis.

an inadequate evisceration and/or bad shot (e. According to data reported by EU MSs in the framework of the Zoonoses Directive (2003/99/EC) in 2004–2011. 2012. in pigs include canibalism.8 % of ostrich and 2 % of rabbit faecal samples were positive for this organism. Improper disposal of pig carcasses and offals in the field. faeces Country Number of samples Number of positive samples Italy 2365 441 (18. the spectrum of serotypes isolated from carcasses. the rates are higher in wild boars than in ruminants) as well as between particular regions (e. Salmonella spp. Wild boars are very tolerant to the presence of humans. higher prevalence rates were recorded in southern countries of the EU) (Table 1). than wild ruminants. abdominal pain. life cycle of T. 2012) Animal species and sample Wild boars. According to Petrovic et al.3 % of wild boar.1 % of deer. shooting wound in abdominal region) increases the risk of meat contamination with Salmonella spp. which is assotiated with specific behaviour of this animal species. The diaphragms of all killed wild boars must be examined by artificial digestion method.g. However. nausea and sometimes vomiting.g.. 11. however.First International Symposium of Veterinary Medicine – ISVM2015 geographic regions poses substantial risk of infection spreading to domestic pigs grazed in sylvatic habitats. which may result in a variety of foodstuffs of both animal and plant origin becoming contaminated with faecal organisms either directly or indirectly (EFSA.g.. The common reservoir of Salmonella is the intestinal tract of a wide range of domestic and wild animals. (Wisniewski. Velhner et al. 2001)..1%) 4 (5. 18. 2013) Investigation of wild game pathogens in our country were mainly aimed at wild birds and other enteropathogens (Stojanov et al. it should be emphasized that appropriate disposal of meat originating from infected animals represents an important step in preventing further spreading of trichinellosis.5%) 109 . often commingling with domestic pigs on common pastures and have access to laystall and food waste. 2012). below 10% (unpublished data). Salmonella was therefore shortlisted for risk ranking (EFSA.7%) Portugal Switzerland 77 73 17 (22. lasting a few days. 2014).. 1. 2013). The potential transmission routes of Trichinella spp. in game were reported between individual species (e. 1. The prevalence of salmonellas on wild boar carcasses is relatively low. in the past few decades. in wild boars in some European countries (Paulsen et al. is the greatest risk factor for trichinellosis maintenance and spread within pig population.e.. Table 1. Great differences in the prevalence of Salmonella spp. Wild boars are more frequently the carriers of Salmonella spp. (2014). i. Salmonella has long been recognised as an important zoonotic pathogen of economic significance in animals and humans.1 % of reindeer. Typhimurium. Symptoms are often mild and most infections are self-limiting. Human salmonellosis is usually characterised by the acute onset of fever. for estimating the presence of Trihinela spp larvae. ingestion of synanthropic and sylvatic animals as well as of the faeces of pigs that have been infected some 12 days earlier (Petrović et al. Thus. Finding of Salmonella spp in wild boars has traditionally been associated with S. faeces and lymph nodes is much more diverse. tonsils. Prevalence of Salmonella spp. spiralis in Vojvodina region includes circulation from domestic pigs to wild boars and vice versa.. This is the most effective measure for the control of meat safety when speaking of this pathogen.

coupled with sampling of processed carcasses for Salmonella spp. thus molecular techniques need to be applied. stillbirth. In addition. the parasite can cause congenital infections resulting in abortion.38% in intensive production to 5. The similar trend of higher seroprevalence of Toxoplasma and Trichinella in outdoor-reared swine was reported in the Netherlands (van der Giessen et al. self-limiting symptoms.. can contribute to disease control. An interesting observation was reported by Dubey et al (1992) suggesting significantly higher seroprevalence of Toxoplasma among pigs raised outdoor than in those reared in conventional settings. However. this organism is significant hazard for wild boar meat safety. bleeding and cleaning of carcasses. gondii infection in livestock. which are the definitive hosts (EFSA. The parasite can also cause severe disease in immune compromised individuals such as organ graft recipients and individuals with AIDS or cancer (EFSA. gondii infection are asymptomatic and the majority of the remainder result in only mild. the parasite matures only in domestic and wild cats. In immune-competent individuals. T. drying. Meat or tissue samples can be tested by bioassay or PCR. The frequency distribution of Toxoplasma seroprevalence reported in Dubey et al (1992) study ranged from 0. which makes the diagnostics in living animals impossible. 110 . The seroprevalence in farmed wild boar has been reported to be 33 % (EFSA. with the possible exception of vaccination or culling in geographically isolated areas. gondii infection is common in animals and humans. ingestion of infected rodents and birds or cannibalism (Tenter et al. serologic assays can be applied. and almost all animals may be carriers of tissue cysts of this parasite. gondii are less wellestablished (Opsteegh et al. With the exception of cattle.. Toxoplasma gondii T. Gauss et al. evisceration. 1997.First International Symposium of Veterinary Medicine – ISVM2015 There are few practical options for eradication of Salmonella and other zoonotic diseases in wildlife. presence. cooling and transportation. 2013). and smoking also reduce tissue cyst viability. 2000). 2007). If infected meat is consumed without prior freezing or proper heating (core temperature over 67 °C) T. fermenting. T. Salting. T. gondii is an obligate intracellular protozoan parasite. Given the high incidence in wild boar. Therefore it is important to control hygiene during hunting. where the seroprevalence has been reported to vary between 8% and 38% (Lutz.62% in outdoor-reared system. there are no records indicating that such measures would have successfully eradicated Salmonella in the wild... the offal should be removed from wildlife (Gortazar et al. gondii oocysts cannot be differentiated from Hammondia or Neospora oocysts morphologically... but the exact conditions needed to inactivate T. gondii can be transmitted. vegetation. control measures in live wild boars. Antolova et al. 2006). 2007). Nearly all warm-blooded animals can act as intermediate hosts. Regulating animal density (to avoid crowding and overabundance). Toxoplasmosis in animal commonly takes an asymptomatic course. the outdoor environment with open access to soil. gondii is common in hunted wild boars in EU. 2013). In actual scientiffic literature there are no published recommendations (at least to our knowledge) on Salmonella spp. when game is eviscerated on the spot. 2007). mortality and hydrocephalus in newborns. In pregnant women. However.. To detect T. Common infection routes for wild boars include ingestion of oocysts from the environment. 2013). also. The natural production system is conducive for exposure of the pigs to various known risk factors for Toxoplasma infestations such as cats (the definitive host) and other species that can be harbouring cysts in their musculature as compared to the indoor conventional production system. and moisture allows viable environments for Toxoplasma oocysts. 80–90 % of cases of T. 2005. the presence of antibodies and tissue cysts is assumed to correlate well.

some hazards are not detectable by these procedures (Salmonella.5%). alata in wild boar (11. Recent studies conducted in the eastern parts of Austria indicated an overall prevalence of A. alata mesocercariae in wild boar of 2%. While relevant data on Trichinella spp are available and the mechanisms of the maintenance of its life cycle in our region are well known. Toxoplasma. to date.. chemical hazards) and designing and implementation of appropriate hazard control programs is necessary. when lean muscle (M... thus a thorough post mortem examination for the presence of tuberculosis and artificial digestion to confirm the presence of Trichinella but also Alarai alata is of outmost importance. 2012) found a high prevalence of A. and the transmission of this parasite occurs when humans eat undercooked game or frog meat infected with the mesocercarial stage of this parasite. Jakšić et al.. and that consumption of wild boar meat can be an important factor in the epidemiology of this zoonosis (Moehl et al. but primates can be infested by A. masseter) tissue was tested (Sailer et al. The epidemiology of Alaria infection is not well-understood (Moehl et al. . americana (Moehl et al. its diagnosis is feasible during the official Trichinella inspection in the competent veterinary inspection offices. toxicological profile and likelihood of occurrence.. 2012). Conclusion The absence of characteristic clinical picture is common to all aforementioned hazards. The analysis of the results of the microelements and heavy metals in wild boar meat in Serbia (non published data). 2012) or 6. the data on other hazards are still unclear. A study in Germany (Riehn et al. has shown that no samples exceeded legal limits.Within the category of medium potential concern for farmed game is cadmium. The reported cases of human larval alariosis are most likely due to mesocercariae from Alaria species other than A.No substances were classified in the high potential concern category for game. there has been no report on human alariosis cases due to consumption of wild boar meat and thus Aaria alata was ranked as hazard with low priority. alata are available. The ranking results were as following: . as a result of mistakes or non-compliance with known and regulated procedures. (2002) and Grosse and Wüste (2006) pointed out that the parasite represents a potential source of infection for both humans and animals. . Although specific methods for targeted detection of A. americana.Potentially higher exposure of consumers to these substances from game meat takes place only incidentally. 2009b).First International Symposium of Veterinary Medicine – ISVM2015 Alaria alata Alaria alata is a trematode parasite.. The presence of alimentary pathogens and contamination of boar meat with chemical hazards in Serbia has not yet been fully elucidated. However. and they took into account the findings from the NRCPs for the period 2005–2010.7%. 2009b). Chemical hazards EFSA (2013) ranked chemical residues and contaminants on the basis of bioaccumulation. 2009a). when a muscle – fat tissue mixed sample was tested (Paulsen et al. However. but our results suggest that pollution of the biosphere with chemical contaminants should be systematically monitored to identify potential increasing contamination tendencies. A number of ongoing research-scientific projects in our country address the prevalence of selected hazards among wildlife population with an aim of obtaining 111 .All other substances listed in Council Directive 96/23/EC was ranked as being of low or negligible potential concern .

EFSA: Scientific Opinion on the public health hazards to be covered by inspection of meat from farmed game. control measures during and after hunting.81–87. Cabezon O.. 203–207.. Mammal Review.2006 11. 193–200.. Acevedo P. Zeitschrift Fur Jagdwissenschaft. 2006 10. Rodrigues A. 283–287. Annals of Agricultural and Environmental Medicine. Hamedy A. 12.325-337. Kabelitz T. 3-4...... Ruiz-Fons F... International Journal of Medical Microbiology. Uhitil S. Antolova D. 229-37. References 1.. CAC Codex alimentarius CAC/RCP58-2005.. Zeitschrift Für Jagdwissenschaft.:The status of tuberculosis in European wild mammals. 43. Enemark H. Reiterova K.. Gortazar C.. 42.2000 9. 103–103.3. Dubey J. Vicente J. The EFSA Journal 11. Reglero M. Hamedy A.0002776. Jaksic S. The EFSA Journal 583. grants TR 31084. doi: 10. Moehl K..: Serological evidence of antibodies against Toxoplasma and Leptospira in wild boar. McDonald R. Ruiz-Fons F. Kabelitz P.:Seroprevalence of Toxoplasma gondii in wild boars (Sus scrofa) in the Slovak Republic. 2001 3. Aznar-Martin J.. Council Directive 96/23/EC 5. prevalence and biology of a re-emerging parasite. Vicente J. 2012 13.. 1992 6.: Bovine tuberculosis in Doñana Biosphere Reserve: the role of wild ungulates as disease reservoirs in the last Iberian lynx strongholds..: Prevalence of Toxoplasma gondii antibodies in red deer (Cervus elaphus) and other wild ruminants from Spain. 86. Hawaii.: Alaria alata—investigations on detection. Screening for infection of Trichinella in red fox (Vulpes vulpes) in Denmark Vet Parasitology 88...Wuste T. Parasitology Research. 2009a. foods and animals.First International Symposium of Veterinary Medicine – ISVM2015 scientifically-based risk analysis as a corner-stone for implementing appropriate programmes and measures for the control of alimentary hazards. Henriksen S.1. Thulliez Ph. Lutz W.. Cosivi O..2013 8. Bjorn H.. Gortazar C.. Delahay R. Dubinsky P. PLoS One. 2002 15...: Prevalence of antibodies to Toxoplasma gondii and Trichinella spiralis in 509 pigs from 31 farms in Oahu. Acevedo P. Grosse K.23.7:e2776. 71–73. 20.1–64. control measures for carcass processing and monitoring over chemical residues. Grosse K...1371/journal. 1–15Naranjo V. Almeria S. Wueste T. Vidal D.:Mesocercariae of fluke Alaria alata determined in wild boar meat. 17. 136. 2007 7.pone. 2007 2. guidelines for veterinary inspection of meat.. Code of hygienic practice for meat 4. 2006 14. Lavin S.:Mesocercaria from Alaria alata—discoveries at examination for trichinosis.. and human exposition risk to Alaria mesocercariae—a review.3264.. 57-63. Luecker E.. Gamble H. 105.. 2008 . 106–108. 48.Vucemilo M. Torres J. Wueste T.. Gortazar C. Grosse K. Gortázar C. EFSA: Scientific Opinion of the Panel on Biological Hazards on a request from EFSA on Surveillance and monitoring of Toxoplasma in humans... The programme for control and monitoring of wild boar meat should encompass control measures for live animals. Acknowledgement This work was supported by the Ministry of Science and Technological Development of the Republic of Serbia...: Biology of Alaria spp.Luecker E. Gauss C. Dubey J. Raghunathan P..: Disease risks and overabundance of game species European Journal of Wildlife Research 52.1–2. 112 . Moehl K. Rev Sci Tech. Vicente J. 193–206.. 299. de la Fuente J. 43.. Ashford D. Veterinary Parasitology. Marco I. Fleischwirtschaft. Whitney E.. Veterinary Parasitology.. 1997 16.6.. 14.. Nielsen B:. Negro J.: Epidemiology of selected mycobacteria that infect humans and other animals.

X epizootiološki dani sa međunarodnim učešćem.Zbornik radova u 11. 35... Lalošević D. Bugarski D. 991–995. R. 175-181. 22.uloga divljih životinja u ciklusu širenja trihineloze u Srbiji. Conference Meat and Meat Products Perspectives of Sustainable Production.: Vrednovanje i primena mycobacterium bovis gama interferon testa u dijagnostici tuberkuloze goveda. 2010 Paz M. Hilbert. Zbornik kratkih sadržaja. Stojanov I. Amici A. AE Wageningen.. S. Ruiz-Fons F... 22.135-137. Gortázar C..2008 Pušić I. 1–9... život i zdravlje. 55-63. Rediscovery of Trhichinella spiralis in red foxes (Vulpes vulpes) in Ireland after thirty years of oblivion. 127. 9:e61doi:10. Fulgione. selekcija i reprodukcija svinja'.. Prodanov J. Milanov D. 2012b Petrović J. The Netherlands. F. Milanov D. »Savremeni aspekti održivog gazdovanja populacijama divljači« Zemun-Beograd. Arhiv veterinarske medicine. Teunis P.. 58.. Koets A. IX epizootiološki dani sa međunarodnim učešćem. Prodanov-Radulović J. 61-5. Belgrade.. Casoli C et al. D. Opsteegh M. Langelaar M. Ehebruster J. Wageningen Academic Publishers. 33. Grgić Ž.2010. Urošević M.03.2007 Zbornik radova i kratkih sadržaja.. 609–616. 2013 .. sa međunarodnim učešćem. Pušić I. Lupulović D.: Metode dijagnostike tuberkuloze na živim govedima.. Srbija. Apić J. Vicente J. Di Donato.. jun.. 2012a Paulsen P. 23. V.... 50. kongres veterinara Srbije. 343–354.. Milićević V. 8... Grgić Ž.. 28. 2012. 2008.. Došen R. Grgic Z.2012a Petrović J. Tuberculosis 87. L. 372-373.823. Stojanov I.98-98.: Lesions associated with Mycobacterium tuberculosis complex infection in the European wild boar... 15-19. A... Bugarski D. Silvatična trihineloza .Smulders F:Findings of Alaria alata mesocercariae in wild boars (Sus scrofa) in eastern Austria. 2013. 2014 Pušić I. UDK:351. 2009a Pušić I. Smulders. Tara 2-5.. 125-130. Marčić D. Urošević M. Luecker E. Garrido J. 24. 30. 10th-12th June. Barral M... Vicente J and de la Fuente J.. International Journal of Parasitology. Vidal D.32 113 . 2013b Petrović J. Grgić Ž.: Epizootiološke karakteristike tuberkuloze goveda u Južnobačkom okrugu.... 32. 20. Zbornik radova i kratkih sadržaja.: Efekti različitog lovnog gazdovanja na genetsku strukturu populacije divlje svinje u južnoj Italiji. 2009c .e61 Regulations (EC) 853/2004 i 854/2004 Rippa. 21.2007 Paulsen P. Rafter P.. Infect. 04 2008. Zuchner L. ISSN 1221-5295. Živkov-Baloš M.Simpozijuma sa međunarodnim učešćem 'Zdravstvena zaštita. Trends in game meat hygiene – From forest to fork. D.. Pušić I. 25. Ratajac R. Marucci G. Grgić Ž.012. ISSN 18209955. Međunarodni simpozijum o lovstvu. 19. Pušić I.: The use of different diagnostic techniques in cattle tuberculosis eradication. – 24.... 2005. Maselli. Funte J. Veterinarski glasnik 66. Gortazar C...: Sylvatic trichinosis in the Vojvodina region (Serbia). Milićević V. Veterinarska medicina...... Grgić Ž... Prodanov J. 41. Savić-Jevđenić S.. Meat from wild ungulates: ensuring quality and hygiene of an increasing resource.: Epizootiološke karakteristike tuberkuloze goveda u koviljskom ritu. Bugarski D. 2013a Petrović J.. 2007a.. 29...3-4. Matekalo-Sverak V.. Pozzio E.. Stojanov I. Đorđević V.van der Giessen J. 31.. Santrač V.. Brangan P. F.1:65.2005 Ramanzin M. Đuričić B.. 2009b Pušić I... Food Research International. Beograd. Salvioli. 45. Irschik I..: A preliminary trial to evaluate the gamma-interferon assay for the detection of tuberculosis in cattle under local conditions in Serbia. Bugarski D. Bugarski D. Đuričić B. 2009b. Italian Journal of Animal Science 2010. Prodanov J. II International Symposium and XVIII Scientific Conference of Agronomists of Republic of Srpskam March 26-29..4081/ijas. 101-102.: Salmonella in meat from hunted game: A Central European perspective.09.: Low predictive value of seroprevalence of Toxoplasma gondii in cattle for detection of parasite DNA.Ligrone... Đuričić B.. 207-208. Prodanov J. Milićević V. 27. Grgić Ž. 4.... Veterinary Microbiology. Winkelmayer R..First International Symposium of Veterinary Medicine – ISVM2015 18. Savić S. 153-158. Evidence of the role of European wild boar as a reservoir of Mycobacterium tuberculosis complex. Požarevac 28-31.. Urosevic M. Hofle U..Proceedings.Liguori. Lucrari stiintifice. 26.. Grgić Ž. 360-367. Prodanov J. Riehn K.175183... J. 34.: Molecular diagnostics of trichinella species: new data on trichinella life cycle in Vojvodina region. Pusic I..2009. European Journal of Wildlife Research.

.. Garrido J... Glawischnig W.. Medycyna Weterynaryjna. 2. Suvajdžić L.. Gortazar C. 3–4. in wild boars in Poland. 6. Tenter A.2012. 2012 37.:Seroprevalence of Trichinella spiralis and Toxoplasma gondii in pigs from different housing systems in The NetherlandsVeterinary Parasitology. Langelaar M. J. 399–401. Antimicrobial resistance of escherichia coli in wild animals.. Potkonjak . Parasitol 31.. 346–352. Bouwknegt M..Veterinary Research 37.. 57. Petrović J. 43. identification of risk factors and discussion of risk management options. Petrović J.. Petrović J. Vicente J. Fernandez-de-Mera I.. Wisniewski J. Weiss L. 2012.. 2006 42.. Riehn K.. Juste R.. Fonville M. 2007 41. 2013 40. 114 . Barral M. Urošević M. 2001 39. Heckeroth A. 2012 38. Vollema A. 217-220.. 2001.. 371-374. Wiener Tierarztliche Monatsschrift. Živkov-Baloš M.. 1. Jajić I. Van der Giessen J.International symposium on hunting.: Findings of Alaria alata mesocercariae in wild boar in Austria: current knowledge..107–119. Sailer A. Erratum to “Toxoplasma gondii: from animals to humans” Int.06. Luecker E..: Wild boar and red deer display high prevalences of tuberculosis-like lesions in Spain... The incidence of Salmonella spp.. Kapetanov M.: Karakteristike trihineloze kod ljudi na teritoriji Vojvodine u periodu 2002-2011.Paulsen P. Arhiv veterinarske medicine 35-44. Stojanov I.. Šeperanda M. Ecological role of bacterial isolates in protected wild birds Proseedings. Mirilović M. 45-55. Irschik I. 107-109... Velhner M. 22-24. 148...First International Symposium of Veterinary Medicine – ISVM2015 36. 99. Hofle U. Risatić Z.

maize. are found in young plants and their content decreases with plant ageing. Milovan Jovicin1 1 Scientific Vetereinary Institute „Novi Sad“. The highest levels of β-carotene in pasture grass. The only „natural“ source of vitamin A for ruminants is that occurring by β-carotene cleavage and its absorption by enterocytes and. However. Consumers mostly assess the initial quality of animal products according to its colour. which are considered „natural“ in most countries. parturition and 115 . This period is characterized by increased immunosuppression and thus higher susceptibility to disease. Novi Sad Republic of Serbia * Corresponding author: milica@niv. fat. carrot. Content of mineral matters was measured applying the atomic absorption spectrometry.ns. though their preferences regarding the colour and thus the acceptability of milk and dairy products differ between the countries and even between the regions in one country. adequate β-carotene content in the colostrum is a prerequisite for providing adequate levels of vitamin A (β-carotene). low buffer capacity and a higher amount of water-soluble carbohydrates. the following combinations of raw materials were used: whole corn plant and carrot. to some lesser extent. The energy requirements increase because of accelerated foetal growth and milk production.ac. calcium and phosphorus in the samples was performed by standard methods. pumpkin. while the protein was analyzed by measuring total nitrogen by total combustion (according to Dumas).rs Abstract The aim of this work was to evaluate the nutritional composition of silages based on the cereals supplemented with carrot as well as pumpkin. To that end. Metabolic changes are associated with rapid foetal growth. Furthermore. Thus. The results obtained from this research reveal that cereals silages supplemented with pumpkin and carrot can be considered a good source of nutrients. β-carotene content in maize silage. Peripartal period in dairy cows is highly stressful period associated with intensive physiological changes and metabolic adaptation during pregnancy period and lactation.First International Symposium of Veterinary Medicine – ISVM2015 Invited lecture THE DETERMINATION OF THE QUALITY IN CEREAL SILAGES SUPPLEMENTED WITH PUMPKIN AND CARROT Milica Zivkov-Balos1. Sandra Jakšić1. Key words: silages. 2006). alfalfa. Whole plant maize silage is used worldwide in the rations for cattle. dairy cows Introduction Plant species that are suitable for silage have a higher dry matter yield in the field and higher digestibility. For the ensilage. cereals. oat grits and carrot and corn grits and pumpkin. the carotenoids content in milk can be considered an indicator of pasturebased farming (Nozière et al. ash. 2006). etc. 2011). The contents of β-carotene in grass vary depending on the plant species and growth stage. as the product of liver metabolism. whereas carotenoids transfer is somewhat less pronounced in ruminants and affects the colour of milk and dairy products and body fat as well. is very low. The majority of feeds for dairy cows contain low levels of β-carotene (Nozière et al. Thus. which is a popular main feed for dairy cows. Plant carotenoids are transferred to the products of animal origin with the different absorption rates. egg yolk demonstrates high absorption rate. Determination of moisture. crude fiber... Yellow colour of milk and dairy products is often associated with grass-feeding systems. its absorption by the enterocytes is of vital importance for calf development (Kaelawmun et al.

β-carotene as an antioxidant can affect the functionality of host’s immune system through its positive effects on membrane fluidity (Chew and Park. carrot and pumpkin can be considered alternative cultures and good sources of vitamin A and β-carotene for cattle. 1999). are rich sources of this vitamin precursor. Some crops. Moreover. 2010). In our region. The use of agricultural residues and surplus products as well as alternative crops is often a useful way of overcoming the shortage of animal feedstuffs and has been intensively addressed by some recent researches and projects worldwide. pumpkin (especially some particular varieties) is used as animal feed. Potential way of using the health-nutritional components of „rejected“ crops and thus increasing their economic value is their application in organic egg production (Hammershøj et al.. the cow is in oxidative stress (Kaelawmun et al.. in the production of yellow-colour butter and cream (Watson. Chawla and Kaur (2004) reported that β-carotene supplementation to cows in drying off period is required to improve the antioxidative plasma status and overall health status post partum. It is to be emphasized that including of these alternative crops into the diet for dairy cows could contribute to the increase of organic milk production in line with the basic principles of organic production. deformity. its influence on reproduction has been extensively studied.. According to current regulations. Among the role of retinol in ruminants. (2004). which are used as feed alternative for domestic animals. 1987). after October 31 (Halloween). Carrots have become a common animal feed in egg production in Danemark. (2010) reported that β-carotene supply improved embryo production and quality in super ovulated cows. However. Tjoelker et al. growth and male fertility. the carrots of poor quality (some 22% of total production) are returned to the producers mainly because of undersize. but in general. carrot root has been used in cattle breeding as the winter feed for dairy cows.First International Symposium of Veterinary Medicine – ISVM2015 inducing of lactation. Beside for human consumption. thus substantial amount of the crops is left in the fields. which results in increased generation of free radicals. Agricultural surplus. Oxidative stress is an important factor contributing to disease susceptibility. 2010).S. 1989). The rejected crops that are returned to the supplier are considered goods of poor economic value and are used rather as animal feed than the source of carotenoids.. 1994). as in other mammals. Some farmers use pumpkin fields for grazing (in combination with maize-stalk). though in some lesser amounts. especially through impaired ovarian function and increased incidence of abortion (Hurley and Done.. 2003). Retinol is also involved in various functions. Pumpkins with spots or blemish as well as those broken or damaged during harvesting are discarded as inacceptable for the market. but it conteins also xanthophyll. low purchase price of agricultural products and inability of selling the products on the market result in the disposal and loss of substantial amounts of agricultural products. the integrity of organic 116 . (1988. In addition. pumpkin varieties are grown as decorative plants as well as for human nutrition. When the production of free radicals exceeds the antioxidant defence mechanisms of the body. Some novel researches indicated that carrot supplementation to the diet of dairy cows increases the content of vitamin A and lactic acids in milk (Nalecz-Tarwacka et al. At the food market. very little information is available on the nutritive value of pumpkin in cattle nutrition. the feed used in organic milk production must be 100% organic-grown (EC. Flashy and cellulose portions of pumpkin are one of the most important edible agricultural residues (Razzaghzadeh et al. breakage or root diseases/infection.. and to reduce the incidence of mammary infections.. the demand for decorative pumpkins decreases. Carrot is good source of carotene. Kawashima et al. such as vision. Retinol deficiency may reduce reproductive efficiency in dairy cows. Organic milk production is based on organic principles and objectives including naturalness and recycling of nutrients. to improve the milk production and quality. 2011). In the U. 2007). and intrafollicular concentrations of vitamin A correlated positively with those of estradiol and follicle diameter (Schweigert et al. 1990)). In the U. Some researches pointed out that pumpkin is good source of energy with adequate protein content for the cattle (Jenkins.S.. the conversion rate of β-carotene to vitamin A in granulose cells has been enhanced by follicular growth.

Silage making involves harvesting crops by mechanical harvester. fructans and sucrose to organic acids. i. The aforementioned strongly suggests the soundness and necessity of our research that was aimed at alternative crops and agricultural surplus products from our region.. Such raw materials can be used not only as the source of nutrients for ruminants but also as the substitute for commercial and imported feeds.First International Symposium of Veterinary Medicine – ISVM2015 production could be further enhanced if frequent use of vitamin supplementation with artificial fatsoluble vitamins is substituted by vitamins from natural sources (Mogensen et al. drying and chopping are also required. The advantages of ensiling alternative crops and root crops include (Moran. the following combinations of raw materials were used: 117 . which makes the method somewhat expensive and cumbersome for farmers. when accumulated. Using alternative crops as animal feed can provide competitive alternatives to traditional feed sources and potentially reduce the expenses and impact on the environment. 2012). The silo is opened after several weeks or months and the silage is removed for use as feed. This means that these need to be treated for storage if they are to be made available as a feed resource during lean season. Prior to silage making. which is sealed to produce anaerobic conditions. Although these materials have nutritive value. Ensiling can be considered as a method for making use of wet raw materials more effectively. potential harmful environmental effects of waste incineration. The harvested materials are placed in a silo. reducing total feed costs can improve their palatability can reduce toxicity to safe levels (in vegetables) can destroy harmful bacteria (in food by-products) can constitute a major proportion of diets Another aspect of using carrot and pumpkin in cattle nutrition that is to be emphasized is the fact that using agricultural surplus products for animal feed is a specific recycling process.e. 1999). principally lactic acid. usually with considerable reduction of the size of particles. Preservation of alternative crops Carrot and pumpkin are highly moist materials. 2005): • • • • • • • • feeding is possible when such by-products are not being produced increasing feed resources and an insurance for high nutrient demands. such as milking cows reducing demands on home-grown forages if low cost. fructose. Preservation of ensiled materials is achieved by the conversion of plant water-soluble carbohydrates – glucose. landfills for plant material surplus are greatly reduced. can cause environment pollution and increased costs of waste disposal. they are difficult to incorporate into a commercial feeding program because of preservation problems. which accelerates the release of plant cell contents. since such surplus. The basic aim of these researches was finding new options for balanced livestock diet avoiding the competition with human nutrition.. Moreover. There is also a variable degree of degradation of proteins to amino acids and other nitrogenous compounds (Wilkinson. Materials and Methods Material: For ensilaging. and thus changing the perception of economic value of food. At the same time. which leads to further savings in energy and transportation. agricultural surplus products should be used with an aim of increasing the self-sufficiency and stability of food supply. which could be used as feed for dairy cows and an alternative to synthetic vitamin A and β-carotene in organic milk production.

iron. the desirable content of dry matter (DM) of maize plant for ensiling is 35%.59 0.28 ± 0.92%. 6490-2.20 ± 0. 6491).32 ± 0. whole corn plant and carrot. variety Ishicu Kuru (used for seed production) was prepared in a trench silo.36 1. The serum content of β–carotene was determined using colorimetry. Reduced fermentation in carrot/oat grit silage is most probably due to the high content of dry matter. magnesium. copper.79 89. crude fat. The ensiling was performed in a PVC barrel. Content of mineral matters (manganese. %) (Živkov-Baloš et al. Vitaminized silage of carrot and oat grits Carrots (14 kg) were chopped in small particles (2 cm). 2013.23 23. The ensilaging was performed in a trench silo using an inoculant (Start supplement for silage. which is the „carrier“ of energy value and soluble sugars essential in production of adequate amounts of lactic acid. Novi Sad).86 ± 1.33% to 76. sodium) were determined using atomic absorption spectrophotometry applying Varian SpectrAA-10. oat grits and carrot.71 ± 0.59 96. Vitaminized silage of maize grits and pumpkin. Blood samples were collected before and after silage supplementation to the diet. Pumpkin’s pulp (720 kg) was pulverized using a tractor chips and mixed with 480 kg of maize grits. centre and bottom parts of the trench silo. zinc. The samples were collected into sterilized bags..73 4. 3.. Vitaminized silage of whole maize plant and carrot Silage maize mass was 72 000 kg and carrot mass (whole root) was 3500 kg. Methods of chemical analysis: Determination of moisture.28 0.98 ± 0.5 l water.50 95.79 ± 0. which inhibits the microbial activity (Živkov-Baloš et al.5 kg of oat-grits were added along with 1. This percentage provides an optimal proportion of starch.02 3. the barrel. Chemical composition of vitaminized silages (on dry matter basis.30 10. crude ash. Results are presented as means±SD. 2014). 2. while crude protein was determined by measuring total nitrogen using total combustion according to Dumas (EN ISO 16634-1) and applying Elementar Rapid N Analyzer.70 ± 3.11 ± 0. Animal experiment: Four cows in late pregnancy and four recently calved cows originating from the same dairy farm were fed vitaminized silage of whole maize plant and carrot.13 ± 1.65 3 55.60 8.12 13. and then 12.06 2 53. Moisture content in the examined samples ranged from 45.58 ± 4.13 10.e. kept in iceboxes and transported to the laboratory for analysis. Content of β-carotene was determined by spectrophometric method.72 ± 5. 6865. 2014) Sample Dry matter Organic matter Crude Protein Crude fat Crude fiber Crude ash (DM) (OM) (CP) (EE) (CF) (CA) 1 27. 2. 118 .54 ± 0.First International Symposium of Veterinary Medicine – ISVM2015 1.45 ± 0.02 8. 6492.29 ± 4. 3. Natura point.49 ± 1. calcium and phosphorus in the samples was performed by standard methods (ISO 6496. Silage was carried out in six plastic barrels of 200 L Sampling procedure: Silage samples were taken from the top. 5984.30 ± 1. i. Table 1.44 9. According to the research of Horrocks and Vallentine (1999). corn grits and pumpkin.82 Sample No: 1. crude fibre. Results and Discussion Data on average chemical composition of the examined silage samples are displayed in Table 1.02 ± 5.

94% in DM (Demirel et al. Similar findings (68. The average CA content in carrot is 7.28% DM. 2012). The carrot roots and carrot heads contain 9. (2009).28 to 10.4% (3. (2009) reported that the content of CF in DM of whole plant maize silage is 17. (2009).45% in DM) in silage of carrot and oat grits and 4. The CA content in silages changed from 3.6 g CP / kg DM. 2004).64 to 7. The maize silages EE content changed from 2. The effect of stage of maturity on the ensiling properties of whole crop maize was studied under laboratory conditions.. Our results are in compliance with the results of other authors. Fresh pumpkin (Cucurbita sp. 2011). Enishi et al. respectively. CA in whole plant maize silages changed from 4.75% (average 8. Vranic et al. and the lowest in vitaminized silage of maize grits and pumpkin.0% (0.54 and 27.1% and 18.45% on fresh matter basis (8...11% in DM) in silage of maize grits and pumpkin (Table 1). Djordjević et al. after the process of fermentation (that lasted 28 day).40% in DM (Demirel et al.19-4.. 2004). was 61..52% (average 13. The variability in the contents of mineral elements in plants results from a number of 119 .6% for control and transgenic maize varieties.4%) in DM (Nonaka et al.0213.3-14.9%) in DM (Nonaka et al.57% in DM. 1994).8% of crude fat in DM (Enishi et al.82 to 8. Fresh pumpkin contains about 2.20% DM.96 and 27. Carrot silage has 27. The highest content of Ca was measured in vitaminized silage made of whole maize plant and carrot.36% and 0..20%. The highest content of CF has been established in vitaminized silage of whole maize plant and carrot. (2005) reported Ca and P contents in dry matter of carrot of 0.54% and 1. (2011) established CF content in maize silages ranging between 17.84% on fresh matter basis (average 9. (2012) reported the content of CF in maize stalks. The DM mineral content of our silages was within the range of average values reported by other authors.1% of CF.5 to 9. (2002) findings revealed the content of CP from 8. (2004) reported that fresh pumpkin contains about 7.09%. 1992).32% in DM) in silage of whole maize plant and carrot. 1994). EE content in carrot is on average 1.. Our results of silage CP were in between the results of other authors. (2008) reported that the CP content in samples of maize silage for dairy cows nutrition.First International Symposium of Veterinary Medicine – ISVM2015 The CP content was 2.. Ether extract (EE) ranged between 0. The CF content in silages changed from 4. 1994). Idi et al. respectively (Nonaka et al.2% CF in DM (Enishi et al. 2012). CA content in dry matter of maize silages is 5.. Carrot root contains 8. respectively.98-23.30 % in DM.1 % of DM and 13.8% of CP (Laflamme. Calcium (Ca) and phosphorus (P) content in investigated silages is displayed in Table 2. 1994).29-2.94% and 0.68% to 4. 2010) and 16% (Davis et al. The chemical analysis revealed abundant amounts of these essential macro elements for animal nutrition on DM basis ranging between 900-4300 mg/kg (Ca) and 1600-2200 mg/kg (P). 2008).2-1.1% crude fibre in DM (Nonaka et al.1-12.04%.86% in DM). ranging between 24.. 2011). Hashemi and Razzaghzadeh (2007) reported Ca and P contents in dry matter of silages from Cucurbit residues of 0. 2004).13-7. 2004). The average calcium and phosphorus contents in fresh carrot roots are 3800 mg/kg and 2900 mg/kg DM.07-6.76%. Filya (2004) reported CA contents in maize silages in different stages of fermentation ranging 4. respectively (Davis et al.65%. (2011) noted that silages of 12 maize hybrids have CP content from 4. Fresh pumpkin contains about 2. 7. (2009) reported that EE content in dry matter of maize silages is 8.4% in DM (Jenkins. The CP content decreased from 80 to 58 g/kg DM (Filya. Content of proteins in pumpkins (carving and pie pumpkins) is 14. Đorđević et al.. The pumpkin Ca and P contents are averagely 3900 mg/kg and 2600 mg/kg in DM. 2004)...72 g/kg DM) were reported by Đorđević et al. According to the report of Djordjević et al. respectively (Enishi et al. Highest ash content was measured in the silage of whole maize plant and pumpkin as a consequence of higher proportion of maize stalks in the silage. Carrots have 85-90% moisture content and about 10% crude protein in dry matter (Rust and Buskirk.26%. Demirel et al. Demirel et al. Calcium content in whole maize plant is 800 mg Ca/kg DM (Galila et al.1-10.9% CA in DM. Our silage results were lower than the results of other authors. whereas Galila et al.8% of crude fat in DM (Enishi et al. 2012). Kamalak et al.91% in DM.) contains averagely 13.

.18-0. According to the data from the literature.e. oat grits and carrot. Results are presented as interval of variation The highest manganese (Mn) levels were measured in the samples of maize silage (whole plant) and carrot.09-0. 2006). Demirel et al.8-111. mg/kg 798-1131 660-753 3283-17187 Type of vitaminized silage: 1. i.4 mg/kg DM in the root and 198 mg/kg in leaves (Intawongse and Dean. mg/kg 2175-3912 754. Macro.21-0. mg/kg 22. 2011. mg/kg 126.18 Manganese. The content of Mn in carrot ranges between 34.60 mg/kg.5-95..36-0.14-0. The results of their investigation showed that uptake of some microelements by plants corresponded to the increasing level of soil contamination. 2000.6 70.1-10.8-24. Vitaminized silages. 2.1 99.9 Zinc. being averagely 54. Blackwood (2007) stated that silage made of whole plant maize contained 34. were tested before and during feeding vitaminized silage made of maize (whole plant) and carrot (Table 3.). silages and hay are 196.6-8. Mineral content of vitaminized silages (on dry matter basis) Mineral. The highest zinc (Zn) levels were determined also in silages based on whole maize plant and carrot. Intawongse and Dean. Higher manganese contents in our samples are most probably due to the high soil Mn levels.43 0.8-31. 81 and 36 mg/kg.09 to 6..-802 805-898 Natrium.16 Phosphorus.4-19. the level of β-carotene in maize ranges from 24 to 35 mg/kg. particularly those based on pumpkin pulp and maize grout. respectively (Noziere et al. mg/kg 30.9-147.2 mg/kg of DM.4 15. 3. 2011). 1999). corn grits and pumpkin.5-21. cows in late pregnancy and recently calved.26 0. % 0. unit of measure 1 Type of vitaminized silage 2 3 Calcium. feed (alfalfa and maize) and food (wheat) indicated a high variability in the contents of these elements between some locations in Vojvodina Province (Živkov-Baloš et al.0 mg/kg Mn in DM.13 0. The average content of this provitamin in maize and carrot based silages was about 386. 159.13-0. The most important attribute of these silages is their richness in vitamins and β-carotene. mg/kg 47. Our results on zinc levels correspond with the results of other authors (Demirel et al. dry forages. Thus. whole corn plant and carrot. and that soil-to-plant transfer factor values decreased from Mn>>Zn>Cd>Cu>Pb. % 0.9 4.and microelements analyses of soils. This is significantly higher value as compared to that reported by other authors.. whereas average β-carotene contents in green grass..8 Coper. are very rich in sodium and magnesium.2-7.22 0. such as plant species. 2006). 120 .6 Iron.3 18. 2006).7-20.3 2.16 mg/kg of DM. soil properties and application of agro technical measures (ŽivkovBaloš et al.3 7. Table2.2 Magnesium. Total 8 sera of cows from two production groups.1-61.First International Symposium of Veterinary Medicine – ISVM2015 factors. (2011) reported Mn contents in samples of diverse maize hybrids silage ranging from 4. Iron contents in the examined samples of vitaminized silages were within the range of available literature data.2 7.

I. 4.90 The values in samples before feeding vitaminized silage 7.30-27. Such high levels of β-carotene in vitaminized silage. 3. 134. carrot and pumpkin ensure good results in cattle reproduction and better milk yield. 257-261. 2004.22 8. Paterson. The selected alternative crops are widely grown in the territory of Serbia and do not require any substantial economic investments.: Mineral content of common ruminant stockfeeds. 3. 4. n=4 Content of β-carotene winter 2.59↑ 36. 279-285. Acknowledgments The research was financially supported by the Ministry of Education. With regard to their nutritional composition..98 7. 114. Blackwood.64↑ 42.79-9. blood sera of the cows. contributed to improved production results and significantly reduced administration of veterinary drugs. Feed Sci.44 The values in samples during feeding vitaminized silage 36.59 7. Science and Technological Development of the Republic of Serbia (Project No TR31071) References 1. 121 . carrot and pumpkin that were used in the present experiment were assessed to be of good quality. Primefact 522. 2007. Kaur H. Anim.P.: Carotenoid action on the immune response. Park J. 3. that is. Extensive Industries Development.. The entire technological process is designed to provide highest level of preserving the quality and nutritive properties of feed.83↑ 28. 2.S.First International Symposium of Veterinary Medicine – ISVM2015 Elevated contents of β-carotene were measured in the blood of all cows fed vitaminized silage based on maize and carrot. Tech. 1.23 7.. The content of β-carotene in blood serum before and during feeding vitaminized silage Characteristic Reference value Sample No. crops and pastures.76  0. J. Chawla R.07↑ 36. Nutr.: Plasma antioxidant vitamin status of periparturient cows supplemented with αtocopherol and β-carotene.03  7. n=4 x  SD= x  SD= Sample No. which guarantees a sustainable production of safe organic food of animal origin and satisfactory production outcomes without significantly affecting the farming technology.01 Conclusions Vitaminized silages based on grains. 2. 2. Vitaminized silages based on grains. 1. September Livestock Officer. Chew B.. Table 3. the investigated vitaminized silages are potential resource to be used in bovine diets.30. summer 9.

edu/pdffiles/AN/AN28000. Serbia.M. Bakr A. Humblot P.A. Vét. Kaewlamun W..F. Novi Sad.. Hersom M. Ponter A. Journal of Animal and Veterinary Advances. Kamalak A.J. 13. Miyamoto A.. Demirel R.. 165. Steenfeldt S. 6 (12). Annals of Agricultural Science.. Abdallah M. Sredanović S.pdf 6.. Hammershøj M. 2010.. 1450-1452.. 9. Horrocks R. 90: 1163–1171.. Academic Press. Anim. 2011. EC: Regulation No 1804/1999 from European Commission. Christensen J. Sentürk Demirel D. Okouyi M. K. 2010. 426... Kawashima T.. metabolites and hormones in newborn calves. Animal Food Science and Technology. Vallentine J. African Journal of Agricultural Research. 21.. 42 (3) 121-131.: Effects of a dietary supplement of β-carotene given during the dry period on milk production and. Doane R. Wiggins L. 2002. 72. Techakumphu M. Revue Méd. Djordjević N.: Effect of β-carotene supply during close-up dry period on the onset of first postpartum luteal activity in dairy cows. Anim. 72. Hurley W.. 7..: The quality of silages from lucerne. Vet. University of Nebraska-Lincoln Extension. Schweigert F. Turk. 235-241. Kaewlamun W. San Diego. 18. 5469-5474. Akinci C. Ponter A. 10. Darwish... Duvaux-Ponter C.J. NebGuide. 2004..M.A. J.. 5. Akdemir F.. Permin A.. 2011...: The determination of qualities in different whole-plant silages among hybrid maize cultivars.dom. and β-carotene status. Can. Duvaux-Ponter C. Nagashima S. Kida K.F.: The influence of a supplement of β-carotene given during the dry period to dairy cows on colostrums quality. 2006.: Investigation on the Possibility of Ensiling Cucurbit (Cucurbita pepo) Residues and Determination of Best Silage Formula.: Analysis of in situ ruminal digestive characteristics and nutritive value of pumpkin and carrot juice residue for ruminant feeds.441-443. Index: Beef Feeding and Nutrition. Anim.ufl.. Božičković A. whole maize plant and maize cobs prepared with various additives. Techakumphu M. 141–150. 4..Dairy Sci... 20..M.: Utilization of Cull Vegetables as Feedstuffs for Cattle. Filya I..: Effect of carrots and maize silage on colinization of hens by Ascaridia galli and Salmonella enterica servoar Enteritidis. 12.: Nutritional value upgrading of maize stalk by using Pleurotus ostreatus and Saccharomyces cerevisiae in solid state fermentation. Engberg R. Davis C. 2012. 3648. Remy D. Animal Feed Science and Technology.: Recent developments in the roles of vitamins and minerals in reproduction. 17. Dean R. J : Uptake of heavy metals by vegetable plants grown on contaminated soil and their bioavailability in the human gastrointenstinal tract. 1992. Steenfeldt S. 360-365. 1989. Y. Grassland Sci. 15. J. Sawada K. 2010. 784–804. F. 22. 16.ifas.. 163.. 14... Comparison of in vitro DM degradation of four maize silagesusing the Menke Gas Production method.First International Symposium of Veterinary Medicine – ISVM2015 4. http://edis.: Carrot/grass silage as cattle feed.. Institute of agriculture and Natural Resources. 2009. 282-287. Remy D. (2002). 146-152.. Grubić G.. J Sci Food Agric.L. Jenkins H.. 8. 57 (1) 47-51..P. Intawongse M. Reprod.. H. Kawashima C. 11.. Lević J.D. Nakashima K. Stojanović B. Enishi O.A. C.. Saruhan V. 624.. Gürbüz. C. 5. Saeki M. 23 (1). 1003-1008.M. G2036. 122 .Sci. Laflamme L. Galila A. 50. Fink M... J.. Food Additives and Contaminats. 45. Yoshioka T. Idi A.circulating hormones and metabolites in dairy cows.. Hashemi R. Okouyi M.. 31-37.A. 2007. Sci. 19. Finiaayson. supplementing regulation No 2092/91. Razzaghzadeh S..: Harvested Forages. Proceedings of XIII International Symposium Feed Technology Symposium FEDD-TO-FOOD/1st Workshop FP/REGPOT3.. 116.: Feed Value of Alternative Crops for Beef Cattle. 26.. Humblot P.. 2005. 1999. 2012. Helminthologia. 2004. Aydan F. Kidmose U..: Deposition of carotenoids in egg yolk by short-term supplement of coloured carrot (Daucus carota) varieties as forage material for egg-laying hens. 1999.: Nutritive value and aerobic stability of whole crop maize silage harvested at four stages of maturity.

30. Schweigert F.: Nutritive value of vitaminized silages. 53 (2). 37.A. Dairy Sci.K. 71. 69-84. 57. 6. 1998.edu/Link-Click. 187-192. 27. (2005) . 159: 73-85.Anim. 3112-3119.. 28.10. Responsiveness of peripheral blood polymorpho -nuclear leukocytes to vitamin A and β-carotene challenge in vitro..: Utjecaj dodatka kukuruzne silaže travnoj silaži različitih rokova košnje na ad libitum konzumaciju obroka. Mihaljev Z.S. 1–2.. Mihaljev Ž.. Nonaka K. Jensen S.. Moran J. Ital.J. 85-87.: Alpha-tocopherol and beta-carotene in roughages and milk in organic dairy herds.W. Jovičin M. 1017-1022.. 131. 1994.aspx?fileticket =KjL6uucd9Mg% 3d&tabid=537.. Tanaka T... 2003. J. Mihaljev Ž. Zucker H. Zivkov-Balos M. Proceedings of 23rd International Symposium “New Technologies in Contemporary Animal Production”. Obradović S... Tjoelker L.: Carotenoids for ruminants: From forages to dairy products.: Level of toxic elements and other mineral matters in wheat. Institute of food technology. 33. Zdziarski K. Stojanov I... 24. 2008. In Cattle Call. Nutr. 19-21.R... Poljoprivredni fakultet Novi Sad.. 2008. Vranić M. Obradović S. 32. 2013..2014. Mašić Z. 1994. Watson S. Grolier P. University of Novi Sad.. Jakšić S. Razzaghzadeh S... Kristensen T. J.First International Symposium of Veterinary Medicine – ISVM2015 23.. 1987. Biotechnology in Animal Husbandry. Djilas S. Søegaard K. Matić I. Šaric M. Safe Food.P. Daniel L. Eco-Conference 27-30 September. Livestock Science. Mljekarstvo 58. 123 . Nakui T. Buskrik D. 2011.Sci. Animal Feed Science and Technology. Živkov Baloš M. 7. (2). 53-56. Knežević M.. Nozière P. Research Bulletin of the Hokkaido Agricultural Experiment Station.P.. 312 pp.: Tropical dairy farming : feeding management for small holder dairy farmers in the humid tropics.. Prica N.: Conservative and nutritive values of carrot silage. Wilkinson J. Landlinks Press 25. 29. Mogensen L. Živkov-Baloš M.. Hashemi A.J. 44-54. 2012. Natural Toxins.. Amini-Jabakandi J. J. Proceedings II. Savremena poljoprivreda.... Rust S. – 30. Ćupić Ž.M.: Feeding of Livestock.A. Chew B. Nalecz-Tarwacka T.: Količine makro i mikroelemenata sa područja Vojvodine.. Polish Journal of Food and Nutrition Sciences..: Bovine vitamin A and β-carotene intake and lactational status. 145. 2000. Lucas A. ISBN 978-86-7994-044-5. Mihaljev Ž.J.06. 1999. 28. Doreau M. http.. Chew B.W. 591-98. 26. Dairy Sci. 1. Tanaka T. 48.2013. 1999. Michigan State University Extension Newsletter 13 (4).: Silage and animal health. Živkov-Baloš M. Karaszewska T.. New York: T.. 34. Nelson and Sons..... Jovičin M.1. Apić J. Physiol. Daniel L.: Potentials and benefits of vitaminized silages in the diet of dairy cows. 267. 575-577.: Feeding Carrots or Sugar Beets to Cattle.. 36. 418–450. Effect of dietary vitamin A and β-carotene on polymorphonuclear leukocytes and lymphocytes function in dairy cow during the early dry period.: Transport of β-carotene by the serum lipoproteins in cattle. Anim. 285–288. 2007.//beef.: Effects of different levels of Pumpkin (Cucurbita Pepo) residue silage replacement with forage part of ration on male buffalo calves fattening performance. 162–167. Tjoelker L. 73.. Shinoda M.. Graulet B. 35. XVI International Symposium „Feed technology” Novi Sad (Serbia). Sehested J. 27 (3).. 39. Živkov-Baloš M.. Mihaljev Ž. Rambech W...R (1990). Ljubojević D. 221-232. Anim. 2006.: Contnet Of Trace Elements And Some Radionuclides In Lucerne (Medicago Sativa). 38..A.. 12.S..: The influence of carrot addition to cows ration on the level of vitamins and fatty acids in cow milk... Martin B. Turčin D.. 40. 31.msu.

2012). fungi proliferate and may produce secondary metabolites well known as mycotoxins. Therefore. which get infested prior to and during harvest. handling and storage (Bryden. although more than 300 mycotoxins have been isolated and chemically characterized. milk and eggs. Bojana Prunić2 1 2 Institute of Veterinary Medicine of Serbia. recently revised directive was published in Serbia in March 2014. mycotoxins. Novi Sad. Fungi are ubiquitous and all feedstuffs can be contaminated with mycotoxins. There is a small number of toxins that are of practical relevance. can be adversely affected by mycotoxins. but the level of contamination varies with location and reflects different agronomic practices and climatic conditions. nor all secondary metabolites are toxic. Brase et al. Sandra Jakšić2. Fusarium and Penicillium. regulations Introduction Mycotoxins have globally significant human and animal health. the composition of the commodity and the conditions of harvesting. economic and international trade implications (Bryden. with possible serious effects on animal and human health. but the production of mycotoxins depends upon the fungi present. 2009). Keywords: feed safety. so more attention has to be paid to this problem. Serbia * Corresponding author: ksenija_n@yahoo. worldwide research has focused on those forms causing significant injuries to humans and animals. The major toxins produced by these three genera include: aflatoxins. The supply of meat.First International Symposium of Veterinary Medicine – ISVM2015 Invited lecture MYCOTOXICOLOGICAL ASSESSMENT OF FEED IN SERBIA IN 2014 IN THE LIGHT OF NEW LEGISLATION Ksenija Nešić1*. or during (improper) storage. The amount of 124 . 2009). Belgrade. as well as regular and comprehensive monitoring of feed as important step for struggle and control of these natural contaminants. trichothecenes. Fungi are a normal part of the microflora of standing crops and stored feeds. which dictate the fungi that are present in a farming system (Bryden. European Union and Serbian regulations treat only several mycotoxins by giving maximal permitted limits in feed and food.com Abstract Under favorable environmental conditions. The aim of this paper was to present the mycotoxicological assessment of feed in Serbia in 2014 in the light of this newly established regulation. Formation of mycotoxins is not restricted to any component of the animal feed supply chain. 2009). 2005). Serbia Scientific Veterinary Institute “Novi Sad”. This is followed by the impact on animal health and production (Shier et al. But neither all molds are toxigenic. These moulds produce many different toxic compounds but not all isolates of the same species produce toxins (Cole et al. Milica Živkov-Baloš2. fumonisins and zearalenone. the human food of animal origin. 2003. especially keeping on mind their global impact on food safety. monitoring. So there is strong need for preventive measures. ochratoxins. as well as small number that has been officially regulated. The fungal species most often encountered with intoxications belong primarily to genera Aspergillus. Here shown results indicate that mycotoxins are present more than they used to be. agronomic practices. They commonly enter the food chain through contaminated food and feed crops. when temperature and moisture are suitable. mainly cereals. Regarding feed.

The perturbations of metabolism that occur following mycotoxin ingestion may affect reproductive efficiency of both males and females (Nesic et al. as contamination of animal products with mycotoxins or their metabolic products has significant public health implications. stress. Grain may go into storage at a uniform temperature but over a period the grain mass will cool at a different rate in the centre than at the periphery. Stored grain is not static as well. and turning of the grain before or during storage as well as the respiration of insects and microorganisms in the stored grain. mycotoxins may disturb embryonic and foetal development. temperature and mechanical damage). Most mycotoxins are very stable chemically and once formed in a feedstuff will continue to contaminate that commodity and feeds manufactured from it (Bryden. Mycotoxins are immunomodulators. and biological factors (plant variety. 2012). spore load). both before and after harvest. The accumulation of mycotoxins. As a result of temperature differentials moisture migrates through the storage bin. The minimum critical levels for the growth of fungi are 70–150 g/kg moisture (depending on commodity) and 80–85% relative humidity. impaired nutrient utilisation. Available evidence suggests that tissue accumulation of aflatoxin or its metabolites is very low and that residues are excreted in a few days. However. oxygen. by geographical location. by the type of storage container and by grain handling and transport. whereas Fusarium is more likely to be found as a contaminant pre-harvest (Bryden. which may result from reduced feed intake. 2014). Temperatures at which toxin production can take place vary from 0◦ C to 35◦ C. Fusarium toxins are produced in cereal grains during high moisture conditions around harvest (Nesic et al. resulting in condensation and the provision of ideal conditions for mould growth or the development of ‘hot spots’ in localised areas. changes in feed quality or toxicity per se. depending on fungal species. aerating. 2008) and in the pregnant animal. the actual colonisation and proliferation of fungi is not clear cut but depends on the environmental and ecological circumstances and the resulting toxins will differ accordingly. it is more likely to contaminate commodities both preand post-harvest. If provided grain is dry when placed in storage. relative humidity. It is in a dynamic state and may become infested with fungi and insects. 2009). composition of substrate. The hydroxylated metabolite of aflatoxins B1. insect damage and prolonged drought conditions.First International Symposium of Veterinary Medicine – ISVM2015 toxin produced will depend on physical factors (moisture. 2002). Moreover. the animal product most likely to contain aflatoxin residues. moisture content can only rise from leaks or condensation. 2008). 125 . the amount of drying. Animals are effective toxin eliminators with milk. It is important to know the fate of mycotoxins after ingestion. whereas pre-harvest aflatoxin contamination of crops is associated with high temperatures. These examples demonstrate that although it may be convenient to describe fungi as either pre. pesticide and fungicides). the major problem associated with mycotoxin contamination of the animal feed supply chain is not acute disease episodes but reduced animal productivity. These interrelationships are affected by climatic factors such as temperature and humidity. Low level toxin ingestion may cause an array of metabolic disturbances which may or may not be accompanied by pathological change (Haschek et al. because Aspergillus can tolerate lower water activity than Fusarium. Many studies have demonstrated that mycotoxin ingestion reduced feed conversion efficiency and may reflect impaired nutrient utilisation. chemical factors (carbon dioxide. Microbial and insect growth in stored grain also results in moisture condensation and the potential development of ‘hot spots’. In this regard. aflatoxins M1 is excreted into milk from 1 to 6% of dietary intake (Fink-Gremmels. mostly immunosuppressive and it has been shown they increase the susceptibility of animals to infectious disease (CAST. 2003). transfer of aflatoxin into milk and ochratoxin A into meat have been the issues of most concern. One of the first indications of a chronic mycotoxicosis is growth depression. largely reflects climatic conditions. insects. Moisture depends mostly on water content at harvest.and post-harvest organisms.

glasnik RS. Art.glasnik RS. respectively) and R-Biopharm®. respectively (Petterrson. Germany (Ridascreen AflatoxinB1 30/15. But directive from 2010 (Sl. 4/2010). product 8110. No. with detection limits: 1.No.g. zearalenone. R5402. prescribed levels of 1. No. However. 5 µg/kg. 60 µg/kg. dairy rations with other mycotoxins. product 8331NE. 2004). 27/2014). detected concentrations of ochratoxin A were far below maximum permitted levels given in Serbian directive (Sl. Residues of other mycotoxins including zearalenone. respectively). Keeping on mind worldwide impact of these natural contaminants on feed and food safety. 4/2010).5 126 . 5905 and Ridascreen FAST T-2 toxin. trichothecenes and fumonisins are not considered to be of public health importance as only very low levels of the toxins have been found in the tissues of animals that had been fed very high levels of the toxins in experimental situations (Petterrson. liver and muscle tissue from slaughtered pigs in several European countries.4 % of 138 analysed samples were slightly positive. using commercial ELISA tests produced by Neogen®. product 8230. Art.0 µg/kg. Meterial and Methods Monitoring of the presence of mycotoxins was done performing 1315 analysis of feedstuffs and complete feed for different animal species produced in Serbia during 2014. The contents of aflatoxin B1.No.glasnik RS. R1211. may decrease the excretion of aflatoxin B1 by dairy cattle (Bryden. 2 µg/kg.glasnik RS. Both institutions perform ISO17025 accredited methods. R5502. Veratox for T-2/HT-2 toxin.0 µg/kg. 25 µg/kg. 27/2014). that is not valid since March 2014. Ridascreen FAST DON SC Art. as well as T-2/HT-2 toxin (Table 2). caution should be exercised when extrapolating or predicting tissue residues as there is presently insufficient data on which to anticipate the outcome of any field toxicosis. USA (Veratox HS for Aflatoxin B1. It has been shown that the half-life of ochratoxin A in pigs and chickens is 180–140 h and approximately 4 h. Art. Results Results of mycotoxicological examination of feed samples during the year 2014 showed low presence of ochratoxin A (Table 1). in particular ochratoxin. deoxynivalenol and T2 toxin in feed samples were determined in the Institute of Veterinary Medicine of Serbia in Belgrade and in the Scientific Veterinary Institute Novi Sad. the aim of this paper was to present the mycotoxicological assessment of feed in Serbia in 2014 in the light of actual legislation and to highlight the need for greater attention focused on the prevention. Veratox for DON. which is more strict compared with the previous one (Sl. ochratoxin A. The highest concentration of ochratoxin was detected in the mixture for poultry and it was 0. While 25. 2004).First International Symposium of Veterinary Medicine – ISVM2015 Ochratoxin A has been detected in blood. Most of the values were below the detection limits of the used ELISA protocols. 74 µg/kg and 33 µg/kg. 2012). There are some reports of synergistic effects of different mycotoxins which suggest that contamination of e. Results were compared and interpreted according to new Serbian regulation (Sl. R5302.0 mg/kg for adult pigs and poultry and 0. No. with detection limits: 1. There are significant differences among pig and poultry tissue deposition studies and this is presumably due to differences in absorption and metabolism of the toxin. kidneys. Veratox for Zearalenone. Ridascreen FAST Zearalenon. 250 µg/kg and 25 µg/kg.glasnik RS. 27/2014). Veratox for Ochratoxin.0275 mg/kg. product 8031B. Ridascreen FAST Ochatoxin A. Regarding T-2/HT-2 detection no comment could be given in respect of new regulation (Sl. as no limits are proposed here. with possible serious effects on animal and human health. product 8610. Art.

glasnik RS.003 – 0. with very few positives at the end of the year.First International Symposium of Veterinary Medicine – ISVM2015 mg/kg for young animals. T-2/HT-2 toxin in feed samples T 2 toksin Number of samples Positives [%] Poultry Pigs Cattle Corn Wheat OVERALL 38 77 5 48 1 169 39.159 mg/kg). thereby specifying limits for B1 from group of aflatoxins.002 < 0.002 0.002 0. Among 165 samples in 51.002 0.1 % of samples that exceeded limits permitted by now actual legislation (Sl.3 %).03 mg/kg.4 Range of concentrations [mg/kg] 0. Maximal content of 0.025 0. while all samples of wheat were also contaminated. pigs were strongly affected and the largest mean value was determined in feed for those animals (1.5 26.002 < 0.25 0.095 0.025 0. Both were high above determined concentrations. but there were 4.026 – 0. as well as the biggest number of inadequate samples (27.143 0.002 0.098 < 0.389 mg/kg was found in corn.0082 < 0.1 0. With regard to aflatoxin crisis in 2013.0275 0.0546 0.1 % of performed analysis with 5.25 - Table 2. special attention was paid to the presence of this group of toxins.143 Mean value [mg/kg] 0.029 – 0.glasnik RS.0084 0.0 20.8 0 26.0514 0. 27/2014).143 mg/kg among 169 samples was discovered in feed for pigs.5 0 0 0 25. Table 1. Over time more positive samples were found.242 mg/kg) and 76 % of them were found positive. During the whole year. Maximal detected concentration was found in the corn sample (12.0275 Mean value [mg/kg] 0.2 0.7 0 20. 4/2010). were changing and becoming more complex.0153 < 0.4 % of them were highly contaminated.0052 – 0. a total of 668.0585 Above permitted limits [%] - Maximum permitted level [mg/kg] - But. The largest content was quantified in the corn sample (0.8 % of samples with contamination above permitted level and all of them were for feeding pigs.0681 < 0.5 % of them certain concentrations were detected. Ochratoxin A in feed samples Type of feed Number of samples Positives [%] Poultry Pigs Cattle Corn Silage Sunflower meal Wheat OVERALL 27 62 4 39 3 1 2 138 29. by the adoption of new Directive more stringent criteria for allowable levels of aflatoxin were introduced. zearalenone and DON. 127 .003 – 0. The highest level of 2. Therefore. while the situation with aflatoxin B1 turned down. Generally. As the most sensitive species.0182 < 0.6 30.0087 Above permitted limits [%] 0 0 0 0 0 0 0 0 Maximum permitted level [mg/kg] 0. decreasing trend of recorded concentrations of aflatoxin B1 was noted. but which would be tolerable according to previous permitted limit of 0.0096 < 0.002 < 0.060 0.039 – 0.05 mg/kg (Sl.026 – 0.060 0. the results related to Fusarium toxins.25 0. Deoxynivalenol (Table 5.) was found in the highest percentage of analysed samples (64 %) and 11.0322 mg/kg) which was above regulated limit of 0. 27/2014).0 18.0037 – 0. examining feed throughout 2014. Overall results (Table 3) indicated that aflatoxin was still there in 59. Results of zearalenone analysis are presented in Table 4.25 0.glasnik RS.002 < 0.6 Range of concentrations [mg/kg] 0. the largest number of samples were examined. more than it was allowed by regulation (Sl.

0040 0 Sunflower 8 15.02* 0.389 0.0082 0.9 Lambs 23 30.0050 0 OVERALL 668 59.03 0.0034 1.01 0.0010 – 0.0 0.074 < 0.079 – 5.0065 2 Silage 14 71.074 0 meal Wheat 5 100.6 0.4 0.145 Pigs 77 48.1 0.389 0.170 – 10.243 4.792 2 Silage 12 66.309 0 Silage 8 100.0011 – 0.030 0.046 – 0.6 0. Aflatoxin B1 in feed samples Type of feed Number of samples Positives [%] Range of concentrations [mg/kg] Mean value [mg/kg] Above permitted limits [%] Poultry 189 73.0 0.0 0.0 0.03 0.0 0. Zearalenone in feed samples Type of feed Number of samples Positives [%] Range of concentrations [mg/kg] Mean value [mg/kg] Above permitted limits [%] Poultry 14 28.4 0.0322 0.0011 – 0.063 – 2.574 0.980 8.1 0.0016 0.03 - Table 4.083 0 OVERALL 165 51.3 Cattle 5 40.8 *Double permitted level: for young animals (lower level) and adult animals (higher level) Maximum permitted level [mg/kg] 0.3 Sunflower 5 0 < 0.242 1.0020 – 0.0038 0 additional mix Corn 100 37.031 – 0.0011 – 0.249 0.88 0 Corn 50 76.5* 1 6 6 4 4 - Table 5.47 0.02* 0.242 1.03 0.8 0.02* 0.168 10.9 2-5* 12 12 8 8 - .7 0.079 – 1.931 0 Pigs 66 63.083 0.0011 – 0.079 – 12.0046 8.0037 7.1 0.025 0 meal Wheat 3 33.290 – 1.005-0.091 – 12.3 0.593 0.4 *Double permitted level: for young animals (lower level) and adult animals (higher level) 128 Maximum permitted level [mg/kg] 5 0.067 – 0.9 0.1 *Double permitted level: for young animals (lower level) and adult animals (higher level) Maximum permitted level [mg/kg] 0.852 1.159 27.024 0.0322 0.First International Symposium of Veterinary Medicine – ISVM2015 Table 3.770 0.0013 0.025 < 0.4 Cattle 9 77.005-0.062 – 1.2 0.2-0.612 1.4 0.258 0 Corn 52 53.0010 – 0.0050 0.542 0.0 0.0072 0.005 0.370 – 3.005-0.774 11.0063 0 meal Wheat 2 50.377 3.7 Premix and 39 71.8 0.0 0.013 0.5 0.0048 5.0 0.494 0 Sunflower 2 0 < 0.031 – 2.9 Pigs 190 58.9 0 OVERALL 175 64.8 Cattle 103 59.0060 6.0010 – 0. Deoxynivalenol (DON) in feed samples Type of feed Number of samples Positives [%] Range of concentrations [mg/kg] Mean value [mg/kg] Above permitted limits [%] Poultry 32 53.0 0.0011 – 0.

such as decreased fertility.5 % over regulated level. one fact cannot be neglected: mycotoxins are more present than they used to be. 2010. while 70 % of dairy mixtures were positive and 47. Also. as well as detected aflatoxin concentrations (the largest content was 0. 2005). however. Although these moulds and their secondary metabolites are typical for our region. The gastrointestinal system is the target organ of this toxin. in terms of aflatoxin presence in feed. but not the problem itself.8 mg kg−1 DON is required to obtain a similar effect if pure toxin is used. which stayed captured in professional circles until the attention of broad public was drawn to the case of aflatoxin in 2013. Approaching the end of the year downward trend for this toxin had been increasingly apparent. Most of the analyses presented by Nesic and Pavlovic in early 2013.glasnik RS. But. Common clinical signs of zearalenonetoxicoses are vaginal and vulvar swelling. only 5. 2014). In practice. For example.0322 mg/kg quantified in the corn sample).9 mg/kg (Streit et al. 27/2014). while as many as 35 % exceeded the maximum permitted levels. Comparing the results shown in Table 3 it can be noted that the percentage of positive samples decreased in 2014. increased number of resorptions and reduced litter size (EFSA 2011. from animal health and production point of view their presence should not be neglected. enlargement of mammary glands and testicular atrophy. as well as other reproductive effects. whereas 1. Recent studies have demonstrated the potential for ZEA to stimulate growth of human breast cancer cells (Yu et al. 2011). or even additional mycotoxins in contaminated cereals exacerbates the management of affected animals (Döll and Dänicke. which prescribed more strict criteria for aflatoxin. 2013). the frequency of their presence and level of contamination exceeded previous data (Nesic and Pavlovic. Due to synergistic interactions co-contaminated samples might elicit adverse effects even the concentrations of the individual mycotoxins do not surpass legal guidance values. there is data that a 5% growth depression is to be expected in pigs fed naturally deoxynivalenol (DON)contaminated diets containing 0. It has only modified in accordance with the new conditions of climate and environment with lot of rain and moisture (Republic Hydrometeorological Service of Serbia. Therefore. in their present state regulations do not address co-contamination and associated risks. solely because of its presence in milk (Kos et al. the public interest in the problem of mycotoxins declined.6 mg kg−1 DON. so did not correspond to the Serbian regulation (Sl. Serbian Directive as well as the European Union’s guidance for DON in complete feed for pigs is 0.1 % were above limits permitted by new legislation (Sl. the co-occurrence of DON and ZEA. 2013). situation was quite different and very unlike years ago (Jakic-Dimic et al. As aflatoxin crisis began to subside. testing of maize and wheat during 2014. The highest percentage of contaminated samples (100%) and also the maximal concentration (0. However. 2011). Extremely hot and dry conditions followed by drought were noted during maize growing season 2012 (Republic Hydrometeorological Service of Serbia. 2014). vomiting and digestive disorders with subsequent losses of weight gain (Nesic et al. Fusarium mycotoxins: zearalenone and deoxynivalenol.5% of samples harvested in 2012 could be contributed to weather conditions favourable for mould growth and mycotoxins production (Kos et al. 2014). The economic consequences can be very serious. so aflatoxins occurrence in 68. 2012). 2013). showed in 75 % of them significant contamination. In Serbia during previous years rare or strictly experimental reports were given regarding this topic. Intoxication with deoxynivalenol (vomitoxin) is manifested by a decrease in food intake or its refusal. 2004).glasnik RS. Nesic et al.First International Symposium of Veterinary Medicine – ISVM2015 Discussion Taking into consideration all these collected data. especially in pigs as the most sensitive species.263 mg/kg) was detected in feed for piglets. Although greater number of examinations done. 4/2010). 129 . 2008). Residues of those mycotoxins are not considered to be of public health importance as only very low levels of the toxins have been found in the tissues of animals that had been fed very high levels of the toxins in experimental situations (Petterrson. showed a large percentage of positives on presence of new group. Jakic-Dimic and Nesic.

). Food Microbiol... Chichester. Berthiller F. ‘hidden’. only timely and adequate reaction is the right solution. 134– 158. Mycotoxins are a major analytical challenge because of the range of chemical compounds they represent.L. and the array of feed matrices in which they are found. 2007). it is important to establish better prevention (Nesic et al. 3529–3553. But there are other influences that can disturb the validity of the results. In: Ballantyne B. 109. 2012 Bryden W. There are a number of approaches that can be taken to minimize mycotoxin contamination in the food chain: prevention of fungal growth and therefore mycotoxin formation. Also. A “field to table” combating program against mycotoxins should involve Good Agricultural Practice. thereby increasing exposure to the precursor toxin. ‘bound’ and/or conjugated mycotoxins in feedstuffs and the potential for animals to perform poorly. Animal Feed Science and Technology. Third ed. John Wiley & Sons Ltd.: Mycotoxin contamination of the feed supply chain: Implications for animal productivity and feed security.: Chromatographic methods for the simultaneous determination of mycotoxins and their conjugates in cereals. 2003. Syversen T (Eds. As the latest laboratory results showed permanent presence of some mycotoxins and the cooccurance of few of them.: Chemistry and biology of mycotoxins and related fungal metabolites. These difficulties arise because of the uneven distribution of toxin within a commodity. special attention has to be paid to the control system and regular monitoring of cereals. Mycotoxin conjugates may be formed as a result of plant metabolism (Berthiller et al. 4.. These conjugates will be hydrolyzed following ingestion. for confirming the diagnosis of a mycotoxicosis and for monitoring mycotoxin mitigation strategies. Sulyok M. References 1. Chem. 2006). Good Manufacturing Practice. 2009 Bryden W. 119. 130 .: Mycotoxins and mycotoxicoses: significance. UK.L. Rahmani et al. It is difficult to obtain feed samples representative of what may have caused a mycotoxicosis incident or to represent large grain consignments. 2008. in which mycotoxins occur (CAST. 3903–4399.. Nising C. General and Applied Toxicology. was a major step toward developing rapid. Krska R. for risk analysis. although screening test. Schuhmacher R. Int. especially enzyme-linked immunosorbent assays (ELISA). feed and food has to be organized. 2009. occurrence and mitigation in the food chain. Sampling is the greatest source of error when quantifying mycotoxin contamination. Rev. The development of immunological methods for mycotoxin detection. Whitaker. However. Good Storage Practice and applying the seven HACCP (Hazard Analysis Critical Control Points) principles within the framework of the quality systems.. III46009 and 031071.. 173. it has recently become apparent that there is a connection between ‘masked’. 3. but are not detected by using conventional analytical procedures. Science and Technological Development of Republic of Serbia No. 2009). J. repeatable and sensitive assays. Since managing impact of these contaminants is still great practical challenge. 33–37. Quantifying these compounds requires sophisticated laboratory equipment and trained people (Krska et al. Keck J. as well as the predictive models in regard to meteorological forecasts. 2007 Brase S. 2003.. 2013).First International Symposium of Veterinary Medicine – ISVM2015 Based on the discussion above it is also important to emphasize the process of detection of mycotoxins.F. Encinas A. Analysis is essential for determining the extent of mycotoxin contamination. Marrs T. 2. strategies to reduce or eliminate mycotoxins from contaminated feedstuffs or diverting contaminated products to low risk uses. Acknowledgments This paper is published as part of the projects of the Ministry of Education. as well as Good Laboratory Practice and the methods for mycotoxin detection which must meet the highest standards..

.. 2013 Krska R. Ames. Proceedings of the International 57th Meat Industry Conference.. 2008 Petterrson H. Serbia. Academic Press.). Contam. Pravilnik o izmeni pravilnika o kvalitetu hrane za životinje 27. Handbook of Toxicological Pathology. Wearer M. Iowa.W. October 12-14.. 229.). Schatzmayr G. 2003. 139.: The Fusarium toxins deoxynivalenol (DON) and zearalenone (ZON) in animal feeding. M. Miladinović I. Proceedings of the XIV International Symposium Feed Technology. Pavlović N. 9.K. CRC Press. Mastilović J. Academic Press. 2013. Kos J. Republic Hydrometeorological Service of Serbia. 645–699. Naehrer K. 25.A.. EFSA Journal. 102. 1-191. Sinovec Z. 172–180. Agrometeoroloski uslovi u proizvodnoj 2011/2012 godini na teritoriji Republike Srbije. Belgrade. In: Haschek. Dänicke S. H.B. 31-34. 262–304. 202-251. Jarvis B.. 2003. Pravilnik o kvalitetu hrane za životinje 4..J. Janić Hajnal E. Abbas H. 13. Mycotoxins in Food. Woodhead Publishing..: Selected mycotoxins affecting animal and human health. 93.: Mycotoxins in feed for poultry. 41-46. control and detection of Fusarial toxins.: The case for monitoring Aspergillus flavus aflatoxigenicity for food safety assessment in developing countries. 228. 2004. 132– 145.... Šarić B.. June 10-12. CAST: Mycotoxins – risk in plant. Aflatoxin and Food Safety.. 38. 2014 Službeni glasnik Republike Srbije. J... 2011 EFSA: Scientific Opinion on the risks for public health related to the presence of zearalenone in food. 34. Kokić B. Voss K. CA. Contam.. M. 11. Soleimany F. Matica srpska J. Kapetanov M. 6. Rahmani A.. 2010 Streit E. 26. 2011 Fink-Gremmels J.. 124. Rousseaux.G. 2011.A. 2002. 101-120. Horn B. Turkey. Natural sciences. Proceedings of the 4th International Congress on Food and Nutrition and MycoRed 2nd Mediterranean Workshop on Mycotoxins and Toxigenic Fungi. W. 2-3. 2003 131 . 14. USA.: Mycotoxin analysis: an update.. 18. Nesic V. (Ed. 23. Istanbul. Jakic-Dimic D.. 2014 Nesic K. Food Control. vol. 16. 2013. 8.. Beasley V. Keckes J. New York. No. Wallig.. Nesic K. Crews C.. Rev.: Mycotoxins in cattle feeds and carry-over to dairy milk: a review. Savic B. Pisinov B. Resanovic R. Shier W. Döll S. 2013 Nesic K. T...Secondary Metabolites of Fusarium Fungi. 25.. E. 20. 27. Đuragić O. 1. Lević J. 19. (Eds. 7.: Qualitative and quantitative analysis of mycotoxins. Task Force Report.R. 320-323. Nesic K. Biotech. 2014.. Cambridge.: Detecting mycotoxins in agricultural commodities. 211-219. Acta Veterinaria 58. In: Abbas. 10. 2011.M. Službeni glasnik Republike Srbije. Boca Raton.: Prevention. 61–71.. (Eds.. Molinelli A.: Fusarial Toxins . 9 (6). 2009 Republic Hydrometeorological Service of Serbia. Nesic V. Council for Agricultural Science and Technology. Nesic K. Environ.. N.. Serbia.. Rev.A.: Current mycotoxicological profile of Serbian feed.First International Symposium of Veterinary Medicine – ISVM2015 5. 2012. Agrometeoroloski uslovi u proizvodnoj 2013/2014 godini na teritoriji Republike Srbije. 25.. 2013. second ed.: Efficacy of mineral and organic adsorbent in alleviating harmful effects of zearalenone on pigs performance and health. 2008 Haschek W.. Jakšić S.. animal and human systems...A. Mol.: Mycotoxin occurrence in feed and feed raw materials worldwide: Long-term analysis with special focus on Europe and Asia.K.. Compr. In: Magan.: Occurrence and estimation of aflatoxin M1 exposure in milk in Serbia. Olsen. 22.. 91-99.. 2197. Novi Sad. Food. Food Addit.. 12. 2005. Sci.T.: Natural occurrence of aflatoxins in maize harvested in Serbia during 2009–2012. 24. Food control. Sulyok M.M. Rodrigues I. Ivanovic S.B. Food Addit. 2014 Kos J. Preventive Veterinary Medicine.C. 21. Schubert-Ulrich P. I–III.: Controlling mycotoxins in animal feeds. Whitaker T.). 23.: Handbook of Secondary Fungal Metabolites. 291–311. Cole R. 2010 Jakic-Dimic D. 152–163. 28. Contam. 248-253. Food Sci. 2892–2899.. 2008 Nesic K.: Presence of fungi in poultry feed and effects of contaminants on health status. Jinap S. Vols. Food Agric. Scheweikert M. 15.. 17. McDonald S.

First International Symposium of Veterinary Medicine – ISVM2015 29.B. Ecotoxicol. 2006 30.. Zhang L. Whitaker T.. Yu Z. Environ.: Anti-apoptotic action of zearalenone in MCF-7 cells. Liu F. Wu D.. 441–446. 62. 2005 132 .: Sampling foods for mycotoxins. 23. Saf. Contam.. Food Addit. 50–61.

2007).69  0. Chicken meat is the fastest growing component of global meat demand. It may be concluded that. our results suggest that poultry meat quality is a complex and multivariate property. Mirjana Lukić1 1 2 Institute of Meat Hygiene and Technology. Content of total iron (Fe) did not differ significantly between meat samples. especially polyunsaturated fatty acids (PUFA).10 MAL/kg. commercial chicken meat is known to be deficient in n-3 FA and rich in n-6 FA. where the predominant FAs was MUFA. chicken lipids are characterised by relatively high levels of unsaturated fatty acids. including cooking loss.52  1. however.99 to 4. Ljubljana. respectively). which is affected by multiple interacting factors. the diet was comprised mainly of polyunsaturated FA (PUFA) then monounsaturated FA (MUFA) and saturated FA (SFA) (100:47:27%) versus drumstick and breast muscle.First International Symposium of Veterinary Medicine – ISVM2015 EFFECTS OF FED DIETS WITH A DIFFERENT N-6/N-3 PUFAS RATIO ON OXIDATIVE STABILITY. Therefore.49  1. respectively). The physicochemical properties.27 to 8. Dejana Trbović1. the higher n-6/n-3 PUFAs ratio in meat adversely affected the oxidative stability as manifested by the significantly higher TBA concentrations in heat-processed breast and drumstick meat (4. Comparing FAs composition in diet with drumstick and breast muscle. and treatment group (farms and diets) by at most 5%. physicochemical properties and oxidative stability. as it is preferred over other meat for its health appeal because of its nutritional value.com Abstract The objective of this study was to determine the fatty acid (FA) profile. 13. higher n-6/n-3 PUFAs ratio in the diets improved the FAs ratio in the meat samples. AND PHYSICO-CHEMICAL PROPERTIES OF CHICKENS MEAT Dragan Milićević1*.06  0.63  0.87  1.93 to 5. where consumers are becoming more demanding in relation to food products. Belgrade.88 MAL/kg.40 and 12. Breda Jakovac-Strajn2. In Serbia the consumption of chicken meat is higher compared to other meats. 12.08 to 5.85. lipids and thiobarbituric acid (TBA) in raw and heat-processed breast and drumstick meat samples. Republic of Serbia Faculty of Veterinary Medicine University of Ljubljana. pH. The farm treatments modify significantly growth performance and feed intake of the broilers between farms. which are considered as a positive and healthy aspect by consumers (Bonoli et al. Introduction Effect of diet on human health is a major problem not only in developing countries but also in highly industrialized countries.91. Generally. respectively). Zoran Petrović1.19 and 3. measured by the thiobarbituric acid (TBA) and physicochemical properties of raw and heatprocessed meat of chickens fed with a different n-6/n-3 PUFAs ratio (14. the quality characteristics of the chicken meat. color. although the proportion of FAs with four or more double bonds was metabolized specific. From 133 . However. 2010). but also its taste and appearance (Bogosavljevic-Boskovic et al. all parameters measured were influenced by the interaction of growth performances. The chickens were fed ad libitum on commercial diets for growing broilers which contained different feed ingredients. differed significantly. oxidative stability of lipids. Compared to other meats. Republic of Slovenia * * Corresponding author: dragan@inmesbgd. Nenad Parunović1. compared with those of the group where are low n-6/n-3 PUFAs ratio in meat samples (2.38. Keywords: chicken meat.53  0. in comparison to SFA and PUFA (100:78:55%).. Samples of breast and thigh muscles of broilers equal to 48 from two farms (Farm I and Farm II) were taken during 2012. Ivan Nastasijević1.46  0.. resulting from the different dietary ingredient (particularly soybean meal and sunflower oil).44 and 5.

diabetes. pectoralis major) and thigh meat with skin (Mm. balancing n-3 FA. Cooking loss determined as percentage of weight 134 . and in general causes shelf-life quality deterioration in meat (Bou et al. the lipid fraction has the highest susceptibility to modification. it is important to have low saturated fat and adequate amount of PUFA preferably less n-6 FA. The modern human diet is deficient in n-3 FAs. AG. separated and weighed (Table 1). redness (a*) and yellowness (b*) was measured by reflectance colorimeter using illuminant source D. 12 birds selected on the basis of live weight within as wide range as possible. Japan). while pH value was measured 24 h postmortem. Sample preparation At the age of 39 day.) had been recorded at weekly intervals. Therefore. 2009). Then the samples were equilibrated to room temperature and reweighed.. were slaughtered at a commercial abattoir.. measured by the thiobarbituric acid (TBA) and physicochemical properties of raw and heat-processed meat of chickens fed with a different n6/n-3 PUFAs ratio and a possible interaction between these factors. arthritis. 1994). Decreasing the n6/n-3 FA ratio in chickens is important in order to make chicken meat a functional food (Rondelli et al. The CIE system color profile of lightness (L*). the increasing amount of PUFA content in poultry diets could increase the degree of broilers fat unsaturation and probably the rate of tissue lipid peroxidation. After slaughtering and dressing. which reflects the so-called thiobarbituric acid reactive substance (TBA) value of broilers tissue (Cherian et al. Feed conversion ratio corrected for mortality was then calculated (Table 1). As a result. However. which has been linked to the increase in several degenerative diseases such as cardiovascular disease.w. The colorimeter was calibrated throughout the experiment using a standard white ceramic tile. 2004). cancer and mental illness (Nichols et al. 2011).. Germany) along with a temperature probe into the cranial part of each left breast sample. Feed gain and body weight (b. by inserting a portable pH meter (Testo 205. Therefore it is important to enrich chicken meat with n-3 FA and lower the saturated and n-6 FA content. Lipid oxidation is responsible for the production of undesirable compounds (from both a toxic and sensory point of view) which is of significant importance in consumer purchase decisions for fresh meat (Risvik. Material and Methods Animals and diets A total number of 48 samples of breast and thigh meat were taken from chilled broiler carcasses collected during 2012. Of all the meat constituents. Analyses Meat color was evaluated immediately after deboning using colorimeter (Minolta Chroma Meter RC-400.First International Symposium of Veterinary Medicine – ISVM2015 the human health point of view. All diets were formulated to meet the minimum requirements for broilers and were proved as mash feed. and fed ad libitum commercial diets for growing broilers with different ingredients (Table 2). Color was measured on skin side surface of each left breast in area free of obvious color defect.. the hot carcasses were chilled for 2 h at 4°C .The breast with skin (Mm. bruises and blood spots. feeding strategies have been adopted to alter lipid composition of broilers meat (Kouba and Mourot. oxidative stability of lipids. of regio tibio-femoralis) were cut. in contrast to protein with aminoacidic composition determined by the genetic code. Two homogeneous groups of male and female (50%:50%) Ross 508 and Hubbard broilers were reared under commercial conditions on two farms in Vojvodina in the northern part of Serbia. 2010). The carcasses were weighed and refrigerated for 24 h. 1996). For determine cooking loss whole samples of both muscles (about 20 g) were placed in open aluminium pans and roasted in an electric oven pre-heated to 220°C for 30 min. the present study was conducted to determine the fatty acid (FA) profile.

USA) following the methods described by Jorhem (2000). (1964) and Holland (1971). in order to determine statistical differences among examined parameters between farms (P < 0. The average TBA values in drumstick and breast muscle in other group varied between 0. Although the proportion of FAs with four or more double bonds was metabolized specific. average daily feed intake (103.25 M trimethylsulfonium hydroxide . and drumstick weights were different among the groups of broilers. except in the treatment group were is sunflower oil added in diets in 4. Thiobarbituric acid (TBA) was determined according to the method proposed by Tarladgis et al. Total lipid content was determined by extraction of fat by petroleum ether and Soxhlet extractor after acid hydrolysis of the samples (SRPS ISO.41 g) were in chickens from Farm I in the autumn. color. the diet was comprised mainly of PUFA then MUFA or SFA (100:47:27 %) versus drumstick and breast muscle. both in breast and drumstick muscle.01:1 and 20. Total lipids were extracted from the diet.38. J&W Scientific. particularly soybean meal and sunflower oil.25 mm × 0. ANOVA with Tukey's test was performed. Physicochemical properties. carcass. FAs rations and TBA values in broiler meat Physicochemical properties. respectively). including cooking loss.40 and 12.83 g). Content of total Fe did not differ significantly between samples. 13. Average live weight. Statistical analysis Data from the experiment was analysed by descriptive statistics (mean. breast. pH. These results indicated that n-6/n-3 PUFAs ratio in broiler meat large in magnitude.09 MAL/kg.04 and 0. n-6/n-3 PUFAs ratio were different (14. Determinations of Fe in meat samples were performed by flame atomic absorption spectrophotometry (Analyst 300. differed significantly between treatment group. standard deviation. Japan) equipped with flame ionization detector and capillary HP-88 column (100 m × 0.001). In regard to fatty acids content.20μm. Comparing FAs composition in diet with drumstick and breast muscle. and range). was significantly different (P<0. breast (647.001) lower than those from the other treatment group. Despite the different diet compositions.87  227. and drumstick weights (536. Results Growth performance of the broilers The Growth performances of broilers fed various dietary and composition of the commercial broiler diets which were used for feeding chicks.95  78.45 % (100:71-96:3751 %).85. the n-6/n-3 PUFAs ratio in breast and drumstick muscle samples was higher in broilers fed with higher level of the sunflower oil and the soybean meal (29. FAs rations and oxidative status of raw broiler meat are shown in Table 3 and Figs 1 and 2.84:1 respectively).40  88.9 g) and carcass (1764. thigh and breast muscle samples and further converted to fatty acid methyl esters (FAMEs) (0. The average TBA values in drumstick and breast muscle (0.70 g). 12. At the same age. are shown in Tables 1 and 2. in comparison to SFA and PUFA (100:66-77:5670 %).067 to 0.05). daily gain. Total lipid was determined in raw and roasted breast and thigh meat with skin.First International Symposium of Veterinary Medicine – ISVM2015 lost during cooking. USA).TMSH in methanol as the methylating agent). 1992). TBA content was expressed as mg of malondialdehyde per kg of meat (mg MAL/kg). nutritive values were similar during the investigation (Table 2).91. FAMEs were determined by capillary gas chromatography on GC Shimadzu 2010 (Kyoto. The physicochemical properties. the highest average daily body gains (57 g).02 mg MAL/kg. where the predominant FAs was MUFA. lipids and thiobarbituric acid (TBA) in raw and heat-processed breast and drumstick meat samples. respectively) in treatment group Ib was significantly (P<0. 135 . Perkin Elmer. resulting from the different dietary ingredient.

SFA .14 0.0 16.68 1.19 (316.88 PUFA 57.60 3.1 57.77 55.53 27.31 n-6/n-3 15.23 11.25 51.03 56.1 2.62 2.1486.572.02 (1021.73 0.24 20.10 0.05 16.49 3.6 16.9 1.42 3.65 13.36 0. II .60 0.60 0.01 (1186 .87 ± 227.50 0. b .15 1.92 53.95 15.82 22.04 5.28 0.0 6.73 11.65 14.7) 470.6 .45 13.71 0.13 0.47 52.472.50 0.17 3.67 3.7) Ib (n = 12) 39 57 100.91 13.03 0.10 0.70 0.65 1.10 0. DL Meth–DL .2 IIa 55.0 6.85 PUFA/SFA 3.4 55.775.75 4.21 52.08 0.81 0.83 28.79 28.88 0. b .30 0.40 29.12 0.65 12.0 6.614.65 1.00 13. n .soybean meal.50 0.10 0.2 56.2 .32 6.67 1. CG .75 1.56 3.0 3.0 6.44 Ca 0.13 0. 60% 0.0 27.98 12.05 3.547.76 1764.25 19.27 0.2 58.0 2.65 3.61 13.85 27.63 5. SbM .83 16.05 0.11 0.wheat grain.95 6.15 0.8 .11 DL-Meth.50 0.52 5.38 14.50 0.46 22.28 0. Range) Farm Parameter (range) a Age at slaughter (d) Average daily body gain (g) Average daily feed intake (g) Feed gain (g:g) Carcass weight (g) Breast weight (g) Thigh weight (g) I (n = 12) 38 57 103.27 0.89 ± 51.7 16.9 27.45 13.58 0.6 53.corn gluten.494) a II (n = 12) 38 39 84.78 ± 48.06 IIb 49.4 29.68 Fat 4.83 14.2226.8 (46% CP) SbM 15 33.66 1.83 (1498.4 23.41 (443.84 53.8 Ib 55.55 1.24 0.628) 389.45 I.4) 427.03 0.8 .70 (510 .sunflower oil.70 0.82 1279.0 10 10 SfM 3.80 5.15 Treonine 0.29 3.60 31.1 IIa 55.1 20.58 3. II .65 1.farms.75 1.50 13.30 4.38 (1055 .38 d) Ia 61.62 ± 61.4 55.02 0.77 SFA ME (MJ/kg) 12.60 0.61 3.12 0.06 15.88 1.5 2.46 11. MUFA .53 56.1) 476.12 19.07 0.53 57.82 Water 11.68 0.27 3.20 (398.summer.60 29.72 1.14 3.60 0.38 3.1712.10 VMP 0.93 14.1681.45 Grover (16 .2) 392.06 Ch.61 1.33 49.17 (339 .4 2. Ch .0 2.32 d) Farm a a I II Ib IIb 56.summer.53 4.16 1223.86 0.vitamin + mineral premix.saturated FA.5 ± 80.8 15.51 1.12 Ib 50.40 ± 88.30 11.71 18.7.56 4.2) 452.1) 536.38 12.3 14.36 3.monounsaturated FA .15 (393.8 MUFA 27.0 6.29 0.62 15.4) I.45 L-Lysine 0.5 CG 2.60 4.61 3.10 0.40 12.65 1.15 0.16 0.09 29.autumn/winter Table 2.62 3.83 16.70 ± 130.74 1.03 39.50 1.07 10.04 1400. 0.4 .5 (44% CP) Wg 3.77 1.48 5.12 55.13 0.69 4.40 12.00 13.0 6.39 20.05 0. PUFA .19 10.15 0.95 0.10 14.10 0.64 0.45 3.72 4.08 49.00 13. a .92 52.0 SfO 1.22 3.66 3.14 0.45 4.63 2.15 0.49 3.73 3.First International Symposium of Veterinary Medicine – ISVM2015 Table 1.75 SbM 34.79 10. a .methionine.number of samples.63 Sums of fatty acids SFA 15.0 20.farms.9 ± 39.38 n-3 3.8 IIb 52.62 18.3 16.20 Ash 5.32 5.8 18 30.74 0.5 24.10 6.44 (337.78 0.45 50.98 5.72 1.45±174.45 3.9 25.69 10.14 0.65 2.60 0.73 0.58 MUFA/ 1.71 1.3 ± 116.65 12.69 1.polyunsaturated FA 136 .17 0.57 Crude fibre 1.6 26.2 25.sunflower meal.79 1.0 (33% CP) Yeasts 1.73 1.87 51.1 . Composition and main characteristics of the commercial broiler diet Ingredients/ Amount (%) Corn Starter (0 .83 19.13 0.9 30.0 10.05 0.86 0.61 5.60 0.95 ± 78.81 0.57 1.03 0.90 6. SfM .07 n-6 53.48 53.02 0.50 Chemical composition (%) Crude protein 22.82 0.74 1. SfO .81 Available P 0.98 4.21 4.autumn/winter.62 4.11 0.6 Finisher (33 . Wg .20 (354 .4 4.10 0.32 22. Growth performances of broilers fed various dietary ( X ± Sd.choline.00 13.33 2.88 4.92 4.48 4.01 57.45 13.7) 647.11 11.28 0.70 ± 53.5% 0.95 27.17 53.15 d) Ia 55.34 1. VMP .703) IIb (n = 12) 38 52 106.8 34.65 12.

88 (mg MAL/kg) in autumn.31 * (3.01-6.10) 8.60) 6.72  2.47  0.46 (6.00-9.71  1.40  0.51  0.18) 9.07 %) than samples from Farm I in breast (6.76-2.57 (1.45  0.08  0.36) 2.64 *** raw Lipids (8.69 (7. where the average TBA values in samples of heat-processed breast muscle was 2.61  0.20  1.27-11.89  0.01-1.20 *** (5.48) 4.00-11.91) 5. compared to those from the Farm Ib.20-6.04-4.07  0.14 *** (5. Heat-processed broiler meat (Table 3) belonging to chickens from Farm II contained lower quantities of total lipids in breast (3.63  0.10  1.70  2.45 *** (4.09  0.08  0.07-9.42-4.70 *** (0.16  2.04-0.05  1.10) 7.00) 0. Chemical composition and physicochemical properties of raw and heat-processed breast and drumstick meat Treatment group Parametar Breast Ia Ib IIa IIb 36.63) 5.28 (mg MAL/kg) in summer to 8.30-5.61 *** (5.60-34.98 *** (8.37 (25.04  0.41-1.65) 7.16) 29.62-6.067  0.94-63.02 ** raw (0.12  0.11) 2.34 *** (5.15) 3.95 *** (12.69  3. ** P < 0.58 ** (24.72%) and drumstick (10. *** p  0.71  0.001) TBA values was found in the muscle from the Farm II.77) 8.67  3.09) 32.77 *** (1.55) 0.34) 58.14-2.90 ** (51.94-62.91  1.10) 4.82  2.05) 2.60  2.99 (mg MAL/kg) in drumstick muscle.42 * (3.70 ** (48.00-7.92) 3.30-66.44  0.54) 4.49 ± 1.38-6.54 to 11.11) 0.00) 0.26  3.012 *** (0.70-60.21 *** (54.98 (6.21-6.22 *** (49.83  1.96-36.40  0.26 *** (5.72  0.37 (2.12) 56.39) 5.71) 58.47-11.64) 0.11-14.70) 10.54-61.50-6.78) -0.78) 6.88  1.78-8.11 *** (5.08) 1.71) 4.32-40.77 *** (1.59-5.80-5.71 * (52.11  1.90  0.15 *** (2.10 ** (29.10 *** (1.001).10  3.74) 5. A higher (P  0.00  0.58 *** (49.17 *** (6.11) 2.036 *** (0.004-0.37 ** (0.087  0.93  1.06  2.25) 52.06-33.77 *** (1.78*** (5.51 ** (0.80 *** (24.63 ± 0.45  0.26-7.19  1.01-56.001) could be 137 .67  2.86) 5.93  2.00-15.87 *** L* (54.09 *** (6.99) 5.15-6.20 ** (53.18-10.06) 33.24) 5.02  0.05 *** (0.014 *** (0.26) 11.03-10.03-0.10) 57.05-0.18 *** (5.012 *** (0.90) 2.31  1.34  0.08 (mg MAL/kg) and 3.54  0.50) TBA (mg MAL/kg) 0.73-36.12) Cooking loss (%) L* a* b* pH 24 Fe total (mg/kg) Lipids (%) raw heatprocessed TBA (mg MAL/kg) raw Drumstick Cooking loss (%) The concentrations of total lipid and TBA values in heat-processed broiler meat are shown in Table 3 and Figure 3.04-32.00) 0.25 *** (6.08  3.44-4.08 to 6.07 *** (1.36-8.06 ± 0.62) 6.001 29.83) 58.10-4.91-62.36) 4.47 *** (2.000-0.76 *** (-1.84  0.79 *** (0.46  0.34  4.00-15.07  2.20) 6.55) 6.73 *** (25.29) 13.05-0. TBA values as a measure of lipid oxidation in heatprocessed breast and drumstick chicken meat are shown in Figure 3.86) 53.15) 4.57-6.58-39.06  1.40  1.20  0.30  0.01.22 *** (4.42  1.44-7.03-0.34) 9.First International Symposium of Veterinary Medicine – ISVM2015 Table 3.36) 58.11 *** (1.90-4.02-6.94  0.41 Fe total (mg/kg) (6.60  2.92 * (-0.62-5.95 ** b* (2.67 * a* (1.74) 7.68) 8.78-41.33-5. These differences (p < 0. The average TBA values in samples of heatprocessed drumstick muscle of chickens from Farm II ranged from 5.37  0.73%).086  0.26  0.18-3.05.81) (%) heat14.14) 3.12) * P < 0.11-5.24) 29.47) 3.018  0.67.00) 0.85  1.25 %) and drumstick (13.70 *** (33.55) 5.64-2.172  0.84) 3.064 * (0.30-4.66-60.17) 31.76) 4.04 *** (8.01 *** (0.55 (3.29 *** pH 24 (5.37 to 14.61*** (3.155*** (3.12-15.96  3.25-3.70-6.57  0.33) 1.53  0.86  1.57 to 3.03) 35.18 *** (30.55 *** processed (14.82) 0.22*** (10.07-0.90) 0.10-7.48 * (23.25  0.32-3.73  0.87 ± 1.*** (0. These differences were significant (P < 0.79) 3.08-11.

1. Because of inclusion of grain. which 138 .First International Symposium of Veterinary Medicine – ISVM2015 attributed to initial higher level of TBA values in samples from farm II. as well as high n-6/n-3 PUFAs ratio in breast and drumstick muscle. The fatty acid (FAs) rations (% of total fatty acids) in raw breast (B) and raw drumstick (D) meat from farms I and II during summer (a) and autumn (b) fed dissimilar diets 40 12 A 35 (mg MAL/kg) n-6/n-3 30 25 20 12 B 10 10 8 8 6 6 4 4 2 2 15 10 B (I a) D (I a) B (I b) D (I b) B (II a) D (II a) B (II b) D (II b) B (Ia) D (Ia) B (Ib) D (Ib) B (IIa) D (IIa) B (IIb) D (IIb) Fig.(A) n-6/n-3 PUFA ratio in raw breast (B) and raw drumstick (D) meat from farms I and II during summer (a) and autumn (b) fed dissimilar diets (B) Malondialdehyde (mg MAL/kg) content in heatprocessed breast (B) and drumstick (D) meat with skin from farms I and II during summer (a) and autumn (b) Discussion In the present study. 2. physicochemical properties and oxidative status of raw and heat-processed breast and drumstick meat. and treatment group (farms and diets). the quality characteristics of the chicken meat. The results of the study indicate that all parameters measured were influenced by the interaction of growth performances. corn. plant seeds or oils. on the fatty acid (FA) profile. we analyzed the effect of diets with a different n-6/n-3 PUFAs ratio resulting from the different dietary ingredient (particularly soybean meal and sunflower oil). 100% PUFA 90% MUFA 80% SFA 70% 60% 50% 40% 30% 20% 10% 0% B (Ia) D (Ia) B (Ib) D (Ib) B (IIa) D (IIa) B (IIb) D (IIb) Fig.

versus 18.76 to 1. Several studies have reported.. 1998). In the case of meat. 1980.. Saturated FA are less rapidly incorporated into micelles than polyunsaturated FA because of their non. poultry meat of different kinds generally has as high n-6/n-3 ratio as pork and higher than beef and lamb. whereas the P/S ratio is closer to 1. while it should remain in the 1:1–1:4 range (Lands.0 (Li et al.. (1999) suggested that poultry leg and breast contain significant concentrations of haemoglobin. 2005). the biochemical processes that turn the muscle into meat allow haemoproteins to control the lipoperoxidative processes that definitively accelerate the deterioration of the meat (Alayash et al. In typical Western diets.. These data show much worse production parameters for broilers at Farm II compared with Farm I. 2005). The increase in the TBA content in heat-processed breast and drumstick meat noted in the present study. and b* (data not presented).97 in breast and 0. 2004) and heat-processed meat (Eder et. Bianchi et al.37%. In fact. 1999).39 to 0. For example. 2000). The performance of the birds was not within the expected range of the breed standard (Aviagen. recommended by an international panel of lipids experts. which consequently 139 . The ideal dietary n-6/n-3 PUFA ratio. which makes them rely on an adequate presence of bile salts for efficient emulsification (Polin et al.04 in drumstick). 0. the ideal n-6/n-3 PUFA ratio was not achieved and was far from recommended.. composition. data not presented). an increase in n-6/n -3 PUFA ratio in meat was followed by an increase in the concentrations of lipid oxidation products (measured as TBA content) or cholesterol oxidation products. when the animals are slaughtered. and fatty acid composition. reported that the absorption of long chain SFA is limited by their incorporation rate into micelles.01:1 in breast meat. 2006: Cortinas et al.24 mg/g.. is approximately 2:1 (Simopoulos et al.0 (0. Dänicke. it was noted that production parameters for broilers from the farms were very different. In regarding to diferences between FAs composition in diet with thigh and breast muscle. In addition. it has been found that the haeme group (contains iron. Concerning results in the present studies. Similar results have been reported by Vasavada et al.08:1 to 20. the results in this study supported the hypothesis that chicks can better assimilate FAs from fat sources that are rich in UFA than from fats that are rich in SFA (Smits et al. 2001). Kranen et al. High n-6/n-3 PUFA ratio corresponded to low P/S ratio in samples originating grom farm II.polarity. the n-6/n-3 PUFA ratio is high. A lower dietary n-6/n-3 PUFA ratio provides health benefits to consumers. Concerning the differences in the MAL levels in meat between farms and season it is important to emphasise that this differences can be attributed to the differences in the type of ingredient added to feeds. this result suggests that dietary lipid source or n-6/n-3 PUFA ratio did not influence its color characterized in scale L*. Also. Fe) present in some proteins would have an important catalytic effect in the oxidative decomposition of PUFA. the main source of dietary fat. determine the absolute MAL levels after cooking.First International Symposium of Veterinary Medicine – ISVM2015 are rich in C18:2. P/S ratio is better in samples originating from farm I then from farm II.a*. probably due to the problems induced by microbiological factors (high mortality rate – 28. and so the study did not reflect commercial performance.. particularly corn. It is important to point out the role that haemoglobin can perform in the beginning of lipoperoxidative process. al. (2009) reported that dietary use of vegetable oils produced darker and a higher yellowness of breast meat than animal fats. However. Friedman and Nylund (1980). These results are in contrast to those observed in our study where P/S ratio was below of 1. the results (Fig. The TBA test is a sensitive and useful method for monitoring lipid oxidation in many systems and under a wide variety of conditions. soybean meal and sunflower oil.84:1 in drumstick meat. 2006).67 mg/g and 0. respectively and in consequence. 2001). which strongly depend on fat content. both in raw meat (Zanini et al. was accompanied by a higher proportion n-6/n -3 PUFA ratio in the total FA pool. (2006). ranging between 10:1 and 30:1 (Hibbeln et al.1:1 to 29. ranged from 14... 2B) revealed that the initial MAL levels in meat. 2007). In the present experiment.

Cavani C.F.: Chemical composition of chicken meat produced in extensive indoor and free range rearing systems. Wolfe F.. Guardiola F. measured by the thiobarbituric acid (TBA) in the meat cuts obtained from chickens from the conventional commercial rearing system. From the results of the present study..: Dietary strategies to improve nutritional value. Poultry Science. Food Chemistry. oxidative stability of lipids. Djermanovic V.: The influence of dietary lipid source on quality characteristics of raw and processed chicken meat. However. and sensory properties of poultry products... Codony R. Bonoli M. Conclusion This study contributes an update to the literature data about fatty acid (FA) profile. Lercker G. Results from the current study can be used as a feeding strategy in order to improve poultry production. 423–431. Bogosavljevic-Boskovic S.. Mitrovic S.E. Science and Technological Development of the Republic of Serbia. 284–289. 71 . Philip. Bianchi M.. Rodriguez-Estrada M. 2009 7. 2001 2. European Food Research and Technology.. Alayash A.. 49.: Ross 308 Broiler Performance Objectives June 2007.com/ss/assets/Tech_Center/Ross_Broiler/Ross_308_Broiler_Performance_Objectives. and oxidative stability. higher n-6/n-3 PUFAs ratio in the diets improved the FAs ratio in the meat samples. References 1. Djokovic R. 2007 3.. W. and better slaughtering practices. 1327–1337.P. 800–822. it can be concluded that. 75.: Fatty acids Long-chain fatty acids and inflammation. Therefore. 313-327. Aviagen. Antioxidants & Redox Signalling.: Redox reactions of hemoglobin and myoglobin: Biological and toxicological implications. Tres A. Petracci M. to explain some discrepancy in obtained results with other authors. funded by the Ministry of Education. In addition.F. 2009 4. 2007 6.I. 2012). Patel R. PUFA are important constituents of the phospholipids of the membranes of inflammatory cells..: Effect of feeding fat sources on the quality and composition of lipids of precooked ready-to-eat fried chicken patties. 101. 229. the utilisation of animal feed fortified in some nutrients. 2010 5. 3. Critical Reviews in Food Science and Nutritio.. S.: Dietary oils and added tocopherols: effects on egg or tissue tocopherols. Doskovic V.. 2339–2348. cells involved in the inflammatory response are typically rich in the n-6 fatty acid. Caboni M..T. Decker E.A. 2012 8. Cherian G. fatty acids.. Calder C. 9069–9075.. further studies should be encouraged to evaluate the nutritive value of chicken meat produced through new and alternative rearing systems. which currently also contribute to the variability of the nutrient composition of meat. Proceedings of the Nutrition Society. Bou R. Caboni M... and Cashon R. Ferioli F. http://aviagen. TR 31008. linked to possible microbiological factor which could induce worst production results. African Journal of Biotechnology. and physicochemical properties of the meat. Acknowledgements This study was supported by the projects no. the higher n-6/n-3 PUFAs ratio in meat adversely affected the oxidative stability as manifested by the significantly higher TBA concentrations in heat-processed breast and drumstick meat.pdf . Typically these contain a relatively high proportion of the n-6 PUFA (Calder. Mexico on 6–8 April 2011. 1996 140 . The 5th International Immunonutrition Workshop was held at Puerto Vallarta. oxidative stability. Sim J.First International Symposium of Veterinary Medicine – ISVM2015 might alter the chemical composition.. 53.

Polin D. Pearson A. Dänicke S. Li D.. Journal of the American College of Nutrition. 171-175. Leaf A. Lambooy.C. Lipids. Poultry Science.: A review of nutritional effects on fat composition of animal products with special emphasis on n-3 polyunsaturated fatty acids. 15. Cortinas L.. 1204-1211. Wallingford. et al. Pessotti B. M. 83. 71. M. 2004 23. 487– 489.. R.. F..A.. A. J. 26.: Chemistry of the 2-thiobarbituric acid test for determination of oxidative rancidity in foods. Meso i proizvodi od mesa–Određivanje sadržaja ukupne masti. American Journal of Clinical Nutrition. E. R. Poultry Science.. Partridge. 2000 16..: Long-chain omega-3 oils-an update on sustainable sources. Van Kuppevelt T. Colnago G. L.P. II Formation of the TBA malonaldehyde complex without acid heat treatment..: Healthy intakes of n-3 and n-6 fatty acids: Estimations considering worldwide diversity. Pell K. Meat Science. 2001. Sensory properties and preferences. 5.. Jorhem L: Determination of metals in foods by atomic absorption spectrometry after dry ashing: NMKL collaborative study. Singh S. SRPS ISO 1443/1992... Nichols P. 1155–1164. and Cornforth D. 2006 141 .G. F.: Effects of different dietary lipids on the fatty acid composition of broiler abdominal fat. Salem N. Mann N.. P.Food Science and Technology. 59. Moughan P.. L. and Garcia P. 9. 2010 15.H. Blasbalg T. and Veekamp H. 437–440. 179–192.R. Journal of the Science of Food and Agriculture. Petrie J.T. 83. Lands W.. In: Bedford. Martinez O. S. Goedhart H. Journal of AOAC. 1055. 4. 1980 21.. D.. C. Journal of Food Science. Enzymes in Farm Animal Nutrition. Journal of Animal Physiology and Animal Nutrition. M.First International Symposium of Veterinary Medicine – ISVM2015 9. (Eds. 18. Hibbeln J.: The effect of bile acids and lipase on absorption of tallow in young chicks. 1971 14. E.D.heated processed and frozen meat of broiler chickens fed diets differing in the type of fat and vitamin E concentration. Veerkamp. 242–246. G..: Hemoglobin and myoglobin content in muscles of broiler chickens. Beynen A. D. 2005 12.. 2006 13. 572–585.W.: Evaluation of Antioxidant Effects of Raisin Paste in Cooked Ground Beef.).: Determination of malonaldehyde as an index of randicity of nut meats.. Journal of AOAC International. Kluge H. CABI Pub. and Chicken.N. Vasavada M. 2004 10.R.. Simopoulos A. Pork.G. 11.: Dietary fat and health: The evidence and the politics of prevention: Careful use of dietary fats can improve life and prevent disease.Concentration of cholesterol oxidation products in raw. Hirche. and Sinclair A. 717–723. Baucells M. Bastos M. Holland C.H.. 1999 24.. Villaverde C. Oxidative stability and total lipids on thing and breast meat of broiler fed diets with two fat sources and supplemented with conjugated linoleic acid. G. 1483–1493. A. 33. 83. 231–238. R. 467-476.: Interaction between cereal identity and fat quality and content in response to feed enzymes in broilers. Gru"thal G. Smits C... Biochimie.. 2000 25.. 54. LWT . J. M. 199–236. 13–17. Annals of the New York Academy of Sciences. Wing T. Kouba M. Poultry Science. 83.: Contribution of meat fat to dietary arachidonic acid. 2738–2743. 602–607.. 633–643.. 1024–1026.H.M. British Journal of Nutrition. Kranen R.: The inhibitory effect of a highly viscous carboxymethylcellulose on dietary fat digestibility in the growing chicken is dependent on the type of fat. Risvik E... 36. Fatty acid content in chicken thigh and breast as affected by dietary polyunsaturated level. et al. 93. 93.. 2011 17.. 39. 1999 18. Eder K. Tarladgis B. 2005 19. 1994 22. Nieminen L.J. 2006 28...et al. 67–77. pp. Mourot J. E.. Jr. 1998 20. Nutrients 2. Ki P. Galobart J. Rondelli S. Dugan L. C. UK. 78. Zanini S..: Workshop on the essentiality of an recommended dietary intakes for omega-6 and omega-3 fatty acids. Ng. M. 1964 27.. Brazilian Journal of Poultry Science 6. Riggs J.E. Lands W..

RTE). The main technological problem when it comes to the fish meat is that it goes bad very quickly (FAO. Rzepka et al. In this region.ns. The consumption of smoked fish in our country is lower compared to other countries in the EU. Processing of the fish meat creates adverse conditions for survival of microorganisms. and lately. it makes it more available for the consumers. safety and the lower PAHs content of a product obtained in ecological safe production of smoked common carp meat. Cirković et al. Brankica Kartalović1. which makes smoked products very popular and consumed quite often. 2007). 2015). 2013. Miroslav Ćirković1 1 Scientific Veterinary Institute “Novi Sad”. common carp. safety Introduction Production of smoked meat is common in Serbia and the region. 1995. we have to take knowing and professional care of the fish from the moment they are caught until the moment they are sold to the consumer. The product obtained in this way has not all those sensory characteristics of the products which consumers are given by craft production. chemical and microbiological analyses of the ecologically produced smoked common carp meat which were done at the Scientific veterinary institute "Novi Sad" confirm quality and safety of the product and prove that the application of gravel filter gets smoked product without the presence of carcinogenic polycyclic aromatic hydrocarbons (PAH). Serbia *Corresponding author: jelenababic@niv. Miloš Pelić1.95 (Milijasevic et al. The taste of smoked carp meat resembles the taste of other traditional smoked products and therefore affects the increase of the fish consumption in our market. The aim of this work was to prove quality. 2002. smoked fish is mostly eaten during the Christmas fastening period. 2013. gravel filter. Serbia 2 Institute of Food Technology in Novi Sad.eat meal (Ready-To-Eat. Keywords: ecological. The sensory. Approximately 15% of the fish for human consumption is available in either cold or hot variant (Stolyhwo and Sikorski.First International Symposium of Veterinary Medicine – ISVM2015 ECOLOGICALLY SAFE PRODUCTION OF SMOKED COMMON CARP MEAT Jelena Babić1*. This characteristic is mainly due to the lack of activity of the milk acid. 2015). Jelena Petrović1. The fish processing enables selling it on a much bigger market. that is. The main purpose of the smoking process is to preserve the product. Biljana Božić1.ac. the main cause of fish meat going bad. Novi Sad. In order to make the fish meat more durable (better preserved) as the product. but it shows the tendency for the significant growth. Smoked fish is considered to be a ready –to.rs Abstract Recently. 2002). bactericidical and the combined way (Cirkovic et al. In contrast to 142 . 2005). and they act in a bacteriostatic. This is partially done by drying it out and partially through the transfer of antimicrobiological compositions. Cirkovic et al. the pH value being close to the neutral value and high activity of water (aw) being higher than 0. smoking. Adelaja et al. the production of smoked common carp meat has suffered some changes in the production process that include changing production conditions. as well as adapting recipes and quality to industrial production conditions. Okanović Đorđe2. such are the phenols in smoke. The fish processing industry is not well developed in our country because for many years the amount of fish was just not enough and also because of the consumers' habits. its consumption has increased significantly in many European countries (Gallart-Jornet et al. 2010). that is. This led to selling all the fish raw (Cirkovic et al.

benzo[k]fluoranthene. 20 samples of the smoked carp meat were tested in total. These procedures imply construction of craft smokehouses and chambers that serve the same purpose.d]pyrene are classified as possible human carcinogens (group 2B) (International Agency for Research on Cancer. 2006). brining. Chemical analyses included determining of the PAH levels. chrysene. cutting off the head and gills. but naphthalene. choosing the materials with limited fat content. chemical and microbiological methods. slaughtering. the smoked carp. fishing.First International Symposium of Veterinary Medicine – ISVM2015 the times when the smoked fish meat was considered to be an item of luxury. dibenz[a. wood or cigarettes at 500-700 °C (Wenzl et al. temperature of pyrolysis. PAH) and their alkylated derivatives. Within this type of the fish products. The standard quality of the hot smoked fish meat is not easily sustainable. while group of authors Akintola et al. the duration of drying and smoking. the height of the kiln in relation to the fish. The analyses of the smoked carp meat were done at the Scientific Veterinary Institute "Novi Sad". The identification of PAHs was done with an analytical method gas chromatography–mass spectrometry (GC-MS) (Agilent 143 .2. reached 65 ° C. Some of them are proven to have carcinogenic characteristics (Stolyhwo and Sikorski. benzo[b]fluoranthene. benzo[a]pyrene (BaP) is a definite carcinogenic (group 1). The quality of the product was tested with the sensory. Recently. Material and Methods The carp fish was farmed on the fish farm „Ečka“ in Lukino Selo. followed by hot smoking using beech sawdust until the temperature in the centre of the product. packaging and storing. then drying in the smoke generator with the gravel filter for 1 h at 55 ° C. 2005). 2012). today this is a common product.3-c. exentration. raw material. The product obtained in this way has not all those sensory characteristics of the products which consumers are given by craft production. using the different types of filters (Yurchenko and Mölder.h]anthracene is probably carcinogenic (group 2A). also contains at least 100 polycyclic aromatic hydrocarbons (Polycyclic Aromatic Hydrocarbons. The fish meat contained 6% fat. and then down to the temperature of 3 ° C or less within 12 hours. benzo[a]anthracene. benzo[j]fluoranthene and indenol[1. hot smoking. washing under pressure and draining. cooling. (2013) confirmed the nutritional qualities and adequacies. It depends on the number of factors related to the fish farming. stunning. The acceptance of smoked fish in developed countries is based primarily on the sensory characteristics (Yanar et al. silver carp and trout meat is available in our country (Pavlicevic et al. which was continuously monitored. and the fish was stored at the temperature of 4 °C before it was processed. 2014). The feed with 30% protein was used for farming. 2013). 2012. washing. descaling. 2006). Essumang et al. After that we did washing under pressure and draining. The fishing was done in autumn period. After that we continued with cooling down to the temperature of 10 ° C or less within 3 hours after smoking. drying. available to the great number of people. 2005. Brining was done with a dry method with 2 % NaCl for 12 hours at room temperature. Anggraini and Yuniningsih. PAH compounds reach their maximum levels during burning of materials. consisting of hundreds of components. 2013). choosing the most adequate type of wood. It is known that the smoke. According to the latest classification of the carcinogenic PAH compounds. This carcinogenic effect needs to be minimized by technological procedures in the production of the smoked carp meat. This value was kept for 1h. Wood smoke has also been classified as definite carcinogenic (group 1) (International Agency for Research on Cancer. the temperature in the central part of the fish and finally. halving. as well as adapting recipes and quality to industrial production conditions. transport. the production of smoked common carp meat has suffered some changes in the production process that include changing production conditions.

Five sensory evaluators.83 4. Processing and Transport.52 0.67 0.99945). The coefficients of determination (r2) for the PAH standard calibration plots were pyrene (0. Sensory characteristics of the final product.99928) and flourene (0. Quantification was based on external calibration curves prepared from the standard solution of each of the PAHs.18 μg/kg). microbiological and sensory tests confirm the quality and safety of the smoked carp meat processed in this ecological way. The obtained results of chemical.13 μg/kg). Microbiological analyses were done according to the current Regulation (Regulation on General and Special Conditions of Hygiene of Food at any Stage of Production. naphtalene (61. based on comparison of the retention times of the peaks and target ions with those obtained from standard mixture of PAHs (standards supplied by instrument manufacturer).93μg/kg).99975). acenaphthylene (60.60 0.86 0. indenol[1.76 0. The most important thing is that PAHs from the groups 1. benzo[k]fluoranthene (0.2. Figure 1.51 4. fluorene (50. were determined in a quantitative-descriptive test (SRPS EN ISO 6658/2002).56 μg/kg).60 μg/kg.99963). Results The total PAHs concentration in ecological smoked common carp meat was 279. at the interval scale ranging from 1 to 5. “the Official Gazette SRJ” 72/2010) by determining/detecting Listeria monocytogenes (SRPS EN ISO 11290-1/2010) in the final product.81 8.99999). benzo[b]fluoranthene (0.97 μg/kg). 2012) were not detected in the samples.3-c.First International Symposium of Veterinary Medicine – ISVM2015 7890B/5977A MSD).82 X Discussion and Conclusion Many studies done on animals have shown that dietary intake of BaP causes increased levels of tumors.13 4. acenaphthylene (0. acenaphtene (8.66μg/kg ).13 10. 2A i 2B (International Agency for Research on Cancer.49 0. benzo[a]anthracene (0.67 4. acenaphthylene (0. The results of the sensory marks of the ecologically smoked carp meat Sensory characteristics Appearance Colour Smell Colour at the intersection Texture Taste Sd CV% 4.99926). the smoked carp meat. The reference method for determining the presence of Listeria monocytogenes (SRPS EN ISO 11290-1/2010) did not reveal any of its presence in all the samples. pyrene (3. The results of the sensory characteristics of the smoked carp meat are shown in Figure 1. were giving marks in sensory characteristics.66 13.33 μg/kg). Maximal concentrations of PAHs detected in the final product are: fluoranthen (63.99950).58 μg/kg).30 11.14 14.d]pyrene (0. 2001). fluoranthene (7. anthracene (21. who had passed the sensory evaluation training in detecting and recognizing smells (SRPS ISO 5496/2002) and whose senses had previously been tested using the test for determining the sense of taste (SRPS ISO 3972/2002).42 17.99982).83 4. especially in the upper gastrointestinal tract (Kazerouni et al. 144 .

The concentration of total PAHs varied between 23. and is still a significant component of the CTUIR’s cultural and spiritual identity in the USA. Regional initiatives of Sweden support further development of the traditional sauna smoking process and improvement of the quality of the smoked products (Wretling et al.74 μg/kg (Basak et al. 2008.79. They proved that traditional method of smoking had 7 genotoxic PAHs. 2010). 2002). 2005. high performance liquid chromatography. 1996). 2010). 2002. Gas chromatography is widely used to determine PAH compounds in food (Simko. The results of Essumang and the group of authors (2014) have shown the statistically significant difference in PAH levels between smoking with no charcoal as a filter and smoking with charcoal as a filter. but smoking processes can introduce potentially harmful combustion by-products into the smoked fillets. 2010. Samples of meat and fish smoked by indirect technique all had BaP levels below limit of quantification. The levels of PAH in smoked fishery products from modern smoking kilns with external smoke generation are higher than the levels in smoked fishery products from traditional smoking kilns (Karl and Leinemann. the content of PAH in smoked fish depends on the concentration of these compounds in the wood smoke. They are: fluorometricand spectrofotometric. Some of variables are: the type and 145 . Duedahl-Olesen et al.1000°C (Simko. 2002). most commonly from the contaminated water because fish rapidly metabolizes PAHs (Stolyhwo and Sikorski. Forsberg et al.4 μg/kg. six samples of smoked fish which were produced by traditional ‘‘sauna’’ smoking. Non-processed fish can have small or undetectable amounts of different PAHs absorbed from the environment. whereas non-direct exposure to smoke leads to a product with lower concentrations of PAHs (Simko. had high BaP levels ranging from 8. Temperature of smoke plays an important part in the amount of carciogenic PAHs that are created during pyrolysis. 2012) The sum of PAH in smoked fish products in Denmark ranged from 22 μg/kg in smoked mackerel prepared in an electric oven to 1387 μg/kg in herring smoked by direct smoking (Duedahl-Olesen et al. various methods are used. Investigation of potential carcinogenic PAH in two different smoked fish in Turkey showed a significant correlation between the fish fat and the total PAHs level. Traditional sauna smoked products are marketed as special delicacies.4 to 14. Direct exposure to smoke leads to a product with higher concentrations of PAHs. but during an official control programme of BaP levels in Swedish smoked meat and fish. That was confirmed by their study in which the carcinogenic and non-carcinogenic PAHs in traditionally smoked salmon were 40–430 times higher than those measured in commercial products. Also. Data reported in the literature on PAHs in smoked fish are highly variable and that can be attributed to the differences in the procedures used for smoking. smoking temperature and smoking time.83. 2005). gas chromatography mass spectrometry (GC-MS) or gas chromatography with flame ionization detector (Yurchenko and Mölder. Many studies have been investigating the influence of different combustion woods and smoking duration on smoked food PAH content and confirmed that soft resinous woods and longer smoking durations resulted in food with higher PAH content (Stumpe-Viksna et al. Duedahl-Olesen et al.First International Symposium of Veterinary Medicine – ISVM2015 In order to determine PAH compounds in food. Yusuf et al. Forsberg et al. 2005). 2006). (2012) reported that traditional smoking of fish is still practiced. Yurchenko and Mölder. The amount increases linearly with the smoking temperature within the interval of 400. (2015) investigated the effect of fish smoking methods on dietary exposure to PAHs and potential risks to human health. 2010).

227-237. 2010.T. Maletin S.. This method of smoking can be applied to other smoked products in craft industry. Brown A. 351-355.K. Novakov N.. Essumang D. Yuniningsih S.: Effective reduction of PAH contamination in smoke cured fish products using charcoal filters in a modified traditional kiln.K.. 2013 2. Polycyclic Aromatic Hydrocarbons 26.: Gajenje i kvalitet mesa šaranskih riba. WB 1519. Adjei J..H. Jovanovic B. ATSDR: Case Studies on Enviromental Medicine: Toxicity of Polycyclic Aromatic Hydrocarbons (PAHs). Duedahl-Olesen L. Bello B. Turkish Journal of Fisheries and Aquatic Sciences 10.L. Journal of Food Composition and Analysis. J.. 2012 4. 27. Yusuf et al. 128-138.: Polycyclic aromatic hydrocarbons (PAH) in Danish smoked fish and meat products. 2013 3. rural tourism and higher profit for the producers.P. FAO fisheries technical paper.Food.348 food and Agriculture organization of the United Nations. Novi Sad. Dodoo D.. 2014 10. 2010 8. Essumang D. Adjei J. Duedahl-Olesen L.. Granby K.L.O.K. temperature of smoke generation.: Influence of smoking parameters on the concentration of polycyclic aromatic hydrocarbons (PAHs) in Danish smoked fish. Osowo O. Considering that the traditional-craft production of the smoked meat is typical for our country. Case Study: Istanbul/Turkey. preparation of fish etc (Basak et al. 2015 7. losses and the profitability of production”.. Cirkovic M. Binderup M... Novi Sad.. Republic of Serbia. 2002 6. Food and Nutr. J. Food Control. 3. while at the same time.. Beside this. Djordjevic V. 63. 2006 9. 12. 1-4.: The Detection of Potential Carcinogenic PAH Using HPLC Procedure in Two Different Smoked Fish. especially when it comes to the policy of protecting the consumers. 2. smoking time.Tech. Sci.Naučni institut za veterinarstvo „Novi Sad“. Karakoc F.: Effects of Hot Smoking and Sun Drying Processes on Nutritional Composition of Giant Tiger Shrimp.: Liquid Smoke Purification Process for Benzo (A) Pyrene Levels Lowering on Food Safety. 163–184. oxygen accessibility..F. Pol..K.K... 1. FAO: Quality and quality changes in fresh fish. Abdullahi B. Food safety is one of the most important policies of the EU. we obtain a product that has all the sensory characteristics provided by the traditional craft industry. it is necessary to continue our work on improving and securing the quality and safety of smoked products and also. 2012 11. We proved the quality.A.K.Agric. monografija. Ljubojevic D. 2015).: Polycyclic aromatic hydrocarbon (PAH) contamination in smoke-cured fish products.. Acknowledgments This paper is a result of the research within the project TR 31011 “The influence of the quality of the food components for cyprinid fish species on the quality of meat. Timm-Heinrich M.. By producing the smoked carp meat in this way. Hojgard A. Poljoprivredni fakultet. protecting the geographical origin. Dodoo D. Anggraini S. Christensen J. Sengor G. Food additives & contaminants. 4. 85-93. the EU pays a lot of attention to the production of traditional-craft products because it enables the development of villages. 2010 5. safety and the lower PAHs content of product obtained in ecologically safe production of smoked common carp meat.: Ribarstvo.First International Symposium of Veterinary Medicine – ISVM2015 composition of wood.. 35.D. fat content. References 1.. we obtain a safer product because it contains lower levels of PAHs which minimizes the carcinogenic effect if consumed. 27... Akintola S. White S. type of generator. 1294–1305. Cirkovic M. 1995 146 . financed by the Ministry of Science and Technological Development. Basak S.

2005 22.: The determination of polycyclic aromatic hydrocarbons in smoked fish by gas chromatography mass spectrometry with positive-ion chemical ionization.Food Chem.. Stone D. Omoleye T. Baltic M.: Analytical methods for polycyclic aromatic hydrocarbons (PAHs) in food and the environment needed for new food legislation in the European Union.. Journal of Food Composition and Analysis 23.Agric. Greenberg A. International Journal of Food Science and Technology. Cardenas A. Food. Baltic M..: Freshness and quality attributes of cold stored Atlantic bonito (Sarda sarda) gravad. Food and Chemical Toxicology 39.. Simko P. 2010 25. Chem.. 57–68. Journal of Food Engineering. African Journal of Food Science. Escriche I..: Effect of pre-processing of trout by freezing on the characteristics of smoked trout fillets. Kleiner J.. volumes 1 e103. 2012 13.: Effects of brine concentration on shelf-life... 6. 66-70.I.A. Petrovic J. Kukare A. Che-Han H.: Polycyclic aromatic hydrocarbons in meat smoked with different types of wood.: Determination of polycyclic aromatic hydrocarbons in smoked meat products and smoke flavouring food additives.. 2006 24. 264-272.L. 716-725.: Effects of brine concentration on shelf-life of hot-smoked tilapia stored at 4 °C. Fito P. Z Lebensm Unters Forsch 202.. Rzepka M. 2015 147 .N... 6. Karl H. Simon R.. Waters K.M. Morozovs A. Özogul F. International Agency for Research on Cancer.. Mölder U. Sikorski Z.D. 3-18. Rustad T. Spiric A. Wretling S. Borovic B. Larsson B....A.3. Anderson K. Leinemann M. 2012 15. Gallart-Jornet L. Tehnologija mesa 51.: Uticaj različitih smeša gasova na promene nekih mikrobioloških i heijskih parametara u odrescima (Cyprinus carpio) upakovanih u modifikovanu atmosferu. 2010 18.: Determination of polycyclic sromatic hydrocarbons in smoked fishery products from different smoking kilns. Akintola S... Rothman N. Yurchenko S. Kazerouni N.First International Symposium of Veterinary Medicine – ISVM2015 12. 857-869.. 2005. 91. 1-2.... Boskovic M. Forsberg N. Pavlicevic N.. 423-436. Erikson U.: Polycyclic aromatic hydrocarbons in smoked fish.. Djordjevic V.: Analysis of 200 food items for benzo(a)pyrene and estimation of its intake in an epidemiologic study..A. 303-311. 267–27.M. Eskhult G.. 80. 770.. 2002 21. 2006 26.: Effect of Native American Fish Smoking Methods on Dietary Exposure to Polycyclic Aromatic Hydrocarbons and Possible Risks to Human Health.. Surówka K.1. TrAC Trends in Analytical Chemistry.. 1318–1326..M... 48. 25. 794–797. 97.. Fakoya K. Bartkevics V. 1. Yusuf K. Food Chemistry. Harris S. 7. 2013 19.: Influence of brine concentration on Atlantic salmon fillet salting..: Polycyclic aromatic hydrocarbons (PAHs) in Swedish smoked meat and fish. 244-247. 2008 23. 2. Stolyhwo A.. Velebit B. 9. 1996 16. Milijasević M. 2013 20. 6899-6906.IARC: IARC Monographs on the Evaluation of Carcinogenic Risks to Humans.. 458-464.. Journal od Food Composition and Analysis 18. Agboola J.. Food Chem. 27. Spiric D. Journal of Chromatography B.27. Wenzl T. Akamca E. Stumpe-Viksna I. Karabasil N.O. Dimitrijevic M. Michalczyk M.. Matzke M.. 2001 17. Anklam E..a critical review.. Ezechukwu L. Barat J.126-135. Sinha R. 2007 14.A. Eriksson A. Celik M. 60. Harper B. Harding A... 110. Tehnologija mesa 54.. E... Babic J..... J. Yanar Y.

Milica Todorović1. The aim of our research was to investigate the impact of commercial preparations linseed. Stamen Radulović1 1 Faculty of Veterinary Medicine. In these studies. In these biotransformation are involved enzymes desaturase and elongase and throughout their activities. The abbreviation "n-6" (or n-6) indicates that the first double bond in the molecule of fatty acid is at the sixth carbon atom. The importance of conjugated linoleic acid (CLA) for human health is also highlighted. The meat of pigs fed with these supplements had significantly better ratio of n-6/n-3 fatty acids. or of commercial preparations of CLA supplementation in diets for pigs on fatty acid composition of pig meat. or CLA. Keywords: pigs nutrition. whose main representative is linoleic acid (C18: 2 n-6) and n-3 fatty acids. fatty acids.Adding linseed preparation. Srđan Pantić3.The use of linseed or CLA in the diet of pigs significantly influenced the content of saturated. whose main representative is alpha linolenic acid (C18:3 n-3). Serbia 3 DOO Nutritio. but retains the ability to translate basic essential fatty acid ingested with food (linoleic and α-linolenic) in the so-called long-chain polyunsaturated fatty acids with specific roles in the body. especially n-3 and n-6 fatty acids and their relation. Dobrila Jakić-Dimić2. In the natural resources most often reported unsaturated fatty acids belong to the n-6. Belgrade. counting from the methyl group. meat quality Introduction Numerous medical findings show that a significant role in the development of cardiovascular and other chronic diseases in humans has a relationship between the two groups of polyunsaturated fatty acids in the diet: n-6 acids. special emphasis is placed on the use of fats in human nutrition. or preparation of CLA in food for pigs improves the nutritional value of pigs meat. Jelena Ivanović1. University of Belgrade. depends the intensity and efficiency of these reactions (Šobajić. compared to the meat of pigs fed without the addition of linseed preparation. 2002). The presence of these isomers has not been proven in the meat of pigs fed without the addition of CLA. the content and a ratio of fatty acids in pig meat may be affected by choice of feeds for pigs. BiH * Corresponding author: radmilam@vet. Serbia 2 Veterinary Scientific Institute. The meat of pigs fed with the addition of CLA preparations revealed the presence of both isomers of this preparation. Furthermore. Bijeljina. linseed.First International Symposium of Veterinary Medicine – ISVM2015 EFFECT OF THE DIET ON IMPROVEMENT OF THE FATTY ACID COMPOSITION OF PIG MEAT Radmila Marković1*. number and position of double bonds in molecules. monounsaturated and polyunsaturated fatty acids in pig meat.rs Abstract Numerous studies have confirmed the correlation between the prevalence of chronic disease and human nutrition.bg. as for "ω-3 '(or n-3) indicates that the first double bond in the molecule of fatty acid is at the third carbon atom.ac. n-3 and n-9 series. The human body cannot synthesize essential fatty acids. as well as the amount of substrate. Fatty acid composition of feed for pigs and pig meat was determined by gas chromatography. 148 . Branko Petrujkić1. Unsaturated fatty acids have mutually differences in chain length. Milan Baltić1. Dragan Šefer1.

Interest in the role of polyunsaturated fatty acids has been launched by investigations in 70 th of the last century. primarily alpha-linolenic acid (ALA). if not identical. so that this relationship could be approximate to optimal (4:1). meal examination to influence the fatty acid composition and meat quality of pigs. prior to absorption from the gastrointestinal tract (Baltic et al. 2011. however. The CLAs are a mixture of positional and geometric isomers of linoleic acid (9c. In ruminants. in pork and meat products (Corino et al.. as linseed. They were fed with standard mixture for pigs in the final stage of fattening. fatty acids are absorbed from the gastrointestinal tract with small changes. 2005.12c isomer could be responsible for changes in whole-body fat deposition (Pariza et al. The ability of producing n-3 enriched meat products of pigs is very interesting for many producers and consumers.. Markovic et al. essential n-6 fatty acids. More than 70% of this oil contains polyunsaturated fatty acids.11t isomer has positive effects on some types of cancer by inhibiting tumorogenesis. while 10t. Jiang et al. In the pig nutrition soybean.. 2011b). 2010). considering that the total oil content of the meal is variable depending on the method used for extraction of oil. 2001). so that today in human diet efforts is made in order to enrich food with n-3 fatty acids.12c C18:2). under the influence of the process of microbial fermentation and biohydrogenation. as noted above. 2011b. which affects the energy value of this nutrient. Materials and methods The aim of the research in the Experiment 1 was to investigate the effect of different sources of fat in the diet on fatty acid composition and meat quality of fattening pigs. despite their diet rich in fat and based on marine mammals and fish whose food chain is based on algae and plankton rich in n-3 polyunsaturated fatty acids. the fatty acids from food in the digestive tract are changed. In monogastric animals such as pigs. The aim of this study was that in two experiments on pigs’ choice of ingredients. but also alleviating symptoms and improving the clinical picture in some autoimmune and inflammatory disorders. It should be noted that linseed meal contains the fatty acid profile that is similar.12c isomers are predominant (often in a 1:1 ratio). In synthetic CLA preparations the 9c. the fatty acid profile of tissue directly reflects the profile of fatty acids in animal nutrition. In fact.11t and 10t.. Markovic et al. It appears that the 9c. which were first identified in rumen fluid as an intermediate in the biohydrogenation process (Bartlett and Chapman. In modern human nutrition the ratio of n-6/n-3 polyunsaturated fatty acids is relatively wide (1015:1). 2011). 1996).. In addition. which have revealed a very low occurrence of vascular disease in the population of Greenland Eskimos. provided that the groups differed only in the fact that the first experimental 149 .. for example. The pigs were divided into three groups of ten animals and the experiment lasted 46 days until a mean weight of about 100 kg. in coastal areas of Japan (Karolyi.. with an initial body weight of 60 kg. 2007). Linseed contains about 35 to 45% oil compared to the mass of dry material (Karleskind. sunflower and other oilseeds that contain fatty acids of n-3 series and fatty acids of n-6 series are used (Baltic et al. Similar observations were later confirmed by epidemiological studies in other populations with a similar diet. dietary CLA seems to be highly deposited in body tissues of monogastric animals and as a result. 1961). The trial was conducted on 30 crossbreeds pigs (♂Yorkshire × ♀Landrace).First International Symposium of Veterinary Medicine – ISVM2015 Numerous studies confirm that increased intake of n-3 fatty acids can affect on decreasing the risk of heart disease and vascular disorders. an essential ω-3 fatty acids and linoleic acid (LA).

were extracted from pig muscle tissue with hexane/isopropanol mixture by accelerated solvent extraction (ASE 200.5% in the mixture.5 16.01) difference between groups (Experiment 1). second experimental group (E-II) preparation of linseed (Vitalan®. 2011).. The mixtures were balanced and completely satisfied the needs of the animals in this production stage.0 14. In the examined total fatty acid content of pig feed.20 0. Dionex. affects the fatty acid composition of meat.60 1. longissimus dorsi) from each pig in all groups for analysis of fatty acid composition analysis were taken at the end of the both experiments. added in the feed.80 14. total lipids were converted to fatty acid methyl esters (FAME) by trimethylsulfonium hydroxide.0 11.50 2.0 14. Sixty crossbreed pigs (♂Yorkshire × ♀Landrace). After the evaporation of solvent to dryness under the stream of nitrogen. as well as their relationship with feed and meat were investigated. Table 1.20 0. after slaughtering. The pigs were divided into two groups (Control-C and Experimental-E) of 30 pigs in each and fed with a standard mixture (NRC. we have investigated the quantities and proportions of fatty acids in pork meat when fed diets with variable fatty acid content. with an initial body weight of 60 kg were used in this study.First International Symposium of Veterinary Medicine – ISVM2015 group (E-I) had a grain sunflower. The complete feed mixture of E-II group. France) in the recommended inclusion rate of 2. BASF. The fatty acid composition of feed and meat content of n-3 and n-6 fatty acids. The diet between groups differed only in the fact that the experimental group had commercially prepared conjugated linoleic acid 60% CLA (Lutalin®. (Table 2) it was noticed that there was a statistically significant (p<0. Vitalac. at the recommended rate of 2. grain Wheat bran Vitalan® Lutalin® Dicalcium phosphate Chalk Salt Vitamin mineral premix ∑ E-I Experiment 1 E-II E-III 46. Meat samples (M. FAMEs were determined by Shimadzu 2010 gas chromatograph equipped with flame ionization detector (FID) and cianopropyl HP-88 capillary column (100m × 0.40 1 100 Experiment 2 C E 48 28 16 5 3 100 46 28 16 5 2 3 100 The total lipids.20 0.5 7.2 - 50.5 51. grain Full-fat soybean meal Soybean meal Sunflower.20 - 0.60 1. 1998). Germany).0 16. In the Experiment 2 the aim of the research was to investigate if the addition of CLA in the diet of fattening pigs.0% of the mixture.50 1.60 1. Results In these studies. Raw material of the final feed for pigs fattening (%) Feed Corn.0 13.7 15. and the third experimental group (E-III) full-fat soybean meal included in the diet (Table 1).0 16. for fatty acid determination. from 60 to 110 kg (fattening period of 60 days).25 mm × 0. processing and chilling of the carcasses. The nutrient composition of the diets is detailed in Table 1.40 1 100 0.40 1 100 0. which contained the preparation of 150 . grain Barley.20μm) (Trbović et al. Germany). grain Wheat.

51 - E-II ( X SD) 37.25 39.84BC±0.60 25.07 2.51±0.90 0.56 43.38AB±0.92 8.79BC±0. which was significantly higher (p<0.71AB±0.55 53.73AC±0.88 9. a the same letter indicates significant difference of 151 .53A±0.01 32.19±0.81AC ±0. Since the fatty acid content was significantly different. Table 2.51A±0.01 - - - ND 3.78a±1.01 ND 5.76 0.28 17.38A±0.60 ND ND E ( X SD) 53. compared to E-I group (52.76BC±0.57±0.55±0.26 55.27 38. meat from the group which was fed with linseed preparation.07 37.76 42.71A±0. B.24 39. a the same letter indicates significant difference of p<0. was significantly higher (p<0. The content of n-3 and n-6 fatty acids.32 37.60 9.98A±0.67AB±0.14 - E-III ( X SD) 20.28 22.40 17.22 11.33A±1.18 1.21A±0.32 54.03 24.B±0.03 Legend: A.00) (p <0.03 13.54AB±0.95a±0.91A±0.28 8.44 16.01 1.12 23.12BC±0.08 - E-III ( X SD) 37. C the same letter indicates significant difference of p<0.32±0.42BC±0.01).01. SFA and MUFA in the feed of the control group were significantly higher (p<0.37±0.36±0.94A±0. and the ratio n-6/n-3 FA SFA MUFA PUFA n-6 n-3 n-6/n-3 c9t11CLA t10c12CLA c9t11CLA+ t10c12CLA E-I ( X SD) 20.99AB±0. compared to the other two groups.60B ±0. the most beneficial ratio of n-6/n-3 was observed in E-II group (5. In the Experiment 1.05 Experiment 2 E-I ( X SD) 36. Fatty acid composition in meat (%).91±0. but on the other hand the average content of PUFA in this group was lower as well as the n-6/ n-3 ratio compared to the other two groups of pigs (p<0.01) (Table 3).65AC±1.38 46. significant differences between the contents of fatty acid in the feed of control and experimental groups were observed.57AB±0.20 25. CLA isomers c9t11CLA and t10c12CLA were detected in the feed supplemented with CLA (experimental group) and were below the detection limit in the control group (Table 2).60 8.48A±1.46 35.75 43.05 In the Experiment 2.72A±1.02 17.56±0. and ratio Experiment 1 FA SFA MUFA PUFA n-6 n-3 n-6/n-3 c9t11CLA t10c12CLA c9t11CLA+ t10c12CLA Legend: A the same p<0.48 49.31A±0.93A±0. had the highest percentage of SFA (37.04 29. E-II group.22 5.07 1.08 19.70 47. The average content of SFA and MUFA in the meat (Experiment 1) was higher in the group of pigs fed with linseed preparation (E-II).53AB±0.57 0.01) compared to the E-I group.98A±0.01) than in feed of the experimental group.02 ND 2.59AC±0.33B±0.65) and E-III group (11.53AC±0.29A. that resulted in different ratios of n-6/n-3.05) (Table 2).28 0.1 52.47A±0.05 20.12±0.23AB±0. In the Experiment 1. Table 3.48A±0.54BC±0.69AC±0. while between E-II and E-III groups no significance was observed (Table 3).97 2.17A±0.22 25. The fatty acid composition of feed (%).46B±0.05 41.58a±2.54 - - - - Experiment 2 C ( X SD) E ( X SD) 22.57) (a group that was fed linseed preparation).41 4.11 22.32 25.56 1.10 - Experiment 1 E-II ( X SD) 18. Similarly the most beneficial ratio of n-6/n-3 was observed in the feed of the experimental group (p<0.First International Symposium of Veterinary Medicine – ISVM2015 extruded linseed.87BC±0.46AB±0.55 - C ( X SD) 43.99a±0.75%).54±0.72a±3.80a±2.98AB±0.21 ND 2.60 56.01.71 letter indicates significant difference of p<0.99A±0.01) in the feed of the experimental group.56±0.36A±0.40AC±0.00BC±0. had a significantly lower content of SFA and significantly higher PUFA content (p<0.17AC±0.01) (Table 2).

The average content of monounsaturated or polyunsaturated fatty acids (37.56±0.01.05.71±0.01%. virtually everyone knows that there is a connection between diet and health.01% and 3.95 ± 0.42±0. It has been found that the average content of saturated fatty acids in pork meat of pigs fed with the addition of linseed was significantly higher compared to the SFA content of the meat from pigs fed with the addition of sunflower. 8. monounsaturated (MUFA) and polyunsaturated (PUFA) fatty acids. and content of n-3 fatty acids significantly higher in pork meat of pigs fed with the addition of linseed (p<0.51±0. malignant neoplasms.33± 1.99±0.03%. The average content of saturated (SFA).57%. In this study (Experiment 1) results indicate that by changing sources of fat and fatty acid composition of feeds. Among the risk factors of numerous chronic noncommunicable diseases (cardiovascular and cerebral diseases. were statistically significantly different. as a source of fatty acids (Table 3). which are numerous (more than 200).53±0. There was no statistically significant difference between the average content of n-3 and n-6 fatty acids in meat sample (0. which was significantly higher (p<0.01) than the average content of saturated fatty acids in the meat of pigs of the control group (43. bile duct diseases.88%. Discussion A negative attitude towards the consumption of meat has many different causes. 1. Today.72 ± 3.32±0. nephrolithiasis. t10c12 and total CLA content in the meat of pigs of the experimental group was 2.99±0.97) were significantly lower (p<0. Pork from pigs fed with additions of linseed had a statistically significantly better ratio of n-6/n-3 fatty acids. the fatty acid composition of meat can be affected.72±1.01). which was significantly higher (p<0.71% (respectively). 2008). nutrition is of the great importance. respectively). respectively) than the average content of monounsaturated or polyunsaturated fatty acids in the meat of pigs of the control group (46.87±0.01) and 17. diabetes. 9.First International Symposium of Veterinary Medicine – ISVM2015 Meat from E-II group (Experiment 1) of pigs contained 43. Since linseed has a desirable fatty acid composition. between groups.48±1. which was significantly lower (p<0. 2014). The fatty acid profile of the meat directly reflects the fatty acid profile in feed (Eastwood.92%.28% of MUFA. respectively). The average ratio of n-6/n-3 fatty acids in meat pigs experimental group (24. many producers are interested to include linseed in swine finisher in order to improve the fatty acid composition of meat.01) compared to E-I and E-III group.01) (Todorovic. as well as the average contents of n-6 and n-3 fatty acids in the feed. The average content of n-6 fatty acids in meat was significantly lower.36±0.56±0. The meat of pigs that were fed with soy (E-III group) was 41.38%).01) compared to the E-I group that was fed with sunflower grain.08% of PUFA.90%. Scientific discoveries and better informed consumers have contributed to the understanding of these connections. obesity. respectively) and a control group of pigs (0.19±0. dental caries). respectively) in the experimental group pig meat was significantly lower (p<0.37±0. It was found that the average content of saturated fatty acids in the meat of the experimental group of pigs (53.04%.07%) was significantly higher (p<0. 8.60.28%.58±2. One of the most common is the health concern. The average content of conjugated linoleic acid c9t11. 152 . osteoporosis. 9.44% of PUFA. hypertension. In the meat of the control group of pigs the CLA was not detected (Table 3).05% of MUFA and 20.60) as shown in Table 3. p<0.05) than the same ratio in the meat of the control group pigs (29. The average content of polyunsaturated fatty acids in pork from pigs fed with the addition of linseed was significantly lower compared to average content of these acids in pork from pigs in the other two groups (p <0.

21 and 28 days before the slaughter. Fatty acids n-3 have a protective effect on the cardiovascular system and the decrease of frequency of deaths caused by cardiovascular diseases. (1990). Pariza. salmon) (Losso. 2002.First International Symposium of Veterinary Medicine – ISVM2015 Apart from the optimal quantity of essential fatty acids in nutrition. The CLA concentration in muscle tissue may be further enhanced when CLA supplementation is combined with additional dietary fat (Gatlin et al. 1998). An important source of n-3 fatty acids is the fish meat of northern sea fish (mackerel. which is understandable. Results of n-6/ n-3 fatty acid ratio in the diets of the control and experimental groups of pigs are shown in Table 2.... Okanović et al. given the fact that the Lutalin® preparation. according to the producer statement contains 50% and 50% c9t11CLA t10c12CLA (Table 2). The average content of isomers c9t11CLA and t10c12CLA in feed for the pigs of the experimental group were nearly identical. 10 and 15%) 25 days before the slaughter. 2004). As a part of these investigations have been two isomers of CLA. A number of the current research is directed at manipulating the fatty acid content of meat animals in order to increase n-3 and CLA content (Enser et al. Romans et al. subcutaneous adipose and muscle tissue. which is caused by the content of these acids in mixtures. 14. It is notable that it is not the same degree of adoption and incorporation of both isomers of conjugated linoleic acid were observed in the feed. 1997). Later. It is recommended that polyunsaturated fatty acids present 10 to 20% of total daily intake of lipids. One of the first studies about the effects of linseed on meat lipid profile was performed by Cunnane et al. (2010) investigated the impact of feed enriched with linseed on the content of n-3 fatty acids in pork. It was found that the experimental group of pigs had significantly increased the content of polyunsaturated fatty acids (PUFA).. 2000 and Thacker et al. Václavkova and Bečkova. Both of these acids were found in the meat of pigs. Feed containing linseed resulted in higher concentrations of n-3 fatty acids (> 7 mg/100 g). Piglets had significantly higher levels of ALA in the liver. A large number of experiments were performed in final pig fattening stage (Raj et al. These authors concluded that linseed should not be used in the feed of finisher pigs at the level higher than 15% in order to maintain the meat sensory properties. heart. herring. and blood pressure. c9t11CLA and t10c12CLA. Enser et al. The swine feed by adding CLA to change the attitude of n-6/n-3 fatty acids. (1995b) studied the different length of linseed use in feed (15% linseed) 7. their ration is also very important. which decreased ratio of n-6 and n-3 fatty acids in meat (<3) making it better for human health. from the age of two till the tenth week of age feed was supplemented with 5% of linseed. These acids decrease triglycerides in blood. Isomer c9t11 is more suitable for installation in intramuscular fat depots (Pantić. The ratio of n-3/n-6 fatty acids is optimal if it is in a range 1:4 to 1:5. Romans et al. from pigs with an average weight of 110 kg. while the amount of saturated and monounsaturated fatty acids was reduced in the same group. provided that the content c9t11CLA was almost twice the content t10c12CLA (Table 3). 2014). The ALA content of back fat adipose tissue significantly linearly increased with the increase in the length of feed supplementation with linseed. 2010. Matthews et al. (1995a) studied the influence of different concentrations of linseed in feed (5. The cereal-based diet commonly 153 . 2000. other researches performed trials in order to determine the optimal level and the length of supplementation of linseed in feed. In the other study. sardines. In this experiment. kidney.. regulate the activity of protein kinase C that have a role in angiogenesis and slow down the growth of tumor metastases. 2007. as well as the void content of n-3 fatty acids. as a supplement mixture for pigs. 2002). Adding a CLA mixture to the feed of experimental groups of pigs increased content of n-6 fatty acids. skin. in order to ensure that the enrichment of n-3 fatty acids does not negatively affects meat quality. Adding CLA in the mixture for pigs (Experiment 2) has significantly influenced the fatty acid composition of the mixture.

9: 1961. Đorđević Vesna: Nutrition and meat quality.K.. Alessia Di Giancamillo.. By adding a mixture of linseed to the mixture for finishing pigs the meat with favorable fatty acid composition and favorable ratio of n-6/n-3 fatty acids compared to pigs which had no linseed in the diet was obtained. Smith et al. Dietary Conjugated Linoleic Acid Affects Morphofunctional and Chemical Aspects of Subcutaneous Adipose Tissue in Heavy Pigs. 2012). the addition of CLA in the diet of pigs increases the content of the SFA and reduces the content of MUFA and PUFA in the pig meat. Science and technological development of the Republic of Serbia. University of Saskatchewan. Conclusion A diet enriched with extruded linseed had a beneficial impact on the content of n-3. Departmant of Animal and Poultry Science.. Karabasil N.00) (p<0.. 1. 1444-1450. 2002.C... 2011. Canada. J. The inclusion of high dose of dietary CLA in pigs of conventional genotype (♂Yorkshire × ♀Landrace) increased the CLA content in pig meat. 1990 Eastwood Laura: The nutritional value of flax seed meal for swine. Chapman: Detection of hydrogenated fats in butter fat by measurement of cistrans conjugated unsaturation.G. 2001. and D.. Also. 2008 154 . Chemical analysis of the fatty acid composition of complete mixtures found that the feed which was included preparation of linseed had significantly lower SFA content. Agric. TR 031034 financed by the Ministry of Education. Nutr.M.. . 2011b Baltić Ž. Joo et al. 6. n-6 acids and the ratio of n-6/n-3. 2. 2005 Cunnane S.01). 5. Todorović Milica: Ishrana i kvalitet mesa svinja.. 3... 251-254. The results from this study show that the pig products can be modified to in order to provide a significant increase the functional lipids. 2005.Simpozijuma-Zdravstvena zaštita selekcija i reprodukcija svinja. Zbornik radova 9. Veterinarski Institut Požarevac.M. 4. 2002. eggs or pork meat in order to increase the content of n-3 PUFA requires a supply of n-3 PUFA from the diet (Nieto and Ros. Anim. Acknowledgment The study was conducted within the project "The selected biological threat to the safety/quality of food of animal origin and control measures from the farm to the consumer". Armstrong J. 154-159. which can have a positive influence on the human health. Thiel-Cooper et al. Sci. 6. Baltić Ž.567) in comparison to a composition for a full fat soybean meal group (11.. which is important for the health of consumers. Marković Radmila. PhD Thesis. Šefer D. Tehnologija mesa.C. Ganguli S. References 1. 50-53 Corino Carlo. Many studies in order to manipulate the fatty acid composition of the meat using whole oilseeds have been conducted. the ratio of n-6/n-3 fatty acids in feeds linseed group was lower (5. Also. J. and content is significantly higher PUFA mixture of full fat soybean meal.. Food Chem.139-146 Bartlet. Gatlin et al. J. Can. Marković Radmila. Dietary modification of poultry meat. and C18:0) and decreases the amount of MUFA fraction (mainly C18:1) in pig the tissues by down-regulating the D9-desaturase activity (Eggert et al. Raffaella Rossi. Several reports indicate that CLA supplementation increases the amount of saturated fatty acids (C14:0. Stitt P. 135. Cinzia Domeneghini.First International Symposium of Veterinary Medicine – ISVM2015 offered to poultry and pig supplies mainly n-6 PUFA and a small amount of n-3 PUFA.70.. J. Srebrno jezero. 2002.A. Lauridsen et al.: Raised omega-3 fatty acid levels in pigs fed flax. Dokmanović Marija. 52. C16:0. This is reflected in the fatty acid composition of the animal product.. 2001).

Zlatibor. Calder P.J. Homer D. Zbornik referata i kratkih sadržaja 22. Drljačić A. Todorović Milica. 83: 637-643. Schinckel: Effects of conjugated linoleic acid on the belly firmness and fatty acid composition of genetically lean pigs. Palić D. 355-362. Ros: Modification of Fatty Acid Composition in Meat Through Diet: Effect on Lipid Peroxidation and Relationship to Nutritional Quality – A Review. Fakultet veterinarske medicine Univerziteta u Beogradu.doi. Drobnjaković R.M. 95-111..: Oils and Fats Manual. 28. NRC. 2005 Losso N. Jiang S.: Conjugated linoleic acid differentially regulates fat deposition in backfat and longissimus muscle of finishing pigs. Baltić Ž. J Anim Sci. 2012 http://dx.B. liver and sausages. Zhong W.I Lee. 25. 2000 Nieto. Intercept Ltd. 52. Meat Science. 9. J Anim Sci...org/10. 2000 Eggert J. Journal of Animal Science. 2001 Gatlin LA. J. 189-194. Marija Dokmanović. Meat Sci.B. 283–298.org/10.. Sheard P.doi. Y L. Park: Effects of dietary conjugated linoleic acid on fatty acid composition. Enser M. Jelena Đurić.pogled u budućnost.. 18. UK. Cook M.M.and meat quality.2527/jas. 11. Milica Todorović.R... Radulović S. Drljačić A.. 2010 Pantić Srđan: Uticaj konjugovane linolne kiseline na proizvodne rezultate. 1998 Okanović Đ. 19. Br. 4... 88. 69:393–399. 8.. Hewett.: Effect of whole linseed (Linum usitatissimum) in the diet of finishing pigs on growth performance and on the quality and fatty acid composition of various tissues..First International Symposium of Veterinary Medicine – ISVM2015 7.. Meso. Chemistry and Industry. Skomial J. Hallett.5772/51114 NRC: Nutritional requirements of swine. Harrington: Fatty acid content and composition of UK beef and lamb muscle in relation to production system and implications for human nutrition. 16: 464469. Skiba Grzegorz. K. 16. adipose tissue. 1997 Pariza M.. B. 151 – 158. 14. G. J.J. 2007 Lauridsen C. kvalitet mesa i proizvoda od mesa svinja u tovu. 2002 Karleskind A.Q. 17. Meat Science.3. Gill B. 1. 132:3105–12. A.. Ivanov Dušica. Lin X. and G. Fandrejewski H. 56. 22. Progress in Lipid Research.: The biologically active isomers of conjugatedlinoleic acid.: Ishrana i kvalitet mesa svinja. Veterinarski žurnal Republike Srpske. Radulović S.R. 2002 Jiang Z. 24. Odle J.J. Wood.. slaughter. S. 55: 201-212. Nutr. 49:329–341.I. Washington. color. Richardson R. Krmiva. Baltić Ž.. Chapter 12. 30-36. 79:2866–2872.Mu and P. Ilić N. Andover. 1694-1705. Savetovanja veterinara Srbije. 13. lipoproteins.Y.2008-1551 Joo S. G.: Značaj izbora hraniva za masnokiselinski sastav mesa. IX. 15. H. 23. Ha and G. 40. Mills and A.C. Karabasil N. XI.Fursey... & Zheng C. Weremko Dagmara. M. Henckel: Influence of dietary conjugated linoleic acid (CLA) and age at slaughtering on performance. 2011b Marković Radmila.. Vukčević Č. Animal Science Papers and Reports.. 2001 Raj Stanislawa. Hampshire. J. 2002 Marković Radmila..P..: The influence of dietary source of fatty acids on chemical composition of the body and utilization of linoleic and linolenic acids by pigs.M.. Vol. Doktorska disertacija.E.A. Ikonić P. 1998 Enser M.. and water-holding capacity of pork loin.. a newly recognized nutrient. See MT. Thies F..W. 12. 2014 Pariza M. 2010 155 .. 6: 78-87. 2010 http://dx.D.:Conjugated linoleic acid. and G.: Conjugated linoleic acid combination with supplemental dietary fat alters pork fat quality.T. Preventing degenarative diseases by anti-angiogenic funtional foods. Park Y. 10. 20. Larick DK. 21.. 80:108–112. Wood J.. Belury. Yang L.A. 10th Ed.P.1... 26. Food Technology.. 2011 Matthews K. DC.. 1996 Karolyi D. lipid oxidation.. and tissue deposition of CLA in barrows.D.: Feeding linseed to increase the n-3 PUFA of pork: fatty acid composition of muscle.E.G.. Polawska Ewa.: Influence of linseed enriched diet on omega-3 fatty acids content in pork. Kempa-Steczko. Šefer D. T. Journal of Animal Science.: Polinezasićene masne kiseline u ishrani ljudi. Lin Y C.W.

Đinović-Stojanović Jasna. Arch. Libal G. 84: 681–688.M Cortese. Johnson R. Sci.. 73: 1982-1986.:. 1995b 29. B. J. I. Racz V. Journal of Animal Science.. Costello W. Can. Dummerstorf. 102-107. Romans J. J.C Sparks. 80: 2110–2115.. II. Dietary level of flaxseed. 2002 30. Wulf D. Hrana i ishrana.. F. 35. 2002 31. T.: Effects of ground flaxseed in swine diets on pig performance and on physical and sensory characteristics and omega-3 fatty acid content of pork.: Performance and carcass characteristics of growing finishing pigs fed barley-based diets supplemented with Linpro (extruded whole flaxseed and peas) or soybean meal. G. Petronijević R. Costello W. Todorović Milica: Uticaj različitih izvora masti na proizvodne rezultate i kvalitet mesa tovnih svinja. 2004 33. 2011. 43. Anim.... Trbović Dejana.C.. Tierz. R..L.R Wiegand. 1995a 28. Conjugated linoleic acid depresses the Δ9 desaturase index and stearoyl coenzyme A desaturase enzyme activity in porcine subcutaneous adipose tissue. Šobajić Slađana S.S.: Effects of ground flaxseed in swine diets on pig performance and on physical and sensory characteristics and omega-3 fatty acid content of pork. J. 50. V International Conference „Aquaculture &fishery“. 2014 32. zdravstveni značaj i dijetarni izvori ω -3 masnih kiselina. Milijašević M. Sci. Fakultet veterinarske medicine Univerziteta u Beogradu. and R. MatekaloSverak Vesna. Thacker P. Hively. Soita H.... Johnson R. Duration of 15% dietary flaxseed.. J. Uloga. Bečkova Ružena: Effect of linseed in pig diet on meat quality and fatty acid content. 79: 1821–1828..B. Sci. Special Issue. Conference proceedings. Smith S. Libal G.C Parrish. 3-6.. Thiel-Cooper.. Wulf D. Ewan: Conjugated linoleic acid changes swine performance and carcass composition. 2007 156 .Y. Doktorska disertacija. Chung. Journal of Animal Science. J. K.. 144-151. 73: 1987-1999. Anim. 2001 34. Romans J. 80-84. Vaclavkova Eva. Vranić Danijela. Anim..First International Symposium of Veterinary Medicine – ISVM2015 27. Spirić Aurelija: Fatty acid profile of carp fish species from two aquaculture systems. P Casteñada.J Han.

the rising cost of poultry feed.05 mmol/L. total bilirubin.ac.5% of Thymus vulgaris herba and 2% of Pimpinella anisum pulverised fructus.001). triglycerides and activity of creatine kinase enzyme.001).5% of Ocimum basilicum and 0. The fifth group was fed with BD mixed with Salinomycin (60 ppm). third and fourth groups of chicks were fed BD enriched with 1% of Ocimum basilicum pulverised herba. Taking into account this. were divided into five equally groups (n=30). p<0. concentrations of glucose. Blagoje Dimitrijević1. Serbia 2 Institute of Veterinary Medicine of Serbia. Key words: phytonutrients. On the day of hatching 150 broiler chicks.01.88±1.rs Abstract Maintaining bird health. albumin.71±1. regarding diseases or agents acting on the gastrointestinal tract. Mila Savić1. but we observed beneficial effects on some parameters of protein metabolism.First International Symposium of Veterinary Medicine – ISVM2015 EFFECTS OF SOME DIEATARY SUPPLEMENTATION WITH PHYTONUTRIENTS ON SELECTED BIOCHEMICAL PARAMETERS AND GROWTH PERFORMANCE IN BROILER CHIKENS Milanka Jezdimirović1*. Also. However. Faculty of veterinary medicine.73±0. problems of drugs residues.29±1. is crucial in broiler production.02 vs 1. growth performance.89±0. This is mainly due to the short generation interval of poultry. it is well known that broiler production is impossible without antibiotics. In addition. 41. p<0.51 g/L. microbial resistance and diseases have become major problems militating against the industry (Puvača et al. The control group (1st group) of broilers received a basal diet (BD) without any feed additive.04 g/L. Creatine kinase activity and total bilirubin concentration were significantly reduced in broilers fed with phytoadditives. which are used as growth promoters and in order to suppress overgrowth of pathogenic microflora in the gastrointestinal tract. 2013). Thymus vulgaris and Pimpinella anisum) on growth performances (body weight. feed conversion ratio and carcass yield). regarding diseases or agents acting on the gastrointestinal tract. particularly of broilers. Slavoljub Jović1 1 University of Belgrade. Belgrade.05. 0. p<0. It could be concluded that supplementation of the diet with phytoadditives has a potential to improve health status in broilers. Maintaining bird health. The second.bg. Dragan Bacić1. total proteins. we investigated the growth promoting and beneficial effects of three phytoadditives (Ocimum basilicum. The results indicated that feeding the diets enriched with selected herbal supplement failed to affect the growth performance of chickens at 56 days of age. Saša Ivanović1. The concentration of total proteins was significantly higher in chicks fed with phytoadditives. is crucial in 157 . in broiler chicks at 56 days of age. Ocimim basilicum in combination with Thymus vulgaris decreased the concentration of tryglicerides (0. but this was not the case with other phytoadditives. broiler chickens Introduction Expansion of the poultry industry holds the greatest promise for bridging the animal protein gap in the world.08 vs 35.5% of Thymus vulgaris pulverised herba and 0. Albumin concentration was also significantly higher in experimental groups (28. since this is the entry route of nutrients for bird development. respectively. Further examinations are needed in order to elucidate the exact mechanism of action. Serbia * Corresponding author: milanka@vet.23±0. Nemanja Jezdimirović2. total feed intake. p<0. this supplementation had no influence on glucose metabolism..32 vs 19. blood chemistry.

generally recognized as safe and commonly used items in the food industry (Lv et al. Continuous lighting 158 . total bilirubin. 2010). albumin. Thymus vulgaris and Pimpinella anisum) grown and harvested in Serbia.. which was then maintained constantly. 2011). Also. involving new therapeutic molecules to which resistance has not yet developed (Orengo et al. which are used as growth promoters and in order to suppress overgrowth of pathogenic organisms in the gastrointestinal tract. Plants are an important source for drug discovery – particularly for parasites because of the long association between the coexistence of parasites. concentration of glucose. their mode of action. 2011). it is well known that broiler production is impossible without antibiotics and coccidiostats. dried at room temperature away from sunlight.. a number of plants and their extracts have been used in poultry nutrition. feed consumption.First International Symposium of Veterinary Medicine – ISVM2015 broiler production. Their functional substances (such as flavonoids. Material and methods Plant materials The herba of basil (Ocimum basilicum) and thyme (Thymus vulgaris) and fructus of Pimpinella anisum were collected in Vojvodina (North Province of Serbia). But. since this is the entry route of nutrients for bird development. were randomly divided into five equally groups (n=30). new commercial additives derived from plants including aromatic plant extracts and their purified constituents have been examined as a part of alternative feed strategies for the future. Recently. The dried leaves and fructus were pulverised and kept at 8 oC before mixing with broiler diets. repel competitors and attract pollinators (Petrović et al. and. the room temperature was kept at 32 oC and then was gradually decreased by 3 oC per week to a final temperature of 23 oC on the day 21. As a result. in broiler chicks at 56 days of age. Less than 10% of approximately 250000 of the world’s flowering plant species have been investigated scientifically for their pharmacological properties but almost 25% of active medical compounds currently prescribed in the USA and UK were isolated from higher plants. yet only in the past 20-30 years have scientists seriously begun to determine whether plant-derived traditional remedies are effective. humans and herbal remedies (Anthony et al.. triglycerides and activity of creatine kinase enzyme. we investigated the growth promoting and beneficial effects of three phytoadditives (Ocimum basilicum. and function by mechanisms other than those of chemotherapeutics. feed utilization and decreased mortality from clinical diseases is well documented. polyphenols and terpenoids) are mainly secondary metabolites synthesized by plants to deter herbivorous predators. 2011). total proteins. 2005). Such products have several advantages over commonly used commercial antibiotics since they are residue free and they are also. if so. On the day of hatching.. the growing concern over the transmission and the proliferation of resistant bacteria via the food chain has led to a ban of the feed use of antibiotic growth promoters in livestock within the European Union since 2006 (Brenes and Roura. „natural“ methods are likely to play an increasing role in the control of the disease since they are well accepted by consumers. Plant products are residue-free. Plants and their extracts have been used for many centuries as treatments for ailment of many pathological conditions. Experimental animals and diets On the day of hatching 150 broiler chicks. The broilers were kept in large pens on wood shavings. on growth performances. The prophylactic use of antibiotics in poultry nutrition in order to cause improvements in growth. Taking into account this. Also. These botanicals have received increased attention as possible growth performance enhancers for animals in the last decade.

total feed intake. Statistical analysis was performed using the Graph Pad Prism 5. The body weight of broilers. „Grower“ from day 15 to 35 and „Finisher“ from day 36 to 56. Sample collection None of broiler chickens in any group died during the trial. On day 56 of age all broilers were slaughtered by decapitation. 0.5% of Thymus vulgaris herba and 2% of Pimpinella anisum. third and fourth groups of chicks were fed BD enriched with 1% of Ocimum basilicum pulverised herba. feed conversion ratio and carcass yield were among the growth parameters studied and recorded on the day 56 of life. while bromocresol green was used to determine albumin concentration. Statistical analysis Statistical significance of differences of all examined parameters were determined by means of the ANOVA.05. 159 .0 Software.5% of Ocimum basilicum and 0.5% of Thymus vulgaris and 0. Results The effect of diet supplementation with 1% of Ocimum basilicum. December 1986). as well as in control groups (C1 – fed with BD. Significance level was set at p < 0. All birds were fed ad libitum with the commercial standard diets for broilers (Veterinarski ZavodZemun.5% of Thymus vulgaris pulverised herba and 0. CA. Relative humidity in the room was maintained at 70%.5% of Thymus vulgaris herba and 2% of Pimpinella anisum pulverised fructus. Germany). L 358/1–358/6. The broilers had free access to feed and water. Data were expressed as means ± standard error. feed conversion ratio and carcass yield are shown in Table 1. Total bilirubin (the sum of conjugated and unconjugated bilirubin) was determined in the reaction with diazonium ion of sulphanilic acid. Biochemical assaying The kinetic method was used to determine creatine kinase (CK) enzyme activity. Sera were obtained after a spontaneous blood coagulation attained by centrifugation lasting 10 min at 3000 rpm. USA. Blood glucose concentration was determined by using PrecisionXtra plus test strips. Serbia): „Starter“ from day 1 to 14. Spectrophotometric measurements were performed with Cecil CE 2021UV/VIS spectrophotometer. The biuret method was used to determine total protein concentration. 0. enabling the separation of blood serum. All experiments were performed according to our institutional guidelines for animal research and principles of the European Convention for the Protection of Vertebrate Animals Used for Experimental and Other (Official Daily N. The control group (1st group) of broilers received a basal diet (BD) without any feed additive. respectively. Thus obtained blood sera were frozen at -20 oC until further analysis. Blood was taken without anticoagulants’ presence. while triglycerides concentration was determined after enzymatic hydrolysis with lipases and quinoneimine as indicator.First International Symposium of Veterinary Medicine – ISVM2015 regimen (24 h of light per day) was kept throughout the fattening period.5% of Ocimum basilicum and 0. followed by the Tukey test. 18. The second. and C2 – fed BD plus Salinomycin) on the body weight. in experimental groups. All of the above mentioned biochemical parameters were determined using commercial kits (Bayer Diagnostics. The fifth group was fed with BD mixed with Salinomycin (60 ppm).

89 2.04 2375±55. total feed intake. compared to C2 group (695.50±0.5% of Thymus vulgaris herba and 2% of Pimpinella anisum (III group).73±0. p < 0. + p<0.01) and III groups (41.4±30.05.5% of Ocimum basilicum and 0. 1. in this case the higher albumin concentrations were determined in I (28. p < 0.85 g/L. Table 1.51 g/L) and C2 (19.01 vs.5% of Thymus vulgaris herba and 2% of Pimpinella anisum (470.5% of Thymus vulgaris herba and 2% of Pimpinella anisum (III group). But it is also worth to mention that we determined higher values of albumin in I group (fed BD plus 0.15 1.39±0.001) compared to C1 (19.05.48 2573±75.5% of Thymus vulgaris (II group) and 0. C1 – control group fed with BD. C1 control group. but also for skeletal muscle integrity. Also.49 Total feed intake (g) 8405 7214 6985 7365 8210 Feed conversion ratio 2.5% of Thymus vulgaris (II group) and 0.71±1. 0.02±0.5% basil) compared to II group (24.5% of Ocimum basilicum and 0.25 2694±91. Control groups (C1 – fed with BD and C2 – BD plus Salinomycin) on growth performance of broilers at the age of 56 days C1 I group II group III group C2 2602±64.8±74.5 U/L).5% of Thymus vulgaris (403. feed conversion ratio and carcass yield). p < 0. the higher concentrations were recorded in I (41. 3) is another biomarker which can be used for evaluation.08 g/L. p < 0. C2 control group Creatine kinase activity (Fig. p > 0.01) and broilers fed BD with 0. p < 0.55 U/L.29±1.First International Symposium of Veterinary Medicine – ISVM2015 Our results showed no statistically significant differences (p > 0. 160 . There were no differences between C1 group (BD only) and I group of broilers (BD plus basil). 2) were also statistically significant higher in broilers fed with phytoadditives.99 1.05 Carcass yield 1605 1794 1768 1601 1715 Body weight Concentrations of total proteins (Fig.87 1.99 2654±70. In this experimental design we determined the lowest activity in group of broilers fed BD with 0. between groups of chicken.05).89 g/L.5% of Ocimum basilicum and 0.001) compared to C2 group (35.31±0.1±41.06 U/L. p < 0.05) in the growth performance indices (such as body weight.76 g/L.001) and III groups (26. ** p<0.001 vs. The effects of diet supplementation with 1% of Ocimum basilicum (I group).53 g/L) groups. p < 0. 0. C2 – control group fed with BD plus Salinomycin) on concentration of total proteins in broilers at the age of 56 days. The effects of diet supplementation with 1% of Ocimum basilicum (I group). Total proteins g/L 50 ** + *** ++ * 40 30 20 10 2 C gr ou p III ro up II g 1 C Ig ro up 0 Fig. not only of functional status of hepatocytes. The albumin concentrations (Fig.32 g/L.01.05).26±1.06 g/L). *** p<0. ++ p<0. 1) were statistically significant higher in groups of chickens supplemented with phytoadditives.

First International Symposium of Veterinary Medicine – ISVM2015 40 # *** +++ Albumin g/L 30 *** +++ ** ++ 20 10 2 C III gr ou p ro up II g Ig ro up C 1 0 Fig. * p<0. C2 – control group fed with BD plus Salinomycin) on concentration of total bilirubin in broilers at the age of 56 days.5% of Thymus vulgaris (II group) and 0.01 vs.001 vs.05.5% of Ocimum basilicum and 0. C1 – control group fed with BD.5% of Thymus vulgaris herba and 2% of Pimpinella anisum (III group).05 I group vs.01. ++ p<0.05.5% of Ocimum basilicum and 0. The effects of diet supplementation with 1% of Ocimum basilicum (I group). C2 – control group fed with BD plus Salinomycin) on creatine kinase activity in broilers at the age of 56 days. The effects of diet supplementation with 1% of Ocimum basilicum (I group). C2 control group Total bilirubin mol/L 15 10 ** + * 5 2 C gr ou p III ro up II g Ig ro up C 1 0 Fig. C1 control group. ** p<0. C2 control group. * p<0. II group Creatine kinase U/L 1000 800 600 * ** 400 200 2 C III gr ou p ro up II g Ig ro up C 1 0 Fig. C1 – control group fed with BD.5% of Thymus vulgaris herba and 2% of Pimpinella anisum (III group). 0. +++ p<0. ** p<0.5% of Ocimum basilicum and 0. 3. 2. *** p<0.01 vs. 0. C2 – control group fed with BD plus Salinomycin) on albumin concentration in broilers at the age of 56 days.01.5% of Thymus vulgaris (II group) and 0. # p<0. 4. ** p<0.5% of Thymus vulgaris (II group) and 0. 0. C2 control group 161 . The effects of diet supplementation with 1% of Ocimum basilicum (I group).5% of Thymus vulgaris herba and 2% of Pimpinella anisum (III group).001 vs. C1 – control group fed with BD.

5. C1 – control group fed with BD.0 Fig.5% of Ocimum basilicum and 0.01) and in II group (8.11±0.16 µmol/L.89±0.5% of Ocimum basilicum and 0. p < 0. 6.05) between broiler groups regarding concentration of glucose (Fig.001). 5) was the lowest in II group of broilers fed with addition of 0.5 ### *** +++ 1.5% of Ocimum basilicum and 0.03 mmol/L).20±0. 0.05 mmol/L) and C2 (1. The effects of diet supplementation with 1% of Ocimum basilicum (I group).25±0. C2 control group.5 2 C III gr ou p ro up II g 1 C Ig ro up 0.02 mmol/L) and II group (1.27±0.5% of Thymus vulgaris herba and 2% of Pimpinella anisum (III group). 6) Triglycerides mmol/L 1.14±0. *** p<0. p < 0.0 0. p < 0. We did not find any significant differences (p > 0.05) compared to C2 group. compared to C1 (1. The same statistical differences (p < 0.001 I group vs.5% of Thymus vulgaris (II group) and 0. C1 – control group fed with BD. usage of antibiotics has negative effects on animal’s health and production 162 .First International Symposium of Veterinary Medicine – ISVM2015 Concentrations of total bilirubin (Fig.5% of Thymus vulgaris herba and 2% of Pimpinella anisum (III group). C1 control group.001 vs. Triglycerides concentration (Fig.5% of Thymus vulgaris (II group) and 0.01 vs. ### p<0.001) were noticed between I (1. 4) were the lowest in III group of broilers (8. The effects of diet supplementation with 1% of Ocimum basilicum (I group). C2 – control group fed with BD plus Salinomycin) on concentration of triglycerides in broilers at the age of 56 days. II group Glucose mmol/L 15 10 5 2 C gr ou p III up ro II g Ig ro up C 1 0 Fig. But. 0. It is of interest to note that we did not find statistically significant difference between C1 (BD only) and C2 groups (BD plus Salinomycin).31 µmol/L. p > 0.06 mmol/L) of broilers.23±0. +++ p<0.5% of Thymus vulgaris (0.02 mmol/L. C2 – control group fed with BD plus Salinomycin) on concentration of glucose in broilers at the age of 56 days Discussion & Conclusion The practice of feeding livestock with subtherapeutic levels of antibiotics has been in use for over fifty years.05.

Plants and their extracts (called essential oils) possess antibacterial. also were much higher in herbal supplemented broilers.5% basil and 2% anis (III group). We presumed that potential synergistic effects between basil and thyme could result in beneficial effect on both the growth performance of broilers and their hepatoprotective effects. a number of spices and herbs have a long history of traditional use in treating elevated blood sugar levels. 163 . Later studies of Bakirel et al. now days consumers request poultry products that are free from residual chemotherapeutics..5% basil and 0. 2011).5% of Thymus vulgaris had a better feed conversion ratio and carcass yield compared to other groups of broilers.5% basil and 0. (2005). our study focuses on three plants used alone or in combination. the most higher values were recorded in group supplemented with mixture of 0. Namely. it is of interest to mention that our results showed that phytoadditives can improve growth performance in broilers. 2). are responsible for such liver response. glycogen synthesis. Moreover. although there were no statistically significant differences between control and experimental groups (Table 1). Furthermore. which could have alleviated the animals’ response. are important for detecting performance responses to plants used as feed additives (Catala-Gregori et al.. For example Jarvill-Taylor et al. very important as a part of defensive systems of an organism (and that they are elevated in this case).5% of thyme (Fig. Environmental conditions. the most remarkable are results in albumin concentrations (Fig. From productive point of view. since the liver is the only site for its synthesis. that broilers received BD with 0. (2008) showed that ethanolic extracts of rosemary leaves lowered blood glucose in normoglycemic and glucose-hyperglycemic rabbits. the contribution of this herbal combination should not be neglected in stimulation of broilers immune system. 2002). Our trial was performed under highly hygienic conditions. 2008). there was a significant decrease in total bilirubin concentration in birds fed diets supplemented with 0. Synergism among some herbal constituents was highlighted in the in vitro studies performed by Montes-Belmont and Carvajal (1998). the combination of some plants extracts could present better effect on the growth performance in poultry in comparison with their individual supplementation. If one takes into account that globulins are the second protein fraction.. Burt (2004) reported that an antagonistic effect has been expected as well. (2001) reported that cinnamon stimulated glucose uptake. But. 1). two major ingredients of basil (Lv et al. Although total protein concentrations were also affected by phytoadditives in BD (Fig. Weight gain is one of the most sensitive and informative measure of efficacy of certain additives (Conway et al. Dietary supplementation of our plants combination to chickens for 8 weeks did not cause a significantly lower blood plasma glucose concentration... alternatives to treat infectious diseases and agents promoting food preservation (Solorzano-Santos and Miranda-Novales. 1). where the relative concentrations of each phytomolecule may vary considerably (Orengo et al. 2009).5% thyme (II group) and 0. A decrease in total bilirubin level in the blood sera in the current study could be explained by stimulation of uridine diphosphate glucuronyltransferase enzyme (UDP-glucuronyltransferase). antifungal and antiviral properties and have been screened worldwide as potential sources of novel antimicrobial compounds.5% of Ocimum basilicum and 0. such as density and stress status of the animals. Total proteins. it is obvious from results showed in Table 1.First International Symposium of Veterinary Medicine – ISVM2015 (Marković et al. The use of natural products as an alternative to drugs may be the best solution to this consumer demand (Harper and Makatouni. Our results showed that 1% of basil had the best stimulatory effect on hepatocytes to synthesized albumin. and in this respect our results are contradictory. In the present experiment. 2011). Instead of testing each and every one. According to Ertas et al. 2012). 1999). and activated glycogen synthase in 3T3-L1 adipocytes. The aim of this research was to find what plant and effective doses of herbal additives could have a beneficial impact on the growth performance and health status of broilers. The herbal products are complex mixtures of ingredients. It is possible that eugenol and carvacrol.

Animal Feed Science and Technology...N. 177-184. 21. Ciftci M. 3.: Effects of borneol on blood chemistry changes in chickens. Idaomar M. 59. where this combination of phytoadditives significantly decreased the concentration of triglycerides in the blood of broilers. Poultry Science.. 3 and 4). 7. Acta veterinaria (Beograd). 2004 Catala-Gregori P. Undoubtedly.U. 116. Najafi and Torki (2010) found that total cholesterol. 2008 Bakkali F.. 4. 2010 Burt S.. Averbeck S.: Essential oils: their antibacterial properties and potential application in foods – a review. 623-629. Roura E. 10...G. 2008 Brenes A.. 2005 Bakirel T. 2. Fyfe L. 46. Sinsek U. It could be concluded that supplementation of the diet with phytoadditives has a potential to improve health status in broilers. 88. International Journal of Food Microbiology. except for the combination of 0. these findings coupled with total bilirubin concentration. Cobanova K. 9. 879-884. no changes in serum cholesterol and plasma lipids because of dietary supplementation of herb extracts (some monoterpens and essential oils) to broilers were observed. Further examinations are needed in order to elucidate the exact mechanism of action.E.. 8.5% thyme (Fig. (2009). (2005) found out that borneol inhibited glucuronidation of non steroidal antiinflammatory drugs in isolated rat hepatocytes. Bakirel U. Acknowledgment This work was granted by Ministry of education. suggest that wall of liver cells was strengthened in some way (Bakkali et al. McKenzie M. Smith H. Faix S. Dalkilic B. 2008 Conway D.D. Grant No III 46009...: Efficiency of a prebiotic and a plant extract alone or in combination on broiler performance and intestinal physiology. Kels O. science and technological development.: In vitro assessment of antidiabetic and antioxidant activities of rosemary (Rosmarinus officinalis) in alloxan-diabetic rabbits.: The effect of an essential oil mix derived from oregano... Dayton A. Republic of Serbia. 1999 Ertas O. 64-73. Yaroibi H.. 446-475. 2005 Faixova Z. Travel A.: Plant active components – a resource for antiparasitic agents? Trends in Parasitology. triglycerides and highdensity lipoproteins in the blood of broilers did not respond to the dietary supplementation of clove extract. Canadian Journal of Animal Science. This could be also applied to activity of creatine kinase activity. Siraki et al. 5. Little is known about the effects of herbs on lipid metabolism of broilers... 529-535. References 1. Mallet S. International Journal of Poultry Science. 2009 164 ... Averbeck D.. Piesova E.. 1-14. Food and Chemical Toxicology.P. 4. 5).A review. Journal of Ethnopharmacology. Orengo J. 2008).. Anthony JP.: Essential oils in poultry nutrition: Main effects and modes of action.: Comparative testing of anticoccidials in broiler chickens: the role of coccidial lesion scores.First International Symposium of Veterinary Medicine – ISVM2015 or by protective effects of essential oils presents in our combination of plants on wall of liver cells (Figs. On the other hand. Guler T.5% basil and 0. we found significantly decrease of its activity in the blood sera of broilers fed with combinations of basil and thyme (II group) and basil and anis (III group)... 158. Makova Z. 223-253.. 6.G. Our results are in line with these findings. The effect of some functional herb substances (cyclic terpenes) on serum cholesterol and total lipids in poultry were reported by Faxova et al.. Lessire M. 78. Ulgen S. clove and anis on broiler performance. Leng L. 94. There are several reports concerning an inhibition or activation of hepatic UDP glucuronyltransferase by certain plant constituents.: Biological effects of essential oils ... Namely. Takacova J.

20.J. Harper C. British Food Journal. 61. Martonova M.. Petrujkić B. Glamočić D. Liang H. World’s Polutry Science Association. Yuan Q.: The effect of supplementation of clove and agrimony or clove and lemon balm on growth performance...: In vitro antimicrobial effects and mechanism of action of selected plant essential oil combinations against four food-related microorganism. Journal of Food Protection. 9. Carvajal M. 2012 17. 23..G. 163-169.. 1164-1168. Marković R. Anderson R. O´Brien P. blood metabolites and immunocompetence of broiler chicks fed diets included essential oils of medicinal herbs. antioxidant status and selected indices of lipid profile or broiler chickens.First International Symposium of Veterinary Medicine – ISVM2015 10. Stanaćev V.R.... Miranda-Novales M. Garcia V.. Solorzano-Santos F. Current Opinion in Biotechnology. Makatouni A.G. Ruiz-Ibanez M. 104.. Najafi P. Marcincak S. Lević J.: A hydroxychalcone derived from cinnamon functions as a mimetic for insulin in 3T3-L1adipocytes. 69. 2001 12. 185... 44. 41.: Application of quantitative structure-toxicity relationships for acute NSAID cytotoxicity in rat hepatocytes. Del Rio L.: Control of Aspergillus flavus in maize with plant essential oil and their components.: Beneficial effect of phytoadditives in broiler nutrition. Veterinary Parasitology.G.... Buendia A.: Evaluating the efficacy of cinnamaldehyde and Echinacea purpurea plant extract in broilers against Eimeria acervulina.. Perić L. Marcincakova D. Buleca J..A.. Montes-Belmont R. Milić D. Stanaćev V. 151. 287-299... Krstić M.. Graves D. 2010 16.: Consumer perception of organic food production and farm animal welfare. Torki M. 174-91. Food Research International. 20. 27-37. Madrid J... 616-619. Hernandez F.J..: Essential oils from aromatic herbs as antimicrobial agents.. Puvača N. 1-6. Petrovic V. Siraki A.. 158-163. Lv F. Li C...: Effect of different growth promoters on broiler performance and gut morphology. 2009 14. Popelka P. Chemico-Biological Interactions. 2011 165 . Šefer D... Molnar L.. 327-336.. 2011 18. Journal of Animal and Veterinary Advances.: Performance.. Journal of American College of Nutrition. 1-8. 2002 11. 2011 13. Jarvill-Taylor K. 2013 19. Archivos de Medicina Veterinaria. 3057-3064. 1998 15....J.J. Catala-Gregori P. Orengo J. 2005. Kovac G. Simkova J. Chevaldina T. Journal of Animal Physiology and Animal Nutrition. Tuckova M.

Having in mind characteristic climatic conditions in Serbia in 2011/12 and 2013/14 production years. occurrence of plant diseases and pests and consequently. the toxin production.ac. Serbia * Corresponding author: sandra@niv. 2004). 2014). contaminated with deoxynivalenol (75%) and zearalenone (44%). Comparison of the data on climatic conditions with the levels and incidence of samples contaminated with aflatoxins and Fusarium toxins revealed negative effects of climatic deviations (precipitation rate and temperature) in the territory of Serbia on mycotoxicological safety of maize. Biljana Abramović4 1 Scientific Veterinary Institute “Novi Sad”. extremely humid climate conditions in 2013/14 production year resulted in particularly high concentration of Fusarium toxins. University of Novi Sad. and 90% with zearalenone. Consequently. Nadežda Prica1. Keywords: mycotoxins. 2011)..5 µg/kg. whereas 24% of examined 75 milk samples contained aflatoxin M1 at concentrations above 0. Milica Živkov-Baloš1.ns. Contrary to that.2% were contaminated with aflatoxins. high percentage of 16 examined samples of complete feed mixtures for pigs were declared unsafe... 2008) and zearalenone (Jajić et al. 2013).. Moreover. Novi Sad.First International Symposium of Veterinary Medicine – ISVM2015 THE INFLUENCE OF CLIMATIC FACTORS IN SERBIA ON MYCOTOXIN PRODUCTION Sandra Jakšić1*.. that is. aflatoxins were not identified as common contaminant of cereals in the territory of Serbia (Jakšić et al. Serbia 3 Faculty of Agriculture.. The available results on crops contamination for each year were correlated with the climatic conditions characteristic for the relevant year. climate. Kos et al. thus. Mycotoxins may possess carcinogenic. In warm and humid subtropical and tropical conditions. neurotoxic. Serbia Institute of Veterinary Medicine of Serbia. The mycotoxins of greatest concern in Serbia usually were Fusarium toxins such deoxynivalenol (DON. resulting in the formation of aflatoxins (Sanchis and Magan. Thus. Mycotoxins cause individual toxic effects to human and animal health. Out of 67 examined maize samples. immunosuppressive. Belgrade. cytotoxic. Novi Sad. Serbia 4 Faculty of Sciences. University of Novi Sad. Zoran Mašić1.rs 2 Abstract Marked climate changes led to frequent droughts and high temperatures that favor the growth of molds. but also ochratoxin A as Aspergillus toxin (Jakšić et al.. 2013). Ksenija Nešić2. high concentrations of fumonisins were not recorded either (Jakšić et al. Until now. Extremely warm and dry 2011/12 production year (according to the report of Republic Hydrometeorological Service of Serbia) was characterized also by high aflatoxin levels in maize. estrogenic or teratogenic activity (Nešić et al. Jajić et al. 2014). 61. 2012). they were not addressed in legal regulations pertaining to animal feed (Official Gazette RS. 2011. our research was aimed at investigating their influence on contamination of animal feed and potential consequent poisoning of milk by specific mycotoxins. Igor Jajić3. feed. milk Introduction Mycotoxins are toxic compounds produced by filamentous fungi. 100% of 21 examined maize samples were contaminated with deoxynivalenol and fumonisins. however. cumulative effect of low mycotoxin 166 . maize ears are ideal conditions for colonization and dominance of Aspergillus flavus/parasiticus species. and consequently animal feed and milk. which often contaminate cereal food and feeds.

93 aw) Fusarium verticillioides. and alterations in these are expected to have a wide range of impacts on plants and on mycotoxins concentrations in plants (Miraglia et al.90−0.98 aw) 25 (0. 2010). etc. a producer of the fumonisin toxins. Fungus species Aspergillus flavus Aflatoxins 33 (0.. graminearum. On the other side. Table 1.99 aw) Mycotoxins production Ochratoxin Zearalenone DON 15−30 (0.. Production of mycotoxins on crops depends on climatic factors such as temperature and relative humidity. verticillioides. F. mild temperature and rain during maize plant growth is conducive to plant infection by F.95 aw) Conditions adverse to the plant (drought stress. Optimal temperature (ºC) and water activity (aw) for mycotoxin production and growth on different substrates (Sanchis and Magan. and which are marginal and which are optimum for germination. parts of Europe and the United States of America. Accurate information is therefore needed on the impact of and relationship between key factors related to climate conditions (water availability and temperature). factors influenced by climate such as insect and other pest attack.g.95 aw) 30 (0. poor nutrient status. Therefore. changing climate has a direct impact on mycotoxin production (Paterson and Lima. is the most common species on maize in Southern Europe. graminearum A. soil condition and nutrient status and agro-industrial methodology are potential and indirect triggers of fungal colonization and mycotoxins production (Tirado et al. Temperature and rainfall are the climatic factors that are most likely to be affected widely by future global change. 167 . the production of the toxins will be favored by the foreseen climate change. graminearum and DON levels (Miraglia at al. growth and toxin production (Sanchis and Magan. such as F. 2011). 2009). F.) encourages the fungal partner to develop more than under conditions favourable to the plant with the expectation of greater production of mycotoxins. 2009). Fumonisins have been associated with dry weather during grain fill and late season rains. While drought years may take most of crop value in the case of aflatoxin problems. verticillioides. temperature stress.. F. According to Paterson and Lima (2010) the biggest risk with respect to mycotoxins from climate change will be found in developed countries with temperate climates (e.98 aw) 25 (0. and the dominant species is determined by meteorological conditions.98 aw) F.98-0.995 aw) 30 (0. thus.95 aw) 30 (0. proliferatum 25 (>0.90 aw) 20−22 (0.) and the anticipated climate changes will present numerous challenges for those involved in mycotoxins research and crop production in the near future. 2004). and A. 2013).99 aw) Growth 35 (0. Maize can support different mycotoxin-producing molds.First International Symposium of Veterinary Medicine – ISVM2015 concentration and potential synergistic effects of low levels of multiple mycotoxins are issues that are receiving growing attention (Stojanov et al. etc.. ochraceus Penicillium verrucosum Fumonisins 25−30 (0. stress induced by pest attack. Table 1 shows the optimal temperatures and water activity (aw) for mycotoxins production and growth in vitro for some important plant pathogenic fungi. flavus. changes in global temperature would directly affect their growth and mycotoxins production capacity.96−0. Therefore. 2004).

deoxynivalenol. Modelling studies provide increasingly realistic scenarios for the influence of changes in the magnitude and variability of precipitation. 2009. RBiopharm. No. aflatoxin M1. yet suspect because of evident health problems on related pig and poultry farms. Table 2. Recovery was 101% for aflatoxins. Paterson and Lima. No. Special software. The level of aflatoxin M1 was examined in 75 milk samples. lot #A-S-267. the detection limits (DL) were 1. R1121). China) and is inversely proportional to the mycotoxin concentration in the sample. and milk were analyzed by enzyme-linked immunosorbent assay methods.2 . DL Min Mean value Positive/ Positive samples Toxin Max (µg/kg) (µg/kg) (µg/kg) (µg/kg) total no. The samples originated from different localities of Serbia.. feed. Aflatoxin content in maize samples in Serbia. No. directly on the production line. harvest 2012 are presented in this article. Materials and methods The results of determining the contents of total aflatoxins in 67 maize samples. the Rida®Soft Win (Art. 103% for DON. Z9999. The presence of total aflatoxins. Results and discussion Contamination of maize and milk by aflatoxins in 2012 Having in mind characteristic climatic conditions in Serbia during 2012. The contents of Fusarium toxins: deoxynivalenol. as well as by participation in proficiency testing scheme (milk powder sample FAPAS 04224).75 µg/kg (ppb) for aflatoxins. R3401) and Ridascreen®FAST Zearalenon (Art. No. R5901). etc. aflatoxin concentration has been examined in selected maize samples (Table 2). Having in mind characteristic climatic changes that resulted in specific extreme conditions in Serbia in 2011/12 and 2013/14 production years. feed and potential consequent poisoning of milk by specific mycotoxins. with a view to providing the necessary foresight for strategic adaptation to climate change (Miraglia et al. Germany). of samples (%) Aflatoxins 1. lot #Z-C-320 (Trilogy Analytical Laboratory. and 25 µg/kg for fumonisins. together with the development of models to forecast the effects of climate change on mycotoxins. Washington.75 2. fumonisins (FB) and zearalenone in corn. R5502) test kits (R-Biopharm.36 168 41/67 61. TR-F100. which particularly affected maize production. Ridascreen®Fumonisin (Art. lot #F-C-439. Milk samples were collected from milk collecting points or dairy plants. 105% for aflatoxin M1. R5202).First International Symposium of Veterinary Medicine – ISVM2015 A high priority over the next decade is the collation of accurate contamination and weather data. 5 ng/kg (ppt) for aflatoxin M1. USA). 99% for fumonisins. 2010).11 156 37. on mycotoxins contamination. and 90% for zearalenone. lot #DW-174 and ТR-Z100. Laboratory detection limit for zearalenone was 60 µg/kg. Ridascreen®FAST DON (Art. zearalenone and total fumonisins were examined in 21 maize samples (harvest 2014) as well as 16 samples of complete pig mixtures and 7 complete poultry mixtures. No. The analytical quality of the ELISA method was assured by the use of certified reference materials: TR-A100. Ridascreen®Aflatoxin M1 (Art. using Ridascreen®FAST Aflatoxin (Art. temperature. No. Thermo Scientific. was used for the evaluation of enzyme immunoassays. The investigated samples were a part of animal feeds that were submitted to our laboratory for regular control. Germany). our research was aimed at investigating their influence on contamination of maize.2 mg/kg (ppm) for DON. TR-D100. The color intensity is measured photometrically at 450 nm (Multiskan FC. harvest 2012. 0. According to the manufacturer´s description.

thus in that case 22. and with very little precipitation. 61. 2010). 68. 2012). 2013).50−0. ideal for the development and activity of plant pests. of samples Toxin Aflatoxin M1 DL* (µg/kg) Positive/ total no.4% with concentration above 50 µg/kg and with a maximum concentration reaching even 145. No.5 µg/kg aflatoxin M1.80 (µg/kg) 0. maximum permitted content of aflatoxin B1 in animal feed is 30 µg/kg. Researches on aflatoxin in maize (harvest 2012) in Serbia of other authors revealed similar results: 56% positive samples out of which 5.5 µg/kg.e.4% of examined samples would have been declared unacceptable. Weather conditions negatively affected the tasseling.First International Symposium of Veterinary Medicine – ISVM2015 As obvious from Table 2.. During this period. which was maximum permitted level in animal feed according to the relevant Regulation in Serbia of that time (Official Gazette RS. pursuant to new Regulation (Official Gazette RS. one can conclude that summer 2012 was the hottest one in Serbia since record began.3% of the samples would have been declared unacceptable for human consumption because of aflatoxin concentration above 0. 2010).. 2014). i. silk production and fertilization of corn.05 55/75 73. thus not complying with the legislative regulations in Serbia of that time (Official Gazette RS. According to the aforementioned report of the RHMZS. the samples were diluted. 2013). however. The hottest and driest period (30 June-25 July) in the major part of the territory coincided with the most important generation phases of spring crops. dramatically accelerated ripening of the majority of crops has occurred. Three heat waves were recorded in Serbia in the period from June to August 2012. thus determination range encompassed concentrations from 0. Prolonged periods of extremely high air temperatures during June. Maize contamination with high levels of aflatoxins has lead to consequent milk contamination with M1. and was ready for harvesting as early as end August (RHMZS. Out of 67 examined samples.05 µg/kg Table 3. The results of the examination of milk samples are displayed in Table 3. the level of total aflatoxins exceeded 50 µg/kg. Such conditions were. Maize was the most endangered crop of all. a metabolic product of aflatoxin B1. hydro-meteorological extremes ranging from heat and cold waves to severe and prolonged drought. Eighteen (24%) examined samples contained more than 0.05−0. When analyzing the obtained results in relation to EU regulations (EC.3 37 8 10 * Because of high toxin concentration and max permitted level of 0. of samples Positive samples (%) 0.5% revealing toxin content >50 µg/kg (Kos et al.e..50 (µg/kg) 0. 73. Such conditions favored the occurrence of Fusarium infection and increase in pest population.2% of samples revealed aflatoxin levels above DL. Contents of aflatoxin M1 in milk samples in Serbia in 2013.. the worst situation was recorded in Vojvodina region. July and August 2012 as well as precipitation deficit resulted in severe and extreme draughts in many regions of Serbia. Namely.8 µg/kg (Škrinjar et al. i. thus causing substantial damage and losses in agricultural crops production manifested by high concentration of aflatoxins in maize and consequently in milk. 2013). Consequently.5% positive samples with 29. with an average precipitation rate of only 25%.05 to 0. Poorer qualitative and quantitative crop yield can be attributed to both unfavourable combination of temperature and humidity conditions in the periods of the year coinciding with the most critical stages of plant development and inadequate implementation of appropriate agro-technical measures. 169 .80 µg/kg According to the report of the Republic Hydrometeorological Service of Serbia. Positive deviation of maximum daily temperature as compared to the annual range of average daily temperatures was even up to 13°C.80 (µg/kg) > 0. 2012-production year was characterized by pronounced climatic changes. 14 (21%) were unacceptable for animal feed.

42 Complete poultry mixtures DON Zearalenone Fumonisins (mg/kg) (µg/kg) (mg/kg) 7 Not 7 legislated 6 7 0 0 3. DON and fumonisin contamination was confirmed in 100% of examined maize samples.47 574 144 2.5% of samples were contaminated with zearalenone.901 2.82 0.449 min content Average Total number of samples Number of positive samples Number of inappropriate samples max content min content Average Total number of samples Number of positive samples Number of inappropriate samples max content min content Average 2. 2014.7% and 100% samples.28 Complete swine mixtures DON Zearalenone Fumonisins (mg/kg) (µg/kg) (mg/kg) 16 16 16 16 16 16 12 7 0 5. high percentage of pig mixtures were declared inappropriate according to the Regulation because of increased contents of DON (75.207 83 0. in Serbia Corn DON Zearalenone Fumonisins (mg/kg) (µg/kg) (mg/kg) 21 21 21 Total number of samples 21 19 21 Number of positive samples Number of inappropriate 0 0 0 samples 7.82 337.24 0. Concentration of Fusarium toxins in samples of animal feed and maize (harvest 2014). whereas 90.15 0.82 1. Fumonisin concentration in examined samples did not exceed the maximum permitted values according to EU 170 .4 3.7%). Table 4.6 2389 10. 4000 µg/kg for zearalenone and 60 mg/kg for fumonisins (Official Gazette RS. Although the concentrations of the examined mycotoxins in maize did not exceed the maximum permitted levels (8 mg/kg for DON.0%) and zearalenone (43. high incidence of samples positive to Fusarium toxins was recorded in maize samples.First International Symposium of Veterinary Medicine – ISVM2015 Contamination of maize and animal feed with Fusarium toxins in 2014 The results on the contents of some Fusarium toxins in maize (harvest 2014) and animal feed are presented in Table 4. 2006)).837 1. maize contamination with these mycotoxins consequently resulted in large number of contaminated samples of complete pig mixtures (100% samples contaminated with all three toxins) and complete poultry mixtures (DON and fumonisin contamination of 85. respectively).83 According to the results presented in Table 4. As complete feed mixtures contain large proportion of maize.311 4.17 0.6 1.12 433.2 max content 0. EC.

2.. L 229: 79. maize diseases and insects and thus reduce the risk of mycotoxin contamination. By mid May. Jurić V. Acknowledgments The work was financially supported by the Ministry of Education. 2013 171 . 2006/576/EC. References 1. The obtained data on the level of mycotoxins and correlation of their contents are useful instrument for developing a model to improve prediction of risks for mycotoxin contamination in Serbia. weather conditions in the territory of Serbia in 2014 revealed several extreme deviations as compared to the annual range of average values for this climatic region. 11. Krstović S.. Abramović B. Conclusion Based on the analysis of the content of examined mycotoxins and agrometeorological factors we can conclude that temperate climate is the determining factor for mycotoxicological safety of cereals in the region of Serbia.: Occurrence of Deoxynivalenol in Maize and Wheat in Serbia. the territory of Serbia was characterized by abundant rainfall. 2006 EC (European Commission): Commission Regulation 165/2010 of 26 February 2010 amending Regulation (EC) No 1881/2006 setting maximum levels for certain contaminants in foodstuffs as regards aflatoxins. however. The presented results indicated that humid climatic conditions in 2014 significantly contributed to the development of Fusarium moulds and consequent mycotoxin production in maize.. the average rainfall recorded in Serbia was 700 mm. the precipitation rate was 2-3 times higher as compared to the multi-year annual average. 2008 Jajić I.. 124. 9. their presence should not be neglected because of their potential cumulative and synergistic toxic effects with DON and zearalenone. Proceedings for Natural Sciences. Perišić B. O. L 50: 812. The summer 2014. According to the report of RHMZS... Matica Srpska Novi Sad. 2006). Such extremely humid and rainy weather brought about a number of plant diseases such as blight and decaying fungi as well as intensive activity of the European corn borer (Ostrinia nubilalis). zearalenone. thus resulting in delayed harvesting. The deviation from annual average precipitation and temperature values. 2014). During the vegetative period (April-September) 2014. EC (European Commission): Commission Recommendation of 17 August 2006 on the presence of deoxynivalenol. Jakšić S. (June-August) was characterized by moderately warm and extremely rainy and humid season. T-2 and HT-2 and fumonisins in products intended for animal feeding. 21142126. Science and Technological Development of the Republic of Serbia (Project No 172042). increased grain moisture content as well as grain damage caused by mouldy corn agents such as Fusarium and Penicillium was recorded (RHMZS. In the major part of the country. that is. Bursić V. Frequent rains and increased air humidity contributed to significantly slower ripening of maize. 2010 Jajić I.: Presence of zearalenone in the most commonly grown wheat cultivars in Serbia. Glamočić D. Even though this rainy year contributed to record maize yields. precipitation surplus or droughts as well as prolonged periods with extremely high temperatures. 3. 101-109. impose the necessity of applying all available agro technical measures to prevent development of fungi. which has never been recorded so far. International Journal of Molecular Sciences.. which is the highest rate of rainfall during vegetation period recorded in the last 45 years. 4. ochratoxin A. J.First International Symposium of Veterinary Medicine – ISVM2015 regulations (EC... O. J.. Abramović B.

: Correlation between the limit values of laboratory and clinical mycotoxicosis.R... Reviews of Environmental Contamination and Toxicology.. 12. 120. 2012 Kos J.. Journal for Natural Sciences.: How will climate change affect mycotoxins in food? Food Research International. 27: Pravilnik o izmeni pravilnika o kvalitetu hrane za životinje.. Jocković Đ. Kleter G. 8. Food Control.A.M. 2010 Paterson R.rs/ciril/meteorologija/agrometeorologija..: Climate change and food safety: A review. 43.. 4 : Pravilnik o kvalitetu hrane za životinje. 615-619. 3. Zlatibor. P. Mihaljev Ž. 124. Battilani P.... 3134. Milanov D. Magan and M.pojava.. Sanchis V. Piva G.. 7. Food and Chemical Toxicology.2013. 1902-1914.. Clarke R. J. Živkov-Baloš M. Lima N. 325-332. 4959. 2014 Paterson R. 2013/2014.gov. 2011 Jakšić S. Toti L.R. 2013 Miraglia M.. Zbornik referata 47. 17. 2013 Škrinjar M.hidmet. 2010 Official Gazette RS.: Co-occurrence of Fumonisins and Deoxynivalenol in Wheat and Maize Harvested in Serbia. 7. 47. zakonska regulative. 10. 5. 15. http://www.. 228. Jakšić S. 2555-2566. Filippi L. Abramović B. Abramović B. Pristupljeno 05. Mycotoxins in food: Detection and control.. čl. 19. Despotović V. 13.com/products/food-feed-analysis/mycotoxins. Mastilović J. Food Research International.: Fumonisins and co-occurring mycotoxins in north Serbian corn. Boca Raton.. N. Dekkers S.Y. 89.02.php. 11. L. In. 27-32. Jaykus L.. 2004. 20. Mycotoxins. Prandini A.. 16. RHMZS (Republički hidrometeorološki zavod Srbije): Agrometeorološki uslovi u proizvodnim 2011/2012. Croci.C. No. van den Born G. Matica Srpska Novi Sad.. 2013. 6. 1745-1765. Potkonjak D. 99 i 101.: Further mycotoxin effects from climate change. 14.V. Kapetanov M. 20: Pravilnik o maksimalno dozvoljenim količinama ostataka sredstava za zaštitu bilja u hrani i hrani za životinje i o hrani i hrani za životinje za koju se utvrđuju maksimalno dozvoljene količine ostataka sredstava za zaštitu bilja. 1009-1021... Nešić V. Proceedings for Natural Sciences. Brera C.Z. Matijević Z.. No. Prunić B... Coni E. Hutjes R.: Natural occurrence of aflatoxins in maize harvested in Serbia during 20092012. 9..: Environmental conditions affecting mycotoxins..M.C. 18. uticaj na ljudsko zdravlje.M... Eds. Kocić-Tanackov S. Jajić I. Stojanov I. 7. http://www..W..A. Šojić D. 3–9. Lima N. Bulletin of Environmental Contamination and Toxicology. 9.M... De Santis B. 2011 R-biopharm... McQuatters-Gollop A.r-biopharm.04. Srbija. Pisante M. Ivanović S. Tirado M...M. 174-189. 2014 Official Gazette RS. Janić Hajnal E. FL: CRC Press.. 43. 34. Bjelica L. No. 1..: Climate change and food safety: An emerging issue with special focus on Europe. godinama na teritoriji Republike Srbije. 2010 172 . Cubadda F. 101-120. Marvin H. 44..First International Symposium of Veterinary Medicine – ISVM2015 5. Matica Srpska Novi Sad.: Fusarial Toxins: Secondary Metabolites of Fusarium Fungi.M.. Magan N. Food Research International. Jajić I.J.2015..04. A... Sarić B. Olsen.2015... Radulović Prodanov J. Jakšić S.. 2009 Nešić K. Pristupljeno 05. Živkov-Baloš M. Vespermann A..: Aflatoksini u žitaricama i proizvodima na bazi žitarica . Frank J. 2013 Official Gazette RS. Noordam M. Savetovanje agronoma Srbije.

The “technologically enhanced naturally occurring radioactivity” is attributed to uranium. Serbia * Corresponding author: zeljko@niv. To determine the soil levels of natural radionuclides the samples were collected from 11 localities in the territory of Vojvodina. Milica Živkov-Baloš1.ns... ICP-MS Introduction Natural radioactivity implicates presence of radioactive elements that have been present in nature since the formation of Earth and the very beginning of formation of its entire living world (biosphere). 1994). nuclear reactor accidents. Uncontrolled application of phosphate fertilizers 173 . include also uranium-235. industrial and medical use of radioactive compounds) and application of phosphate mineral fertilizers in agricultural production lead to substantial environmental contamination. which is brought to the environment through diverse technological procedures and agro technical measures (Rajković. Sandra Jakšić1. mining of ore containing heavy metals (zinc.. Some other natural radionuclides. knowing of radioactive contamination of the soil is of great importance for radiation safety issues in biotechnology (Petrović et al. Land contaminated with radionuclides represents the first link in the food chain and hence the radioactive contamination of crop and livestock production. thorium and their prodigy (Kisić et al. The values for concentration of radionuclide activity measured in the examined samples do not significantly diverge from standard values for agricultural soils.rs Abstract Peaceful uses of nuclear energy (nuclear weapons testing. which represents the first link of the ecology chain: soil-vegetation-animals-man. as well as the thermal power stations producing huge amounts of solid waste (ash. 2006). reactor accidents. and it is considered background radiation or natural phon. radium-226 and radon-222 (Levant. and their amounts vary according to the locality (Mitrović et al. soil.ac. Radioactive contamination of the soil is either natural (formed without man’s activity) or human produced (nuclear testing.. 2013) increase the levels of soil radioactivity. 2006). Novi Sad. The exposure to low-level radiation originating from these natural elements has been always affecting all living beings on Earth. The largest source of radiation activity of the soil is a natural radionuclide potassium-40 (Dželalija. predominantly through intensive application of agro-technical measures based on the use of artificial phosphate fertilizers that contain substantial amounts of natural uranium. Moreover. cinder) that contain natural radionuclides such as uranium. thus. copper. Abundant researches revealed substantial differences in the levels of natural radionuclides between particular localities at Earth’s surface. 2001). 1996). Dragana Ljubojević1. Technological development resulted in substantial increase of natural soil radioactivity. thorium-232. Miroslav Ćirković1. The soil plays a crucial role in the process of radionuclide distribution and transfer. The basic component of the biosphere is lithosphere (Earth’s crust). Nadežda Prica1 1 Scientific Veterinary Institute “Novi Sad”. Key words: natural radionuclides. uranium-238. 1996).First International Symposium of Veterinary Medicine – ISVM2015 RADIOACTIVITY OF THE SOIL IN VOJVODINA (NORTHERN PROVINCE OF SERBIA) Željko Mihaljev1*. led) from deep layers of lithosphere and processing thereof. which have always been present on Earth. radioactive waste) (Dobrić et al. Brankica Kartalović1. The measurements were performed applying inductively coupled plasma with mass spectrometry.

Contrary to other radioisotopes.. 2001). The amount of radioactive material from the soil absorbed by plants is directly proportional to the pollution emission density at particular territory (Simić M. The majority of soil samples were of “chernozem”-type (Živković et al. The samples were collected only from flattened soil surface at the depth of 10-20 cm. All samplings (at each of 11 localities) were performed by collecting soil samples from 10-15 different points at the total surface of 100m2. The most important physico-chemical properties include chemical composition (concentration of minerals and content of organic matter). 226Ra is a long half-life -emitter. 226Ra and 222 Rn being the most dangerous members of uranium chain. and hence in plants and other links within the food chain.U(SO4) (Mitrović et al. moisture content and crop density. structure (mechanical composition).. Emissions of those radionuclides into the environment represent potential significant risk factors for the exposure of local inhabitants to ionizing radiation. The amount of 1g of homogenized sample was weighed and decomposed in HNO3 and H2O2 mixture using the wet digestion method and the system Ethos. 1972). Microwave Labstation. manifesting affinity for accumulating in bones.. Milestone. Uranium content was determined using Agilent 7700x Series ICP-MS. Material and Methods Soil samples were collected from 11 localities in the territory of Vojvodina (Table 1) during 2014. uranium is deposited as highly water-soluble uranyl sulphate UO2(SO4) and urano-sulphate . pH. Geographical view of sampling locations 174 . 1989). as well as for increased levels of natural radiation in particular regions. Figure 1. In a superphosphate. Dried soil samples were mechanically crushed (ground) to obtain fine powder. radioactive decay of 238U and 232Th results in formation of the series of unstable nuclei. its physico-chemical properties that significantly affect the resorption rate of radioactive material. while gaseous 222Rn is responsible for internal irradiation of lung tissues.First International Symposium of Veterinary Medicine – ISVM2015 implicates substantial potential for undermining of ecological balance as they represent the most powerful source of 238U and 232Th content in the soil. Subsequently. 2011). and data analysis was performed by MassHunter Workstation software. removal of mechanical impurities (mainly stones and plant particles) has been performed. that is. The samples were dried at 1050C until reaching the constant mass (IAEA. The transfer of radionuclides from the soil into the plants is substantially dependant on the soil type. Involvement of particular radionuclides into biological cycle is associated with plants ability to absorb radioactive elements from the soil via their root systems.

85 ± 0.78 ± 0. potential contamination of the soil in Vojvodina with depleted uranium caused by NATO bombing in 1999 is widely accepted public opinion.24 3. Obvious variations in potassium content in soil lead to the conclusion that incorporation of radionuclides from the soil into the plants largely depend on pedological properties.63 ± 0.33 22.08 1. 175 .30 ± 1.09 2.22 ± 0.49 ± 0.5 nm and using cesium as the ionization-suppressor. what is in accordance with the results of our previous researches (Ćupić et al.18 3.09 1.12 ± 0. 1973).55 ± 0.42 23.57 ± 0.55 30.87 ± 0.84 ± 2. One can also conclude that potassium-40 is predominant natural radionuclide in the soil as compared to other radionuclides.59 31. All aforementioned factors strongly suggest the importance of comprehensive assessment of the soil radioactivity status in Vojvodina (Bikit et al. 1973).28 40 K activity [Bq/kg] 516.08 1.10 Bq/mg U for 238U (Eisenbud.08 1.63 ± 1. 235U and 238U. The obtained levels of Kconcentration and 40K activity are considered common values for the soil and are in full accordance with the results of other authors (Bikit et al.02 ± 0.4 405.5 ± 10. Potassium content was determined using the method of emission spectrophotometry on Spectr AA–10.10 1..1 502.64 ± 1.28 ± 0.72 ± 0.37 ± 0.30 11.64 39. as well as the activity levels of natural radionuclides 40K. Locality 1.65 ± 0.88 ± 0.87 ± 0.16 3.4 ± 15.14 2.51 ± 0.6 344.84 ± 4.71 ± 0.6 690. Despotovo 4.17 17.54 15.80 ± 0.36 ± 0. Table 1. Bački Brestovac 10.35 238 U activity [Bq/kg] 52.58 21.84 ± 0. The soil levels of potassium-40 activity were calculated from total potassium.06 15.3 ± 12.9 Bq/kg.570 Bq/mg U for 235U and 11. Table 1 displays the results on potassium and uranium concentrations.83 Discussion and Conclusion The results displayed in Table 1 revealed potassium contents in the examined soil samples ranging from 10.First International Symposium of Veterinary Medicine – ISVM2015 The activity levels of uranium-235 and uranium-238 in soil samples were determined according to total uranium concentration using mass activity values 0.03 ± 0. soil exploitation.47 34.91 ± 0.53 35.4 ± 19.14 2.73 43.76 ± 0.5 695.35 17. 2010).16 33.09 1.14 2. Temerin 5.74 ± 0.91 ± 0. using the mass activity value for potassium being 31. 1990).76 ± 0. at wavelength 766.0 554. manufactured by Varian. emissions from nuclear plant reactors in neighboring regions cause contamination of the air and water in a wide area.39 ± 6.3 559.08 ± 1.19 3.9 U content [mg/kg] 4.561 Bq/g K (Eisenbud.10 1.0 476. Results The soil in Vojvodina region undergoes radioactive contamination from diverse sources.16 3.84±4. 2011).86 ± 1.92 ± 0. Intensive application of phosphate fertilizers with high uranium content potentially causes gradual increase in the activity level of uranium chain in the soil.6 ± 17.24 10. Rumenka Average value ± SD K content [g/kg] 16.29 12. Bački Jarak 11. Moreover.49 g/kg with an average value for all localities being 16.89 ± 0. Čurug 8.28 g/kg.45 16.57 ± 0.97 37. Mihaljev et al.2 741.3 ± 13. agrotechnical treatments as well as on the type of plants.6 ± 11.18 ± 2.15 2.70 31. with an average activity level for all localities being 531.1 ± 17. Lovćenac 7.06 ± 0. 2005.08 ± 0.91 to 23.08 1. Zmajevo 3.3 – 741.42 ± 1.86 29.4 ± 14.6 359.13 3.62 235 U activity [Bq/kg] 2.97 ± 1.40 ± 0.11 1. Contents of potassium and uranium and concentration of potassium-40.14 3..1 531..4 ± 134. uranium-235 and uranium-238 activity in soil samples No.8 ± 19.3 ± 18.24 ± 0. These values correspond with the potassium-40 activity concentration in a range 344.4 ± 134. Above all.60 ± 0..40 ± 1.4 Bq/kg.80 36.17 2. Bač 2. Čenej 6.96 ± 1. Kisač 9.

. Vienna. 2006 Dželalija M. Radonjić V.... food. Science and Technological Development of the Republic of Serbia. Nikolov J. Kemijsko-tehnološki fakultet. Mrđa D.... 34-37 Ćupić Ž. Đurović B. 2011)..: Merenje radioaktivnosti zemljišta na teritoriji AP Vojvodine. 5..: Environmental Radioactivity.71 Bq/kg. Maria CurieSklodowska University. Proceedings of the International Symposium on Post-Chernobyl Environmental Radioactivity Studies in East European Countries.87 ± 0.. Novi Sad. Departman za fiziku. Hansman J. Ivančev A. 5. 729-738. establishing limits for the contents of natural radionuclides (238U.:Prirodna radioaktivnost uglja i letećeg pepela u termoelektrani „Nikola Tesla B”. Jovančević N.: Total beta activity.. Vrnjačka Banja. 40K) in mineral and phosphate fertilizers as potential sources of radioactive contamination of soil.: Contamination of Soil and Food with Radionuclides from Chernobyl. Poland. building materials and other goods that are placed on the market (Official Gazette of RS.84 Bq/kg. It is therefore an attractive alternative for monitoring uranium because can detect the normal environmentally caused concentrations (Schramel et al.83 Bq/kg.35 Bq/kg and 238U = 29. 4. The importance of natural radionuclides as potential pollutants in agricultural and livestock production is addressed in the latest addendum to the Ordinance on the limits of radionuclides in drinking water. Mihaljev Ž. Soil contamination with wet or dry atmospheric precipitation and materials characterized by technologically increased level of natural radioactivity can represent a permanent reservoir of radionuclides that significantly contribute to the overall radiation exposure and total population radiation dose. 1990.. We also may conclude that ICP-MS (inductively coupled plasma mass spectrometry) proved very sensitive method for quantitative determination of uranium concentration in soil samples (Sahoo et al. Krmar M... average value 36..: Ionizirajuće zračenje u biosferi. 1997).51-2. Systematic monitoring of radioactivity level of agricultural soil is of paramount importance in Vojvodina... Bikit I.. 63. 2010 Bikit I. 67. Godine. Similar results on uranium concentration in the soil and the activity concentration for radioactive uranium-238 were reported by other authors (Skipperud et al. average value 1. as the region with extremely high potential for production of safe food. Živkov-Baloš M.. Hemijska Industrija. 11a. project No TR 31084. 6. Academic Press. Čonkić Lj. Lublin.. Mihaljev Ž.First International Symposium of Veterinary Medicine – ISVM2015 Uranium contents in soil samples were uniform. ranging within an interval 2.. Sveučilište u Splitu. Slivka J.. 7. 226Ra..42-52.:Nuklearni akcidenti u svetu od 1950 do 2005. References 1. Kljajić R.76 mg/kg with an average value for all localities being 3.65-4. Univerzitet u Novom Sadu. Vesković M. 2013 176 .28 mg/kg (Table 1). New York. 2. Split. Vojnosanitetski pregled. Based on these values. Todorović N.39 ± 6. This addendum introduced the new article. 465-469. 245-248 Dobrić S. animal feed. Kazimierz -1990. drugs. 1989 Kisić D. the following activity concentrations for uranium were calculated: 235U = 1. Radanović S. 3. 8. 5. No. Proceedings of XI international feed technology simposium-Quality Assurance. 1973 International Atomic Energy Agency-IAEA: Measurement of Radionuclides in Food and the Environment. general use items. Prirodno-matematički fakultet. Forkapić S. 2006 Eisenbud M. 2011). 97/13). Acknowledgments The work was financially supported by the Ministry of Education. potassium-40 and residual beta activity in alfalfa samples in Vojvodina region. Filipović J. 2005. Miletić S.

Proceedings of XV International Eco-Conference. 2011 Sl. br 97/2013. Kljajić R.. 167-182. Mitrović R. Veterinarski Glasnik 65.. Uranium and rare Elements Concentration in Weathered Japanese Soil Samples... glasnik RS.. Radošević B. 16..: Prirodni kontaminanti životne sredine. 2001 Sahoo S.:Uticaj radioaktivnog zračenja na ljudski organizam. Mikrochimica Acta.. Sorimachi A. Tokonami S..: Soils of Vojvodina. Tanasijević Đ. 281-287 Mitrović B. 1-2.: Sistem radijacione kontrole u biotehnologiji.K.. 30-32..: Thorium.. 15. 1996 Mihaljev Ž. Novi Sad. Stojković L. Salminen S.: Radijaciona zaštita u biotehnologiji. lekovima. Ćetojević D.. 1... Kovačević J. Environmental Protection of Urban and Suburban settlements II. Banja Luka. Vitorović D.. 1-2... 1st International Conference Ecological Safety in post-modern environment. Hemijska Industrija. 45-57..: Osiromašeni uranijum – Uranijum. Posebno izdanje Agencije za posebni otpad-APO. Petrović B.. nks-243. 13. DP Institut za mlekarstvo. 123-140. Hosoda M. Kamagata S.. 4.First International Symposium of Veterinary Medicine – ISVM2015 9. 2011 Mitrović R. 1994 Rajković M. Drezgić P.: Total beta activity. Book of Abstracts. Mijatović D. 2011. 12.: Method for the Determination of Thorium and Uranium in Urin by ICP-MS. Potassium-40 activity and residual beta activity in different Tea Samples. Pravilnik o dopuni Pravilnika o granicama sadržaja radionuklida u vodi za piće.. Sigmarsson O. predmetima opšte upotrebe. Ćupić Ž. 2001 Skipperud L. Jović V. Nejgebauer V..: Methods-MS.. Institute for agricultural research. 19.. 10. 21. Wendler I.. Ishikawa T. 126.. Palsson S. 263-266. Vitorović G. 20. Živkov-Baloš M. Živković B. 18.. Miljković N. final report. 2009. Roos P. Stojanović M. Tehnologija mesa. Nygren U. radioaktivnost i zakonska regulative. 17. Naučni institut za veterinarstvo “Novi Sad”. 1972 177 . 416-419. 1997 Simić M. građevinskom materijalu i drugoj robi koja se stavlja u promet Veriš A. Tramošljika Lj.... Bosna I Hercegovina.. Uchida S. Roth Werner E. Jakšić S. 55. 42.: Izloženost prirodnom zračenju na Zemlji. životnim namirnicama. 2011 Schramel P.. Zagreb. Novi Sad. 1996 Petrović B. Beograd. Progress in Nuclear Science and Technology. Levant I. Novi Sad.E. Popić J.: Radiaktivnost fosfatnih mineralnih proizvoda. Nordic nuclear safety research.. 11. 14.. stočnoj hrani.

eat thou honey. and 29 samples (72. in only three samples (7. 45/2003 and Codex Alimentarius. 2014). Sandra Jakšić1. Roman. Milica Živkov-Baloš1. Moreover. which the bees collect. we have managed to find useful applications of honey in chronic wound management. such as Aristotle (384 . This study was aimed at investigating the physicochemical properties of local honeys collected from different flora from Vojvodina.5%). crystallized. Modern science is finding that many of the historical claims that honey can be used in medicine may indeed be true. titratable acidity. moisture content. ash content Introduction Honey is a sweet liquid produced by honeybees using nectar from flowers through a process of regurgitation and evaporation. indicating adequate processing.5%) revealed values lower than 10 mg/kg. the HMF content was elevated in one sample (2. In 178 .ac. The physicochemical characteristics of 35 out of 40 honey samples (87. The moisture content exceeded the maximum level permitted by the Regulation in only one of 40 analyzed honey samples (2. The titratable acidity of all samples was lower than the limit of 40 mmol of acid per 1000 g of sample. and deposit in honeycombs to mature”. according to the current quality criteria. Sara Savić1 1 Scientific Veterinary Institute ’’Novi Sad’’.5%) analyzed in this study completely correspond with the national Regulation No. good maturity and freshness. transform by combining with specific substances of their own. In 40 samples analyzed. Branka Vidić 1. According to the Regulation ("Official Gazette of SCG". Five samples (12. honey is defined as “sweet. King Solomon said.5%). Key words: honey. ash content exceeded the maximum level permitted by the Regulation. Dragana Ljubojević1. titratable acidity.322 BC) and Aristoxenus (320 BC). Honey also possesses antiseptic and antibacterial properties. 45/2003 and Codex standards. The physicochemical parameters such as moisture content. Serbia * Corresponding author: nadja@niv. However. 45/2003). quality. Research findings pointed out that the physicochemical properties of local honey from Vojvodina were in accordance with the Codex standard and the products meet significant quality criteria for a high-quality honey. HMF determination and ash content were analyzed. for it is good". viscous product produced by honeybees from the nectar of honey plant flowers or from secretions of living parts (conifer or hardwood species). it should be noted that many of honey's health claims still require further rigorous scientific studies to confirm them (Nordqvist.ns. dense. No.First International Symposium of Veterinary Medicine – ISVM2015 PHYSICOCHEMICAL ANALYSIS AS AN INDICATOR OF THE QUALITY OF HONEY ORIGINATING FROM VOJVODINA REGION Nadežda Prica1*.5%) exceeding the limit of 40 mg/kg. HMF content. "My son. In the Bible (Old Testament). and there are a number of reasons why it may be good ( Nordqvist. Novi Sad. and Islamic texts and the healing qualities of honey were referred to by philosophers and scientists all the way back to ancient times. Vedic.rs Abstract Physicochemical analysis of honey plays an important role in determining the overall characteristic of honey and final assessment of its quality. The possible health benefits of consuming honey have been documented in early Greek. Željko Mihaljev1. which is typical for fresh unheated honeys.5%) did not meet standards established in the Regulation No. In modern science. 2014).

Chemical composition of honey implicates highly complex mixture of more than 200 different substances (Ferreira et al. 14 samples of linden honey.0 ml/min.22-μm membrane filter. Italy). total acidity. Serbian honey could potentially be very interesting for the EU market. The acidity of honey was determined by volumetric method (Off.Gazette of SFRJ. 2002). Serbia has a very long tradition of beekeeping. The mobile phase was MeOH−water (10+90. particle size 3 μm). 5 samples of sunflower honey and 1 sample of forest honey. hydroxyl methyl furfural (HMF) content and total acidity. ash content. whereas some are produced during the maturation process in the honeycomb (Krell. 2008). and leave in the honey comb to ripen and mature”. degasser. the method Off. so it is very important to verify its compliance with the quality specifications of the European Union (European Economic Community. using an Abbe refractometer (Model RMT. 1985).First International Symposium of Veterinary Medicine – ISVM2015 Codex standard (2001). Ten grams of honey were dissolved in 75 ml of distilled water and alcoholic solution of phenolphthalein was added. Thermo Scientific. deposit. It was cooled in desiccators and weighed. and some originate from honey plants. consisting of an autosampler WPS3000. honey is defined as “natural sweet substance produced by honey bees from the nectar of plants or from secretions of living parts of plants or excretions of plant sucking insects on the living parts of plants. 179 . Acidity (milimol of formic acid per kg of honey) was determined as 10 times the volume of NaOH used in titration.1 mol/dm3 NaOH. According to the method. transform by combining with specific substances of their own. 1985). All samples were in their original packages and were transferred to the laboratory and stored in a cold and dark place. v/v) filtered through 0. Optech. The investigated samples included 12 samples of meadow honey. 40 samples of different honeys originating from Vojvodina region were collected. 4 samples of multiflower honey. HMF content and ash content in the examined honey samples are displayed in Table 1. 1996). at a flow rate of 1. 2009). store. Results and discussion The obtained results on moisture content. Some of these substances are produced by honeybees. The plate was heated in a muffle furnace for about 3 to 5 h at 600°C. good geographical condition and a variety of botanical species provide great potential for the development of apiculture (Mačukanović-Jocić. 14 samples of acacia honey. and obtaining the corresponding % of moisture from the refractive index of the honey sample was calculated by consulting a standard table for this purpose. and Hypersil GOLD column (150×3 mm. Material and methods To the purpose of determining the moisture content. Moisture content was determined by the refractometric method (Off. Gazette of SFRJ. Its favourable climate. 5 g of each sample was weighed in a ceramic plate. dehydrate.. 1985. quaternary pump. Germany). For determination of ash content. The solution was titrated with 0. was followed. The weight of ash gave the ash content and was calculated by the following formula: Ash (%) = Weight of sample after ashing × 100 /Weight of fresh sample taken For the HMF determination use was made of an HPLC Dionex UltiMate 3000 Series system with a diode array detector (DAD-3000. which the bees collect. The system was controlled by Chromeleon® 7 software (Thermo Scientific). Gazette of SFRJ. All measurements were performed at 200C after equilibrium.

Our results correspond with these reports. another sample of meadow honey revealed ash contents of 0. The research of Prica et al.96%) was found in one sample of meadow honey.36 10.64 Linden 8 15 – 18. who reported that the range of moisture content of pure honey is 16.78 15. it depends upon the season and geographic condition.028%.10 0.98 ±9.07 0.) are in agreement with the findings of Cantarelli et al.49% in honey samples.4 16.33 ± 0. some evidence (Rogulja et al.48 ± 0.75 – 26 20.40 ± 3.13 6..22 ± 0.42 9.81 ± 8.7 18.13 8.87 ± 12. 180 .6 17.40 4. yet the acidity was within the proper range.20 Acacia 10 14. Table 1.48 ±1. These results are also in agreement with those of White (1975a). Furthermore.84 – 34.6 16.75 Sunflower 3 16 – 16. HMF.2 –27. Fredes and Montenegro (2006) reported that honey with lower moisture content would have a longer shelf life. whilst darker honeys in general appear to be higher in acidity. these results are also in agreement with those of Nuru (2002) and Downey et al.8–21. The variation may be due to many factors such as soil conditions. 45/2003).00 12.42 10 – 15. however. The composition of organic acids in honey has not yet been adequately investigated.78 – 43. which exceeds the maximum permitted level of 0.09 ± 0. Total ash contents measured in other honey samples were in accordance with the limits prescribed by relevant Regulation.45 6.5 – 18. who worked on different varieties of honey and obtained ash content in the range of 0.50%.5 – 34.41 0.11 ± 0.02 –0.79 0.0 – 0.33 ± 1.27 0.2 mmol of acid/1000 g moisture content was observed in multiflower variety.34 ± 3.0 15. The maximum moisture content was found to be 34.07 – 2.6 – 18. Results of determining moisture content.00 mmol of acid/1000 g in linden samples.17 ± 3.020 to 1.9 ± 7. maximum HMF content in honey put in the market is fixed to 40 mg/kg.86%.04 – 1.75 10. chestnut and meadow honeys are characterized by particularly low contents of organic acids. The maximum ash content (2. HMF in honey content exceeded maximum permitted value in only one sample of acacia honey. whereas 2.First International Symposium of Veterinary Medicine – ISVM2015 Moisture content is one of the most important compositions to be considered as a quality parameter of honey.36%. The majority of honey samples had HMF contents in line with the maximum permitted levels prescribed by the Regulation ("Official Gazette of SCG".54 Multi flower 7 15. who reported that the moisture content in honey was in the range of 14 to 18%.2 ± 1. atmospheric conditions and physiology of each plant.13 13.50 0.42 ± 2.69 – 16. .) also demonstrated low acidity of acacia honey as compared with other examined honey types.38 ± 0.07 –-0. According to the obtained results.7 7.13 Average values obtained in our research (Table 1. No.10 to 23. (2008).008 to 0. however.69 –10.4 17. ash content and total acidity in diverse honey samples TYPE OF HONEY No. HMF represents the freshness of honey and depends on adequate beehives and harvest practice.75 13. who analyzed different varieties of honey and determined the ash content range of 0.36 0.47 ± 1. 2009) suggest that acacia. of samples Meadow Moisture content (%) Acidity (mmol of acid/1000 g) Ash content (%) HMF content (mg/kg) Range Average ±SD Range Average ±SD Range Average ±SD Range Average ±SD 12 14.8 16.2 – 18.66±1. (2014. These findings are in agreement with those of Ihtisham-ul-haq (1997). The results obtained for meadow honey do not correspond with the aforementioned evidence.67 ± 1.81 3.23 – 7.10 5.93 2.275 0.15 5.44 0. (2005).96 0.

.. Aires E.M.. 2005 4. Martín P. Walshe T. Science and Technological Development. Food and Agriculture Organization of the United Nations Rome 1996. Montenegro G. Research findings pointed out that the physicochemical properties of local honey from Vojvodina were in accordance with the Codex standard and it meets significant quality criteria for a highquality honey..php 181 . Jelly J.M.G. Serbia.fao.: Quality of honey from Argentina: Studi of chemical composition and trace elements.. 2001. LD. In 40 samples analyzed. 9. RDN.. Fredes C. Ferreira I.09. Thesis.5%).5%) did not meet characteristics established in the Regulation No. Reviewed by Megan Ware. good maturity and freshness. ash content exceeded the maximum level permitted by the Regulation.: Antioxidant activity of Portuguese honey samples: Different contributions of the entire honey and phenolic extract.5%) exceeding the limit of 40 mg/kg. which is typical of fresh unheated honeys. Cantarelli M. 50-58. Official Journal of the European Communities.2014. Marchevsky E.D.com/articles/264667.: Heavy metal and other trace elements contents in honey bee in Chile. Nordqvist J. in only three samples (7. Barreira J. Cien. Food Chemistry. Pristupljeno 12.: The biology of melliferous plants with an atlas of Serbian apiflora. 114.A. 2002 5. 3. 110..2014. indicating adequate processing. Dostupno na: http://www.. The titratable acidity of all samples was lower than the limit of 40 mmol of acid per 1000 g of sample.R.. Moreover. Technol. geographical locations and honey bee species on the water activity and other physico-chemical parameters of honey. Agric.: Value-added products from beekeeping. Ihtisham-ul-haq: Effect of floral type.Sc. Republic of Serbia.: Preliminary contribution to the characterization of artisanal honey produced on the island of Ireland by palynological and physicochemical data. Acknowledgments This work is supported by a grant from the Ministry of Education. 33. according to the current quality criteria. Food Sci.C.. 2006 7. Deptt.5%) revealed values lower than 10 mg/kg.5%). 2009 6.C. NWFP Agricultural University. What are the health benefits of honey?. 3341. Krell R.F. Project number TR 31084 References 1.. Codex Alimentarius Commission: Revised Codex Standard for Honey. 96.F. Dostupno na www. the HMF content was elevated in one sample (2.G. Camiña J. Estevinho L.11. The moisture content exceeded the maximum level permitted by the Regulation in only one of 40 analyzed honey samples (2. 2008 2. Hussey K. 1/2. Pakistan. Food Chemistry. Faculty of Agriculture (on Serbian).J. Faculty of Nutrition Sciences.org/docrep/w0076e/w0076e00. Peshawer. and 29 samples (72.First International Symposium of Veterinary Medicine – ISVM2015 Conclusion The physicochemical characteristics of 35 out of 40 honey samples (87. Codex STAN 12-1981. Mačukanović-Jocić M. 1997 8.. FAO Agricultural Services Bulletin No. M.M. 26.. 124. 45/2003 and Codex Alimentarius. 2008 10. Beograd.medicalnewstoday. 14381443.htm. Pellerano R. 47-50. 45/2003 and Codex standards. Five samples (12. The Journal of the Argentine Chemical Society. Downey G.. registered dietitian and nutritionist. European Economic Community: EEC Council Directive of 20 December 2001 relating to honey. 91: 347-354. Inv.5%) analyzed in this study completely correspond with the national Regulation No.

Ph. 2.pcelinjak. Rhodes University. 2009.) of the Northern Regions of Ethiopia. Vahčić N.. London.. vol 7..hr/OLD/index.: Kemijske. Pravilnik o kvalitetu i drugim zahtevima za med. Kartalović B. fizikalne i senzorske značajke meda. 99-110. 15.. preparate na bazi meda i drugih pčelinjih proizvoda. 45/2003.D. list SCG.php/Prehrana-i-biotehnologija/kemijske-fizikalne-i-senzorske-znaajkemed. 2002 12. Babić J. pp. 2014 13.. 14. Matković D.2014.html. Archives of Veterinary Medicine. Heinemann. Rogulja D.. Živkov-Baloš M. druge pčelinje proizvode. Jakšić S. Pristupljeno 12. 157-206. br.. Dostupno na www. Prica N.First International Symposium of Veterinary Medicine – ISVM2015 11.: Water content and acidity as an indicator of the quality of honey originating from Vojvodina region. dissertation. Mihaljev Ž. Savić S. South Africa. Nuru A. White JW : Composition of Honey in: Honey A Comprehensive Survey (Ed.: Geographical races of the Honeybees (Apis mellifera L..1975a 182 . Sl. Crane E).11.

Dragana Ljubojević3. Rade Jovanović4 1 University of Novi Sad. which reflects the 183 . followed by the addition of 1.0 g/100g (2442. (1991) explained that hot red pepper is rich in vitamin C. Removal of antibiotics as growth promoters has led to animal performance problems. With the ban of antibiotics use in animal nutrition due to the emergence of microbe resistance. Institute of Food Technology. The highest share of high density lipoprotein (HDL) with statistical significance (p<0. Novi Sad. 2013).5 (HRP-0.5 g/100g has led to the highest final body weight of chickens (2460. increase of feed conversion ratio. 2009). Olivera Đuragić2. Novi Sad. Belgrade. 2009. while the experimental treatments were fed with the same mixture only with addition of two levels of hot red pepper 0.. Serbia * Corresponding author: nikola. Addition of hot red pepper in the amount of 0.) plays an important role in decreasing the deposition of cholesterol and fat in the body. nutrition. Jovanka Lević2. contributes to decreased levels of triglycerides and supports the vascular system in the body.com 2 Abstract Experiment was conducted to investigate the effect of hot red pepper in broiler nutrition on productive performances and blood lipid profile.05) differences compared to a control treatment. chickens. Hot red pepper (Capsicum annuum L. (2012) addition of hot red pepper had significant effect on the heterophil/lymphocytes (H/L) ratio.5) and 1.05) compared to a control treatment (2075.puvaca@gmail.05) was determined also in hot red pepper treatments.6 g). low density lipoprotein (LDL) and non-high density lipoprotein (non HDL) was recorded in broilers in treatments with hot red pepper with statistically significant (p<0.0 g/100g (HRP-1. Puvača et al. it can be concluded that the addition of hot red pepper in broiler chicken nutrition has positive effects on production performances and in improvement of chicken blood lipid profile. Sanja Popović2. 2001). within four replicates. Dragomir Lukač1. capsicin and capsanthin. cholesterol. Serbia 4 Institute for Science Application in Agriculture. food Introduction Beside of an important role of hot red pepper in daily human nutrition for enhancement of taste. Serbia University of Novi Sad. this spice have also been efficiently used in animal nutrition for improvement of animal health and production of healthier meat and eggs..4 g) with significant differences (p<0. Faculty of Agriculture. Novi Sad. Control treatment (CON) of chickens were fed with mixture based on corn flour and soybean meal of standard composition and quality. The lowest amounts of triglycerides. Key words: Hot red pepper. and a rise in the incidence of certain animal diseases (Wierup. Efficient hot red pepper compounds consist of capsaicin. Based on the obtained results. 2001).8 g). alternative growth promoters must be found (Steiner. total cholesterol. Ljiljana Kostadinović2. Hencken.0).First International Symposium of Veterinary Medicine – ISVM2015 EFFECTS OF DIETARY HOT RED PEPPER ADDITION ON PRODUCTIVE PERFORMANCE AND BLOOD LIPID PROFILE OF BROILER CHICKENS Nikola Puvača1*. aroma and colour of food. Serbia 3 Scientific Veterinary Institute „Novi Sad“. which have a considerable impact in improving production through contributes the reduction of heat stress (Yoshioka et al. A recent studies involved in chicken performance have shown that blends of active compounds for hot red pepper have chemopreventive and chemotherapeutic effects. For biological research three treatments with the total of 450 broilers were formed. The alternatives to antibiotics as growth stimulators are numerous (Steiner. In research of Al-Kassie et al.

followed by spectrophotometric measurement of maximum absorbance at a wavelength of 433nm.04 Treatments with different letter indexes in the same row are statistically significantly different (p<0. vegetables and mushrooms and non-alcoholic beverages (Vračar. while the feed consumption and feed conversion ratio were monitored at the pen level also every seven days.31 0. which is involved in stress hormones. Body weight was monitored at an individual level during the entire experimental period every seven days. The content of capsaicin in a sample of pepper is determined according to the method described in the manual for quality control of fresh and processed fruits. Chickens were reared on floor holding system with the chopped straw as litter material. during the preparatory period. The method is based on extraction of capsaicin from a sample of hot red pepper. For the first 14 days. grower and finisher mixtures which is given in Table 3. The content of capsaicin in samples of hot red pepper powder is expressed in g/100g dry matter of the sample. Chickens were watered throught the nipple water system. The colour intensity of the solution is proportional to the concentration of capsaicin. Table 1. starter. g/kg Capsaicin. and then for the last 7 days of fattening period with finisher mixtures according the experimental design given in Table 2 and dietary chemical composition of used starter. The aim of this study was to investigate the effect of hot red pepper in broiler nutrition on blood lipid profile and productive performances. chicks were fed with grower mixtures for the next 21 days. For nutrition of chicks three mixtures were used. Material and Methods Determination of bioactive components in hot red pepper Content of capsanthin or colored matter in a sample of hot red pepper powder is determined by the reference method SRPS EN ISO 7540 (2012). and which supports the immune system of birds and enhances its resistance against disease through decreasing (H/L) ratio. Following the preparation period. Every dietary treatment included 150 chickens. During the experiment chicks were fed and watered ad libitum.05) Animal trials Biological tests were carried out under production conditions at the experimental farm "Pustara" in property of the Faculty of Agriculture from Novi Sad. separation of colouring matters and the development of colour characteristic of capsaicin. g/kg a 3.First International Symposium of Veterinary Medicine – ISVM2015 role of hot red pepper. a total of 450 one-day old Hubbard broilers were distributed into three dietary treatments with four replicates each. 184 .96b 0. Content of capsanthin in samples of ground pepper is expressed in g/kg of dry matter of the sample. The method is based on extraction of colored substances from a sample of hot red pepper with benzene and then spectrophotometric measurement of maximum absorbance at a wavelength of 477nm. grower and finisher through pan feeders. Microclimate conditions were regularly monitored. chicks were fed with starter mixtures. especially its active compound capisicine.58 0. At the beginning of the experiment. Concentration of capsanthin and capsaicin is given in Table 1. Concentration of capsanthin and capsaicin in experimental hot red pepper Hot red pepper powder samples (n=3) LSM SELSM Bioactive compounds Capsanthin. which were divided in four pens with 37-38 chicken per each pen. 2001). Chickens were provided with the light regime of 23h of day per entire experimental period of 42 days with incandescent light source.

05 was used. MJ/kg *Hot red pepper is added on top on the basic diet Starter 89.5 21.3 4. Gazette of SFRY. hot red pepper on 1 kg of dry matter should comprise at least 2 g of capsanthin and capsaicin between 0.6 5.3 10.8 Finisher 89.5 HRP-1. According the Serbian regulation (Off.5 Diet mixtures Grower 89. 1/79).0 1.96 g/kg) as the main bioactive components in hot red pepper.6 12.5 4.0 Concetration of additives in chicken diets In starter.1 3.5 5.5 to 0. No.6 1.7 3.9 0.0 0. Experimental design with chickens Experimental treatmens CON HRP-0.7 20.0 1. Significant effects were further explored using analysis of variance (ANOVA) with repeated measurements. least square means (LSM) and standard errors of least square means (SELSM).9 3. except for the content of capsaicin.4 10.5 13.1 0.0 Hot red pepper 0. Serum samples from blood were separated by centrifugation (4000 rpm for 5 min at 20°C). In grower. Commercially available kits (Randox Laboratories Limited .7 3.First International Symposium of Veterinary Medicine – ISVM2015 Table 2.5 0. As it can be seen from the results shown in Table 1.31 g/kg) and capsaicin (0.8 0. g/100g Nutrients Dry matter Moisture Crude protein Crude fat Crude fibre Crude ash Ca P Metabolic Energy.6 12.7 g.0 0.5 17. Values were expressed as mg/dl.0 Table 3. samples of hot red pepper correspond to quality parameters requirements of Serbian regulations. Results and Discussion Capsanthin and capsaicin content From the results given in Table 1 it can be seen the concentration of capsanthin (3. Chemical composition of dietary mixtures.8 0.9 3.United KIngdom) were used to analyse the serum for triglycerides. In finisher.3 Blood lipids At the end of 6th week. as well as Fisher's LSD post-hoc multiple range test with Bonferroni corrections to ascertain differences among treatment means.0 0. which in the tested samples was higher for 185 . A significance level of p<0.0 0. total cholesterol.5 Hot red pepper 0. g/100g g/100g g/100g Additive 1 – 14 days 15 – 35 days 36 – 42 days Control treatment 0. twelve birds were randomly chosen from each treatment and bled via wing vein puncture to obtain blood samples. to determine if variables differed between treatments. HDL and LDL on an biochemical autoanalyzer Cobas Mira Plus (Roche Diagnostics).4 10. Statistical analyses Statistical analyses were conducted within statistical software program Statistica 12 for Windows.

the highest achieved body weight of chicken was in treatment HRP-0. From the results given in Table 5 it can be noticed that the highest amounts of triglycerides (65.2 42 days 2075. (2014) with the different forms of hot red peppers showed better growth performance results of chickens on experimental hot red pepper treatments in comparison to control treatments.5 1193.6 g) which was followed by treatment HRP-1. respectively (Simonovska et al.6a 1.5 (2460.5a 161.6 Age of chickens 14 days 21 days 28 days 388. 2014).7 mg/dl) were in control treatment with statistically significant (p<0.43 g/kg.33 Treatments with different letter indexes in the same column are statistically significantly different (p<0. addition of hot red pepper exerted the stimulating effect and led to statistically significant differences (p<0. At the end of the second fattening period.87 8. Lipid profile in broiler chickens Addition of hot red pepper as feed additives to broiler chicken nutrition in this experiment led to high improvement of lipid profile of chickens.84 35 days 1643.2 mg/dl) and LDL (36.7a 162.1a 12.6a 1162. The highest content of capsaicin was found in the placenta. Body weight of chickens in experiment. which is also in agreement with previous findings of Alaa (2010).5 LSM HRP-1.First International Symposium of Veterinary Medicine – ISVM2015 0.8a 42. (2014c) with the use of hot red pepper in broiler chicken nutrition.05) compared to control treatment.4 g) with statistically significant differences (p<0.05).5a 42a 0.0 (2442. Taking into account that the capsaicin is alkaloid responsible for the hot taste of pepper.4a a a 385.48 and 6.3 770. (2011) revealed that the inclusion of hot red pepper at levels of 0. 10.05) differences in comparison to treatments with the dietary addition of hot red pepper.05) differences in body weight (Table 4). total cholesterol (97.6a 3.8b 2460.38 11. g Experimental treatments CON LSM HRP-0.6a 2442. this result was expected because the hot red pepper is recognizable its pungent quality.05) Our study has shown that the addition of hot red pepper has positive effect on production results of chickens. (2012) and Puvača et al. Table 4.4 1183. respectively.47 7 days 162.75% and 1% in the diets of broiler chicken of hybrid line Ross 308 improved body weight gain and feed conversion ratio.1 762. Afzal et al. Chickens have finished the preparatory period with uniform body weight with no statistical significant differences (p>0. (1985) reported that polyunsaturated fatty acids prevent atherosclerosis through the formation of cholesterol esters.6a a a 385. while the highest ratio of 3. Investigation of Thiamhirunsopit et al.1a 1812. Similar result was obtained by Dang et al.0 LSM Pooled SELSM 1 day 42.9 mg/dl).5%. (2014) in their study of three-liquid-phase extraction and separation of capsanthin and capsaicin from Capsicum annum L. Both levels of hot red pepper in our study decreased LDL levels compared to the levels in chickens of the control 186 .4a 24. Productive performance of broilers Based on the obtained results it can be concluded that the addition of hot red pepper in the diet of broiler chickens led to a statistically significant (p<0. Al-Kassie et al.71 estimated from the quantity of capsaicin and dihydrocapsaicin was calculated in the pericarp.6a 785. After the completion of the experimental period.26 g of dry mater. This effect can be explained by the possible inhibition of the Acetyl CoA syntheses enzyme that is necessary for the biosynthesis of fatty acids. as well as dihydrocapsaicin.8b 1815. 0. The determined pungency level in placenta of 272 211 SHU was almost five times and two times higher than the pungency level in the seed and pericarp.05) in body weight in relation to the control treatment. Research of AlKassie et al..

16 36. 2009). LDL and increase of HDL by this spice herb supplementation in broiler diet could indicates effective in regulation of lipid metabolism in a favourable manner for prevention of atherosclerosis or coronary heart diseases in humans who use this kind of chicken products in their daily nutrition.5 g/100g has led to the highest final body weights of chickens.33 Treatments with different letter indexes in the same column are statistically significantly different (p<0. it can be concluded that the addition of hot red pepper in broiler chicken nutrition has positive effect on production performances.. Serbia.6a 2.First International Symposium of Veterinary Medicine – ISVM2015 treatment. 1985. Table 5. Petefi brigade 2.25 to 1% had influence on decreased concentration of blood cholesterol.01 non HDL a 78.3b 1. Biochemical blood parameters and lipid profile.A. triglycerides.9 16. Agricultural and Biological Chemistry.4b 10.M. Afzal M..3b 0.d. 24300 Bačka Topola. References 1. mg/dl Experimental treatments CON LSM HRP-0.. because capsinoids includes antimicrobial activities against disease caused by bacteria. 49..H.5a 35. Also the realization of one part of this experiment was supported by the Perutnina Ptuj – Topiko a. Meat obtained by chickens fed with hot red pepper poses better lipid profile and can be successfully used in daily human nutrition as a dietetic food.2 35. Hassan R..5b 3. Similar results with the lowering effects of total cholesterol in red and white meat and skin of chickens fed with dietary garlic powder was obtained by Stanaćev et al.0 LSM Pooled SELSM Triglycerides a 65.A.2a 52.05) Addition of hot red pepper to the broiler diet in different amounts from 0.A.7b 0. Beside the hot red pepper. Spice herbs in human nutrition had a very large influence in health promotion and lowering concentration of blood cholesterol and lipid oxidation (Ahuja and Ball. Also it can be concluded that significant lowering of plasma cholesterol.: Allium sativum in the control of atherosclerosis. Conclusions Based on the obtained results.. 2006). 2010. addition of spice herbs and medicinal plants can facilitate activity of enzymes which are involved in the conversion of cholesterol to bilious acids and subsequently will result in lower cholesterol concentration in the carcass.7 9. (2012). 1187-1188.4b 54.0 16..8a 3. 187 . Addition of hot red pepper in the amount of 0. Furthermore. El-Kazini A. Capsinoids present in red peppers causes pungent. garlic (Puvača et al. Al-Kassie et al.9 HDL LDL b a 19.9b 18.5 LSM HRP-1.03 HDL/LDL 0. hot tasting sensations when consumed as a part of the diet in addition to sensory properties of chicken meat that may be affects human health. This effect can be explained by the possible mechanism of antioxidant and antiperoxide lowering action on LDL or the decrease in hepatic production of very low density lipoprotein (VLDL) which serves as the precursor of LDL in the blood circulation (Kim et al. 2014b) had a high impact on alteration of blood lipid profile of chickens.8 Total cholesterol 97.6b 1.. 2012).7b 17. and other blood biochemical parameters (Alaa. Fattah R.7a 1. Acknowledgments This paper is a part of the project III 46012 which is financed by Ministry for Science and Technological development of the Republic of Serbia. 2014a) and black pepper (Puvača et al.

Doucet E..) on productive performances and blood lipid profile of broiler chickens. 188 .Y. lipid peroxidation and ileal nutrient digestibility in broilers reared under high stocking density condition. 2013. Stanaćev V... 266. Nottingham University Press: 1-169.M. Kufa Journal for Veterinary Medical Sciences.: The potency of feed supplemented mixture of hot red pepper and black pepper on the performance and some hematological blood traits in broiler diet. Glamočić D.. 28-38. Al-Nasrawi M.J.. stress index. 2816-2819. Yang H. Macedonian Journal of Animal Science. Dionne I. Ahuja K. Novi Sad.J. Rafajlovska V.. 7. Stanaćev V. 6. Annals of Biological Research. Steiner T.M. Milošević N.Y. 15. Ljubojević D. Stanaćev V. Simonovska J. Srbinoska M.First International Symposium of Veterinary Medicine – ISVM2015 2. 3. 2014a. 2014b. 32. Xiu Z... 33.. Journal of the American Medical Association. Kostadinović Lj.: Effect of dietary garlic bulb and husk on the physicochemical proper-ties of chicken meat... 2001. 842-845.. Hencken H. Pakistan Journal of Nutrition... Nikolova N... 17. 20. Kavrakovski Z. 12. 2.. 8.. from Macedonia. 4.: The Swedish experience of the 1986 ban of antimicrobial growth promoters.. Drapeau V. SRPS EN ISO 7540. 183–190. Puvača N.. British Journal of Nutrition.. Al-Kassie G. 90100. (2014c): Digestibility of fat in broiler chickens influenced by dietary addition of spice herbs.. Wierup M. Perić L. 7. Ball M. Ajeena S. 19. Puvača N.: Nutritional and bioactive compounds in hot fruits of Capsicum annuum L. 2014.) and copper as phytoadditives in the feed on the content of cholesterol in the tissues of the chickens. Microbial Drug Resistance.. Tremblay A. Perić L. 2011.. 16. 2012. Milić D.. Lukač D. 11. Puvača N.A. 14.. 85. Thiamhirunsopit K. Kijparkorn S. and usage of antimicrobials.: The effects of using hot red pepper as a diet supplement on some performance traits in broiler. Yoshioka M. Lukač D. Czech Journal of Food Science.. Biotechnology in Animal Husbandry. Popović S.: Influence of black pepper (Piper nigrum L. Plavša N. Dang Y.. 192. Kostadinović Lj. 10. 1.: Phytogenics in animal nutrition Natural concepts to optimise gut health and performance. Macedonian Journal of Chemistry and Chemical Engineering. 239-42..: Influence of garlic (Allium sativum L. Glamočić D. Lević J..: Cooling the burn from hot peppers. 96. Stanaćev V. 2009. Requirements for ground paprika. 13.: Effect of chili meal (Capsicum frutescens LINN..L. Vračar Lj. Journal of Medicinal Plants Research. disease prevention. 1991. 2012. Živkov Baloš M. 61–67.. Al-Kassie G. Kim Y.. 30.J. 10. 5: 29-33.. 109–114. Phisalaphong C.D. Ljubojević D. 669-677..: Manual for quality control of fresh and processed fruits. Lukač D. Butris G.. 18. 2009.. Jin S.: Ground paprika (Capsicum annuum L. 398-405.) on growth performance. Boonkird S.: Effects of dietary garlic addition on productive performance and blood lipid profile of broiler chickens.... Popović S. Alaa A.: Three-liquid-phase extraction and separation of capsanthin and capsaicin from Capsicum annum L. 97–104. Zhang H...A.J.A. Dokmanovć B. Popović S. 4. Animal Feed Science and Technology.M. 203-211.: Beneficial effects of phytoadditives in broiler nutrition. Poultry Science.. Stanaćev V. Milić D.: Effects of daily ingestion of chilli on serum lipoprotein oxidation in adult men and women.S. productivity. 9.). 6. (2001): Combined effects of red pepper and caffeine consumption on energy balance in subjects given free access to foods.K.. World's Poultry Science Journal. 2014c. 2001. 88. 2001. Ljubojević D.. 2006.S. Stanaćev V. Kostadinović Lj.A.. Ajeena S. 5.: The effect of the Capsicum annuum in the diet of broilers on the isolation and shedding rate of Salmonella paratyphoid. Puvača N. 2014. 53-57. 2766-2770. International Journal of Advanced Biological Research. British Journal of Nutrition. 27-34.. 69. 2010. Puvača N. vegetables and mushrooms and non-alcoholic beverages (In Serbian).. 2012.. Faculty of Technology. 2014. with special reference to animal health.

First International Symposium of Veterinary Medicine – ISVM2015 ________________________________________________________________________ Session № 3 VECTOR BORNE INFECTIONS Full papers _______________________________________________________________________ 189 .

Flavivirus genome is constituted by a single-stranded RNA molecule of positive polarity (≈ 11. Japanese encephalitis virus (JEV). they are 190 . A characteristic shared by a wide variety of flaviviruses is that they can infect cells from the host nervous system. These vectors can transmit the virus to other animals or to humans. which act as their natural host. Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA). Europe. Global climate warming together with changes in land use are helping to change the distribution patterns of flaviviruses. Usutu virus (USUV) and Bagaza virus (BAGV). and prophylaxis (vaccine and antivirals) will be discussed. Nowadays. Bagaza virus Introduction Flaviviruses (Flaviviridae family) constitute a genus of viruses that contains more than 50 different species. being thus arboviruses (arthropod-borne viruses). Here.es Abstract Flaviviruses (Flaviviridae family) constitute a genus of viruses that contains more than 50 different species. 3 mosquito-borne flaviviruses have been detected in Europe: West Nile virus (WNV).. Lineage 2 strains are currently circulating in central and south-eastern Europe. Usutu virus. Earlier in this century. different aspects of mosquitoborne flaviviruses pathogenesis and clinical consequences. Madrid (Spain) Corresponding author: jcsaiz@inia. West Nile virus. diagnosis. among others (Weaver and Reisen. being WNV the most clinically relevant. many of which are important human and animal pathogens. Yellow fever virus (YFV). 2010). lineage 2 strains entered the continent. mosquitoes. These vectors can transmit the virus to other animals or to humans. Global climate warming together with changes in land use are helping to change the distribution patterns of some flaviviruses. Usutu virus (USUV). which often include encephalitis (Sips et al. 2012). Keywords: Flavivirus. causing a considerable number of bird deaths and neurological disorders in a few immunocompromised patients. distribution. which act as their natural host.5. Most flaviviruses are maintained in nature in an infectious cycle that includes transmission between wild animals.First International Symposium of Veterinary Medicine – ISVM2015 Plenary lecture: MOSQUITO-BORNE FLAVIVIRUSES IN EUROPE: CURRENT PERSPECTIVES Juan Carlos Saiz Departamento de Biotecnología. and it is now considered a European resident pathogen. epidemiology. or Tick-borne encephalitis virus (TBEV). including Serbia. thus inducing severe neurological diseases. was reported for the first time in Austria in 2001 and quickly spread across Europe. such as Dengue virus (DENV). thus inducing severe neurological diseases that can lead to death. many of which are important human and animal pathogens. frequency and severity of the outbreaks increased greatly. causing zoonoses.000 nt) that encodes a polyprotein in a single open reading frame. being already responsible for hundreds of human cases and dozens of deaths. 28040. West Nile virus (WNV). and insects (mosquitoes and ticks) that act as their vectors. Flaviviruses are maintained in nature in an infectious cycle between wild animals. so that. Usutu virus (USUV). causing zoonoses. and insects (mosquitoes and ticks) that act as their vectors. Carretera de la Coruña Km 7. but from the 1990´s the number. Flaviviruses can infect the host nervous system. BAGV was reported for the first time in Europe when caused a deadly outbreak among partridges and pheasants in Spain in 2010. WNV lineage 1 has been circulating in Europe since 1960´s.

The E glycoprotein is exposed on the surface of the virion and is the main responsible for the induction of neutralizing antibodies. NS (NS1. humidity. ticks. mosquitoes.000 nucleotides in length that encodes a polyprotein in a single open reading frame flanked by two non-coding regions (NCRs) located at the 5’ and 3’ ends of the genome (Martín-Acebes and Saiz. Climate (temperature. In fact. Expansion of mosquito species to more extreme latitudes and elevations allows them to reach new host populations to feed on. Weaver and Barret. thus playing a pivotal role in arboviral dissemination and evolution (Gould and Higgs. 2B. etc. being the most clinically relevant the TBEV (Beck et al. density and stability. 2013). or those for which the vector is still unknown. being again those of the Culex species the main vectors. overabundance of birds that share urban and rural areas with ubiquitous fastidious mosquitoes that feed on birds and mammals plays an important role in flavivirus transmission. 3. Several other species have been also described as competent vectors in other geographical areas.. For instances. Genomic organization and structure Flavivirus genome is constituted by a single-stranded RNA molecule of positive polarity of about 11. 2012).First International Symposium of Veterinary Medicine – ISVM2015 currently being detected in new geographical zones. are neurotropic. 2013. Likewise. Mature virions display a smooth outer surface with no projections or spikes constituted by the membrane (M) protein and the E glycoprotein. 2004). Within a mosquito genus. The RNA presents a cap structure at 5’ end.. but frequently cause hemorrhagic diseases. prM and E) and seven nonstructural. being the most efficient ones those of the Culex species. Aedes-clade viruses have primates as main reservoir and are not used to be neurotropic. a fact that has many consequences. In Europe. 2A. Heavy rainfall and warm temperatures benefit the increase of mosquitoes populations. forestation. 2009. Those transmitted by mosquitoes are subdivided into 2 clades depending on the vector genus (Culex or Aedes) (Beck et al. Weaver and Barret. Tick-borne flaviviruses are also grouped into 2 clades... water sources. in two of the major urban WNV 191 . latitude. 2012. those that circulate among seabirds and those that produce encephalitis and which main natural reservoir are rodents. more than 11 species have been described as WNV competent vectors in U. 2004). 2012). and a single open reading frame that encodes for a polyprotein that is proteolytically processed by viral and cellular proteases rendering ten major viral proteins: three structural (C.S.) directly affect arthropod populations. 2013). Ecology Flaviviruses are grouped according to their vectors. Culex-clade viruses usually have birds as natural reservoirs. although other species (such as Aedes or Ochlerotatus) may also play a role on viral transmission as bridging vectors that can transmit the virus to mammals. 2012). 4A. and to share new ecological niches with other vector species.) and landscape conditions (altitude. Climate change affects the geographical and seasonal distribution of arthropod vectors. and may cause encephalitis. the virus has been isolated from more than 40 different species. but lack a 3’ poly (A) tract. 2012). and has been positively correlated with arbovirus transmission (Martín-Acebes and Saiz. rainfall rate. resulting in a particle of icosahedral symmetry. The genomic RNA is enclosed within a nucleocapsid formed by the capsid (C) protein that constitutes the core of the virion and is enveloped by a lipid bilayer derived from the host cell (Martín-Acebes and Saiz. 2009). etc. Beck et al. different species show diverse competence for transmission of the different flaviviruses (Martín-Acebes and Saiz. where they cause infectious outbreaks that affect both human and animals (Gould and Higgs. 4B y 5) involved in different aspect of the viral cycle (MartínAcebes and Saiz.

YFV. the regions were heavily infested by potential mosquito vectors. which infects mainly sheep and it is transmitted by I. For instance. although imported infections by other members of the family (DENV. 2014). Thus. In contrast. Looping ill virus (LIV).. and Volgograd and Volzhskiy (Russia). TBVE is the most clinically relevant in Europe (Amicizia et al. Hence. At the beginning of this century.. 2012). 2009). 2013). Regarding mosquito borne flavivirus circulating in Europe. 41 clinically and laboratory confirmed of which 9 resulted fatal (Dauphin and Zientara. and the Bagaza virus (BAGV) was recently detected in Spain (Beck et al. persulcatus and infects more than 10. urbanization. represents an important threat for human and animal health.First International Symposium of Veterinary Medicine – ISVM2015 outbreaks reported in Europe. arboviral epidemics are probably more related to the concomitant profusion of hosts and vector populations in the same area. and 192 . from which the first WNV strain was isolated in the country (Lani et al. in what was the largest human WNV outbreak in Europe during that year (http://ecdc. USUV. Flavivirus circulation in Europe In Europe. Ireland. lineage 2 strains entered the continent and. which was reported for the first time in Austria in 2001. but it was in the 1990´s when lineage 1 strains colonized south Europe and the Mediterranean basin. being already responsible for hundreds of human cases and dozens of deaths (Lani et al. 2013). and because JEV outbreaks were mainly restricted to Japan before the second world war. Lineage 2 strains have already been detected in central and south-eastern Europe. and the European regions of Russia. the first outbreak of WNV clinical infection in humans was reported in 2012 with a total of 70 West Nile fever cases. generally wastelands and mashes where migratory birds are abundant. hundreds of cases are reported every year. Norway. central Europe. ricinus ticks.. Among tick-borne flaviviruses. Recently USUV seems to have also colonized the continent. only a few flaviviruses are considered endemic (WNV.000 humans every year around the world. Presence of WNV in Europe is known since the 1960´s. In Europe. horses and birds. but where it is more common is in the British Islands (Amicizia et al. thus. In Serbia. being now considered endemic in the continent (Martín-Acebes and Saiz. etc.. 2014). mosquitoes.) are occasionally reported (Beck et al. may lead to the emergence or re-emergence of new arbovirus with expanded tropism and host-range and. only other two mosquito borne flaviviruses have been detected in Europe (Beck et al.. together with viral genetic mechanisms. An important factor in arboviral evolution is socio-economic development since it has led to increased and faster travelling. but it has not been detected again since then. birds. the conflict seems to have favoured virus spread (Gould and Higgs. 2013). BAGV was reported to cause a deadly outbreak among partridges and pheasants in Spain in 2010. 2013). The virus has been detected in mosquitoes. The virus is transmitted by Ixodes ricinus and I. anti-WNV antibodies had been detected in humans. they have been isolated in birds. since then. As mentioned early. causing a considerable number of bird deaths. Turkey and Bulgaria). Before that. has quickly spread across the continent. originating a very significant increase in the number. irrigation. Most cases occur in Finland. West Nile virus is the more clinically important. 2012). 2007). Nowadays. 2009). and humans in several countries. new human and animal behaviours and climate changes are facilitating contact between vectors and hosts that. even though it is estimated that between 70%-95% of them are asymptomatic. Besides TBVE. which took place in Bucharest (Romania). than to other factors (Brault.. and WNV-RNA was amplified from mosquito and bird tissue pools. One year later over 300 new human cases were reported in the country. USUV and TBE). bats. frequency and severity of the outbreaks (Martín-Acebes and Saiz. has been reported in several countries (Spain. sentinel chickens.eu/). 2013). deforestation.. viruses from the two lineages are currently circulating in Italy.europa. and migratory activities leading to overpopulation.

by ataxia and muscular weakness. mainly reverse transcription (RT) polymerase chain reaction (PCR) assays and quantitative real-time RT-PCR (Martín-Acebes and Saiz. with an estimated 10% of the neuroinvasive cases resulting fatal. West Nile fever (WNF) is characterized by several non-specific flu-like symptoms. which usually last for 3 weeks (Martín-Acebes and Saiz. brain stem and spinal cord (Martín-Acebes and Saiz. Severe West Nile disease (WND) is associated with neurological disorders. 2007). 2012). 2012). 2012. 2007). Diagnosis Flavivirus laboratory diagnosis relays on isolation of virus. clinical cases of WND in horses do not precede that in humans. implementation of vaccination campaigns has strongly reduced these mortality rates. However. although. as well as nonneurological. such as ataxia and paralysis. When birds die from WND. the majority of WNV infections in horses are usually not accompanied by presentation of clinical signs. brain stem and spinal cord. WNV is capable to directly infect neurons. Typical clinical signs in birds are neurological. contrary to other Flavivirus infections. although severe neurological diseases are observed in less than 1% of them (Sips et al. finally penetrates the CNS resulting in inflammation of the medulla. A 4193 . but an estimated 20% of the infected people develop clinical symptoms. Dauphin and Zientara. 2012). 2013). or detection of virus-specific IgM antibody that should be further confirmed by detection of IgG antibody in the same or a subsequent sample. humoral immune response is capable of control viral load and dissemination. weight loss and myocarditis (MartínAcebes and Saiz. namely hemagglutination inhibition (HI). 2012). Cross-reactivity between Flavivirus antigens is the greatest drawback for proper serological diagnosis and epidemiological studies and. The pathogenesis of WNV infection is similar to that of other Flaviviruses. and it has been recently associated with a few cases of neurological disorders in immunocompromised patients in Italy and Croatia (Beck et al. predicting an increase of the risk for human infections (Martín-Acebes and Saiz. Dauphin and Zientara. lethargy. Even though outbreaks resulted in 25 to 45% of mortality rates among affected horse.First International Symposium of Veterinary Medicine – ISVM2015 equids. 2012). discarding their use as sentinels. sometimes. ruffled feathers. they use to do it in the first 24 h after the onset of clinical signs. A fully functional immune (innate and adaptive) response (humoral and cellular) is essential to fight WNV infection. In this regard. 2012. such as depression. immunoflourescence (IF) or plaque reduction neutralization test (PRNT). overall.. considered as the gold-standard (Martín-Acebes and Saiz. Monitoring of crow mortality has been successfully adopted as an epidemiological indicator for tracking WNV activity in the USA. which usually develop between 2 to 15 days after infection and last for 2 to 5 days. After primary inoculation. Nevertheless. sera have to be tested against different related viruses and results have to be subsequently confirmed by different assays. Virus isolation in susceptible cell culture is the gold standard for virus detection. (Martín-Acebes and Saiz. thus. 2012.. several methods for detection of viral RNA have been applied for Flavivirus surveillance and diagnosis. WNV is believed to replicate in resident skin Langerhans dendritic cells before it traffics to the lymph nodes and blood stream from where it reaches the spleen and kidneys and. which are only observed in around 10% of the animals and are characterized by fever and. Clinical manifestations and pathogenesis Most of WNV infections in humans are asymptomatic. As in humans. but it is usually hampered by the typical short duration and low levels of viremia and by the need of BSL-3 facilities. WNV infection causes damage in multiple bird organs. detection of viral antigens or RNA in blood or tissues.

as they should be first tested for antiviral activity in animal models and adverse effects should be ruled out. the search for more efficient. and larvae) (Martín-Acebes and Saiz. progress in Flavivirus therapies should pass through a combination of drug strategies that targets viral replication. and even though there are effective. 194 . 2007). the differences in WNV disease manifestations between different regions of the world. and limits the development of resistant variants. Dauphin and Zientara. 2007). 2012. no WNV or USUV vaccine or specific therapy has been approved for humans. including the repositioning of drugs approved for other purposes that have also shown antiviral activities against Flavivirus (Martín-Acebes and Saiz. mammalian cells. and viral neutralizing titers 4-fold higher than titers to other related-flavivirus is usually taken as a probe of the specificity of the infection. however. The candidate may be targeted against the viral particle itself. insect cells. Dauphin and Zientara. boosts protective immune responses. In this regard. The search for antiviral compounds active against Flavivirus infection includes the identification of those targeting distinct aspects of the viral replication cycle (Martín-Acebes and Saiz. the development of national and international surveillance programs to monitor WNV spread and to take appropriate measures to control it. promising approaches are being developed (MartínAcebes and Saiz. no approved vaccines exist for human use. the better understanding of WNV immunity. pathogenicity. rapid. and the search for cost-effective human vaccines and antiviral targets for therapeutic usage. impairing its entry and/or infection. some aspects of WNV activity still need to be further addressed: the ways WNV colonizes new ecological niches and the role that climate and anthropogenic factors play. both commercial and in-house. This search has leaded to the identification of multiple promising compounds interfering with these processes. Dauphin and Zientara. are currently applied for serological testing using inactivated whole virus as antigen. 2007). Conclusions Although our knowledge about Flavivirus infections has greatly increased during recent years. 2007). Recently a new approach in antiviral search has focused on cellular factors (proteins and lipids) implicated in the viral life cycle. 2012. licensed WNV vaccines for horses. which may constitute potential targets for antiviral activity. In any case. and PLATESAP2013/ABI-2906 (Comunidad Autónoma de Madrid). and specific diagnostic assays. or it may block multiplication of the virus within infected cells. long way remains to be completed before these novel compounds could to be administered to humans or animals. and clinical treatment is only supportive. and then. or recombinant viral proteins (or fragments of them) synthesized in diverse systems (from bacteria to insect cells and larvae) (Dauphin and Zientara. 2012. Different ELISA formats. These candidates are based on the use of either live attenuated or chemically inactivated virus. and the molecular basis of virulence. minimizes neuronal injury. however. Acknowledgments Supported by grants RTA-2011-0036 and E_RTA2013-00013-C04-2014 (INIA). 2012.First International Symposium of Veterinary Medicine – ISVM2015 fold increase in PRNT titers between 2 sequential serum samples collected 2-3 weeks apart usually confirms an acute Flavivirus infection. However. Dauphin and Zientara. its production implies risks for laboratory personnel and needs highly sophisticated biosafety level 3 (BSL-3) containment facilities to grow the virus. although some have undergone clinical trial. 2007). Prophylaxis Until now. several ELISAs have been developed using recombinant viral proteins expressed in a variety of systems (bacteria.

1016/j.12. 8. Vaccine 25:5563-5576.10.2009. Doi:10.008. World Journal of Virology 1(2):51-70.001. 3. Nature Rev Microbiol 2:789-801. Vet Res 40:43.i2. Zientara S.2014.51.005. Human Vacc & Immunotherp 9(5):1163-1171. et al. evolution and emergence of arboviral diseases.2006.07. Sips.ttbdis. Amicizia D et al. (2013). Neuroinvasive flavivirus infections. (2012).1038/nrmcrol1006.trstmh. Trans R Soc Trop Med Hyg 103(2):109-121.04. Lani R. Doi:10.025. Ticks Tick Borne Diseases 5(5):457-465. Doi:0. Dauphin G. (2013). 195 . Doi:10.712.1051/vetres/2009026. Doi: 10.1016/j.5501/wjv. Tick-borne viruses: a review from the perspective of therapeutic approaches.antiviral. 10. West Nile virus: recent trends in diagnosis and vaccine development. Present and future arboviral threats. 5. Martín-Acebes MA and Saiz JC (2012). Int J Environ Res Public Health 10:6049-6083. 9.J. Epidemiology of tick-borne encephalitis (TBE) in Europe and its prevention by available vaccines. Doi:10. Doi:10.23802. 2. et al.4161/hv. Flavivrus in Europe: complex circulation patterns and their consequences for the diagnosis and control of West Nile disease.1002/rmv. Doi:10. 4. G. Gould EA and Higgs S (2009). (2014). 7. host range. Rev Med Virol 22(2):69-87. Weaver SC and Reisen WK (2010). Doi:10. Beck C. 6.2008. Weaver SC and Barret ADT (2004). West Nile virus: a re-emerging pathogen revisited. Brault AC (2009). Doi:10.1016/j. et al. Antiviral Research 85(2):328. Impact of climate change and other factors on emerging arboviruses diseases.1016/j.First International Symposium of Veterinary Medicine – ISVM2015 References 1. Changing patterns of West Nile virus transmission: altered vector competence and host susceptibility. (2007).vaccine.v1.3390/ijerph10116049. Transmission cycles.

research on ticks as vectors. Whether or not the transferred pathogen is actually causing a disease. Dermacentor marginatus. in ticks is constant.rs Abstract Tick borne diseases are one of the key issues within a „One Health“ concept.ns. Monitoring of the prevalenece of B.burgdorferi in ticks varies from 23% to 42. Tick species found in different regions of Serbia so far are the following: Ixodes ricinus. In another study.First International Symposium of Veterinary Medicine – ISVM2015 Invited lecture AN OVERVIEW OF THE RECENT STUDIES ON TICK BORNE PATHOGENS IN SERBIA Sara Savić1.40% in different regions.l. The first studies were on the presence of Borrelia burgdorferi sensu lato starins in ticks.burgdorferi s. followed by research on Babesia spp. A triangle between humans. lusitaniae. animals and ticks has been a challenge for researchers for some time now. 2013). most important the pathogen. anaplasmosis. Željko Čonka3 1 Scientific Veterinary Institute „Novi Sad“ 2 Department of veterinary medicine.l. babesiosis Introduction Arthropods as vectors of pathogens are causing vector-borne diseases.burgdorferi s. but it differs among different regions in Serbia (Vojvodina.61% to 46. Branka Vidić1. Voganj * Corresponding author: sara@niv. Hemaphysalis punctata. ricketiosis. the host and the host’s immune system (Mencke. Coxiella burnetii was found in less than 7% in ticks in different regions of Serbia. Vector borne pathogens are often known as emerging pathogens. Rhipicephalus sanguineus. Babesia spp is found to be present in ticks with two different methods. Coxiella burnetii and Francisella tularensis in ticks.8% in ticks.s. an important threat to public health. B. Key words: tick borne pathogens. Dermacentor reticulatus. All of the monitored pathogens are causative agents for more or less dangerous zoonozes. but in the whole region – on the topic of the presence of Anaplasma phagocytophilum. tick borne pathogens and tick borne diseases has started approximately a decade ago. Emerging pathogens include infectious agents that were previously un recognized and have been identified and associated with a new disease or an illness with a previously unknown aetiology. Belgrade region and middle Serbia). The pathogen carried by the arthropod vector is transferred during blood feeding. the closest interaction between the arthropod vector and the vertebrate host. University of Novi Sad.9% ticks in Serbia.5%.burgdorferi s. zoonozes. afzelii. valaisiana. more genospecies were found in ticks during the last few years: B. 2 Zito Dunav Agroveterina DOO. in different tick species with different prevalence varies from 10. Faculty of agriculture. The prevalence for B. During the last few years a lot of work has been done. organisms that have been described in other regions 196 . The prevalence for Francisella tularensis microorganisms has also been found as 3. garinii and B. depends on a complex interaction of many factors. B. Haemaphysalis concinna For B. Aleksandar Potkonjak2. borreliosis. Anaplasma phagocitophylum has recently been found in 13. A research on vector borne infections and pathogens has started two decades ago. In Serbia. which can be found in the region of Serbia and almost all of them have already been reported in humans.ac. B. not only in Serbia.

Similarly to other tick borne infections agents. human granulocytic anaplasmosis (HGA) caused by A.. Germany. animals introduced into new areas by humans such as farm animals imported into areas where they were not present before. or agents that were constantly present in the affected area at a low level or in a different host and due to some change have become more widely spread in the population under concern (Harrus and Baneth. Switzerland. 2012). therefore. 2011 and Hasle. phagocytophilum. Czech Republic. Important tickborne zoonoses such as Lyme disease. migrating wild animal species such as jackals. it is likely to have been circulating among wildlife animals and ticks long before it emerged as a recognised clinical cause of human disease. A wide variety of pathogens is transmitted from ticks to vertebrates including viruses. 197 . 2013). animals and ticks within the environmental conditions. and human babesiosis caused by B. 2014) Ticks as vectors Approximately 900 species of ticks have been described to date. their transfer from one location to another depends mostly on movement of hosts including birds which can fly long distances (Mathers et al. It has been identified throughout Europe. inevitably makes them suitable to host other organisms. Figure 1 – Overlaping of tick borne infections among different species (Baneth. A triangle between humans. in patients in Sweden. The lifestyle of ticks which includes uptake of blood from hosts. Candidates Neoehrlichia mikurensis is an intracellular bacterium member of the Anaplasmataceae family which causes severe disease with fever and septicaemia in humans. 2005). of which most have a life cycle which requires passage through the vertebrate host (Dantas-Torres et al. protozoa and helminths. has been a challenge for researchers for some time now. approximately 200 belong to the Argasidae (soft ticks). fungi. Ticks cannot fly or move long distances by themselves and. Tick borne diseases are one of the key issues within a „One Health“ concept. bacteria such as rickettsiae and spirochetes.. movement between different hosts and production of eggs from which a new generation of ticks develops. human monocytic ehrlichiosis (HME) caused by Ehrlichia chaffeensis. Several factors contribute to the change in geographic ranges of tick borne infections. 2014). China (Foldvari. It is an example of an “emerging” tick borne infection that has been known only for a decade and appears to be dispersed in multiple regions.First International Symposium of Veterinary Medicine – ISVM2015 and imported into areas where they were previously unknown. microti were all described in the US during the second half of the 20th century and later in other countries and continents. of which more than 700 belong to the Ixodidae (hard ticks). secretion of saliva into the host tissues.

Transmission of tick borne infections can also occur by contaminated blood transfusions and needles.. instead of Lyme borreliosis which is used in North America. 2003).. The study indicated a higher prevalence of borreliosis in owners of hunting dogs (15%) compared to non hunters (9%). but in more than 90% of hunters. if competent tick vectors and reservoir hosts are found in those areas.l. Babesia of different species have been shown to be transmitted by blood transfusion in both humans and dogs (Stegeman et al. For example. In Europe several Borrelia species have been described. but do not rely on infecting people for their persistence.afzelii. there are some pathogens of veterinary importance which are transmitted naturally by other mechanisms. Factors that influence the distribution of I. but I. Ixodes ticks are abundant throughout Europe. 1991).. and may affect humans or domestic animals. Despite the global abundance of humans and their presence in a variety of climates and ecological conditions. military personnel. Considering the large size of the global human population. is protozoa that belongs to the Apicomplexa and infect vertebrates by oral ingestion of an arthropod host containing infective sporozoites. there was no evidence of clinical symptoms. Hepatozoon spp. allowing dispersal of ticks and pathogens into new territories (Estrada-Peña et al.. host or habitat). Such artificial transmission may result in spread of tick borne infections to new areas. which are considered to cause human borreliosis with clinical symptoms. infect dogs that orally uptake and ingest ticks harbouring mature sporozoites. they are not major reservoirs for tick borne infections. (2) factors related to changes in the distribution of tick hosts (which may be directly or indirectly a consequence of human interventions) and (3) other ecological changes.valesiana. as infected patient or as a sentinel for tick borreliosis in Europe is rather limited. There is an association between occupations such as forestry workers. Although the majority of tick borne infections are transmitted via the tick saliva during the course of the blood meal. humans would be expected to be one of the most common blood sources for ticks. Information on the role of dogs in tick borreliosis. It is proposed to use term borreliosis or tick borreliosis for Borrelia infection in Europe with B. Hepatozoon spp. 2012). 2011). and B. Lyme disease circulates mostly among rodents. or imported pet animals. Tick borne infections of humans.First International Symposium of Veterinary Medicine – ISVM2015 rodents travelling accidently with ships or trucks. 2006).. 2003. ricinus in Europe have been identified as the following: (1) factors directly related to climatic change (affecting the tick. farm animals and companion animals such as dogs and cats. and humans or domestic dogs are just incidental hosts that could suffer from clinical disease but do not play an important role in the enzootic transmission and epidemiology of this infection (Radolf et al. These species are referred to collectively as Borrelia burgdorferi sensu lato. Certainly most tick borne infections circulate between wildlife animals and ticks. however all of these zoonotic agents are associated with wildlife reservoirs Tick borreliosis One of the most prevalent vector borne disease in humans in Europe is borreliosis. and the surface size of the adult human body.garinii and B. The data for seroprevalence of borreliosis in dogs in Europe 198 . all the way up to Norway and Sweden (Jaenson and Lindgren. may overlap. Climate change may also facilitate migration of vertebrate tick hosts. rangers and borreliosis (Nohlmans et al. For example. and some agents such as B. Stuenzner et al. I. ricinus has also been recorded at 1200-1300m above sea level in Check Republic and Austria (Daniel et al. B. burgdorferi and Anaplasma phagocytophilum are able to infect hosts belonging to more than one of these categories.. 2012). the high density of humans in some areas. The risk of tick bite during outdoor activities for humans and dogs was studied in hunters and compared to humans without association to hunting.burgdorferi s.ricinus nortward shift has been noted.

B. seroepidemiological data and improved diagnostic tests are urgently needed to evaluate the importance of the parasite. Scotarczak and Wodecka. real-time PCR. the geographic distribution of babesiosis has expanded from western and central Europe toward northern Europe. probably due both to changes in the climate which has increased tick survival and due to an increase in companion animal travels. 1998) Tick-borne rickettsiales Rickettsiales transmitted by ticks in Europe and causing clinical signs in dogs are Anaplasma phagocytophilum and Anaplasma platys. the detection of the parasites in ticks and seroepidemiological data in Europe identified 3 humanpathogenic species: B. Slovakia. 2011. but also Ixodes ricinus and Dermacentor spp have been described (Benianti et al. 2014) Rickettsia conorii is the most important tick borne rickettiosis with public health impact in Europe. Human babesiosis is caused by the intraerythrocytic parasite of the genus Babesia (phylum Apicomplexa). Dogs have been identified as reservoirs of Rickettsia conorii (Levin et al.. Rarely. Comprehensive systematic investigations of the prevalence in ticks. The relative small number of approximately 50 documented human cases is probably due to the lack of knowledge of the disease and the availability of diagnostic tools. There is also Erlichia canis. venatorum (EU1-3). The main vector for Rikettsia conorii is Rhipicephalus sanguineus. Italy. and not merely restricted to research facilities.First International Symposium of Veterinary Medicine – ISVM2015 vary from only several percentages in Czech Republic. to 50% in Slovakia (Pelchalova et al. Poland. microti. Finland. which was difficult and sometimes impossible prior to the advent of molecular biological techniques. Sweden. Human babesiosis is a zoonotic disease with a worldwide increasing importance according to the increasing number of immunocompromised patients.. Anaplasma phagocytophilum has been found all over Europe in the following countries: Austria. 199 . In recent years. divergens und B. Luxembourg. Clinical symptoms have a wide range from asymptomatic to severe and letal cases. Humans are commonly infected by the bite of Ixodid ticks. but have also expanded the capability of detecting new. transmission does occur perinatal or via contaminated blood transfusion. Stefancikova et al. belonging to the Anaplasmataceae family.. Hungary. Netherlands. 2003.. It is the pathogen of „Mediterranean spotted fever“. Slovenia. Kiss et al... Review of current situation in Serbia The development of molecular diagnostic tools such as conventional PCR. Russia. previously unknown. 2002). So far. Furthermore. pathogens and distinguishing between species and strains of microorganisms. 2012) Tick borne babesiosis In temperate areas of Europe. Poland and Romania. 2006. Dermacentor reticulatus is a quite common tick species affecting dogs and is the primary vector of canine babesiosis due to Babesia canis Canine babesiosis is a tick-borne disease caused by intraerythrocytic protozoa of the genus Babesia which can cause severe clinical illness. Germany. France. these molecular capabilities have become accessible and affordable to diagnostic laboratories in the last decade. Czech Republic. Switzerland and United Kingdom (Jahfari et al. Norway. Belgium. DNA sequencing and other methods have not only enhanced the capacity of diagnostic laboratories to detect the presence of infection. Spain.

humans * No Conclusion Vector-borne diseases are important infectious disease of human and veterinary medicine across Europe. D. tick borne pathogens and tick borne diseases has started approximately a decade ago. Dermacentor reticulatus. 2013). 2008).burgdorferi s. which can be found in the region of Serbia and some of them have already been reported in humans (Savić et al. humans Cats * Ticks Ticks. Anaplasma phagocitophylum has recently been found in 13. dogs. 2014. 2008. Belgrade region and middle Serbia)..burgdorferi s. Coxiella burnetii and Francisella tularensis in ticks. 2013). B. The prevalence for B..s. All of the monitored pathogens are causative agents for more or less dangerous zoonozes. The first studies were on the presence of Borrelia burgdorferi sensu lato strains in ticks. sheep. During the last few years a lot of work has been done.. not only in Serbia. 200 . the dynamics of ticks spreading into new habitats due to climate changes and land use is not enough known. Monitoring of the prevalenece of B. Flea Tick Tick Tick Tick Tick Detection in Serbia Ticks. It was found in Dermacentor reticulatus (21. B. The prevalence in ticks in the second study was quite higher 46. 2010. In another study.l.First International Symposium of Veterinary Medicine – ISVM2015 In Serbia. 2010). lusitaniae.l.. in different tick species. Tick species found in different regions of Serbia so far are the following: Ixodes ricinus. in ticks is constant.9% ticks in Serbia. 2013). more genospecies were found in ticks during the last few years: B.8% in ticks (Milutinovićet al. 2002).burgdorferi in ticks varies from 23% to 42. including strains with proven pathogenicity for humans (Tomanović et al.. Babesia spp is found to be present in ticks with two different methods. B. For B. Hemaphysalis punctata. Haemaphysalis concinna (Tomanović. by molecular detection in ticks collected from the field (Mihaljica et al.40% (Pavlović et al. Both studies were done in the same region. Table 1 – Zoonotic tick borne diseases and hosts found in Serbia Disease Borreliosis Bartonellosis Ehrlichiosis Rickettsiosis Anaplasmosis Tularaemia Coxiellosis Tick-borne encephalitis Louping ill *unpublished data... reticulatus ticks. Rhipicephalus sanguineus.. but in the whole region – on the topic of the presence of Anaplsma phagocytophilum. The other group of authors searched for Babesia by microscopic analysis of the midgut content of ticks in R. From all the published data recently. but it differs among different regions in Serbia (Vojvodina. followed by research on Babesia spp. research still going on Vector Tick Flea. Tick Tick Tick. Potkonjak et al. it is concluded that further research is needed and field studies on vector borne diseases in Serbia.57%) and Haemophysalis concinna (8.. research on ticks as vectors.. 2012). 2014. Dermacentor marginatus. Potkonjak et al. garinii and B. afzelii. marginatus and D. sanguineus.. The epidemiology of ticks. dogs Ticks Ticks.57%) with one group of authors.5% in different regions (Milutinović et al. collected from dogs with clinical sighs of babesiosis. Coxiella burnetii was found in less than 7% in ticks in different regions of Serbia (Tomanović et al.burgdorferi s. valaisiana (Tomanović et al. The prevalence for Francisella tularensis microorganisms has also been found as 3. 2012). Savić et al.

8 (9). Unlike some of the major human vector-borne diseases associated with flying insect vectors.03. 201 . and an increased awareness. Epub 2014 May 15. From a veterinary medicinal perspective the importance of a ‘One health’ concept was recently addressed by the World Small Animal Veterinary Association (WSAVA) by initiating the ‘One Health Committee’ ( Day. One health: the small companion animal dimension Vet. diagnostic. Dis. It is the aim of this committee to position small animal veterinary medicine as an integral part of the ‘One health’ concept in terms of zoonotic and vector-borne diseases (Day. Chomel. Shift of the tick Ixodes ricinus and tick-borne encephalitis to higher altitudes in Central Europe. epidemiology. Dumont P.. J.44(9):591-6. Eur. Ticks and tick-borne diseases: a One Health perspective Trends Parasitol. 2002. 5. Beugnet F. Tick-borne infections of animals and humans: a common ground. D. 2014 Beninati T. Human tick borne infections cannot be described without studying and understanding their relationship to animal hosts and reservoirs.. Noda.. Esposito.011.1016/j. from epidemiology. Soll M. 49. J. 2010). Vectors. References: 1. 2014). Infect.. Parasit Vectors. doi: 10. 4. Int J Parasitol. N.. Dermacentor reticulatus ticks. pp. 4. like Anaplasma phagocytophilum or Rickettsia conorii are emerging and re-emerging vector borne diseases in Europe. The question at the moment is weather is the global prevalence of tick borne infections increasing or are improvements in the ability to detect infection using sensitive and specific new techniques. 2011. 437–446. 847–849. 28. needs to be included in any action of European bodies regarding tick borreliosis and also this disease is an important canine vector borne disease. F. clinic..8:50. Daniel M. 6. Danielova.. pp. 3. doi: 10. and combined teams of experts from several scientific disciplines such as entomology. Nozicka. C. One health: the importance of companion animal vector-borne diseases Parasit. 22. Baneth G. point clearly towards the necessity for a joint effort under the ‘One health’ concept in all aspects. A. Clin. responsible for more detection of disease? It is most likely that both an increase in the spread of tick borne infections and an improved capability of detection are the answer for the global rise in reporting of tick borne infections. 2012. Rec.1186/s13071-015-0682-z. medicine. Day M. Dis. Repellency. 2003.J. Infect. B.2014. Genchi. tick borne infections are zoonoses and control efforts must consider this when programs are developed to limit or eradicate them. 2011). Lo.B. prevention of attachment and acaricidal efficacy of a new combination of fipronil and permethrin against the main vector of canine babesiosis in Europe. Vector borne diseases shared between humans and dogs. 2015. 983–986. G. First detection of spotted fever group rickettsiae in Ixodes ricinus from Italy Emerg. Infections with Rickettsiales.J. 7. B. Microbiol. 2014 Aug. 2. Day M. Jirsa. Fourie JJ. 327–328. Favia. Otranto.ijpara.. 167. A. therapy and prevention. p. V. pp. 2010. surveillance in wildlife and tick populations. Science and Technological Development of the Republic of Serbia. Kriz. Dantas-Torres F. 2015 Jan 27. Integration of veterinary and human reporting systems. Acknowledgments This work was supported by the grant TR31084 of the Ministry of Education. pp. where infection could be independent of association with animals. Rizzoli. public health and veterinary medicine are needed for the formulation of regulations and guidelines for the prevention of tick borne infections (Baneth. H.First International Symposium of Veterinary Medicine – ISVM2015 Veterinary medicine in general.

2014 May. Santos-Silva.a rare but potentially dangerous zoonosis.F. Vektorske zoonoze PASA u Vojvodini. Čakić S.T. Mencke N.. George.T. B Lako. Heylen D. A. Microbiol. Földvári G. 758–768. J. 87–99. pp. 1. Terzin V. Medlock J. A. Rigó K. pp. Transport of ixodid ticks and tick-borne pathogens by migratory birds.A. 64 (4). 5. Estrada-Peña. van Maanen C. Schánilec.. Milutinović M. Int. doi: 10. Rizzoli. Molecular detection of Babesia spp in ticks in Northert Serbia.Sci. Derdakova. Pavlović I. 2014 Aug 15. Parasites & Vectors . M.L. 25. Tomanović S. Driving forces for changes in geographical distribution of Ixodes ricinus ticks in Europe. P. Sánchez. Future challenges for parasitology: vector control and 'One health' in Europe: the veterinary medicinal view on CVBDs such as tick borreliosis. 10. Takumi K. J. A Petrović. Hendrickx. Domestic dogs (Canis familiaris) as reservoir hosts for Rickettsia conorii Vector-borne Zoonotic Dis. Borrelia burgdorferi in ticks and dogs in the province of Vojvodina. C. Lako. 2006. Milutinović M.. 2014.. 10. 2002. Jahfari S. A. van Leeuwen AD.007. A. 30 (3). Geneeskd.139 (18):957-62. Terzin D. V Vračar. Tóth M.3201/eid2003. 1991. Golovljova. 10. 1. 12. M. Infect.K. Cell. doi: 10. Mihaljica D.20(3):496-8. Tomanović S. L. G. Serological confirmation of Borrelia burgdorferi infection in dogs in the Czech Republic. K. Potkonjak. Killmaster. Res. 2011. Nat. 231–238. Földvári G.. Epub Apr 23.1186/1756-3305-7-365. Stevenson. 20. N. Serbia.. Hansford. Commun. Lepsanović. Hu . Grgić Ž. Hildebrandt A. T. 15. E. Nohlmans M. 357–361. Borrelia burgdorferi sensu lato. Rev. Ćurčić V.. Zákovská. B. Radolf J. Fonville M.195(3-4):256-71.M. Jablonszky M. 1309–1318. L.G. Hasle G. Van Bortel.. Arhiv veterinarske medicine.E. Exp Appl Acarol. pp. Emerg Infect Dis. G. pp. Heyman P. Sprong. Jurišić A. H.1016/j.. Takken W. pp. Z. rickettsiosis and canine leishmaniosis. 2005. Parasit Vectors. Of ticks. van den Bogaard. 2 (1). An assessment of the distribution and spread of the tick Hyalomma marginatum in the western Palearctic under different climate scenarios. K.C. Milutinović M. 14. I. 10-15. pp. Majoros G. Parasitol. Caimano.. K. Savić S.M.45(3-4):171-83.E. Human babesiosis . Candidatus Neoehrlichia mikurensis and Anaplasma phagocytophilum in urban hedgehogs. 2014. Lolić Z. Ruzić M. Lindgren. 19. Pfister.P. H.M. Sprong H. 1951-1958. Estrada-Peña A. van Boven. Lazić. Szekeres S.. Pejchalová K. Epub Jun 13. Vidić B. 28–33. Vet.G. J. The range of Ixodes ricinus and the risk of contracting Lyme borreliosis will increase northwards when the vegetation period becomes longer Ticks Tick Borne Dis. 22. 35. Dtsch Med Wochenschr.J. B. Epizootiological research of canine babesiosis in the Belgrade district. 2288–2292. mice and men: understanding the dualhost lifestyle of Lyme disease spirochaetes. 135 (48) . Radulović Z. Oteo. p. van Duijvendijk G. 2008. Fukui T.Protozool. 2014. Vial. O. Potkonjak A. P. 2014. Radulović Ž. Epub Apr 6. J.Biol. 2012. Kazimirova.. doi: 10. Harrus S. Vectors. M. 2012. 7(Suppl 1):P18. Arch. Fucík. p. Butler CM. 2008 Aug. Estrada-Sánchez. Anaplasma phagocytophilum.7:365. Circulation of four Anaplasma phagocytophilum ecotypes in Europe. A Jurišić.D.. 23. A. Levin M. D Rajković. H. G... Molnár V. 26. S. Jaenson T. 18.K.vetpar.M.2013. Belgrade. Microbiol. Francisella tularensis and their co-infections in host-seeking Ixodes ricinus ticks collected in Serbia. Temtsova. Rijks JM.E. Jaenson. pp. 2012. Front. 2013 Aug 1. A.04. Tijdschr. Jensen. Baneth. vol. 2014 Mar. 77-87. pp. van Wieren SE.. doi: 10. Parasite. 13. Res.1055/s-0034-1369936. Petković D. 2003.1007/s10493-008-9166-6. S. 16. Sprong H. Parasit.First International Symposium of Veterinary Medicine – ISVM2015 8. 202 . Randolph. Vidić. 2013. Zeller. Bormane. A. 11. br. doi: 10. Prevalence of Lyme borreliosis in The Netherlands Ned. Tack W. A. M.A. Coipan EC. Vector Borne Zoonotic Dis. Masuzawa T. Savić S.130935. Molelecular characterization of Borrelia strains isolated from ticks in Vojvodina. 12. Hunfeld KP. 48. E Ruzić-Sabljić. 2012. Jahfari S. Szekeres S. 44– 49. 17 (4) . Jensen. B. 2013. van der Giessen J. 12 (1) . L. 12. A. 2012. 2010. 9. Papa. Okamoto Y. Penezić A. J. 6. 21. Vet Parasitol. Drivers for the emergence and re-emergence of vector-borne protozoal and bacterial diseases. Plantard.. S Savić. Coipan EC. Blaauw. Hengeveld P. 24. 17.

M. J. Environ. Wochenschr. Pet’ko. 31. 2013 Mar. Mihalca. Strain diversity of Borrelia burgdorferi sensu lato in Serbia. Z.F. Agric. D. Skardová. Wodecka.. G. W. eastern Slovakia Ann. Marth. Wien.J. Exp Appl Acarol. Tresová. 1998. pp. Stefançíková A. 2006. Cakić S. Chochlakis D. A. Wendelin. pp. 222. Med. Dumitrache. 2014.First International Symposium of Veterinary Medicine – ISVM2015 27.. 203 . Stegeman J. 10 (1). G. Krupaci. 7(Suppl 1):O25. Med. 682–685.R. 11 (9) . Parasites & Vectors . E. R Sukara. Bordeanu. Agric.B. 25–30. M. 2013. L.59(3):367-76. Transfusion-associated Babesia gibsoni infection in a dog.F. Gliga. 30. M. M Milutinović. Spînu. S Ćakić.. Breitschwerdt.. pp. Stuenzner D. Radulović Z. 113–115. Mihaljica D. Klin. V. Am.D. Tomanović S . I. Sesztàková. B. E. Milutinović M. 2003. A. 2003. D Mihaljica. Assoc. Halouzka.. I. 29. A. 28. Sixl. Kruger. 32.O. T. Med. J.. E Ružić-Sabljić. Skotarczak B. pp. B. E. J. Birkenheuer. Prevalence of Borrelia burgdorferi sensu lato in the tick Ixodes ricinus in the Styrian mountains of Austria. Environ. 959–963. A. doi: 10. Epub 2012 Jul 7. 1259–1262. 5 (1) . Mircean. 33. Tomanović S.1007/s10493-012-9597-y. Kiss. Elisa comparison of three whole-cell antigens of Borrelia burgdorferi sensu lato in serological study of dogs from area of Kosice. 2011. pp. Ž Radulović. Cadar. Serological reactivity to Borrelia burgdorferi sensu lato in dogs and horses from distinct areas in Romania Vector Borne Zoonotic Dis. Hubalek.. 118. Psaroulaki A.. Brudaşcă. Molecular evidence of the presence of Borrelia burgdorferi sensu lato in blood samples taken from dogs in Poland Ann. Tselentis Y. Analysis of pathogen co-occurrence in host-seeking adult hard ticks from Serbia. Vet..

Novi Sad. the data on the WNV serology studies conducted in human population in Serbia in the last few years. antibody and virus detection. Serbia 2. Indirect monitoring of virus presence was performed by serological testing of WNV seronegative . University of Novi Sad. Recently. Keywords: West Nile virus. the number. Faculty of Agriculture. The results of the first studies on WNV presence in mosquito vectors. Department of Biotechnology. Juan Carlos Saiz 4 1.rs Abstract West Nile virus (WNV) is a neurovirulent mosquito-borne Flavivirus with zoonotic potential. constituting a serious veterinary and public health problem. Vesna Milosevic3. In addition. Serbia Introduction West Nile virus (WNV) is a neurovirulent mosquito-borne Flavivirus with zoonotic potential. Number of tested samples is defined at the level of each district of the Republic of Serbia in relation to the risks of WNV infection. The program was funded by the Veterinary Directorate. wild boars. Novi Sad. which is maintained in nature in an enzootic transmission cycle between avian hosts and 204 .sentinel horses and backyard chickens hatched during 2014. Madrid. prevalence and incidence of WNV infection among virus natural hosts and vectors. and in human population. Institute of Public Health of Vojvodina. Serbia 4. with neurological consequences for birds. and consequently timely alerting of human health services and local governments in order to control the mosquito population and to inform the local communities. University of Novi Sad. surveillance program. The monitoring program was based on the direct and indirect monitoring of WNV presence in nature. and the existing data of WNV outbreaks in 2012. Diana Lupulović1.ns. Serbia 3. and direct monitoring was done by molecular testing of WNV presence in pooled mosquito’s samples and in wild birds. sentinel (horses) and other animal species. and it was implemented on the field by veterinary service in collaboration with entomologists and ornithologists. 2013 and 2014 are included. Dušan Petrić2.ac. the national program for WNV monitoring launched by the veterinary service in Serbia in April 2014 is presented. including Serbia. humans and horses have increased dramatically throughout central and south Europe. mosquitoes. Medical Faculty. Novi Sad. Sava Lazić1. The emergency of WNV infections in Serbia is described through the current epidemiology situation based on recent data on the presence. The short overview of the WNV serology studies conducted on horse blood samples collected in different occasions during the last six years. Laboratory for medical and veterinary entomology. Ivana Hrnjakovic Cvetkovic3. Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA). human population. Also. domestic and wild animals. Spain Corresponding author: tomy@niv. and the results of the serology studies conducted among other animal species like pigs. and roe deer in Serbia are presented and discussed.First International Symposium of Veterinary Medicine – ISVM2015 Invited lecture WNV IN SERBIA: UPDATE OF CURRENT KNOWLEDGE Tamaš Petrović1. Scientific Veterinary Institute “Novi Sad”. frequency and severity of outbreaks of infections caused by WNV. The main objective of the monitoring program was early detection of WNV presence in nature. and in wild birds as virus natural hosts in Serbia are presented and analyzed.

A total of 337 persons tested in 2010 were exposed to at least one mosquito exposure related risk factor.. ELISA IgG testing revealed the seroprevalence of WNV in 6.. Wild birds are important to public health because birds migrating across national and intercontinental borders and becoming a longrange virus vectors (Linke et al. 2011). 2006. program based WNV surveillance in sentinel chickens. Russia and the Mediterranean basin causing dozens of humans and horses deaths (Castillo-Olivares and Wood. Middle East. Only scarce historical data exists about the presence of WNV in human population and indicate seroprevalence of WNV in republics of former Yugoslavia of 1-3% in Croatia.First International Symposium of Veterinary Medicine – ISVM2015 ornithophilic mosquito vectors.. 2010. Weissenböck et al. however severe neuroinvasive disease and occasionally with fatal outcomes can occur. mainly of the Culex genus (Hayes et al. 2008. while in the group using window screens only 0. The obtained seroprevalence in this study still didn’t suggest more intensive circulation of WNV in Serbia. Since 2008. 1% in Montenegro and 1-8% in Serbia (Vesenjak-Hirjan et al.... horses or mosquitoes did not exist before 2013. West Nile virus (WNV) was first isolated from a febrile woman in the West Nile district of Uganda in 1937 (Smithburn et al. but also Aedes and Ochlerotatus genus. constituting a serious veterinary and public health problem for Europe (Barbić et al.. 205 .. The virus occasionally infects other vertebrates. Valiakos et al. Europe. 1940) and today is considered as the most widespread flavivirus in the world. After almost a 30 years gap. The virus is maintained in an enzootic cycle between ornithophilic mosquitoes. 5. 2004. 2010.. Blitvich. 2007.. Following infection. Russia.6% . 2003). the regular. and certain wild bird species (Savini et al. many bird species produce levels of viraemia that are sufficient for transmitting the virus to mosquitoes (Komar et al. Also. WNV was found in more than 150 species of wild and domestic birds (van der Meulen et al. until the 1990´s WNV had caused sporadic outbreaks with rare reports of encephalitis but its epidemiological behaviour changed when it re-emerged in Romania. 1% in Bosnia and Herzegovina and Kosovo. 2003).. 2012.04% were seropositive to WNV. are occasional. including humans and horses. 2012). Human and mammals.. no clinical manifestation of disease was ever reported in Serbia until 2012. WNV epidemiology in human population in Serbia First serological investigation was conducted in 1972 and antibodies against West Nile virus (WNV) were found in 2.. and in 2008 and 2009 in goshawks and a falcon in Austria (Bakonyi et al. 2012). 2012. 2010).67% of human sera of the 45 patients who were hospitalized for encephalitis or meningoencephalitis in the period 2001-2005 and 3. 2008... in which it may cause sporadic disease outbreaks that may result fatal.69% of 406 samples taken from healthy persons. 2004.. Among them...7% of human sera (Bordjoški et al.99% (18 out of 451).. 1072).. Papa et al. dead end hosts and play limited roles in the natural cycle because viraemia is generally too low to infect mosquitoes (Dauphin et al. Except this data. The history of West Nile fever in Serbia is largely unknown. 2007). WNV infections have been described in a wide variety of vertebrates (Komar et al. 2011). Erdélyi et al.4. Australia and Americas (Trevejo and Eidson. Average seroprevalence of WNV in samples taken from 2001-2010 was 3. 1991). endemic in Africa. that should be submitted to laboratory testing for WNV presence. Calistri et al. Most of the probably infected people did not screen windows and doors in their houses. 2005. Platonov et al. Due to absence of routine diagnose praxis and limited resources in hospitals of Serbia the human cases of meningoencephalitis of “unknown” origin. Calistri et al. had been neglected up until 2012. Ziegler et al. 2012). In Europe... with the exception for research purpose. only recently the strains of WNV lineage 2 were identified in Europe: in 2004 and 2005 in goshawks and birds of prey in Hungary. in 2007 in Volgograd. as to our knowledge.. Ziegler et al.88% were seropositive to WNV (Petrić et al. 2008. In addition. 2012). Wodak et al.. 2005). 2011). WNV has been heavily spreading throughout central and southeastern Europe. Asia. especially horses. Ziegler et al.

a total of 303 West Nile fever cases were reported. 2012. 2014). The high WNV prevalence was assumed to be the results of intensive WNV circulation that was confirmed in Romania during 2008 . Infection in 35 cases resulted fatal (lethality of 11. and in the second study the blood sera were taken from horses situated in the stables. with high number of horses in the same location. WNV antibodies were found in 72 (28. often individually reared. sampled during 2009-2010.6%) sera samples..First International Symposium of Veterinary Medicine – ISVM2015 In August 2012. was reported for the first time ever in Serbia (EpiSouth Weekly Epi Bulletin .23%) obtained in horses during 2012 was much higher than that found in horses during 2009 and 2010 (12%). 2013). This prevalence (49. WNV epidemiology situation in horses Serological analysis by ELISA based on WNV recombinant envelope E (rE) protein and PRNT showed for the first time in Serbia that 12% of 349 tested horses from northern part of country. The higher level of 28. 2014). .7%). 2012. Per stable. 2013. 2014). Almost all the cases were detected in central and northern part of the country.. during 2007-2011.. presence of anti-WNV IgG antibodies were examined by commercial ELISA test in blood sera samples of 130 horses from 6 stables and 1 settlement in Vojvodina province. range: 42–650). ECDC. the presence of WNV specific antibodies was examined in 252 horse sera samples collected from 7 different stables and locations in Vojvodina province and Belgrade area. South Backa and Srem county) (ECDC. WNV seroprevalence ranged per stable from 13. among which 202 were clinically and laboratory confirmed.5%).3% up to 40% seropositive animals.6%). which in one case also cross-neutralized Usutu virus. 2013). 2013. This was the first time that anti-USUV high neutralizing antibody titers have been reported in horses. presented specific neutralizing WNV antibodies (average PRNT90 = 120. among which 42 were clinically and laboratory confirmed.23% (64/130) samples.N°232. Almost all of the cases were also detected in central and northern part of the country (Institute of Public Health of Serbia. 2014). As of November 30.. 2012. Positive horses were found in 14 of the 28 municipalities studied. 72% of them in the Beograd district (ECDC. so 47% of cases were from Serbia. being the first time that WNV infections in the country have been associated with clinical symptoms... and became even more severe during 2013. Obrenović et al. northern Serbia (Petrović et al.. The highest prevalence of anti-WNV antibody positive animals was found in stable near Romanian border (40%) and near Belgrade (35. a total of 71 West Nile fever cases were reported.. This epidemic continued. and in 9 cases resulted fatal (lethality of 12. 2011). Popović et al.2010 and the close proximity of river Danube with a high circulation of migratory wild birds (Medić et al. In our another previous study (Medić et al. Popovic et al. 2013. Positive results were obtained in 49.6% anti-WNV antibody positive horses obtained in that study comparing to 12% reported in our first investigation could be explained by the fact that in the first study the horse sera were collected randomly from the whole territory of Vojvodina province. which are up to 200km distant (Lupulović et al. Obrenovic et al. most of the examined horse sera in this study were sampled during 2010 and 2011 that could imply on possible more intensive WNV circulation during year 2011. Also.N°240. The outbreak characteristic was similar as those from 2012. 2014). The epidemic also continued during 2014. In Europe during 2014 in total 163 human cases were reported. It can be concluded that WNV infection in Serbia become endemic and can be assumed that it will be public health problem in the coming years also. an outbreak of WNV infection in humans. during November and December of 2012. percent of seropositive animals was from 35% to 64%. including the confirmed seroconversion in at least 8 horses that 206 . All the cases were detected in central and northern part of the country. to asses WNV presence in the environment immediately after the human WNV outbreak in 2012. In addition. and 103 were classified as probable cases. As of November 2nd. and 65 out of 76 (86%) of them in four counties (Belgrade. South Banat. In total 76 clinical cases were reported and 9 cases resulted fatal.

by RT-qPCR in 9 birds: 3 Northern goshawks (Accipiter gentilis). West Nile virus from one Northern goshawk (SRB-Novi Sad/12) was isolated on Vero cell culture and its full genome sequenced. 2013). WNV lineage 2 has expanded southwards and reached Serbia recently. Further on. In 2010 mosquito trapping was focused 207 .. and Hungary. it seems logically to think that since its original detection in Hungary. 1 Legged gull (Larus michahellis).6%) blood sera of: 4 Mute swans (Cygnus olor).. 2013).First International Symposium of Veterinary Medicine – ISVM2015 tested negative in 2010. 2 White-tailed eagles (Haliaeetus albicilla).0%) with new cases of seroconversion were detected also indicating an intensive WNV circulation in 2013 (unpublished data). and 1 Common pheasant (Phasianus colchicus). at least. based on serological testing of humans and horses. 1 Bearded parrot-bill (Panurus biarmicus). which simultaneously circulated during summer of 2012. Three of the seropositive birds found here were resident birds (two White-tailed Eagles and one Common Pheasant). Seven of these birds died during the summer of 2012 while two (a pheasant and one goshawk) died during winter-early spring. According to these findings. are seropositive (unpublished data). Mosquitoes were sampled on the spots where possible circulation. WNV circulation was examined by ELISA and PRNT in 92 blood sera and 81 pooled tissues from 133 wild resident and migratory birds from 45 species within 27 families collected from January until September 2012 in Vojvodina Province northern part of Serbia (Petrović et al. Viral RNA was detected. Italy. Very recent WNV infection theory is also supported by findings that among young. thus confirming an intensive WNV circulation in 2012 on the territory of Serbia. These results suggest that WNV has reached the country in. isolation of WNV-RNA from dead predators (5 of the 9 WNV positive birds) provides more evidence that birds of prey play a key role in virus transmission (Petrović et al. Presence of WNV in natural host species and vectors in Serbia Presence of WNV was also studied in susceptible wild bird’s species and mosquitoes as virus natural hosts and vectors in the last few years in Serbia. Data obtained from human serological surveillance in 2009 had indicated seven “hot spots” of possible WNV transmission in the municipality of Novi Sad (capital of Vojvodina Province). can be distinguished (Petrović et al.53-75. for the first time in Serbia. 2 White-tailed eagles. the areas around the rivers Danube. High prevalence of 46. as it showed a total of 29 distinctive nucleotides when compared to those circulating in Europe. SRB-Novi Sad/12 isolate was unique. almost 57% tested positive on anti-WNV antibodies (Petrović et al. Sava and Tisza. but it cannot be ruled out that there had been prior sporadic human and animal cases that have gone unnoticed.. and 1 Common pheasant. Phylogenetic analysis of this complete genomic sequence showed a lineage 2 strain that clusters with the viruses responsible for the most recent human and animal outbreaks reported in neighbouring countries. Similarly. up to 3 years old animals. 2014). WNV antibodies were detected in 7 (7. Eight of the nine WNV RNA positive birds were strictly resident.88% (ranged between stables from 23. was detected in order to optimally utilize available number of test kits and minimize the number of pools for mosquito surveillance. All the isolates were classified by phylogenetic analysis of partial E region sequences as lineage 2 WNV strains and they were closely related to those responsible of recent outbreaks in Greece. 2013). two different events and suggest that the virus not only has become endemic in Serbia and surrounding countries. suggesting that they became infected in the country. The very recent data suggests that more than 50% of horses from Northern and central part of Serbia. Moreover. however. 96 horses from 5 tested stables during 2012 were tested again during 2013 with the same methodology.. but that it is also evolving while circulating in the area. 1 Hooded crow (Corvus cornix). while the other four (Mute Swans) are considered both migratory and resident birds in Serbia. Comparison of partial sequences of the E region from five additional WNV sequences recovered from respective birds in this study shows that at least two different groups of lineage 2 strains.

During this experiment. WNV seroprevalence in different domestic and wild animal species Presence of anti-WNV antibodies in blood sera of different animal species detected recently also represents the evidence of intensive circulation of WNV in the last few years in Serbia. During the year 2012 WNV outbreak in Serbia. The very recent testing of WNV presence in mosquito vectors (Cx. 208 . neutralized WNV. The surveillance program encompassed sentinel species (poultry and horses). 688 samples obtained from 279 farm pigs..First International Symposium of Veterinary Medicine – ISVM2015 on these “hot spots” revealing WNV RNA in three out of 50 pools of Cx. Out of tested blood sera of 66 donkeys. ELISA-reactive sera were identified in 43 (15. Active surveillance was performed by serological examination (by ELISA) of sentinel poultry and horses and by testing of virus presence in samples of mosquito vectors (sampled by dry-ice baited traps in the period of most prominent vector activity using special traps)... 6 (14%).31% poultry (Đuričić et al. in press). To assess WNV circulation among mammals in the country. In addition. 2013). Passive surveillance encompassed serological (testing of paired serum samples) and virological examination of clinically ill horses manifesting signs of CNS dysfunction. pipiens pipiens. either temporarily or permanently. Of these. The presence of WNV genome was established in only three pooled-samples of mosquitoes collected during 2010 in the territory of Detelinara (part of the city of Novi Sad). The isolate was typed as lineage 2 WNV (Petrić et al. The surveillance program was conducted throughout the year according to the provided guidelines. 2012). 318 poultry. presence of anti-WNV antibodies was found in 0. 2015). 1076 dogs. 102 sheep. mosquitoes (particularly species Culex pipiens.4%) pigs..5%) respectively. and 17 (18. but still the virus circulation in vectors is endemically present for the least four last years. West Nile virus RNA was detected in 9. One out of the 45 ELISA negative sera tested. The Cx. the first finding of WNV in mosquitoes in Serbia (Petrić et al. pipiens pipiens) was done during the first WNV surveillance program during 2014 in Serbia. 318 wild boars. The detection of virus presence in birds and mosquitoes was done by molecular diagnostic (RT-PCR or real-time RT-PCR).55% of 314 mosquito pools (11113 specimens) from 9 municipalities in Cx. which were confirmed as most prevalent WNV vectors in our region) and wild bird species.6%) wild boars. Methodology of WNV surveillance program in Serbia Veterinary Directorate of the Ministry of Agriculture and Environmental Protection infront the Veterinary Service launched and funded the national WNV surveillance program starting from April 2014. mosquitoes were collected at 62 sites in 31 municipalities in Serbia. Aedimorphus vexans and Culiseta annulata (Petrić et al.7%) roe deer. presence of WNV genome was confirmed in 28 (9. These data point on slightly less intensive WNV circulation during 2014 in Serbia. 30 cattle. pipiens pipiens. 56 (17. neutralized WNV (Escribano-Romero et al. pipiens pipiens mosquitoes were collected from the whole territory of Serbia and out of 995 tested mousquito pools WNV were found present in 22 (2. as well as in the samples of all collected dead wild birds belonging to the species susceptible to WNV (tested throughout the year). 33 (59%).93% dogs and 0. and 91 roe deer were investigated for the presence of antibodies to WNV by ELISA and viral neutralization test.21%) samples (unpublished data). 6 goats. a total of 56757 mosquitoes (841 pools of 50 individual insects) originating from 66 localities in 29 settlements in Vojvodina were examined.2%) out of 306 mosquito pools collected and tested from 20 localities in Vojvodina Province of Serbia during 2013 (unpublished data). which are natural virus reservoirs and populate the natural habitats in Serbia.. from a roe deer. and 5 deer. 2012). collected between 2008 and 2012. and 4 (23.

October Collecting mosquitoes at 2-week intervals in the period May-September at 10 localities within the County and testing the virus presence by RT-PCR or real time RT-PCR methodology (7 samplings in the period from end May to the first half of September) RT-PCR or real time RT-PCR methodology for samples of up to 50 dead birds (WNV-susceptible species) per County during the period May October Collecting mosquitoes at monthly intervals in the period May-September at 5 localities per County and testing the virus presence by RT-PCR or real time RT-PCR methodology (5 samplings once a month in the period from second half May to the first half of September) Future steps and expectations The aforementioned serological and virological examinations confirmed active circulation and endemic presence of WNV in the territory of the Republic of Serbia. The whole Program was described in details by Petrović et al. 1 in July. or up to 100 samples of purposely hunted birds or live captured susceptible bird species per County during the period May . Based on the obtained results and anticipated intense circulation of WNV that poses substantial risks for both public and animal 209 . 5 samples / settlement from et least one household according to described schedule.First International Symposium of Veterinary Medicine – ISVM2015 The active and passive surveillance encompassed all municipalities in the Republic of Serbia. 1 in September (until 15 Sept) Serological testing of 30 sentinel horses in the authorized institute. 4 samplings (1 in June. Sampling and blood testing of same horses to be performed three times (in three occasions) (June-July-August) Serological testing at the authorized institute in the period June-September from 6 settlements / County. 2014a) High-risk regions/Counties Lower-risk regions/Counties 1. and previous studies performed in horses). 2 in July. sampling from min 3 localities per County. (2014a). WNV surveillance program (sampling /testing) in Serbia in 2014 (Petrović et al. Sampling and blood testing of same horses to be performed three times (in three occasions) (June-July-August) 2. Testing of sentinel animals (domestic poultry and horses) aimed at early detection of WNV circulation Surveillance of sentinel poultry on rural households – poultry hatched in current year (backyard poultry) Surveillance of sentinel horses Serological testing at the authorized institute in the period May-September from 10 settlements / County. 6 samplings (1 in May. 1 in September (until 15 Sept) Serological testing of 50 sentinel horses in the authorized institute. sampling from minimum 3 localities per County. Table 1. 1 in June. 5 samples / settlement from et least one household according to described schedule. The basic methodology of WNV surveillance program in Serbia in 2014 is described in the Table 1. Testing aimed at early detection of WNV in natural reservoirs and vectors Virus surveillance in wild birds Virus surveillance in vectors mosquitoes (Culex pipiens) Application of RT-PCR or real time RTPCR methodology for testing samples of dead susceptible bird species throughout the year. 1 in August – by middle. The selection and distribution of sampling localities in each county-region is defined by epizootiological services of Scientific and Specialized Veterinary Institutes according to the assessment of the risk of exposure to WNV (according to the human cases in the last 2 years.. 1 in August – by middle.

Ursu. Vasić A. Reported cases of West Nile fever for the EU and neighbouring countries. gоdini ..: Arbovirusne infekcije u SR Srbiji.. Starešina. A. Lj. 9. S. Lazić S.org/sites/default/files/bulletin_file/eweb_232_30_08_12.N°240. E..europa. Savini: Spreading of West Nile virus infection in Croatia.. Veterinary Microbiology 159. West Nile: worldwide current situation in animals and humans. 5.php?content=940 ) 210 . Rev. Manić M. Boskovic R. F. Anim. Ratz. and N. November 2014. 10. E. Katić. Institut za javno zdravlje Srbije.. E. http://www. Montgomery.aspx ... 3. 7. 12. Lelli R. Hubalek. No. Listeš. 5-6. Z. 2006. 2. (www.rs/index. 4.. Madić. Savini. 1972. Merino T. Vojinović D. K. Reported cases of West Nile fever for the EU and neighbouring countries. D. 35. Ivanics. Ferenczi. H. and J. Vet..N°232. Bakonyi. 17 October – 23 October 2012 (e-WEB) available at: http://www. J. Ursu. 71-86. Di Gennaro.batut. Available from: http://ecdc. Blitvich.. J. Weissenbock H. Giovannini. Elezović Radovanović M. Acta Veterinaria (Beograd). Novotny N. 14.. Infоrmаciја о акtuеlnој еpidеmiоlоšкој situаciјi grоznicе Zаpаdnоg Nilа nа tеritоriјi Rеpubliке Srbiје u 2014. Rogožarski D. Vol.. Lupulović D. K. Situations update 30. Veterinary Microbiology 176. 27 No5. No 3-4. V. Vector Borne Zoonotic Dis.. N. Health Res. Vojnosanit Pregl. Bakonyi T. A. Monaco. 343-355. Prokić N.. EpiSouth Weekly Epi Bulletin . Erdelyi.07. Labrović. 618-623... B.. P.org. [Accessed 16 Dec 2012].. Comp Immunol Microbiol Infect Dis. ECDC (European Centre for Disease Prevention and Control).pdf EpiSouth Weekly Epi Bulletin .aspx ECDC (European Centre for Disease Prevention and Control). Science and Technological development References 1. L. Stevanović. 569-579. 8.. Komar. 29-37.. 2005. 15. S.. E. Gligić A.. Ferenczi. West Nile virus serosurveillance in wild and domestic mammals from Serbia. 2007 Escribano-Romero E. Campbell G. Murgue (2004).eu/en/healthtopics/west_nile_fever/West-Nile-fever-maps/pages/index. No 8. Wood: West Nile infection in horses. The Open Virol. 12(4). Acknowledgments This work is conducted within the project TR31084 funded by the Serbian Ministry of Education. Castillo-Olivares. G. Dauphin.. G. 22nd August – 28th August 2012 (e-WEB) available at: http://www. 2004.. 11. J. 504–508.eu/en/healthtopics/west_nile_fever/West-Nile-fevermaps/Pages/index. Nowotny: Lineage 1 and 2 strains of encephalitic West Nile virus.J. T. A.: Epidemiology of West Nile in Europe and the Mediterranean basin. Res. and B..org. Ilić Ž. 1167-1173. V. O’Leary. Barbić. Available from: http://ecdc. K.: Seroepizootiological-epidemiological investigation and mapping of West Nile infection in the Republic of Serbia. 16.: Epidemiology and transmission dynamics of West Nile virus disease. 181-188. 2010. K. 2012. 365–369. Zeller.2014..First International Symposium of Veterinary Medicine – ISVM2015 health in Serbia. 2015. DOI: 10. No 2. Zientara.episouthnetwork. Marić J.2298/AVB 1306569D Calistri. A.25.org/content/episouth-weekly-epi-bulletin-e-web Erdélyi. [Accessed 10 March 2015].. R. Gligic A. Emerg Infect Dis. Szeeredi. 13. Emerg Infect Dis. J.. 63. there is a need for further studies and continuous monitoring and surveillance of WNV infection and virus epidemiology in Serbia in the coming years. Ionescu.batut. Đuričić B. Blázquez A-B. Hayes. Petrović T. 11. Situations update 20. November 2012. 7. E. and G. central Europe. F.episouthnetwork. Nasci.: Transmission dynamics and changing epidemiology of West Nile virus.. Saiz JC. 9(1).rs. 29(4):173175. Bordjoski M. Lazić G.. S. 4. 2013. Skare.europa. 6.. 2008. 467-483.: Clinical and pathological features of linage 2 West Nile virus: Infections in birds of prey in Hungary.

Konjević A. Lupulović D. Parasitol Res. Capua I. Jerant Patić V....eurosurveillance. Edwards. Teodori. Nauwynck H. 1940. Vol. Fabijan D. Russo. Hrnjaković-Cvetković I. Petrović T. M. Simić Danijela.E. G. Euro Surveill. Vidanović D. V. Marini. Lavadinović L. Lupulović D. and V. 29. Dulović O. Lazić S. in relation to climate change and mosquito (Diptera: Culicidae) bionomics... p29-45. Vazquez.. B. H.. 637–657. Infect. Langevin.H. Platonova. Marinković.C. Lazić S. Petrić D. 18. M. Saiz JC. 16(18):pii=19862. Hrnjaković Cvjetković I. Milošević V. V. Arhiv veterinarske medicine. Radovanov J. 2013. 17. 462-468. Touloudi. Paul J. T. Muller... 2011. Ilić-Vlatković Verica.. Stefan-Mikić S. 2003. Xanthopoulou. Medić S. F. Platonov. Dis. 66 (2). Virol.org/ViewArticle.. Hinten. J. 232. Nowotny N. Outbreak of West Nile virus infection among humans in Serbia. 2010.. C.. Petrović T. HealthMED. In press Petrović T. Izveštaj o zaraznim bolestima u 2012. van den Hoven R. O. Kaiser. R. Greece. A. Smithburn. D. Eidson: Zoonosis update: West Nile virus. http://www. Bunning M. Birtsas. S. E.B. Fedorova.. Am. M. Alonso-Padilla J.: Serological study on WNV presence in horses in Vojvodina after the human outbreak in Serbia in 2012. Milošević B. Nowotny N. F. Kovačević G. Institut za javno zdravlje Srbije „dr Jovan Jovanović Batut“. Lazić G. J Infect Dev Ctries.. Spyrou. F. Shopenskaya. Lazić G. T. 30... N. A.org. Zgomba M. 311-322.: Experimental infection of North American birds with the New York 1999 Strain of West Nile virus.. Suppl 1. Emerg. C. 158 No 3-4. C. Berthold.. Iacovakis. Pinoni. Petrić D.: Serological evidence of West Nile virus infection in the horse population of northern Serbia. Martín-Acebes M.. Muhle. Available online: http://www. 267-273.T.. Bugarski D. No9. Capelli.. 21.aspx?ArticleId=19862 van der Meulen. S.. Zhuravlev (2008). F. Bugarski D. Hughes. Trop. 27. Jerant Patić V. Assoc. Kanazit Milena. Debeljak Z. 2. Kapetanov M. 33. 22.: West Nile virus in the vertebrate world. Hettler.. Niedrig. 24. G. Hyg. Davis. Koppen.A. Milošević V. Vector-Borne and Zoonotic Diseases. Athanasiou. A.: Molecular detection and phylogenetic analysis of West Nile virus lineage 2 in sedentary wild birds (Eurasian magpie). Montarsi. Milošević V. Vet Microbiol. Conraths.: Monitoring West Nile virus (WNV) infection in wild birds in Serbia during 2012: first isolation and characterisation of WNV strains from Serbia. Burke. Bakonyi. [Accessed 30 May 2013]. 150. 1-8. Pensaert. August to October 2012 .. Escribano-Romero E. Lelli R.M.. Ignjatović Ćupina A. P.. A.18(43):pii=20613 Petrić D... Schmidt... Karan. 471-492. Lupulović D. 31. Trevejo. Lazić S. Di Gennaro. Šekler M.: Evidence of West Nile virus lineage 2 circulation in Northern Italy. L. K. ISSN2217-9607. 19. Lupulović D.... Eurosurveillance.S. Blazquez A. 8(7):914-918...P.U. Jevtović D. Epidemiology of West Nile infection in Volgograd.. Lazić S.. Poluga J. Med. M. 26. 2011. Pisciella.. First Serological Evidence of West Nile Virus Activity in Horses in Serbia. N. Ellerbrok.. Euro Surveill. Petrović T.pdf Papa. 358–364. 23. Vet.. Emerg Infect Dis. 9. A. 2011. Petrović T. 2014. Polci. West Nile virus presence in mosquitoes in Serbia during 2012. 2013. Grgić Bojana. Popović N. Pauli G. Lončarević Goranka. Nedelijković J. Bowen.. R... Petrović T. Arch.. 77. A. A...I.. Bláquez A-B. L.. 20. 45-53 Savini. Valiakos. S. 2008. Tenorio. Obrenović Jelena. Paz Sánchez-Seco M. Vol.J.. Linke..: West nile virus surveillance in humans and mosquitoes and detection of cell fusing agent virus in Vojvodina province (Serbia).First International Symposium of Veterinary Medicine – ISVM2015 17. Vol 18.. T... No 2.W. 2014. 32. 2013. Saiz JC. T. 11. L.rs/download/izvestaji/Godisnji%20izvestaj%20o%20zaraznim%20bolеstima%202 012. K. Hrnjaković Cvjetković I. 2010. 2014a.. Seke Kristina.. Mutavdžić Tanja. 473-481.batut. U. K.. Lupulović D. Marangon. Med.. P. No 3. Nemeth. 25. 2012.. D. 1302– 1309.: Genetic characterization of West Nile virus lineage 2. Am J Trop Med Hyg 20. J. Komar. Petrić D. Ignjatović Ćupina A. 2012. 28.: Serologic evidence of West Nile virus infections in wild birds captured in Germany. Billinis C.V.. and M. Dimitrijević Dragana. A.. 920–922.godini na teritoriji Republike Srbije. Bellini R. Cvjetković D.. K.. D. Lazić S.V. R.. 6... Escribano-Romero E. Monaco. F. 2007. 103.. 34. 7. Terregino. Zgomba M. Urošević A.J.. Arch Biol Sci Belgrade.: West Nile virus surveillance program in Serbia. Russia. S.: A neurotropic virus isolated from the blood of a native of Uganda. G. Plavšić B. 44. 1303-05. Greece. Bairlein.. 2005. Lazić G.. Muller.. Am. 211 . Milinković Milunka. A.

Groschup M. Hubálek. U. Bagó. 2012 212 . 140. Punda-Poli V. Vesenjak-Hirjan J. Wodak. Richter. Angenvoort.. S.: Detection and molecular analysis of West Nile virus infections in birds of prey in the eastern part of Austria in 2008 and 2009. Epidemiology. Vet.: Geographical distribution of arboviruses in Yugoslavia. 95-101. Weissenböck. Journal of Hygiene.. Zoonoses and Public Health. H. K.. Nowotny. Microbiology and Immunology (Prague) 35.: Zoonotic mosquito-borne flaviviruses: worldwide presence of agents with proven pathogenicity and potential candidates of future emerging diseases.. M. Bakonyi.. 129-40. 37.. J. 36. Dobec M..H. 59. S. Winter P. 2010.. Vet Microbiol... Seidowski. Microbiol.First International Symposium of Veterinary Medicine – ISVM2015 35. Revilla-Fernández. 149. Nowotny N. Z. Müller. N. T.. D. N. Weissenböck.. E.. H. No 3-4. 358-366. 271–280. Ziegler.. Nowotny. Vol..: Monitoring of West Nile Virus Infections in Germany.. 2011 38. Z. Eiden. 1991.

coronitis. 4 °C and -70 °C. Milica Lazic1. Europe). massive subpleural hemorrhages.First International Symposium of Veterinary Medicine – ISVM2015 PATHOMORPHOLOGICAL FINDINGS IN ORGANS OF SHEEPS DIED OF BLUETONGUE DISEASE Ivan Dobrosavljevic1*. Laboratory confirmation is essential for final diagnose. The severity of lesions depends on the virulence of the virus. erosion and cyanosis of the mucous membranes of the oronasal cavity. Milena Zivojinovic1. face. virus has high capacity to quickly spread across the area. It was first described in South Africa (in the late eighteenth century) in Merino sheep (Verwoerd and Erasmus. 2004). The etiological agent of the disease is a virus which is composed of a segmented. Edema of lips. The first autopsy findings of dead sheeps did not clearly indicate blue thongue disease: several erosions on the tongue and gums with plenty of saliva. Portugal. India. the disease have been reported in Cyprus.dobrosavljevic@vsipozarevac. excoriations. The first cases in sheep in Branicevo district were recorded in September. but not at -20 °C. the period of time of it presents on some area and the immune status of the host.5 (Owen. Pozarevac. Middle East. 213 . During the late summer and early fall 2014. China. The virus is unstable below pH 6. During the twentieth century. Bluetongue is most prevalent in tropical and subtropical climate area. Introduction Bluetongue (BT) or ovine catarrhal fever is an arthropod-borne viral disease of domestic and wild ruminants. These gross lesions are nearly certain sign of the disease. Key words: Orbivirus. gross lesions. and torticollis. edema and hemorrhages of the papillary muscle of the left heart ventricle. laminitis. particularly sheep. emerging of the disease was observed in the eastern and southeastern part of Serbia. It was classified in genus Orbivirus. The lesions of the proximal part of the pulmonary artery were slightly pronounced (hardly visible changes). Since the 1990s. USA. The name of the disease derives from cyanosis of the tongue. Australia and in now days in Southeast Europe. sheep. In blood and tissue specimens it is very stable at 20 °C. 1964). There are at least 24 serotypes worldwide. nose. On the tongue and gums there could be seen erosions and in one sheep it was found edematous tongue with mild cyanosis (blue tongue). Israel. Spain. Pakistan. It is characterised by inflammation. Indonesia. Dragan Rogozarski1 1 Vetrinary specialistic institute “Pozarevac”.com Abstract Bluetongue is an infectious arthropod-borne viral disease primarily of domestic and wild ruminants. oedema of the head and neck. double-stranded RNA enclosed in a double-layered capsid. family Reoviridae. Edema of the head was followed by plentiful salivation. family Reoviridae. Infection with bluetongue virus (BTV) is common in a broad band across the world. The sheeps have had fever. Subsequent autopsy cases were revealed pathognomonic lesions on the proximal part of the pulmonary artery (ring bleeding under the adventitia of the pulmonary artery). submandibular area and eyelids were seen in most of the cases. The etiological agent of the disease is Orbivirus. haemorrhage. slightly swollen subcutaneous tissue in the chest region. lameness and depression. Slavonka Stokic-Nikolic1. Although not all serotypes exist in any one geographic area. BTV has extended considerably north of the 40th and even the 50th parallel in some parts of the world (eg. The most pronounced lesions were in the thoracic cavity: hyperemia and pulmonary edema. Serbia * Corresponding author: i. There are at least 24 serotypes worldwide. It was confirmed as BTV Serotype 4. Malaysia.

such as the pulmonary artery and those where the most severe lesions are found. slightly swollen subcutaneous tissue and few ecchymoses of the intermuscular connective tissues in the chest region (Fig. 1. The lesions of the proximal part of the pulmonary artery were slightly pronounced (hardly visible haemorrhages) (Fig. 2004). Figure 1. 7. oedema and haemorrhage as well as to secondary lesions in the overlying epithelium (Verwoerd and Erasmus. Erosive glositis and hyperemia of corner of the lips. Results During the late summer and early fall 2014. stasis and exudation. Oedema of the head was followed by plentiful salivation. The sheep have had fever. The most pronounced lesions were in the thoracic cavity: hyperaemia and pulmonary oedema. nose. The mechanism of these lesions is not understood. Oedema of lips. which eventually gives rise to hypoxia. submandibular area and eyelids were seen in most of the cases. face. emerging of BT was observed in the eastern and southeastern part of Serbia. 2004). The most sever lesions occur in areas where the temperature is lower than that of circulating blood (Verwoerd and Erasmus. in Veterinary institute “Požarevac”. in September 2014. Pathological changes in these cells leads to hyperplasia of the endothelium and consequently vascular occlusion. 214 . It was confirmed BTV. There is also evidence for a highly selective involvement of endothelial cells in certain blood vessels. massive subpleural haemorrhages.First International Symposium of Veterinary Medicine – ISVM2015 Bluetongue virus (BTV) first multiplies in the regional lymph nodes after virus inoculation by the bite of a midge before spreading to the rest of the body. The first cases in sheep in Branicevo district were recorded in September. Figure 2. Erosion and haemorrhage on the mucosa of lower lip. On the tongue and gums there could be seen erosions and in one sheep it was found oedematous tongue with mild cyanosis (blue tongue). lameness and depression. The aim of this paper was not to elucidate the new facts about BT. 6. In all cases BTV was confirmed in full blood samples by ReverseTranscription Polymerase Chain Reaction (RT-PCR). 8 and 9). Material and Methods Photos used in this paper were taken during necropsies of sheep. serotype 4. but to remind and emphasizes the importance of gross lesions in the diagnosis of this disease. 4 and 5). Viral replication occurs primarily in endothelial cells and pericytes of capillaries and small blood vessels. 2 and 3). The first autopsy findings of dead sheep did not clearly indicate Blue tongue disease: several erosions on the tongue and gums with plenty of saliva (Fig.

Massive subpleural hemorrhages 215 . Ecchymoses of the intermuscular connective tissues in the chest region. Hyperemia and pulmonary edema with lot of foamy exudate in bronchus Figure 5.First International Symposium of Veterinary Medicine – ISVM2015 Figure 3. Figure 6. Figure 4. Figure 8. Slightly swollen subcutaneous tissue in the chest region. Hardly visible subepicardial petechiae and petechiae at the proximal part of pulmonary artery Figure 7. Erosions and haemorrhages on dental pad.

Erosions on dental pad covered with diphtheritic deposits. Gelatinous oedema of connective tissue in the surroundings of the esophagus Figure 11. Oedema of subcutaneous tissue in the submandibular area. Figure 14. Disseminated subepicardial ecchymoses 216 Figure 12.First International Symposium of Veterinary Medicine – ISVM2015 Figure 9. Hardly visible petechiae in tunica media of proximal part of pulmonary artery (inner side). Hydrothorax . Figure 13. Figure 10.

Discussion Previously described gross lesions correspond largely with the clinical signs (Moulton.Fig. but they have also been seen on rare occasions in other infections such as 217 . subcapsular petechial hemorrhages of the spleen – Fig. Edema and hemorrhages of the papillary muscle of the left heart ventricle.Fig. Figure 17.10. Disseminated subendocardial ecchymoses.Fig. Subcapsular haemorrhages of the spleen Subsequent autopsy cases were revealed more pronounced and characteristic lesions: erosions on dental pad covered with diphtheritic deposits – Fig. Ecchymoses and larger haemorrhages in the tunica media of the pulmonary artery near its base are characteristic of BT (Fig. 16. 13. hydrothorax . 8. 14. 11. 17. pronounced ring bleeding in the tunica media of proximal part of pulmonary artery . edema and hemorrhages of the papillary muscle of the left heart ventricle . 12. sprayed subepicardial bleeding which cover a large area of the heart . Ring bleeding in the tunica media of proximal part of pulmonary artery. Figure 16. gelatinous oedema of connective tissue in the surroundings of of the esophagus – Fig.First International Symposium of Veterinary Medicine – ISVM2015 Figure 15. 1961). oedema of subcutaneous tissue in the submandibular area – Fig. These lesions are sometimes described as being pathognomonic for BT. 9 and 15). 15.Fig.

but all together in correlation with clinical signs and epizootic anamnesis are certain milestone in the right direction. 17). In: Virus infections of Ruminants. Sometimes epicardial and endocardial haemorrhages as well as focal necrosis of the papillary muscle can be seen in the left ventricle (Fig.J.W. 3. Lear A. 1989).. In: The Merck Veterinary Manual... A presumptive diagnosis of BT can be made from previously described lesions in affected sheep. rumenal pillars. Amsterdam: Elsevier Science Publishers. 9). 10). occur especially in acute fatal cases (Fig. conformation of the virus genome or serology is necessary. The mucous membrane was covered with a large amount of saliva..merckmanuals.: Bluetongue. 1964). which have been observed in latter clinical cases and necropsies (Fig. and Moses M. erosions and haemorrhages of the mucous membrane (Fig. 2 and 3). Severe hyperaemia and oedema of the lungs accompanied by copious amounts of froth in bronchi and trachea. reticular folds and oesophageal groove also can be seen in gastrointestinal tract (Erasmus. 16). Destruction of epithelial cells lead to excoriation and erosions (especially in areas of most friction: inside of the lips. dental pad. In sheep that die after typical oral lesions of BT have regressed. particularly adjacent to molars). and Callan R. Whitehouse Station. Merck Sharp & Dohme Corp.First International Symposium of Veterinary Medicine – ISVM2015 Rift Valley fever. petechiation and erosions of the mucosa of the forestomachs..E.: Plant Poisonings and Mycotoxicoses of Livestocks in Soutern Africa. Kellerman T. 1988). 2. Vol..A. Secondary bacterial infecton is often responsible for the diphteric necrosis of the erosions (Martens et al.html 218 . 1990). Cape Town. ed. Laboratory conformation is also necessary to identify the serotype involved in order to establish specific control measures.W.S. Each of described lesions for himself are not sufficient for diagnosis of BT. a subsidiary of Merck & Co. heart-water and pulpy kidney disease in sheep.. In nonendemic areas and in other ruminant species laboratory conformation by either virus isolation. Inc. Hyperaemia.A.. Dinter Z and Morein B. 1990. References: 1.: Overview of Bluetongue. especially in those areas where the disease is endemic. 1. 2014. N. it may be difficult to differentiate BT from disease such as heartwater and pulpy kidney disease (Verwoerd and Erasmus. Coetzer J. These haemorrhages may be difficult do see and it may be necessary to stretch the pulmonary artery and to hold it against the light (Fig. 6). http://www. cheeks and tongue.com/vet/generalized_conditions/bluetongue/overview_of_bluetongue.. Aiello S. 1988. as well as hydrothorax. Erasmus B. 2014).S. The muscle lesions comprise ecchymoses (Fig.A.S. and Naudé T. 2004). Lymph nodes are commonly swollen and oedematous and at the spleen can be seen subcapsular haemorrhages (Fig.. ed. 5) and gelatinous oedema of the intermuscular connective tissue. U..J. vesicular diseases such as foot-and-mouth disease and contagious ecthyma. Aspiration pneumonia may occasionally be found (Luedke et al. Oxford University Press Soutern Africa. they may be barely visible in mild or convalescent cases (Lear and Callan. Oral lesions which have been seen in the initial stage of the disease consist of slightly expressed hyperemia. Bleedings in the wall of the base of the pulmonary artery and lesions of the papillary muscle of the left ventricle are highly characteristic for BT and they are usually obvious in severe clinical infections but as shown in Figures 8 and 9.J. particularly of the papillae. 3. particularly in the neck and the dorsal thoracic region. The most severe pathology changes occur in the lungs. First cases of the disease should be differentiated from early signs of hepatogenous photosensitivity caused by a variety of plant and mycotoxin poisonings (Kellerman et al.

M.: Analysis of the roles of bluetongue virus outer capsid protein VP2 and VP5 in determination of virus serotype.: Clinical and pathologic features of bluetongue in sheep.M.: Investrigation into the pH stability of bluetongue virus and its survival in mutton and beef. 25.G. 2004.: Bluetongue. American Journal of Veterinary Research. 1989. 219 .E. Cowley J. Coetzer J. Cape Town. 7. and Erasmus B.N. Owen N. Corteyn A. 109-118. Virology.P. and Tustin R. and Doyle C. 561-565. 963-970.C.H.C. Onderstepoort Journal of Veterinary Research. 1964.: Pathology of bluetongue of sheepin California. 6. Jennings D.. 8.J. Verwoerd D. 2 nd edition.M... 1201-1220.. 1964. Burroughs J.J. 1961.. 493-498. 170. Moulton J. Bowne J.C.H.. Jochim M. 31..A. Oxford University Press Soutern Africa. Journal of the american Veterinary Medical Association.First International Symposium of Veterinary Medicine – ISVM2015 4. 138. In: Infectious diseases of livestock. and Gorman B. Martens P. Pedley S. Jeggo M. Luedke A. 5. ed.W..W.

Eight tick species from four genera were identified on the hosts: Ixodes ricinus Linnaeus 1758. The adult stages of all tick species were found on the hosts. transstadial and transovarial transmission of important pathogens for human and animal health. reticulatus. anaplasmosis. adults were found for five tick species. punctata. H. sanguineus Latreille 1806. responsible for the maintenance of the high tick density populations in certain habitats and therefore seasonal. H. concinna. 1758) and wild boars (Sus scrofa Linnaeus. University of Novi Sad. bacteria and protozoa. concinna. During the last two decades. the dominance of the certain life stages was significantly different. the absence of digestive enzymes and relatively adaptable life cycles enable acquisition. Faculty of Agriculture. often host nonspecific. reticulatus Fabricius 1794. locality and the sampling methods.uns. but only five species from three genera on the vegetation: I. Their relatively slow feeding process on the hosts. ricinus. maintenance and transmission of a variety of the pathogens and thus cause severe diseases in humans and animals. seasonal migrations and population fluctuations most of the vertebrate species found at hunting resorts represent an "epidemiological bridge" among hosts. Serbia 2 Department of Veterinary Medicine. often host nonspecific. Tick-borne encephalitis. parasites and pathogens. all agroecosystems with wide belts of deciduous forests and sporadic shrub vegetation. and therefore capable of parasitizing a numerous species of vertebrates. life stages. Dragana Rajković1 1 Department of Environmental and Plant Protection. ricinus and H. transmitted to the host during the feeding phase. However. D. viruses. High tick infestation could cause the death of the host due to blood loss (Balashov. Serbia * Corresponding author: petra@polj. Rhipicephalus bursa Canestrini & Fanzago 1878 and R. H. Vojvodina Introduction All hard ticks species are obligatory parasites. nymphae of I.rs Abstract All hard ticks species are obligatory parasites. Faculty of Agriculture. Due to its wide home ranges. marginatus and D. 1758).First International Symposium of Veterinary Medicine – ISVM2015 SPECIES DIVERSITY AND LIFE STAGES DOMINANCE OF HARD TICKS (Acari: Ixodidae) AT VOJVODINA HUNTING RESORTS Aleksandra Petrović1*. babesiosis and others. Ixodidae. sulcata Canestrini & Fanzago 1878. punctata. cases of zoonoses transmitted by ticks. The aim of the study is to determine the hard tick species diversity and the dominance of the certain life stages on the hosts and on the vegetation cover at the hunting resorts of Vojvodina. Depending on the season. Key words: ticks. Vuk Vračar2. University of Novi Sad. punctata and larvae only of I. Ivana Ivanović1. ricinus. and therefore capable of parasitizing a numerous species of vertebrates. but nymphal and larval stages only of I. Two methods were used for tick sampling: from the vegetation and from the body of the hunted roe deer (Capreolus capreolus Linnaeus. concinna and H. Haemaphysalis concinna Koch 1844. on the vegetation cover. The study was conducted from 2011 to 2014 at 20 hunting resorts in Vojvodina. H. D. cit. hunting resorts. Evans. Novi Sad. diversity. maintenance and transmission of a variety of the pathogens and thus cause severe diseases in humans and animals (Sonenshine. Their relatively slow feeding process on the hosts. Aleksandar Potkonjak2. 1991). spatial. 1992). loc. H. 1968. punctata Canestrini & Fanzago 1878. the absence of digestive enzymes and relatively adaptable life cycles enable acquisition. are on the rise. such as Lyme borreliosis.ac. but more important is the role of ticks as vectors of numerous pathogens. Novi Sad. Aleksandar Jurišić1. ricinus and H. and 220 . Dermacentor marginatus Sulzer 1776.

The role of wild boar as a reservoir of Anaplasma phagocytophilum is confirmed by Michalik et al. Due to their vector role... Kiffner et al. seasonal and spatial dynamics of ticks and their hosts is crucial.. 1993). as well as the expansion of vectors and pathogens in the new areas.. In order to obtain the most accurate data on tick species diversity and density in practice. parasites and pathogens. 1991). such as hunting and natural resorts (Jurišić et al.. To understand the complex interactions among ticks. To avoid the bias and to obtain the actual state of tick species diversity and their spatial dispersion.. 2004. Ruiz-Fons et al.First International Symposium of Veterinary Medicine – ISVM2015 represent the leading health problem in many parts of Europe and North America (Paulauskas.6 m) through the vegetation and the soil surface in total length of 100 m for an hour (Sonenshine. 2010. The rural habitats have low anthropogenic influence. Due to different host seeking strategies. so floristic and faunistic communities are rich and diverse and provide favourable conditions for maintaining the tick populations.. (2009). 2008). Jurišić et al. The sampling was conducted at five chosen transects of each hunting resort. Additionally... Due to its wide home ranges. Several studies have confirmed the high infestation of roe deer and wild boars in Europe (Fuente et al. seasonal migrations and population fluctuations most of the vertebrate species found at hunting resorts represent an "epidemiological bridge" among hosts. spatial. stating that its abundance can affect the population dynamics of I. Acarological studies in our country are mainly focused on urban and suburban habitats. 2012. Pintur et al. 2008). Vor et al. ticks are the subjects of many studies. there are numerous evidences of a positive correlation between the number of roe deer and ticks (Carpi et al. ricinus ticks. This method was not used if the average daily temperature values were under 5°C. and to determine the potential risk of the contact between humans and animals with infected ticks. a good knowledge of all biotic and abiotic factors that affect the population of these arthropods is needed. their hosts and pathogens. Both sides of the cloth were carefully examined every 20 m. transstadial and transovarial transmission of important pathogens for human and animal health. 1758) (Pintur et al. Material and Methods Tick sampling and identification Ticks were collected during the four year study (2011-2014) using two methods: from the nature and from the hunted carcasses of roe deer (Capreolus capreolus Linnaeus.e.. 2011. 2010. ticks were sampled according to „Flag-hour“ method (Maupin et al. Furthermore. 1758). followed by the wild boar (Sus scrofa Linnaeus. continuous and systematic monitoring of species abundance. if weather conditions were suitable. from 10 am till 6 pm. the estimated relative abundance of tick populations is in most cases the direct result of the applied sampling methods and as such do not represent a real tick species diversity at a certain locality. i. 2009). Ticks were sampled monthly. two different methods of tick sampling were applied in this study. although a few numbers of studies were conducted at the natural habitats of ticks. The main host for the adult stages of Ixodes ricinus in Central Europe is roe deer (Capreolus capreolus Linnaeus. 2006. 1758) and wild boars (Sus scrofa Linnaeus 1758). 2012). 2012). responsible for the maintenance of the high tick density populations in certain habitats and therefore seasonal. it is necessary to use different methods of tick sampling. by dragging the white flannel cloths (1 x 1. Although the role of roe deer and wild boars in maintaining the agents of some diseases in natural habitats (such as Lyme borreliosis and Tick-borne encephalitis) is still unclear. Frome nature. The 221 .. which confirms the importance of understanding the complex mechanisms of transmission of these potentially serious diseases. The aim of the study is to determine the hard tick species diversity and the dominance of the certain life stages found on the hosts and on the vegetation cover at the hunting resorts of Vojvodina. the further increase of tick-borne disease incidences could be expected as a result of global climate change. Carpi et al.

Srbobran (19. Faculty of Agriculture). Senta (25. Titel (26. (2004) and Walker et al.429 ha. N45°35`509`` E20°07`219``). Localities The study was performed at 20 localities on the territory of Autonomous Province of Vojvodina. N45°57`301`` E20°05`469``). Futog (14. Each carcass was systematically and thoroughly inspected using palpatory technique by three observers using latex gloves.147 ha.277 ha. N45°12`338`` E20°19`075``). N45°58`399`` E20°05`316``). Differences in abundance of identified tick species. 2007). N 45°44`103`` E20°09`462``). Bačka Palanka (52.204 ha. N45°33`336` E20°05`512``).812 ha.236 32.565 ha. four in Banat: Čoka (23. N45°32`005`` E19°54`542``). Tick species were identified up to species level according to identification keys: Nosek & Sixl (1972). All tick specimens were collected using acarological tweezers and placed into plastic tubes (5 ml) with a small cotton ball soaked in water to maintain the humidity and closed with perforated plastic stopper for sufficient ventilation. N45°36`536`` E20°04`419``). Nadalj (3.3547 0 256 1084. Novi Kneževac (30.First International Symposium of Veterinary Medicine – ISVM2015 collection of ticks from the carcasses of roe deer and wild boars was performed immediately after the hunt. Novi Bečej (60.302 222 .928 1.413 ha.648 7267 8 11. Bačko Petrovo Selo (11. licensed to University of Novi Sad. N45°41`144`` E20°05`283``). distribution fitting tests (χ2 and Kolmogorov-Smirnov tests). 15 in Bačka: Ada (13.01 as highly statistically significant) were applied.070 ha. Estrada-Peña et al.05 as statistically significant and p<0.304 ha. Bečej (30. Pančevo (69. Mol (9.957 4.646 ha.0875 0 569 8641. N46°03`271`` E20°04`422``). N44°51`530`` E20°37`453``). N46°01`456`` E20°04`598``). N45°33`331` E19°46`052``).441 ha. Kanjiža (39.856 ha. N45°14`005`` E19°41`093``). N45°41`593`` E18°55`340``).343 ha. Apatin (28.500 ha. N45°01`570`` E19°49`189`` (area according to Antonić & Beuković. Statistical analyses The obtained values were tested using software Statistica 12 (StatSoft. The collected specimens were properly labeled and transported to the laboratory and maintained in induced diapause at 5°C till examination and identification. Bačko Gradište (6. All studied localities were described as agroecosystems with wide belts of mixed deciduous forests and sporadic shrub and bush vegetation. Results The qualitative and quantitative studies of tick species and life stages collected from vegetation and from the carcasses of the hosts have shown the differences in relative abundance of identified tick genera and species (Tab 1. N45°46`522`` E20°09`230``). N45°20`447`` E19°13`108``). In order to statistically analyze the data.560 ha.149 ha.). and one in Srem: Ruma (50.057 92. N45°14`198`` E19°20`239``). (2007). Bač (30. Table 1.745 ha. N45°32`509`` E19°51`239``).548 ha.139 ha. Turija (5.539 ha. one-way ANOVA (tested by Fisher’s LSD test for significance level of p<0. life stages and localities depending on sampling method Ticks collected from the vegetation Ticks collected from the hosts Total number Number of tick species The mean of collected ticks Minimum collected ticks Maximum collected ticks Variance Standard deviation Standard error 20035 5 50.

64 Senta 371 258 242 96 967 0 0 69 28 97 0 0 0 0 0 0 19 24 21 64 0 0 0 0 0 1128 5. ricinus n ♀ ♂ 152 217 73 145 154 89 169 269 85 Σ 715 633 844 l D. H.86 Bačka 256 189 198 96 739 0 0 72 26 98 0 0 0 0 0 0 12 34 9 55 0 1 0 0 1 893 4.05).01) between the number of collected I.39%).33%). concinna.45 2. reticulatus n ♀ ♂ Σ 0 0 11 8 19 0 0 0 0 0 0 0 0 0 0 l H.12 2. Five tick species from three genera were identified: Ixodes ricinus Linnaeus 1758 (82. Furthermore.20 0. concinna (1.86 8.24 0.74 1.99999 for p˂0.40 21. ricinus (49.11%).32 Apatin 0 3. The most abundant were the larvae of I. The larval stages of other four species as well as the nymphal stages of D.40 Kanjiža 326 36 240 68 670 0 0 71 21 92 0 0 21 11 32 0 18 30 12 60 0 0 0 0 0 854 4. reticulatus have not been found using this method.99 0. concinna Koch 1844 (0. and 2.5%). Eight tick species from four genera were identified: I. reticulates (4.01) comparing to collected larvae and females. ANOVA proved high statistical significance between the total number of collected ticks and their species and life stages (psp=0. and ANOVA did not emphasize any statistical significances regarding the different localities as independent variables on the number of collected ticks as a dependent variable (pl=0. ricinus and all other species and D. The number of ticks collected from the vegetation Locality l 273 245 321 I.55 Turija 245 233 206 85 769 0 0 48 39 87 0 0 6 1 7 0 19 36 15 70 0 0 5 2 7 940 4. D.24 5.First International Symposium of Veterinary Medicine – ISVM2015 Ticks collected from the vegetation The totals of 20035 ticks were sampled from the vegetation (Tab 2.00000 and pst=0. D. The Fisher's LSD test demonstrated high statistical differences (for p<0.22%). reticulatus and H.39 100. Ticks collected from the hosts The total number 7267 specimens of ticks were sampled from the roe deer (64 carcasses) and wild boars (29 carcasses) (Table 3.46 Palanka Bačko 259 175 178 59 671 0 0 56 35 91 0 0 0 0 0 0 12 29 8 49 0 0 3 1 4 815 4.94 Čoka 398 257 214 82 951 0 0 84 26 110 0 0 8 1 9 0 21 24 28 73 0 2 5 2 9 1152 5.07 Pančevo 569 254 197 58 1078 0 0 88 26 114 0 0 19 7 26 0 11 30 21 62 0 0 5 2 7 1287 6. The larval stages of all identified species.98 0.52 20. Rhipicephalus sanguineus Latreille 1806 (6. However.21 82. reticulatus Fabricius 1794 (1. The most abundant were the females of I.47%) and R.99%) and D. as well 223 .53%).00 1. punctata (2.11 Kneževac Total 6516 4087 4379 1644 16626 0 0 1426 575 2001 0 0 165 76 241 0 291 549 248 1088 0 12 49 18 79 20035 100. marginatus n ♀ ♂ 0 0 48 27 0 0 55 23 0 0 59 25 Σ 75 78 84 l D. The highest number of collected tick specimens was obtained at locality Pančevo (6.38 1. marginatus (13.20%).42 Novi 387 224 226 99 936 0 0 59 25 84 0 0 0 0 0 0 0 0 0 0 0 2 1 0 3 1023 5. marginatus and D. ricinus (69. H. bursa Canestrini & Fanzago 1878 (0.09 0.).00 % 32. punctata n ♀ ♂ 11 32 10 13 35 11 15 21 8 Σ 53 59 44 l H.85%).00 0. marginatus comparing to D.00 7.76%). Dermacentor marginatus Sulzer 1776 (9.75 Novi Bečej 387 311 236 76 1010 0 0 76 34 110 0 0 14 8 22 0 20 21 22 63 0 1 7 4 12 1217 6.00 0.87 9.06 0.82 0.29 Nadalj 198 196 256 79 729 0 0 92 22 114 0 0 10 6 16 0 19 27 24 70 0 0 1 0 1 930 4. as well as Haemaphysalis sulcata Canestrini & Fanzago 1878 (2.85 Bač 0 4.54 Titel 345 265 198 93 901 0 0 99 34 133 0 0 5 3 8 0 21 34 9 64 0 0 4 2 6 1112 5.69 Ruma 425 245 254 86 1010 0 0 87 29 116 0 0 2 0 2 0 15 29 16 60 0 1 1 0 2 1190 5.72 selo Bečej 211 148 265 84 708 0 0 69 29 98 0 0 18 7 25 0 12 32 9 53 0 2 1 0 3 887 4.00%).43%) and H.).00 0. Haemaphysalis punctata Canestrini and Fanzago 1878 (5. Table 2.00 Obtained data had normal distribution. ricinus (32.07 Gradište Bačko Petrovo 358 211 159 63 791 0 0 65 24 89 0 0 12 9 21 0 11 26 7 44 0 0 1 0 1 946 4.).98%).00475 for p<0.06%).07%).00 0.26 Mol 211 184 211 75 681 0 0 84 33 117 0 0 13 5 18 0 13 25 2 40 0 1 2 1 4 860 4.63 Srbobran 386 234 214 96 930 0 0 67 31 98 0 0 14 5 19 0 18 29 8 55 0 2 3 2 7 1109 5.01) (Graph 1. concinna Total n ♀ ♂ Σ 0 0 2 1 3 865 0 0 1 0 1 771 0 0 2 0 2 974 % Ada 0 4.43 0.42%) and the lowest at hunting resort Bačko Gradište (4. the number of sampled males had high statistical differences (for p<0.43 Futog 345 201 245 102 893 0 0 78 38 116 0 0 12 5 17 0 11 31 8 50 0 0 5 1 6 1082 5.

00 0.05) were obtained for comparing the numbers of D.14 0.69 69.32 4. and females compared to nymphs and males. punctata and H.57 Mol 0 26 126 25 177 0 0 29 13 42 0 0 8 5 13 0 0 8 1 9 0 0 2 1 3 0 0 0 0 0 0 9 5 1 15 0 0 1 1 2 261 3.94 Novi Bečej 0 38 184 34 256 0 0 50 25 75 0 0 12 4 16 0 0 0 0 0 0 0 7 2 9 0 0 21 11 32 0 10 11 8 29 0 0 5 5 10 427 5. The highest number of sampled ticks was at hunting resort Novi Kneževac (6.53 0.01) (Graph 3.00 0.25 Turija 0 50 205 41 296 0 0 36 17 53 0 0 11 4 15 0 0 0 0 0 0 2 0 0 2 0 0 11 5 16 0 9 8 5 22 0 0 0 1 1 405 5.85 100.00 1. as well as D.00 1.01) were found in the number of sampled larvae comparing to females and males. bursa. ricinus ticks and all other species. Moreover. H.00 0.22 0.22 6. marginatus. The number of ticks collected from the hosts Locality I. The Fisher's LSD test proved high statistical differences (for p<0. marginatus with H.95 Bač Bačka Palanka Bačko Gradište Bačko Petrovo selo 0 19 256 62 337 0 0 35 24 59 0 0 9 6 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 11 3 23 0 0 0 0 0 434 5.78 Kanjiža 0 24 154 34 212 0 0 34 14 48 0 0 5 1 6 0 0 24 18 42 0 0 7 0 7 0 0 0 0 0 0 10 5 0 15 0 0 2 0 2 332 4. punctata ♂ Σ l ♀ n H.00000 and pst=0.22 Senta 0 45 174 24 243 0 0 40 18 58 0 0 15 5 20 0 0 9 4 13 0 2 0 0 2 0 0 0 0 0 0 8 8 1 17 0 0 0 0 0 353 4.81 Apatin 0 24 129 54 207 0 0 28 16 44 0 0 6 1 7 0 0 0 0 0 0 0 0 0 0 0 0 5 1 6 0 5 10 5 20 0 0 2 1 3 287 3.00 0.First International Symposium of Veterinary Medicine – ISVM2015 as the nymphs of D. sanguineus. the high statistical differences (for p<0.75 Futog 0 58 132 48 238 0 0 39 15 54 0 0 19 4 23 0 0 0 0 0 0 0 5 2 7 0 0 0 0 0 0 11 9 5 25 0 0 0 0 0 347 4.97 0 25 247 51 323 0 0 36 21 57 0 0 11 5 16 0 0 0 0 0 0 2 1 0 3 0 0 0 0 0 0 8 8 5 21 0 0 1 0 1 421 5. sulcata ♂ Σ l ♀ n R.33 10.46 1.00 0.12 777 5014 0 0 681 319 1000 0 0 199 96 295 0 0 100 53 153 0 10 57 22 89 0 0 124 89 470 0 0 39 23 62 Total % 0 652 3585 60 184 0 202 179 7267 100. concinna and R.).00000 for p<0.76 0. Table 3. sulcata and R.59%). ANOVA emphasized high statistical associations between the number of collected ticks and species and life stages (psp=0. H. No statistical significances were found in the number of D.97 49.00 8.06 0. H. and there were no significant differences among collected ticks concerning different localities (pl=1.47 0.00 Tested values had normal distribution.80 0 35 241 32 308 0 0 41 31 72 0 0 9 1 10 0 0 9 4 13 0 0 0 0 0 0 0 0 0 0 0 16 6 4 26 0 0 0 0 0 429 5. bursa ♂ Σ l ♀ n ♂ Total Σ % Ada 0 22 125 58 205 0 0 24 18 42 0 0 2 0 2 0 0 5 1 6 0 0 8 3 11 0 0 0 0 0 0 2 6 3 11 0 0 0 0 0 277 3.11 0.00 0.12%) and the lowest at locality Mol (3. The statistical significances (for p<0.88 Pančevo Novi Kneževac 0 34 182 45 261 0 0 23 11 34 0 0 5 8 13 0 0 17 9 26 0 4 9 2 15 0 0 19 18 37 0 9 18 8 35 0 0 6 4 10 431 5.59 Nadalj 0 35 191 11 237 0 0 31 5 36 0 0 14 8 22 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 3 6 2 11 0 0 0 0 0 307 4. sulcata. punctata. Nevertheless.93 0 31 222 56 309 0 0 36 18 54 0 0 0 0 0 0 0 14 8 22 0 0 6 3 9 0 0 11 6 17 0 9 8 4 21 0 0 7 6 13 445 6. marginatus ♂ Σ l ♀ n ♂ D.54 0.00 0.79 0 23 211 25 259 0 0 29 18 47 0 0 19 5 24 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 5 3 19 0 0 0 0 0 349 4. D. 224 .59 Čoka 0 26 164 26 216 0 0 48 6 54 0 0 17 9 26 0 0 0 0 0 0 0 0 0 0 0 0 24 9 33 0 15 8 6 29 0 0 1 0 1 359 4. marginatus with D.00 9. reticulatus. concinna ♂ Σ l ♀ n H.00 0.05).39 13. reticulatus Σ l ♀ n H. marginatus and R.57 Ruma 0 25 185 21 231 0 0 41 16 57 0 0 8 8 16 0 0 14 8 22 0 0 8 4 12 0 0 16 6 22 0 14 15 9 38 0 0 5 3 8 406 5.78 2.73 2.37 4.38 0. bursa have not been found on the hosts.72 Titel 0 39 147 36 222 0 0 29 5 34 0 0 10 8 18 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 15 10 7 32 0 0 2 0 2 309 4.32 0.78 0.00 0. reticulatus.30 1.74 1.00 2.90 Bečej 0 26 158 57 241 0 0 27 15 42 0 0 10 8 18 0 0 0 0 0 0 0 0 0 0 0 0 8 2 10 0 12 11 5 28 0 0 5 1 6 345 4. ricinus l n ♀ D.00 2. sanguineus ♂ Σ l ♀ n R.01) between the number of collected I.71 0.00000 for p<0.86 Srbobran 0 47 152 37 236 0 0 25 13 38 0 0 9 6 15 0 0 0 0 0 0 0 4 3 7 0 0 9 2 11 0 17 11 5 33 0 0 2 1 3 343 4.83 2. and 4.

R.90 45 80 40 70 35 60 30 50 Number of ticks Number of ticks First International Symposium of Veterinary Medicine – ISVM2015 40 30 20 25 20 15 10 10 5 0 0 -10 I. marginatus and D. as well as in deciduous forests.95 Conf. The results of this study demonstrate that the habitats of this species are restricted to river basins. punctata H. so these ticks have to return periodically to the moist litter layer in order to reabsorb needed water to maintain a certain level of humidity. especially from the animals that could provide it better. This species has been registered on the vegetation cover at 14 localities. hexagonus). ricinus D. Higher adult tick species diversity found on the studied hosts could be explained by the fact that the immature tick stages are capable of feeding on almost any vertebrate. D. sanguineus D. 2004). (2012). R. ricinus. reticulates were collected from the vegetation and from the hosts. or by ambushing a passing animal from a vantage point on the vegetation cover (I. 225 . even in the urban areas (Jurišić et al. by waiting in nests or lairs (I. The number of different ticks stages collected from the hosts Discussion & Conclusion The obtained differences in relative abundance of identified tick species collected from the vegetation and from the hosts were the direct results of applied sampling methods. flagging the vegetation or on the hosts. reticulatus H. all kinds of shrub vegetation along the river banks. Barandika et al. pastures. ricinus in Vojvodina as the second most abundant tick species. Interval -5 Larvae Species Mean Graph 3. but adults require the blood meals of more than 1 ml. rich in bush and shrub vegetation. concinna R. although it could also find an appropriate host by ambush strategy – questing behaviour (DantasTorres. Furthermore. ricinus). Three species were collected only from the hosts: H. is sporadically found on the vegetation. sulcata (females and males). According to Crooks & Randolph (2006) ixodid ticks could achieve contact with a host by active hunting (Hyalomma. D. The most abundant species collected by both methods at each prospected locality was I. such as ungulates (Donzé et al. (2008) and by Mihalca et al. Its presence is registered at all prospected localities. grassland and meadows. Interval Nymphs Females Males Stage Graph 4. 2010). ricinus is the predominant tick species in Europe found by both methods. ricinus and other exophilic ticks. meadows. The number of different ticks species collected from the hosts Mean±0. which is confirmed by similar conclusions of Mihalca et al. marginatus follows the distribution pattern of I. I. The adults of D. marginatus H. sulcata R. as the various tick species demonstrate a different host seeking strategies.. (2012). bursa (females and males). they emphasize that active host questing behaviour increase desiccation. Amblyomma).95 Conf. (2008) proved that although the flagging method is suitable for sampling several tick species like I. sanguineus demonstrates an active host seeking behavior. the efficiency of this technique varies substantially with different tick species and life stages. sanguineus (nymphs. females and males) and R. The determining factors for its abundance are microclimate characteristics and host densities. but more often on the hosts. According to these authors. The same results were published by Barandika et al. wet/flooded forests. 2010).. bursa Mean Mean±0. reticulatus. on the other hand.

it is also able to survive and maintain its population in the outdoor environments (DantasTorres. the absence of D. Due to consistent population densities. punctata were obtained from the vegetation.12% at Novi Kneževac. with overlapping niches with I. monotropic and three-host tick species.First International Symposium of Veterinary Medicine – ISVM2015 The nymphs and adults of H. birds. More frequent. 2004). (2010) have reported their presence on the heads of the roe deer in Germany. reptiles and birds. Furthermore. Mihalca et al. although Vor et al. this species prefers warm and humid areas in Vojvodina. (2012). 2010) and therefore parasite on cattle or wild ungulates (Estrada-Peña et al. forest margins and forest-steppes. H. Statistical significance calculated for the male could be explained by their low abundance and specific sex ratio characteristics typical for the ambush host-seeking behaviour confirmed by Hornok (2009). reptiles. Although R. cit. on the other hand is a typical representative of tick fauna commonly found on ungulates. as they are found in the vicinity or in the lairs of rodent and insectivore species. their adaptability and different host seeking strategies. transstadial and transovarial transmission of pathogens important for human and animal health. but less abundant was H. Acknowledgments The presented work is part of the research done in the project TR31084 granted by the Serbian Ministry of Education and Science and project No: 114-451-1293/2014-03 granted by the Provincial secretary for science and technological development of AP Vojvodina 226 . H. found as adults only on the hosts. and according to Nosek (1971. bursa. which nymphal stages and adults were found both on the vegetation and the hosts. bats. the larval stages of all collected tick species from the hosts are absent too. warm and mild humid areas. with preferences to areas well covered with bush and steppe vegetation (Fuente et al. 2004). carnivores.. In addition.07% at Bačko Gradište to 6. concinna was identified at all prospected localities when sampled the vegetation and at 14 localities when sampled from the hosts. loc. The nymphs and adults of R. as they parasite only on rodents and other small mammals. In order to obtain the most accurate data on tick species diversity and density in practice. sanguineus is an endophilic. reticulatus larval stages on the vegetation cover could be explained by their induced endophilic behaviour. However. concinna. marginatus and D. The species of genus Rhipicephalus were found only on the hosts. bursa were collected at 13 localities. rodents. but only adults were found on the host. only adults of R.. This species is confirmed at 19 localities as a host-seeking tick. these species prefer pastures. However. Statistical differences obtained from studying the appearance of species on the vegetation and on the hosts are mainly caused by ticks preferences to suitable habitats and hosts. sulcata was the most abundant species of Haemaphysalis genus. Similarly to findings of Mihalca et al. 2012). statistical differences obtained for females comparing to nymphs and males from the hosts proves the fact that females are obligated to take the blood meal in order to oviposit. wide home ranges and seasonal migrations. The number of ticks collected from the vegetation varied from 4. spatial.42% at Pančevo and from the hosts from 3. These two species have preferences to open. sanguineus were obtained from all studied localities. to avoid the bias and to obtain the actual tick population densities and their spatial dispersion it is necessary to use different methods of tick sampling and to include a wider range of tick hosts such as other ungulate species. most of the vertebrate species found at hunting resorts are responsible for the maintenance of the high tick density populations in certain habitats and therefore seasonal. and only at 7 as parasiting on the hosts. Its presence is confirmed at 9 localities. The total number of collected ticks was evenly distributed. The presence and abundance of certain tick species at studied localities have not emphasized any statistical significance in both types of sampling.59% at Mol to 6. The most abundant tick stages obtained from the vegetation were larvae and females. ricinus. R.

178 Mihalca A... Spain. Sikora B... Krapinec K. Zoltowsky J.M.: Attachment site and abundance estimation of ixodid ticks (Acari: Ixodidae) on male roe deer (Capreolus capreolus Linnaeus 1758). Cambridge..: Ticks of domestic animals in the Mediterranean Region. Rajković D..: The application of lambda-cyhalothrin in tick control. 52.. Domşa C. Randolph S. Antonić D.. Infect. Anda P. Book of Apstracts. Fish D.. 26.. 9.. J.. Lödige C. Dabert M.E.: Monitoring of tick species (Acari: Ixodidae) in Vojvodina hunting resorts.. 2009. Nićin S. 187-196. 50.. Păduraru A.: Walking by Ixodes ricinus ticks: intrinsic factors determine the attraction of moisture or host odour.: Krpeljivost srneće divljači na području Gorskog Kotora. 1972 Pintur K. Book of Abstracts. The Journal of Experimental Biology. 2012 Nosek J. Cieniuch S... D'Amico G. Germany. Bošković I.Trebinje. 1991 Michalik J... Epiderniol. Ruiz-Fons F. Guerin M.: Prevalence of tick-borne pathogens in ixodid ticks (Acari: Ixodidae) collected from European wild boar (Sus scrofa) and Iberian red deer (Cervus elaphus hispanicus) in central Spain.. Monografija Lovačkog Saveza Vojvodine. Sixl W. Croatia..G.. 11.. 10.O.. 2004 Estrada-Peña A. 12.: Landscape ecology of Lyme disease in a residential area of Westchestcr County. Exp Appl Acarol.L. 2008 Carpi G. Appl. Oltean M.. 15. Hurtado A.: Principles of Acarology. In collaboration with Kvicala P. Dumitrache M. 2010 Donzé G. Serbia. Gortázar C. 2138-2142. 2004 Evans G. 52. 207. 136. Joanneum Jg.. 2009 Jurišić A:.I.. 619–623 227 . 146-148 Jurišić A. 1105-1113. Parasites & Vectors. Cozma V. Proceedings of International symposium on hunting „Modern aspects of sustainable management of game population“. Mircean V. Petrović A. 13. García-Pérez A.. Abt.March 19-21. Walker A. 3. 19. 122-125 Kiffner C. Rajković D. 18.: Tick infestation on roe deer in relation to geographic and remotely sensed climatic variables in a tick-borne encephalitis endemic area. February 13-17... Vicente J. 201-109. Almazán C. Petrović A.F.. Babić I.D. Proceedings of 22nd International symposium „Food safety production“.. Mcmahon C.: Prevalence of Tick-Borne Zoonotic Bacteria in Questing Adult Ticks from Northern Spain.: Allochronic seasonal peak activities of Dermacentor and Haemaphysalis spp. García-Sanmartin J. 163.. 829-835... Eur J Wildl Res. 2011. Rizzoli A. 7. Beuković M. Magdaş C. under continental climate in Hungary. Graz. Rühe F. 3. (2009): Surveillance of wild boar (Sus scrofa) and feeding Ixodes ricinus ticks for Anaplasma phagocytophilum and Borrelia burgdorferi s. 1-11. Petrović A.. 2. 1H2S. Martin P. Naranjo V. Exp.: Rumen metabolites serve ticks to exploit large mammals.l. Racewicz M.June22-24. Rhipicephalus sanguineus.: Lovačka organizacija Vojvodine: 1922-2007. 73–84. 2006 Dantas-Torres F. Exp Appl Acarol..: Central European Ticks (Ixodoidea) – Key for determination.O.. Beuković M..M.A. Györke A.D.: Biology and ecology of the brown dog tick. Weimar. Mitt. Beuković M. 2004 Hornok S.... Zool. Novi Sad.. Bouattour A. using molecular methods.. Landesmus. & Waltinger H. 58.. 2008 Crooks E. 2010 Maupin G.O. 5.: Ixodes ricinus is the dominant questing tick in forest habitats in Romania: the results from a countrywide dragging campaign. 2010 Jurišić A. 133. Kocan K.M.June19-25. Campos E. 4283-4289. Camicas J.. Am. Juste R. University of Zagaroza.First International Symposium of Veterinary Medicine – ISVM2015 References 1. 1416–1424.. 366-369. Neteler M. Stańczak J.. Florijančić T. 2007 Barandika J. Cagnacci F.: Abundance estimation of Ixodes ticks (Acari: Ixodidae) on roe deer (Capreolus capreolus). 209. Estrada-Peña A. Epidemiol. Zemun-Belgrade.. Mărcuţan D. Vor T. Rajković D. 8. 175-182. 17. Veterinary Parasitology.. Popović N... Beck R. 6. 4. Acarol. Gherman C.. 2012.. Alings M... 10th International Jena Symposium on Tick-borne Diseases (IJSTD).. 14.. 6.... 47th Croatian and 7th International Symposium on Agriculture. Vector-Borne and Zoonotic Diseases.. Sándor A.. Opatija. Cambridge Univesity press. 8. A guide to identification of species. 1992 Fuente de la J. 2012. Piesman J.. 16. Bosnia and Herzegovina. The Journal of Experimental Biology...

: Ticks of Domestic Animals in Africa: A Guide to Identification of Species.G. Preston P. Bioscience reports. Kiffner C..E. Oxford University Press... Camicas J. 2006 21. Fernández-de-Mera I. Appl.E. Vor T. Bouattour A. 405–417.. Vol. 1991 22. Veterinary Parasitology. Pegram R. Höfle U. 1993 23... Walker A..G. 1. Vol. Gortazár C. Oxford University Press. Exp.: Biology of Ticks. Sonenshine D. Edinburgh. Ruiz-Fons F. 51. Hagedorn P..Niedrig M.. Estrada-Peña A.M. Horak I. II.First International Symposium of Veterinary Medicine – ISVM2015 20.R. Latif A.: Ixodid ticks parasitizing Iberian red deer (Cervus elaphus hispanicus) and European wild boar (Sus scrofa) from Spain: Geographical and temporal distribution. Oxford. Oxford..: Biology of ticks.L.... 2010 24. 1/2. Sonenshine D.G... Acevedo P.A. Fuente de la J..133–142. 140. Acarol... Rühe F.: Tick burden on European roe deer (Capreolus capreolus). Vicente J. 2007 228 .

University of Novi Sad. Dusan Petric2. West Nile virus (WNV) and Dengue viruses (DV-1 through 4). positive-sense RNA of 11 kb.positive sera on WNV were simultaneously ELISA IgG. 2013). Gordana Kovacevic1a. Serbia *Corresponding author: ivana.First International Symposium of Veterinary Medicine – ISVM2015 CROSS-REACTIONS IN SEROLOGICAL DIAGNOSIS OF FLAVIVIRUS INFECTIONS Ivana Hrnjakovic Cvjetkovic1a. Novi Sad. Considering the fact that WNV circulates in Serbia among mosquitoes. Clinic for Infectious Diseases. Germany). University of Novi Sad. Jelena Radovanov1a. Tamas Petrovic3. Six (33.borne viruses that can cause 229 . cross-reaction. whereas the testing of the other 7 sera showed the presence of both the antibodies against WNV and antibodies against Dengue viruses 1-4 (although the latter in lower titers). All of 18 ELISA IgG. There is glycoprotein E inserted in the viral lipid envelope (Jawetz. Scientific Veterinary Institute ’’Novi Sad’’. Sandra Stefan Mikic4. On the basis of antigenic characteristics flaviviruses can be divided into eight antigenic groups. Faculty of Medicine. Clinical Centre of Vojvodina.3%) patients need to be additionally tested for setting the final diagnose. Eighteen ELISA IgG-positive sera on WNV were tested on Dengue virus by ELISA as well as on 8 flaviviruses (TBEV. serological diagnosis Introduction Flavivirus genus consists of more than 70 viruses. Cross-reaction issues between WNV and Dengue virus can be solved in some cases by IIFT. Serbia 4.rs Abstract The most important flaviviruses are mosquito-borne viruses responsible for severe encephalitis in humans: Japan encephalitis virus (JEV). Natasa Nikolic1a. DV 1-4) by indirect immunofluorescent test (IIFT) Flavivirus Profile 2 (Euroimmun. The antigenic determinants of glicoprotein E are responsible for production of neutralisation antibodies in the host. Novi Sad. horses and humans unlike Denga virus. The aim of the study was to demonstrate the extent to which the use of multiple serological testing is able to contribute solving the cross-reaction issues between some members of genus Flavivirus. diagnosis is based on detection of viral RNA by PCR/real time PCR. Novi Sad.1b. More than thirty of them are pathogens significant for human medicine. Nowadays. In the late phase of infection serologic diagnosis is a method of choice to establish the diagnosis of flavivirus infection. The most important antigenic group is the complex of Japan encephalitis (JE) whose members are mosquito . Serbia 3. it was assumed that there were cross-reactions and sera from 18 patients were tested on eight flaviviruses by IIFT.60 nm in diameter and have a single-stranded. In 12 sera specific IgG antibodies to WNV were confirmed by determination of antibody titres.1b 1a Institute of Public Health of Vojvodina. University of Novi Sad. Aleksandra Jovanovic Galovic1a. WNV.1b*. Dejan Cvjetkovic4. The most important mammalian tick-borne flavivirus is tickborne encephalitis virus (TBEV). 5 sera were only positive to WNV by IIFT (but not to other flaviviruses). Serbia 2. Saint Louis encephalitis virus. Vesna Milosevic1a. birds.1b.positive on Dengue virus. Novi Sad. YFV. Novi Sad. in early illness phase. Melnick & Adelberg's. Among those 12 sera. Faculty of Agriculture. Significant problems in serological diagnosis are cross-reactions between members of Flavivirus genus due to antigenic similarity. Serbia 1b Faculty of Medicine. Keywords: flaviviruses.org. JEV. Aleksandra Patic1a.hrnjakovic@izjzv. Flaviviruses are 40 .

and Romania are at high risk due to high prevalence of the virus in ticks (WHO. Approximately 20% of infected humans suffer from WNV fever and less than 1% develops neuroinvasive disease resulting in encephalitis and meningitis. Surprisingly. south-western and south-central Asia and Australia (Hubálek and Holouzka. southern Europe. circulation of YFV has been increased significantly in Africa. Austria. diagnosis is based on detection of viral RNA by PCR or real time PCR or serologic tests.).. Neurological disorders. Significant problems in serological diagnosis are cross reactions between members of Flavivirus genus because of antigenic similarity. The aim of the study was to examine the value of multiple serological testing in solving the crossreaction issues between flaviviruses. parts of Scandinavia. the most important is tick-borne encephalitis virus (TBEV). Since 2000. Germany). The vast majority of WNV infections in humans are asymptomatic.First International Symposium of Veterinary Medicine – ISVM2015 severe cases of encephalitis in humans: Japan encephalitis virus (JEV).. 2012). commercially available ELISA was used (produced by Euroimmun. The same sera were tested on 8 flaviviruses (TBEV. Results were evaluated semiquantitatively by calculating a ratio of the extinction value of patient sample over the extinction value of the calibrator 2 which was included into the test. West Nile virus (WNV). 2011. YFV. Czech Republic. Neighbouring countries like Bosnia. 2007). Material and methods Eighteen sera ELISA IgG-positive on WNV were tested on Dengue virus by ELISA. Most JEV infections are asymptomatic.. 1-4) by indirect immunofluorescent test (IIFT) Flavivirus Profile 2 (Euroimmun. Cases of yellow fever virus (YFV) infection have been recorded in subtropical areas of Africa and South America (Jerant Patić. 230 . in early illness phase. WNV is the only mosquito borne flavivirus which activity in humans and animals is detected in Serbia (Petrović et al. kidney and liver failure may also occur. Testing. The most remarkable clinical feature is haemorrhagic syndrome.. morbidity rate was very high. meningitis. Human clinical cases associated with WNV infections have been reported from many countries in Africa. Germany). Hungary. pancreatitis and fulminant hepatitis have been described in some symptomatic persons infected with WNV (Petersen and Marfin. Croatia. Among mammalian tick-borne flaviviruses. Japanese encephalitis is zoonosis widely distributed in Asia caused by Japanese encephalitis virus (JEV). 1999). 2012). Further investigations are needed for confirmation of spreading JEV in Europe (Ravanini et al. Switzerland. European Russia (Heinz et al. JEV. However. Baltic countries. ranging from 51 . 2002). serologic tests appear to be the method of choice for establishing the diagnosis in the late phase of virus infection. but in some cases the virus can cause systemic febrile illness with the central nervous system involvement and possible fatal outcome. 2005). Petric et al . Bulgaria. Four denga viruses are widely distributed in the tropics (between 35 north and 35 south latitude) where principal vector Aedes aegypti is present. Myocarditis. WNV. DV. Saint Louis encephalitis virus (SLEV). Lübeck. 2013). Slovenia. TBEV infections are endemic in large parts of Europe (Southern Germany. calculation and interpretation of results were performed strictly on the automatic device Euroimmun Analyzer I-2P following manufacturer instructions. For purpose of WNV IgG antibodies detection. Poland. Slovakia. Viral isolation from blood or cerebrospinal fluid is usually unsuccessful even in the early stage of infection because of low viral loud in humans. 2014. Ravanini reported detection of JEV RNA in mosquitoes collected in northern Italy.89% (WER. Nowadays. Murray Valley virus and the complex of Denga viruses whose members are DV-1 through 4. Epidemics of YFW infection occurred in unimmunized population of Africa in 20th century.

35 Legend: ND .97 5. horses and humans unlike Dengue virus. Table 1.60 5. Eighteen ELISA WNV IgG-positive sera were tested by commercially available ELISA IgG for denga (Euroimmun.88 1.89 0.positive on Dengue virus (table 1).43 3. All 18 sera positive against WNV were tested on eight flaviviruses by IIFT.46 IgM + 5. WNV.16 3.1 and negative if ratio was less than 0. For IIFT.18 1.98 5. 11582.17 2. In the other serum samples past WNV infection were detected. 11528 and 11561 were positive on WNV IgM antibodies that indicated recent infections. serum samples were diluted 1:10 and applied on the slides coated with TBEV. The results were read under a fluorescent microscope (Olympus BH2). In 6 (33. objective 40X.96 3. it was assumed that there were cross-reactions.29 4.28 1.23 4.62 3.73 IgG+ 1.25 2.04 3. WNV. YFV. JEV.69 IgM+ ELISA Denga IgG 1. JEV. intermediate if ratio was between 0.8 and 1.94 2. Germany) and IIFT Flavivirus Mosaic 1 (Euroimmun.1. DV 1-4 antigens. YFV.16 3.83 5.70 2.97 2.13 IgM+ 5. Serum sample No 116. SBD .3%) sera specific WNV IgG antibodies were confirmed and there were no cross-reactivity with other flaviviruses.8. Results All of 18 ELISA WNV IgG-positive sera were simultaneously ELISA IgG.South Backa District Between WNV and Denga virus by ELISA IgG test independent whether it is recent or past WNV infection.28 3. The highest crossreactivity was observed with DV.Nisava district. Considering the fact that WNV circulates in Serbia among mosquitoes.56 2.Results of ELISA IgG on Denga virus in IgG WNV positive serum samples Serum samples 116 159 8 14 91 31 11132 5291 11582 11553 11542 5409 11796 688 626 667 11528 11561 Origin of samples ND ND MBD MBD MBD MBD SBD SBD SBD SBD SBD SBD SBD SBD SBD SBD SBD SBD History of WNV infection recent past past past past past past past recent past past past past past past past recent recent ELISA WNV IgG 4. MBD .79 4. DV 1-4. birds.Middle Banat District. Germany) against TBEV.52 3.85 I1. In 12 serum samples cross reactivity was observed (table 2).15 3. All samples were tested in the Institute of Public Health of Vojvodina and all were positive on WNV IgG antibodies.28 5.60 1.11%) 231 .53 IgM+ 4. in 11/18 (61.First International Symposium of Veterinary Medicine – ISVM2015 Results were considered as positive if ratio was equal to or greater than 1. Cross reactivity of the WNV positive sera observed in ELISA against DV was 100%.

77) 5/18 (27.33) Legend: DV1-4 Denga virus. IFT. 2013). Molecular tests are important because of their sensitivity and specificity but in the late phase of infection they are negative. Neutralisation test. Among those 12 sera. 232 .Yellow fever virus. Laboratory diagnosis of flavivirus infection can be made by isolation from CSF or blood on cell culture in BSL 4 in reference laboratories. In areas where many ARBO viruses are present simultaneously. The study results reported from Makino indicated that the cross-reactivity among flaviviruses has been observed quite often (Makino et al. In our study.11) YFV 4/18 (22.55) Legend: DV. cross-reactivity is important problem in establishing accurate diagnosis. complement fixation test or hemagglutination inhibition test. The serum and/or CSF (in case of neuroinvasive infections) can be tested by ELISA.22) TBEV 3/18 (16.Cross-reactivity between flaviviruses lavivirus Percentage (number of cross reactive samples/number of total tested) DV 11/18 (61. Such results are in agreement with the study results provided by Koraka in which DV antigen was responsible for lower rate of crossreactions by IIFT than by ELISA (Koraka et al. For this reason. 2002).67) JEV 1/18 (5. serotype 1-4 Discussion and conclusion Flaviviruses are important human pathogens distributed worldwide. IIFT.. detection of specific antibodies to flaviviruses in late phases of infection by serologic tests is widely used for routine diagnosis of flavivirus infection. YFV .67) 6/18 (33. 11 sera showed the presence of both the antibodies against WNV and antibodies against Dengue viruses 1-4 (although the latter in lower titers). Cross-reactivity among DV and WNV was 100% by ELISA and 66.33%) was observed with DV4. JEV . TBEV . cross-reactivity among the Flaviviridae family members was observed using ELISA and IIFT. ELISA as well as PCR test can be applied for identification of isolates. Molecular techniques are the tests of choice to detect viremia in all flavivirus infections. The highest cross-reactivity (33. where cross-reactivity was observed in. ELISA and IIFT are commercially available. Cross-reactivity between denga virus (1-4) by IgG IIFT in serum samples positive on WNV by ELISA IgG Flavivirus Percentage (number of cross reactive samples/number of total samples tested) DV1 DV2 DV3 DV4 5/18 (27.77) 3/18 (16.6% by IIFT..Japanese encephalitis virus Cross-reactivity was observed for all denga virus serotypes (table 3). In this study.First International Symposium of Veterinary Medicine – ISVM2015 Table 2.tick-borne encephalitis virus.Denga virus. Melnick & Adelberg's. 1994). IIFT showed a better discrimination between specific IgG antibodies to DV and specific IgG antibodies to WNV than did ELISA IgG specific for these viruses. Table 3. The cross-reactivity within the flavivirus group must be considered in setting up the diagnosis (Jawetz.

. 2011. HealthMed 6. Sittisombut N. et all.. Holouzka J. 3. Milošević V. 2005 Available on line:http://www. DV4 antigen gave the highest rate of cross-reactivity. Acknowledgments The presented work is part of the research done in the project TR31084 and TR43007 granted by the Serbian Ministry of Science and Technological Development and 114-451-2142/2011-01 (20112014) by Provincial Secretariat for Science and Technological Development.Microbes and Infection. New York. Central Europe.The yellow fever situation in Africa and South America in 2004. Jawetz.1-2. 1999 3. Emerg Infect Dis . Groen J. Hrnjakovic Cvjetkovic I.. 86. Radovanov J. Ilaria V.... Osterhaus A. Ravanini P.. Nicosia AM.28. Reactivity of serum samples from patients with a flavivirus infection measured by immunofluorescence assay and ELISA. 80.: Medical Microbiology. WHO. 9.2002 6..int/wer 233 . 173 179. 4. 137. Grgic-Vitek M. Japanese encephalitis virus RNA detected in Culex pipiens mosquitoes in Italy.Wkly WHOEpidemiol Rec... 12..:pii=20221 Available on line: http://www. 951–955. 249-256.. Lupulović D. Tadano M. 29.. Servino L. WER.. 2013 4. Niedrig M. Emerg Infect Dis. Holzmann H. Marfin AA. et al.: Vaccination and tick-borne encephalitis. Huhtamo E.eurosurveillance. 11.. et all. 241-56. Petrović T. Immunol.who. Cvjetkovic D.Sirisanthana V. 2002 8. Vasić A.. 24. Hrnjaković Cvjetković I..2013. Makino Y. Studies on serological cross-reaction in sequential flavivirus ections...26th Edition. References 1.69-76. 69.. Petersen LR.. i ost.org/ViewArticle. Heinz F. Groznica zapadnog Nila ..Vaccines against tick-borne encephalitis:WHO position paper.: West Nile fever – a re-emerging mosquito-borne viral disease in Europe. Ortomedics.Novi Sad. 5. YFV and TBEV antigens gave lower rate of crossreactions than DV antigens by the same test. Petrić D. Jerant Patić V. Kriz B. 5. Maneekarn N..značajna vektorska virusna infekcija u Srbiji:aktuelna situacija. Essl A. 2. 643-650. McGraw Hill Lange. Saito M... Jerant Patic V.First International Symposium of Veterinary Medicine – ISVM2015 Applying IIFT in our study. 38. 2012.. Medicinska virusologija. 2015 (prihvaćeno za štampu) 10.19.. . Milosevic V. Koraka P. JEV. West Nile virus: A primer for clinician...1. Euro Surveill. Veterinarski glasnik. Ann Inter Med. 7.... Stiasny K. Melnick & Adelberg's. 5. Zeller H. 1994.2012. Crobu MG. Microbiol.. 2.. 2007.1209-1215. and Kundi M. WNV.West Nile virus surveillance in humans and mosquitoes and detection of cell fusing agent virus in Vojvodina province (Serbia). Weekly epidemiological record. Hubálek Z.. Petric D. 462-468..17..

There are several types of Ehrlichia. The etiologic agent of canine monocytic ehrlichiosis (CME) is rickettsia Ehrlichia canis (E. Rhipicephalus sanguineus. Diagnosis was not based on blood tests.First International Symposium of Veterinary Medicine – ISVM2015 VECTOR BORNE INFECTION (EHRLICHIA CANIS) – CLINICAL CASE Zlatko Dimeski1*." Ehrlichia are transmitted by ticks including Brown dog tick. disbalance in the movement of the rear limbs. Macedonia 2 Pet Land – Veterinary Hospital. leishmaniasis and ehrlichiosis. canis). loss of weight.7 . R. often destroyed. Goce Cilev1. lymph nodes. Signs of the acute phase of the disease usually develop 1-3 weeks after being bitten by triggers. Kliment Ohridski . Canine ehrlichiosis is also known by other names such as "tracker dog disease". blood examination showed reduced number of granulocytes (41.6 + %) and monocytosis (8.com Abstract Vector borne infection with Ehrlichia canis is a systemic disorder that manifests with fever. This disease is known in the world. with thrombocytopenia and platelet dysfunction and non-regenerative anaemia. Bojan Stamadziovski2 1 Univesity St. The clinical manifestation of the disease is known as ehrlichiosis in dogs (CME). Ehrlichiosis in dogs is usually caused by Ehrlichia canis. The acute phase of the illness usually lasts 2-4 weeks. Ehrlichia organisms are called rickettsia that the evolutionary scale between bacteria and viruses (Tuna and Ulutas. Labrador. bleeding tendencies. depression.Faculty of Veterinary Medicine. of Labrador breed. and possibly E. chaffeensis. Macedonia *Corresponding author/ e-mail: zlatko_raja@yahoo.5 years old. canine typhoid. Diagnostic and treatment of canine ehrlichiosis is described in a male dog. Vector borne infection. 7500 Prilep. increased number of lymphocytes (49. with signs of depression. reduced body weight. also under the following names dog’s rickettsioses. fever. Some affect humans. It is a small gram negative coccoide bacteria that parasitizes in circulating monocytes as a group of organisms called morulae.5 years old. parvovirosis. 2009). rapid tests were also done for diagnostics of giardiasis. tropical pancytopenia. Ehrlichia are transmitted to the animal. "tropical canine pancytopenia. reduced limb function in long inactivity. E. about 2. nervous signs.7 + %). male breed dog Labrador. which affect various species of animals. ruminantium. wolves) and located around the world. liver and spleen are often enlarged. lethargy. Rhipicephalus sanguineus. Anemia. loss of appetite. Ehrlichiosis can have three stages. The disease is transmitted through the saliva of brown tick. As a result of infection. distemper. after which it was concluded that the dog had a positive finding only for ehrlichiosis. Clinical symptoms in this dog were depression. E.%). ewingii. Elena Buntevska2. Some organisms that were formerly classified as Ehrlichia now reclassified as Anaplasma. 'and' dog typhoid. Biljana Petrovska1. it is the treatment of Ehrlichiosis. imbalance in the movement of the rear limbs.g. nervous symptoms. canine hemorrhagic fever. 7000 Bitola. Keywords: Ehrlichia canis.. ''canine hemorrhagic fever. When the mature form of a tick feeds on another animal. shortness 234 . reduced limb function after long inactivity. Ehrlichiosis Introduction In our case. R. which is widespread in the world. Canine ehrlichiosis is a disease of dogs and wild canids (e. about 2. Zivko Gacovski1. Platelets small cell fragments that help blood clotting. After performing the complete blood count.

This can sometimes interfere with some types of leukemia. 2004). anemia. Materials and Methods The diagnosis is based on results of special blood tests.0-96. Chronic phase may have moderate or severe symptoms. arthritis or kidney disease called "glomerluonephritis" which can develop (Yğci et al. 2010).5x10^12/L 14-18g/dl 37.. Blood tests show that one or all types of blood cells are reduced. A positive result indicates that the dog is affected by Ehrlichia. One is known as ELISA test. If the dog became chronically infected. A dog with an active infection showed a significant increase in antibodies present. Weight loss. The antibodies can be detected at an early stage of the disease. the disease can be restored.2-5. Since one tick can infect more than one disease (e. If not. We gave supportive therapy.0-54. because it takes a while for the body to make. for 3-4 weeks. Changes in the level of proteins in blood are different. especially during periods of stress. joint pain and stiffness and bruising are common symptoms. At this stage of Ehrlichia is inside the spleen. haemobartonellosis or babesiosis). and the other is a quick test. The dog will either eliminate Ehrlichia body or infection can progress to chronic phase.0um^3 27. lymphocytes can be increased and abnormal.0% 76.. For treatment we used tetracycline or doxycycline. This stage can last for months or years. In some cases. The most common protein albumin is reduced. which we did when the dog was brought to the veterinary clinic. In the acute phase of disease.0x10^6/L 140-340x10^6/L .First International Symposium of Veterinary Medicine – ISVM2015 of breath.30x109/L 11. and can’t be seen. edema (fluid accumulation) of the hind limbs. even though the dog's symptoms generally improve after several days of therapy. Results and Discussion The rapid test that we did was positive (Figure 1) and in addition we show the results of blood (Table 1) Table 1.. eye inflammation. neurological signs.0-35. canis. he was positive on E. dogs infected with more than one of these diseases at a time.g.9 36. Blood results-clinical case-patient dog ID 3197 (date of analysis 18.. and fever.7 69.0pg 30. enter the subclinical stage. including intravenous infusion and vitamins (B – complex and C vitamin).0-32. and globulin increased (Bulla et al. antibody levels increased significantly. Reducing the number of platelets (platelets that assist in blood clotting) is the most common laboratory finding in all stages of disease. hemorrhage.5 32.02. Many dogs will be able to fight off the infection.3x10 /L 5. 2010). In subclinical stage of the animal may appear normal or mild anemia. One type cells.2015) Parameter Leucocites Eritrocites Hemoglobine Hematokrit MCV MCH MCHC PLT Result 9 11. which generally causes serious symptoms (Mylonakis et al.4 220 235 Reference 4-9x10^9/L 4.2 22.

and Koutinas A. This Ehrlichia targets moncytes and is transmitted by Rhipicephalus sanguineus. (2010) Myelosupressive caninemonogytic ehrlichiosis (Ehrlichia canis): An update on the pathogenesis. Israel Journal of the veterinary medicine. Timisoara. Lucrări Stinifice Medicină Veterinară Vol. Tuna E. hematologic abnormalities and serologic findings. 35 (2004). (2009). Figure1. Yğci B. diagnosis and management. Israel Journal of Veterinary Medicine Volume 65 (1). et al. XLII. 4. Bulla C. Prevalence of Ehrlichia canis infection in trombocytopenic dogs. References 1.. 3. Ba. the "brown dog tick. Res.First International Symposium of Veterinary Medicine – ISVM2015 Blood results were small increase in leucocytes. Volume 65 (4) 2010. Vet. while the remaining parameters were within the normal reference values. Siarkou V. Diagnosis is usually made on the basis of a combination of clinical signs." The therapy that was given to the dog. his general condition improved. and Ulutas B. Mylonakis M. et al. Rapid test Conclusion Ehrlichia canis is the cause of classical Ehrlichiosis in dogs. The relationship between the degree of thrombocytopenia and infection with Ehrlichia canis in an endemic area. 236 . 2. (2010) The spread of canine monocytic ehrlichiosis in Turkey to Central Anadolia. 2009. (2004). G. neurological symptoms and also improved weight gain.

Renal lesions are most commonly affected organs present in dogs with leishmaniasis (Baneth et al. CanL is systemic disease that may potentially relate to any organ or tissue. Ocular lesions as blepharitis. during a week and was mostly visible on the head of the dog.8 mmol/L.6 µmol/L. and it is primarly spread with a bite of female sand fly . HCT 30. CanL manifest a wide range of clinical signs and degrees of severity. male.9 fL. Macedonia 2 Pet Land – Veterinary Hospital. MCHC 333 g/L. 7000 Bitola.5%. HGB 100g/L. There were no characteristic signs as alopecia or skin changes. haematological and biochemical profile. 2009).04x109/L. while others remain asymptomatic carriers and are infectious for sand fly. urea 10. Due to the wide spreading of leishmaniasis in our region. Blagica Trajanoska2. as well as humans. PLT 154x109/L. making it difficult to diagnose the disease. Elena Buntevska2 1 Univesity St. about twelve years old. Milteforan Introduction Canine leishmaniasis (CanL). lethargy and hyperthermia.. P/O in period of 9-12 months). Ipaktin phosphate reducer and Milteforan (2mg/kg body weight. ALT 62 U/L. fast immunological test. Allopurinol. The disease occurs in many forms of which the most common are two following forms: visceral (caused with Leishmania donovani) and cutaneus form (caused by Leischmania tropica). Lymph 21. because circulating immune complexes deposited.60x109/L. anemia. PCT 0. a rapid immunological test for leishmaniosis was conducted and the result was positive finding. but is prevalent in temperate regions. the dog was positive to leishmaniasis. MCV 65. Biljana Petrovska1. which is the main reservoir of infection in humans.04x1012/L. 2003). observed by the owners and according to the anamnesis . According to the test. desquamated and ulcerative lesions of the skin and glomerulonephritis with proteinuria (Zatelli et al. Despite these trials a fast test for leishmaniasis was further made. 2008). The only distinctive symptom in the dog. Bojan Stamadziovski2. Gran.3% Mon 5. which leads to proteinuria. Martin Kamceski2.Faculty of Veterinary Medicine. It is widespread in tropical.. Zivko Gacovski1. and although there is an insufficient number of research contracts for the management of this disease.8. We chose therapy with allopurinol (20mg/kg. Lymph 67.9%.55 U/L) in the blood.was sharply aging.. R. 74.Phlebotomine (Phlebotomus).com Abstract Leishmaniasis is a protozoan disease transmitted among domestic and wild animals. cause Leishmania infantum is the largest global zoonosis potentially fatal for humans and dogs. 7500 Prilep. ALP 23. for 28 days). PDW 39.6. Also.27x109/L. Proliferation of glomeruli appears. Leishmaniasis is a transmissible disease caused by protozoa of Leishmania genus. In this report we will present the diagnosis of leishmaniosis and treatment in a dog of Pekingese breed. Kliment Ohridski . Keywords: Leishmaniasis.079%) and blood biochemistry test (creatinine 168.First International Symposium of Veterinary Medicine – ISVM2015 LESHMANIASIS IN 12 YEARS OLD MALE PEKINGESE-CLINICAL CASE Zlatko Dimeski1*. subtropical regions. R.5fL. АSТ 124 U/L. 237 . corneal edema or chorioretinitis. Rubenal 300. Gran. uveitis. RBC 5.04%. presents with nonspecific clinical signs. Macedonia * Corresponding author: zlatko_raja@yahoo. MPV 8. laboratory tests were made such as haematological analysis (WBC 31. Goce Cilev1. can also be present. RDW 15. Some dogs show clinical signs. Unspecific symptoms may occur frequently. Pekingese dog.7%. Infected animals are usually affected with lymphadenopathy. CanL is endemic in more than 70 countries worldwide (Shaw et al.

6kg 1 x Rubenal tablet twice daily). with a recommendation for controls every 3 months (http://www. 8-11 months. The most common contraindication is vomiting. Epakitin should be recommended at the first signs of hyper-phosphatemia in cases of CanL. it is suggested to use Epakitin in combination with a low phosphorous diet. over a long period of time. However. Also the patient was given a dietary supplement to support renal function . using automated blood analyzer which is calibrated specifically for dog blood. Although we did biochemical profile and a rapid test for leishmaniasis (rapid test kit).Rubenal 300. efficiency and low cost. but rarely only manifestation of the disease. Allopurinol belongs to a class of drugs called xanthine oxidase inhibitors which prevent the accumulation of uric acid. Epakitin’s highly palatable formulation can be used with their regular food in animals that refuse to change their diet. Materials and Methods Complete blood count was performed in blood samples in EDTA tubes. Epakitine phosphate reducer that helps kidney function in support of renal function in case of chronic renal failure in dogs 5 g twice daily. the test results were positive. Renal failure is one of the classic general symptoms that appear in leishmaniasis. Side effects are very rare. crystals form in the urine which may congregate to produce kidney or bladder stones.Acknowledged forms of currently available treatment The dog was treated with Milteforan analkylphosphochorine. 238 .First International Symposium of Veterinary Medicine – ISVM2015 These lesions may progress to chronic renal failure or nephritic syndrome. which is transient.1800petmeds. mixed with food for up to 6 months from the beginning. administered orally. Allopurinol therapy for Pekingese is (25 mg. Treatment was initiated with Allopurinol. It is used in dogs alone or in combination with pentavalentantimonials.com/Allopurinol-prod10042. ¼ of the tablet 100mg) was selected. The test for leishmaniasis was made for high prevalence of this disease in our region. divided into two doses every 12 hours. The drug was administered orally for 28 days. Table 1. For best results. The drug is in the form of liquid. Rubenal 300 helps by maintaining the normal fibrous architecture of the kidneys (Dosage: Dog 3 .html). The most common dosage is 5-20 mg per day. it is currently the standard treatment of leishmaniasis Dog. for its limited toxicity. Rubenal 300 is a new aid to maintaining normal kidney structure which is important in kidney function and is an issue for dogs and cats with kidney problems. If uric acid accumulates in the body.

7 x109/L 0.0 300-380 117-460 7.First International Symposium of Veterinary Medicine – ISVM2015 Also.7 U/L 44-138 <136 3.0-17. 239 . The advantage of this drug is that its direct anti-parasitic activity is not dependent on a functional immune system.0 Parameter Result Ref. the drug showed no adverse effects on the liver and kidneys.80% 69.0-56. This drug is an orally bio-available chemical that was originally studied as an antitumor agent. if the dogs do not have renal insufficiency treatment. Lymph. Hematological finding in the 12 year old Pekingese.0 0.50-8.1 0.2 x109/L 3.8-5.0 20.1-9.0-17.1 x109/L 71g/l 15.64 U/L 45. MCH Gran.0 110-190 39.0-1.40% 3.0-12.7% 89.079% 6.0 62. In the specific treatment.50 6. The dog had overall leukopenia with low number of leucocytes.0-72. Table 2. AST (asparat aminotransferase) showed increased acctivity.3 358g/L 103x109/L 8. Results and Discussion The haematological and biochemical results after the first clinical examination are given in the Table 2 and 3.2 9-49 8-57 Table 3.3 fL 0.0 2.0-30. we have included also some maintenance therapy for kidneys (Rubenal 300 and Epakitin).6 12. % WBC RBC HGB HCT MCV MCH MCHC PLT MPV PCT Result 9 Ref. and also got severally anaemia because of eritropenia and hypohaemoglobulinemia. and it can be attributed to dogs with renal failure and avoiding danger.9µmol/L 72.0 60.0-93.0-12.0-25. Biochemical analysis From the tables we conclude that the dog was severally affected.08x109/L 4. probably because of kidney tissue inflammation.0mmol/L 54.1 U/L 35. wich probably results from reduced synthesis of erythropoietin in damaged kidneys and reduced intake of food. on the day of receiving in the clinic Parameter WBC Lymph.90% 3.0 5.5fL 29. The kidneys are severally affected and they can’t normally clear the creatinine and urea from the body.values Creatinin ALP Urea AST ALT 315.0-9. it was tested in dogs in vivo and found to be an effective agent at eliminating parasitemia.1 x10 /L 0.8 4. % Gran. Subsequent to the serendipitous laboratory finding that Milteforan was active against Leishmania.values 4.2 x109/L 16.% Mon.

Am J Vet Res 2003.4 U/L Ref. Lymph.1 U/L 32.3fL 27. Tarducci A. Borgarelli M.0-30. Platelet count is also near normal value.0-93.0-1. The leukocytes count has normalized.% Mon. with normal number of erythrocytes. Bonfanti U. Hillman TJ (2009) Canine leishmaniosis in the United Kingdom: a zoonotic disease waiting for a vector? Vet Parasitol 2009. Langton DA. References 1. Table 4: Blood results 28 days of therapy with Milteforan and other supportive therapy results after blood analysis and biochemistry Parameter WBC Lymph.52 U/L 8.9fL 0.50 110-190 39. MCH Gran.3 x109/L 21. Zanatta R.0-9.9 x109/L 6. % RBC HGB HCT MCV MCH MCH PLT MPV PCT Result 9 Reference 8.3 315g/L 239x109/L 8. especially in cases in wich there is kidney damage.0-17.6% 68.06x1012/L 137g/L 41.0-12. Urea in the serum show normal levels.10% 4. % Gran.First International Symposium of Veterinary Medicine – ISVM2015 After 28 days of therapy has been shown to improve the general condition of the dog and improved renal function and liver function.50-8.0 60. Maybe we should also include some other reasonable drugs (namely to support kidney function) like diuretics (furosemide and spironolactone). Creatinine is in normal values. 2.2mmol/L 30.values 44-138 <136 3.1 x109/L 0.2 9-49 8-57 Table 5: Biochemical analysis Parameter Creatinin ALP Urea AST ALT Conclusion In this case report. hemoglobin concentration and hematocrit value.8-5.0 117-460 117-460 7.40% 6. Supportive therapy for kidney is also important. wich means that kidneys are working well in respect of clearence. Santilli R.0 62. the finding of anemia has also improved.0-56. AST level is normal.1 0.6 12.0 2.0-25.071% 6.5 x10 /L 1.0-12. we have concluded that: Allopurinol together with Milteforan is acceptable specific therapy for canine Leishmaniasis. Guarraci A (2003) Glomerular lesions in dogs infected with Leishmania organisms. 240 .0 Result 57µmol/L 64.0 0.0-72. but also synthetic erythropoietin and antimonials.0 5. Nigrisoli E.30% 77.1-9. Zatelli A.8 4. Shaw SE.0 20.

Baneth G. 4. http://www.html 241 .com/Allopurinol-prod10042. Solano-Gallego L. Bourdeau P.First International Symposium of Veterinary Medicine – ISVM2015 3. Trends Parasitol 2008. Koutinas AF.1800petmeds. Ferrer L (2008) Canine leishmaniosis-new concepts and insights on an expanding zoonosis: part I.

First International Symposium of Veterinary Medicine – ISVM2015 ________________________________________________________________________ Session № 4 WILDLIFE DISEASES AND PATHOGENS IN ENVIRONMENT Oral presentations _______________________________________________________________________ 242 .

gulls and related birds. 1978. Although there is some dispute on a later year of the isolation of the virus. swine. turkeys. Influenza A viruses in their natural hosts are in evolutionary stasis. are considered aberrant hosts. According to numerous authors.First International Symposium of Veterinary Medicine – ISVM2015 Plenary lecture: INFLUENZA IN BIRDS AND OTHER ANIMALS Vladimir Savić Croatian Veterinary Institute. 1933) in 1930s and two decades later from horses (Sovinova et al. equine influenza and human influenza. On the other hand. horses. but attempts to propagate this virus in cell cultures and chicken embryos were unsuccessful (Wu et al. apparently in any of 144 possible combinations from H1N1 to H16N9. Zagreb. virus. Croatia * Corresponding author: v_savic@veinst. Swine. Influenza A viruses can be further divided into sub-types on the basis of the antigenic reactivity of the surface glycoproteins. equine and swine species (Webster et al. and humans. 243 . and the latter two are primarily of a human health importance. and C. Emergence of highly virulent influenza A viruses is of a particular concern for the poultry industry because such viruses cause up to 100% mortality in chickens and turkeys. B and C. 1931) and humans (Smith et al. 1983). This was followed by isolation of influenza virus from pigs (Shope. particularly chickens. Such rapid evolution can result in high virulence for the new host. In contrast. 1958). Other species that are infected with influenza A viruses. which is also the type associated with influenza of avian. So far there are 16 haemagglutinin (H) and nine neuraminidase (N) subtypes (Fouchier et al. influenza A virus was first isolated from chickens at the beginning of the 20th century (A/Brescia/1902 [H7N7]). Poultry Centre. the haemagglutinin and neuraminidase molecules. Few influenza viruses are well adapted and established in mammalian hosts. Such a universal host can serve as a vessel for mixing of the genetic material of different viruses which can result in new influenza A viruses with unpredictable features. mammals Introduction Influenza viruses are classified into types A. 2009). as an aberrant host... Majority of influenza A viruses are fully adapted to the natural hosts in which they multiply mainly in intestines and the infection causes no symptoms. nevertheless the natural hosts of the virus are wild waterfowls..hr Abstract There are three types of influenza viruses: A. causing primarily respiratory disease like swine influenza. another isolate of the same subtype (A/FPV/Dutch/27 [H7N7]) dates back in 1920s (Alexander. domestic poultry and mammalian hosts. 2005) and each virus possesses one H and one N subtype. are caused by influenza virus type A. the infection in aberrant hosts usually results in rapid evolution due to selection pressure driven by the virus adaptation to a new host. birds. plays an important role in ecology and epidemiology of influenza A viruses because this species is prone to infection with viruses originating from wild birds. B.). and sometimes even for other species. Keywords: Influenza A. including all pandemics. two influenza-like virus genomes designated H17N10 and H18N11 were identified in South American bats. 2014). Influenza B and C viruses are isolated mainly from humans and are less pathogenic than influenza A viruses (McCauley and Mahy. Recently. according to the antigenic properties of matrix proteins or nucleoproteins. The majority of human influenza virus epidemics. influenza A viruses have been isolated from a variety of birds and mammals.

e. 2000. influenza viruses in aberrant hosts usually multiply in the respiratory system (Suarez. This adaptation may result in very high virulence for the new host. Matrosovich et al. and such adaptation usually has far-reaching consequences. shorebirds and terns). i. In contrast. Other species that are infected with influenza A viruses are considered as aberrant hosts. 2007). They are influenced by the virus composition and the host specific receptors (Ito eta al. The distinction between the natural and aberrant host is essential for understanding the ecology of these viruses. Subsequent extensive research revealed more or less barriers to frequent interspecies transmissions of influenza A viruses. Solid line shows usual transmission. very intense evolution in aberrant hosts is attributed to selection pressures for adaptation of these viruses the new host. Figure 1. influenza A viruses occasionally transmit from its natural host to other species in which usually cause short-term spread and soon vanish. Dotted line shows transmission which occurs rarely or only presumed transmission. 1955). 2000. geese and swans) and Charadriiformes (gulls. Capua and Alexander. In contrast. particularly ducks.. 2000. It is important to emphasize that influenza viruses multiply in natural hosts. 2009). domestic mammals (pig and horse) and man (Figure 1).First International Symposium of Veterinary Medicine – ISVM2015 Influenza virus isolates from chicken were initially called fowl plague virus because until 1955 it was not known that they were actually influenza viruses (Schäfer. 244 . Natural and aberrant hosts of influenza A viruses Influenza A viruses infect numerous avian and mammalian species. The most important hosts and transmission of influenza A viruses. The most common aberrant hosts are domestic poultry (chicken and turkey). Despite these barriers. aquatic birds primarily in the intestines being excreted via feces. The vast majority of influenza A virus is fully adapted to aquatic birds in which infection does not cause virtually any disease and such viruses in these hosts are in the evolutionary stasis. and sometimes for other species.. Suarez. In extremely rare cases these viruses adapt to the new host. but the natural hosts of the virus are aquatic birds from orders Anseriformes (ducks.

The successful spread of the influenza A virus among waterfowl is contributed by their seasonal migrations when they can transmit viruses over long distances (Gilbert et al. Eurasian and gull lineages (Suarez. 1988).. but not all viruses of these groups cause HPAI. It became pathogenic even to carnivore mammals. These mutations occur after a number of passages in the chicken or turkey (Capua and Alexander. 2006). With addition of unique influenza A viruses from gulls (H13 and H16 subtypes). and Australasia and the flyways of the Western Hemisphere (Americas). 1992). nucleotide sequence analysis of viruses from the natural host reservoir shows three distinct categories of avian viruses: North American. The virus also caused serious fatally in infected humans (Li et al. 2007). These two avian species are aberrant hosts and influenza A viruses in chickens and turkeys are under continuous selection pressure (Suarez.e. HPAI virus of H5N1 subtype that emerged in mid 1990s in the Far East has undergone additional passages trough domestic poultry and became pathogenic for ducks which were considered until 2002 to be unsusceptible to HPAI (Sturm-Ramirez et al. 2007). 2000). termed low pathogenic avian influenza (LPAI). 2004). 2000). More important is that LPAI viruses of H5 and H7 subtype are potential precursors for HPAI viruses whereas some of them need only a slight mutation to turn them into very virulent viruses. even in hundreds of millions of infectious particles per gram of faeces (Webster et al. Consequently there is no or very limited virus exchange between waterfowl populations the Eastern and Western Hemisphere. Influenza A viruses in poultry Domestic poultry species such as chicken and turkey are susceptible to only a limited range of circulating influenza virus subtypes (Brown et al. all 16 H and 9 N subtypes in the majority of possible combinations are isolated from waterfowls. Africa. infrequent incursions occur and mainly incursions of avian influenza viruses of Eurasian lineage into North America are documented (Pearce et al. These viruses are of either H5 or H7 subtype. primarily respiratory disease. Another group is comprised of viruses causing mild. According to pathogenicity in these two hosts. tigers and leopards. Avian influenza viruses have been isolated from freshly deposited faecal material and from unconcentrated lake water. Beside genetic differences (Figure 2) there are also significant antigenic differences between same H subtypes from different hemispheres. 1978). It may not be neglected that LPAI viruses.. particularly cats. if exacerbated by other infections or environmental conditions. Highly virulent viruses replicates in virtually all organ systems and cause mortality to 100%. Influenza A virus excretion from infected duck lasts for just two to four weeks. there is no or very limited overlap between these two groups of flyways.. as gregarious species. thus waterfowl. influenza A viruses can be divided into two clearly distinct groups. This form of the disease is termed highly pathogenic avian influenza (HPAI). 2007) while H13 and H16 subtypes are isolated almost exclusively from gulls and related birds (Kawaoka et al.. but the virus is excreted in high concentration. i. 2010) including recent incursions of Asian H5 viruses of high pathogenicity into Canada and USA. may cause serious disease. This resulted in separate influenza A virus evolutions in waterfowl in these two hemispheres. The situation with the H5N1 HPAI was even more worsening by virus spill-over from 245 . 2008). Migratory bird flyways can be roughly divided into two groups as a result of geographic ecozones: flyways of the Eastern Hemisphere (Eurasia.. 2008).. Wild ducks are the primary natural reservoir for influenza A viruses in which most of the H subtypes are found (Capua and Alexander. In most cases... which normally do not contract the disease (Alexander and Capua. Separate evolution and ecology of avian influenza viruses in the Eastern and Western Hemisphere is further emphasizes by complete absence of H14 and H15 subtypes in America (Krauss et al.. 2006).First International Symposium of Veterinary Medicine – ISVM2015 Wild birds as natural hosts of influenza A viruses While only few H and N subtypes are found in aberrant hosts.. via fecal material in the water supply (Webster et al. have a very efficient way to transmit viruses. However.

Swine influenza Commonly circulating subtypes in pigs are H1N1. 2007). This virus still circulates among migrating wild birds in Asia. Figure 2. Seasonal migration during 2005 and 2006 resulted in spread of the virus from China to the rest of Asia. pigs have receptors for avian and human influenza viruses. geographical origin and evolutionary features are marked on the right side of the image.First International Symposium of Veterinary Medicine – ISVM2015 domestic poultry into the ecosystem which resulted in migratory waterfowl infection. Nevertheless. Viruses from different host within the respective groups are underlined. The novel reassortant virus occurred in 2014 among poultry and wild birds in South Korea (Lee et al. H1N2. 2014) and afterwards in Japan and China. and H3N2 influenza A viruses which are adapted to this species. Therefore. Europe and Africa. and the tree is midpoint rooted. the pig can be 246 .. Phylogenetic tree from the NS gene of different subtypes of influenza A viruses.. Similar scenario happened with a HPAI virus of H5N8 subtype. This H5N8 virus probably spread by wild birds further into Europe and North America and consequently infected the local poultry. Europe and Africa (Salzberg et al. The tree was made using Maximum Composite Likelihood and Neighbour Joining algorithm with 1000 repetitions. which is a reassortant of H5N1 and therefore also poultry origin influenza virus. Thirty-three isolates from the most important host of influenza A virus with different geographic origin in the period from 1956 to 2011 were compared. Groups of viruses with respect to the host. So far there is no evidence of infection of mammals including humans with this virus. if the waterfowl is considered a natural host of influenza A viruses.

In addition to this.. viruses of H3N2 subtype create a very complex epizootiological situation in pigs (Figure 2) including “human-like” and “avian-like” H3N2 variants. Swine influenza is generally mild and short-lasting illness manifested similarly to a mild clinical picture of human influenza. More important is the role of pig as an intermediate host for avian and human influenza viruses (Figure 1). 2005) related racing greyhounds with infected horses at hippodromes in Florida.. like H2N1. Beside these two H1N1 viruses.. Occasionally.. 2010). As influenza in other species. There is also a report on equine influenza with neurological signs due to viral-type non-suppurative encephalitis (Daly et al. Another subtype formerly known as “equi-2” or “Miami type” emerged in early 1960s in equine population in North America (Waddell et al. 2008)..First International Symposium of Veterinary Medicine – ISVM2015 considered as a universal host of this virus (Figure 1). Similarly to interspecies transmission of equine influenza virus in Florida. genetic makeup and antigenic reactivity. Matrosovich et al. but infection of dogs in 2004 with influenza A virus of H3N8 subtype genetically closely related to contemporary strains of equine influenza virus (Crawford et al. This subtype in equine population is now likely extinct. 2011) yet vaccinated infected horses can still shed the virus. 1970). formerly known as “equi-1” or “Prague type”.e. The North American and Eurasian swine H1N1 viruses. In fully susceptible animals. Therefore. true avian and even equine influenza viruses could be found in pigs. avian origin swine adapted H1N1 virus prevails in the pig populations in Europe and Asia which is also referred as “avian-like” H1N1 (Figure 2). 247 .. clinical signs include pyrexia and a harsh dry cough followed by a mucopurulent nasal discharge (Gerber. Influenza in horses and other equids Equine influenza is a common acute respiratory disease of horses. birds. 1958) during the epizootic equine influenza of H7N7 subtype. great difference between these two equine influenza subtypes (Figure 2) implicates two long-term separate evolutions with no reassortment events between these two subtypes as well as with other influenza A viruses. Simultaneous infection of pigs with two or more different influenza viruses may result in reassortment of the gene segments between viruses of different origin. 2006). equine epizootics highly suggestive of influenza were documented repeatedly.. Before the virologic era.. Other subtypes. human H1N1 viruses (both seasonal and pandemic) can be found in pigs which is usually result of a direct transmission from humans. 1963). In contrast. This can result in a new progeny virus with genetic makeup of both (or all) parental viruses. This H3N8 subtype still circulates in equine populations worldwide and it is currently present in Croatia (unpublished). Swine H1N2 viruses are various reassortants from mentioned H1N1 and H3N2 viruses.. Vaccination provides protection against clinical disease given that the appropriate vaccinal strain is used (Daly et al. 2000). cohabitation of horses and camels in Mongolia resulted in isolation of equine influenza virus (H3N8) from one healthy Bactrian camel out of 460 tested (Yondon et al. and differ significantly from H3N8 and H7N7 viruses isolated from other hosts i. Hence the same subtype of swine influenza virus can be of a different origin. The virus was later found in nongreyhound dogs indicating horizontal dogto-dog transmission (Payungporn et al. but the virus was first isolated in 1956 (Sovinova et al. equine influenza spreads rapidly in a susceptible population. beginning in 13th century (Morens and Taubenberger. H2N3 and H3N1 were also found in pigs. donkeys and mules with symptoms resembling human influenza. The new progeny virus may have possibility to cross host species barrier and even to cause pandemic (Ito et al.. 2009). although of the same subtype. can be easily distinguished by serology. 2014). 2000. but they usually did not establish in this species and soon disappear from the swine populations (Brown et al. horses were considered as a dead-end host. Similarly to H1N1 subtype. Swine influenza virus of H1N1 subtype which is swine entity and evolutionarily has a common origin with the Spanish flu virus prevails in the North American pig population. Both subtypes are at the antigenic and genetic level specific for horses (or equids in general).

Primates are sensitive to human influenza virus. 4..E.A.C. Cardwell J. 45–50.... 1. Slomka M.. Johnson. Smith. Dubovi. 1974 4. 2000 5. Brown I. R.M. Berendt R. Brown I..R. 231–235. mostly from birds to mammals.. Daly J.. 1986). 513-532. Infection and Immunity. Capua I. 2012). 134. 2/3. but it is not known whether the infection stranding was related (Hinshaw et al..: Investigation of equine influenza cases exhibiting neurological disease: co-incidence or association? Journal of Comparative Pathology.: Characterization of a novel influenza A virus hemagglutinin subtype (H16) obtained from black-headed gulls. It remains unknown whether non human primates are infected with influenza viruses in nature (Karlsson et al.: Avian influenza in poultry. Brown I. N. 189.J. Transmission of the H5N1 virus from mammal to mammal was not yet indisputably documented. 79.. malaise.C. Whitwell K. Medina. Shell W. 5.. J. 2012). Osterhaus A. 1.. Bright. Pompey. Influenza A viruses of H7N7 and H4N5 subtypes have been isolated from seals (Geraci et al.. 19-38. water related mammals. 29-46. Alexander D.P. Olsen. P. Rimmelzwaan G. 101-105. P... Essen S.. Manvell R.. 2011 9. C. but such infections are restricted and the virus is not maintained in the new species for a longer period (Webster et al.. macaques infected with influenza virus exhibit fever. Olsen B... Smith K. 1/2.. 2008 3.. 64..J. 7-14.. Like humans.. Banks J. Such findings indicate a relatively frequent transmission of influenza A virus among different species. 2011).A.J.. Veterinary Microbiology. Wallensten A. Bestebroer T.M.. M..J. References 1. Daly J. C. 1985) caused severe and fatal disease in the these species. World's Poultry Science Journal. Dowd G.. 1982) and the virus of H10N4 from minks (Klingebron et al.M. Elton D.M. Munster V. Journal of Virology.e.: Transmission of equine influenza virus to dogs. Hill.. 2007. 9. I. Non human primates that have contact with humans can be naturally infected with seasonal endemic human influenza viruses and with emerging pandemic-risk avian influenza viruses (Karlsson et al. Alexander D. R.M.: Recent epidemiology and ecology of influenza A viruses in avian species in Europe and the Middle East... Wattrang E. Science. 74... Alexander D. Like other human respiratory viruses.. MacRae S. and nonproductive cough (Berendt. W.L. Herfst S. These viruses were phylogenetically closely related to avian influenza A viruses.: Avian influenza infections in birds – a moving target. Cox.D. Influenza and Other Respiratory Viruses. E...: Equine influenza: a review of an unpredictable virus. 1. Miller J. Londt B.H. 5747.I. Revue scientifique et technique... Veterinary Journal. 2005 8.M. Crawford. human influenza virus has repeatedly caused outbreaks of flu-like disease with high morbidity and even deaths amongst chimpanzees and gorillas (Ryan et al. A. 1. 1974).. 2006 6. 2005 248 .F. Capua I... nasal discharge. Developments in biological.. 2007 7. influenza A viruses have been sporadically isolated from other species such as whales. J. 11-18.: The epidemiology and evolution of influenza viruses in pigs. Fouchier R. Newton J. C. 2006 10. Gibbs. Alexander D.W...J. Donis. 2009 2.First International Symposium of Veterinary Medicine – ISVM2015 Influenza A in other animals Besides already mentioned mammals.M.: History of highly pathogenic avian influenza.F. Smith D. 1. 124. Castleman.C.H. R.H.: Simian model for the evaluation of immunity to influenza. Stephenson. 2814-2822.. A range of carnivorous mammals that were infected with the Asian H5N1 HPAI virus was fed by infected poultry or wild birds.. Isolation of H13 subtype from stranded whales can be associated with direct transmission of the virus from seagulls.. 28. Ferro. E. L.J. 1992).C.. seals and minks i. 482485..J..O. Katz. 310.J. Klimov. Chen.

CouacyHymann E. 1985 19. 1672-1675.. 2008 26.. Ip H. Kingsford C...: An avian influenza A virus killing a mammalian species-the mink.G. 349-360.... Ruhnke H.K. Salzberg S.. Chen L.. De Mia G. 63–80. Karlsson E... Journal of Experimental Medicine.. Bean W.. 1-9.K.. 6. Schooley R. 74.A. Osmani A..J. Aly M. 6.. San S. Gilbert M.H.. Karger. 655-656.... Morens D.K.. 1986 15.: Characterization of two influenza A viruses from a pilot whale.: Consequences of non-intervention for infectious disease in African great apes. 1129-1131. Katz J. Pak A.E. Kang H. Ito T. Gill R. sequelae and epidemiology of equine influenza. Grant R. Heidrich J. 1970. 555-559. Pryor S.G. 10.: Finding the real case-fatality rate of H5N1 avian influenza. Early G.P.A. 4. Yingst S. Zorman-Rojs O. Madoff S..J. Kawaoka Y.E.. 347-351. Englund L.. Krauss S. Pompey J..W.. Kwon Y.S. Martin V.: Anatidae migration in the western Palearctic and spread of highly pathogenic avian influenza H5N1 virus. Rompis A. Fiorelli P.. Shaw E... Pearce J. 5...A. 713-718.K. Verlag der Zeitschrift für Naturforschung.. Dung do H.First International Symposium of Veterinary Medicine – ISVM2015 11.L.M. 1684-1693.M.: Swine influenza: III. or behold a pale horse..: Influenza in migratory birds and evidence of limited intercontinental virus exchange. Mahy B.: Host-range barrier of influenza A viruses. failing fowl. 18. In: Equine Infectious Diseases II. 6. 3.. South Korea.J. Schillaci M. 4536. Juntti N.. Chambers T. 2008 22. Gerber H..: Structure and function of the influenza virus genome. Ghedin E. Franks J. 2000 16.. Gerber H..M..M..A. Schultz-Cherry S. St Aubin D.C. Lee Y. Florida.O... Genome analysis linking recent European and African influenza (H5N1) viruses. Saad M.. Padalino I. Geraci J. Emerging Infectious Diseases. Webster R. 1/2. Obenauer J. Slingenbergh J. 2011 28. Guercio A. 11.. and sick swine. PLoS Pathogens. 12. Payungporn S. Crawford P.L. Webby R. 62. Ryan S. Maken Ali A. 6.. 71-75. 247-250. Vergleichende sero-immunologische Untersuchungen uber die Viren der Influenza und der klassischen Geflugelpest. 2007 20..P. Cattoli G.J.. 1.H.. Emerging Infectious Diseases. Biochemical Journal. Journal of Epidemiology & Community Health.J.. eds.S.D. Ramey A. 1087–1089.. Taubenberger J.S.. Virus Research.M. P...W.. 2006 14. Capua I... 203-217. 1.A.. Sengamalay N. McCauley J.J. 2014. Kawaoka Y. Basel: S. Matrosovich M...C. Rockborn G. Donis R.. 2008. 1983 24.J.. 1988 18. Bryans J..C... Webster RG. Jr. 2.. Sladen W. 1/2.T..: Influenza virus infection in nonhuman primates. 54. 215. Oh G.M.. Journal of Virology. PLoS One.. Obert C. 211. Hinshaw V. 2012 17. Stech J. polymerase and host range. Sly T. 58.: Is the gene pool of influenza viruses in shorebirds and gulls different from that in wild ducks? Virology. 1982 12. Barker I.: Mass mortality of harbor seals: pneumonia associated with influenza A virus. 11. Joannis T. 1931 249 .: Clinical features.M. 81-91..D. 2009 23.M. Geraci J.S. Lee E.S.J. Klingeborn B....M. Spiro D. Archives of Virology. Song B. 902-908.. Zaborsky J. 1955 30. Castleman W.. Walker D. Jones-Engel L. Webster R. Veterinary Microbiology. Jeong J.A.T. 2010 27. Historical thoughts on influenza viral ecosystems. 327-337. Kouo T.. 63. Klenk H. Lee B. 148.. 14.. 20. Widjaja L... Savić V..... 2007 29.D. Lubroth J. Prescott J. Niles L. Science.. Feeroz M. Rott R.G..: Influenza receptors... 86..: Influenza A virus (H3N8) in dogs with respiratory disease. Webster R. Baker A. Emerging Infectious Diseases.. Naeve C....(2010) Limited evidence of trans-hemispheric movement of avian influenza viruses among contemporary North American shorebird isolates. Emerging Infectious Diseases.. 13. dead dogs.L. 28.. Bean W. Shope R..C. Dubovi E.. Brown I. 13..W. Schäfer W. Influenza and Other Respiratory Viruses. 10b.M.W. 6. 44-50.. 3/4.R. Engel G. Seiler P. Domenech J. Early G. Xiao X. Choi B. 2014 21.S. 1650-1656. Janies D. Walsh. 3. Hinshaw V. 2010 25.. Emerging Infectious Diseases.. Filtration experiments and etiology. 281–294..: Novel reassortant influenza A(H5N8) viruses.S.L.M. Li F. Revue scientifique et technique.. Jones K. 12.

..M. 9. Veterinary Microbiology. Acta Virologica.. Wentworth D. Intestinal influenza: replication and characterization of influenza viruses in ducks. 22. Yondon M... Nelson M.P..M. Rehg J..: Isolation of a virus causing respiratory disease in horses. Hinshaw VS. Andrewes C. Nemec J. 1/2. Gorman O. Yakhno M.C. 1.: A virus obtained from influenza patients..L.B. 12. 4892-4901.. 2014.G. Zayat B..A..H. Virology. Shi Y.. Heil G. Gray G. Mongolia.J. Laidlaw P.: Reemerging H5N1 influenza viruses in Hong Kong in 2002 are highly pathogenic to ducks. 15-27. Chambers T. Trends in Microbiology.: A new influenza virus associated with equine respiratory disease. Sturm-Ramirez K. Anderson B. Lin X. 52-61. Smith W.T. Journal of Virology.. 268-78. Bissett L.D. 152-179. 1933 32.H... 56. Pouska F. 1958 33.. Suarez D.I. Webster RG.: Equine influenza A(H3N8) virus isolated from Bactrian camel. 74.. 2000 35.. Murti KG. Bousfield B. Journal of the American Veterinary Medical Association... White S.. Dyrting K.E.. 2014 250 . 587–590.P.: Evolution and ecology of influenza A viruses.. McKenzie P. Ellis T.M. Sigel M. 5732. Tumova B.K. 2004 34. 183-191. Gao G. 2144-2147.L.. Halpin R... Wu Y. Kawaoka Y. Microbiological Reviews.: Evolution of avian influenza viruses. Wu Y.. 4.. 2. 2. 84.First International Symposium of Veterinary Medicine – ISVM2015 31. Webster R. Lancet. Emerging Infectious Diseases. 1963 36.E. 2. 78. Bean WJ. 6668. 39. Waddell G. Bat-derived influenza-like viruses H17N10 and H18N11. 1. Tefsen B. Teigland M. 1978 38. 143. 1992 37. Bean W..F.. Sovinova O.

Moreover. a steady increase has been observed in Hungary between 2004 and 2007. The frequencies of the viruses in different countries varied significantly.) became into the scope of the veterinary interest in the last two decades due to their pathogenic role and the increasing importance of the host species. Chronic bee paralysis virus. Vienna. predominantly reverse-transcription polymerase chain reaction (RT-PCR) assays are used to detect viral RNA in honeybee samples. winter losses of honeybees seemed to be increasing everywhere. might be activated by predisposing. Since bees are highly adaptable insects. László Békési5. Budapest. which is a vector of several honeybee viruses. Hungary 6 College of Medicine and Health Sciences. The conventional diagnostic methods have limited value in the case of bee virus infections and diseases. Miklós Rusvai1. Petra Forgách1. Phylogenetic comparisons revealed closer genetic relationships between bee viruses collected in the Carpathian basin. Oman * Corresponding author: Bakonyi.First International Symposium of Veterinary Medicine – ISVM2015 Invited lecture VIRUS INFECTIONS OF THE HONEYBEE (APIS MELLIFERA L. University of Zagreb.Tamas@aotk. they are able to 251 . Zagreb. the domestic and international trade of bees and bee products may also contribute to the aggravation of virus-associated problems in beekeeping in the region. Slovenia 4 Faculty of Veterinary Medicine. RT-PCR Introduction Approximately 25. Our research groups are investigating honeybee virus infections in central-European countries since 1997. intoxications and environmental pollution may also act as an activator of viral infections. Croatia 5 Institute of Apiculture and Bee Biology.2*. Ivana Tlak Gajger4. and Sacbrood virus in Hungary. Nosema apis). Research Centre for Farm Animal Gene Conservation. Aleš Gregorc3. Gödöllő. Norbert Nowotny2.and weakening factors. Besides increasing bee colony density and problems with varroa-control. Many of them can be detected in apparently health colonies. The most important predisposing factor is the parasitic mite Varroa destructor. and resulted in decline of managed honeybee population.szie. and viruses were also considered as causative agents.000 species of bees have been identified worldwide. however. Austria. Although the prevalence of bee viruses in central-European countries was lower than those reported in Western Europe.6 1 Faculty of Veterinary Science. Since 2004 extensive losses of honeybee colonies have been observed in North America and Europe. Deformed wing virus. Subclinical infection. Key words: honeybee. The presence of bee viruses has been reported from several countries worldwide.e. and also weakens the pupae and adult bees by its feeding.hu Abstract Viral infections of the honeybee (Apis mellifera L. Muscat. virus infections. Slovenia and Croatia. molecular methods. Szent István University. which lead to depopulation or sudden collapse of the colonies. Ljubljana. Austria 3 Agricultural Institute of Slovenia. Sultan Qaboos University.) IN CENTRAL EUROPE Tamás Bakonyi1. but its aetiology remained unclear. only ten species can be regarded as honeybees. Hungary 2 University of Veterinary Medicine. Varroa destructor. Nevertheless. therefore. The phenomenon was named to Colony Collapse Disorder. The presence of other pathogens. parasites (i. We have been detecting the presence of Acute bee paralysis virus. Black queen cell virus.

however. Honeybee experts in the USA and Europe formed networks to collect more exact data to identify factors that seem to be not only multifactorial. and resulted in decline of managed honeybee population. Israeli acute paralysis virus (IAPV). this virus may play a role in cases of sudden collapse of honeybee colonies infested with the parasitic mite Varroa destructor. 2008). According to the survey the mean losses varied between 7-22 % in 2009 and 7-30 % in 2010 winter.First International Symposium of Veterinary Medicine – ISVM2015 adjust to a wide variety of climates and geographic regions. On one hand. 2010). winter losses were found to be substantially higher in 2010. 1997). In light of the decline of wild insect pollinators the importance of managed beekeeping is greater today than ever. but the total added crops due to pollination services has estimated 14. 1979)..4 % of their colonies in 2011 (van Engelsdorp et al. The two leading producers of honey are China and the European Union (Word Trade Daily. the mite is a possible vector for the virus.) ranges from the tip of southern Africa to southern Scandinavia. Beekeepers in the majority of the countries who reported disappeared colonies experienced higher winter losses compared with beekeepers that experienced winter losses but not reported disappeared colonies. 1999).. The same was noticed in the USA where survey responders had lost an average 38. However. and hence are relevant in beekeeping. wax.000 tonnes (FAO. Studies focusing on infectious agents in the background of CDD identified viruses.. honey. 2013). only a few of them are considered to be able to cause severe diseases in honeybees. The direct value of the produced honey is about 140 million EUR. Deformed wing virus (DWV). In the last decade extensive losses of honeybee colonies have been observed in North America and Europe (Communication from the Commission on honeybee health.. The apiculture provides full or additional family income with a considerable market for bee products used as food.e. Kashmir bee virus (KBV). through Europe to western Asia (Whitfield et al. but the aetiology of the losses remain unclear (Le Conte et al. The phenomenon was named to Colony Collapse Disorder (CCD) with defined signs and was characterized by „disappeared” colonies. Chronic bee paralysis virus (CBPV). 2010.. BQCV causes frequent subclinical infections in adult bees. 2009). 2012) with the analysed information from 12 countries in 2009 and 24 countries in 2010. microsporidia and parasites as most important factors.2 billion EUR in 2005 in the EU (Gallai et al. The European concerted action was designed in 2008 as a COST action FAO803 by the name of „Prevention of honeybee COlony LOSses” (COLOSS). Honeybees are key pollinators native to Europe and have great impact for many agricultural crops and conservation of natural plant diversity... royal jelly and bee venom) have been used since the prehistoric times for consumption and for therapeutic purposes. and from Americas. 2012). Although more than 20 different viruses were detected from bees. The habitat of the western honeybee or European honeybee (Apis mellifera L. Beekeeping is deeply rooted in human society. The most important beeviruses in Europe are Acute bee paralysis virus (ABPV). Infected queen pupae 252 . which were not typically found later in many parts of the world. The first results were published recently (van der Zee et al. Neumann and Carreck.500. ABPV is commonly present in apparently healthy bees. 2010). The Working Group 1 (WG1) of the COLOSS epidemiological unit developed a detailed selfadministrated questionnaire to collect exact data on losses. 2010. however it affects clinically prepupae or pupae of the queen especially in spring and early summer (Laidlaw. An important finding was that for all countries which participated in 2009. Bee products (i. Black queen cell virus (BQCV). and Sacbrood virus (SBV). pharmaceutics and medical products. also ABPV gained more and more importance (Ball. propolis. on the other hand it weakens the bees and activates viral infections (Nordstom et al. Moritz et al. winter losses of honeybees seemed to be increasing everywhere. In 2012 the total world honey production exceeded 1. 2012). Due to the world-wide spread of the varroa mite in the last decades. but interact with individual situations by countries.

the bees are unable to fly. and causing problems with sectioning of embedded tissues. Siede and Buchler. However. and some of them become inapparently infected adults. As more and 253 . It affects brood and adult bees. IAPV was discovered in Israel. and their specificity – due to virus mixtures used for immunization – might be impaired. 2004. Identification of beeviruses on morphological basis. They often suffer from dysentery and die within a few days. Histopathology is complicated by the presence of chitin. innate immunity. finding virus-free brood for experimental virus isolation is rarely possible. the availability of such sera is limited. Adult bees usually die within a few days after infection. II. and the cell walls get black. Virus isolation based on serial passages of viruses in cell cultures is not applicable due to the lack of beespecific and beevirus-susceptible cell cultures. and pupae infected at the white-eyed stage of development may have malformed wings and shortened life span. 1996. laborious and time consuming. CBPV infection remains sometimes undetected. Serological methods using virus-specific antibodies. Due to the size of bees. specific anti-viral antibodies and immune memory in bees (Azzami et al. Békési et al. Because bees are colonial animals. The guard bees do not recognize them and dismiss them because of their altered look. Possibilities for observation of clinical signs are often complicated. forming the "sac" for which the disease is named. Viral antigens were detected and characterized with these methods using agar-gel immunodiffusion (AGID) or enzymelinked immunosorbent assay (ELISA) platforms (Bailey.. The only possibility for beevirus isolation is experimental infection of larvae. raised in experimental mammals have been developed in specific laboratories. they are trembling and crawling and the wings are asymmetric outspread. however. but the bees remain apparently healthy. 2012). and because viruses frequently cause inapparent infections in honeybee colonies. the bees look black because of hair loss.. Adult bees carry the virus without apparent signs. 2014). causing poor penetration of tissue fixation substances. however it has been rarely reported in Europe so far (Allen and Ball. IAPV is genetically closely related to ABPV and KBV. 1999). the availability of brood is seasonal. The virological diagnostic methods have limited value in the case of bee viruses. 1999). but larvae may survive following ingestion of the virus. 1996). compared to healthy colonies in the USA. but its presence was also demonstrated in other countries.). Infection of adult bees is possible. pupae or newly emerged bees. The virus propagates slowly. because of similarities in size and virion morphology. KBV is closely related to ABPV and IAPV. and signs of different virus infections may be similar. 1967). Two manifestations of CBPV infection have been noted: I. using electron microscopy is on one hand expensive and time-consuming. Although in some cases up to 30% of worker bees are affected. Because IAPV infections were diagnosed more frequently in CCD-affected honeybee colonies.. 1996). SBV affects primarily the brood of the honeybee and results in larval death (Ritter. due to the lack of adaptive immunity. 2007. Sacbrood appears mainly in spring. on the other hand poorly selective. the role of this virus was hypothesized in the background of CCD (Cox-Foster et al. Nosema apis infestation is a suspected predisposing factor for disease manifestation (Allen and Ball. classical serological methods are not applicable for indirect virusdiagnostic approaches. This technique is. Because the immune system of invertebrates is mainly based on non-specific. Chen et al.. and the colonies usually recover spontaneously from the disease (Bailey.. DWV is mostly detected in varroa-infected bees (Bowen-Walker et al. The advances of developments of molecular diagnostic techniques had a revolutionary effect on honeybee virology diagnostics. 1996). the viruses are able to propagate in them.First International Symposium of Veterinary Medicine – ISVM2015 die and darken. Infected larvae fail to pupate and the ecdysial fluid aggregates around the integument. 1967. when the brood-season begins and large numbers of infected young adults are present (Ritter. Additionally. investigations of individuals are usually less informative. Larvae change in colour from pearly white to pale yellow and after death they dry out and change to a dark brown ship-shaped scab. gross pathology is rarely informative.

Hilden. our studies on certain honeybee viruses in Europe are summarized. 2011) software using maximum parsimony. Germany) according to the manufacturer's instructions. stained with ethidium bromide. and 1 min at 72°C. or altered brood were collected. usually dead bees were collected in the hives or from their surroundings. deformed wings. The reverse transcription at 50°C for 30 min was followed by a denaturation and polymerase activation step at 95°C for 15 min and by 40 cycles of PCR with 30 s at 94°C. 254 . inability of flying).. Multiple alignments for phylogenetic analyses were created with the help of the ClustalX program (Thompson et al.6 beta version (Felsenstein.. Samples were stored and transported at 4ºC. Bee samples usually contained at least 50 individuals from each colony. In this paper. and if they were infested with V. The PCR products were electrophoresed in a 1. 2004). Bootstrap analyses were performed on 1000 replicates. and – if it was available – 10 × 10 cm covered brood was also collected.e. Virus-specific primers are listed in Table 1. After centrifugation (~1. Reactions were completed by a final elongation step for 7 min at 72°C.6. Trees were drawn with the help of the TreeView 1. Nucleotide sequences were identified by the Basic Local Alignment Search Tool (BLAST. In the case of diseased colonies (i. sometimes -20ºC storage was applied for longer periods (few weeks) at the beekeepers. software. 2002). and aligned using the Align Plus program (Scientific and Educational Software. colony collapses). Genetic comparisons Selected amplification products were subjected to fluorescence-based direct sequencing (Sanger’s method) in both directions. Sometimes bees with neurological signs (altered behaviour. 1997). sensitive and rapid diagnostic assays were developed on the basis of the polymerase chain reaction (PCR) technology. Hilden. mites were collected from the samples. Approximately 25 to 50 bees were pooled from the same colonies and were crashed in ceramic mortars using sterile quartz sand.0 beta 10 version (Swofford. changed colour. version 4. and Mega 5 (Tamura et al. Viral RNA was reverse-transcribed and amplified in continuous reverse transcription PCR (RT-PCR) method by using the One Step RT-PCR kit (Qiagen. specific. 50 s at 55°C. For the surveillance studies usually healthy bees were collected from the hives. however.2% TAE-agarose gel. Materials and Methods Sample collection The collection methodology was depending on the aim of the investigations.First International Symposium of Veterinary Medicine – ISVM2015 more beeviruses were genetically characterized. and were homogenised in 10 × volume phosphate buffered saline (PBS). destructor. winter losses. distance (neighbor-joining) and maximum likelihood criteria. Phylogenetic analyses were conducted by the PAUP*4. crawling. Germany) following the manufacturer's recommendations. 10 minutes) viral RNA were extracted from the supernatants using the QIAamp viral RNA Mini Kit (Qiagen. Fragment sizes were determined with reference to molecular size markers. and were photographed under UV light.500 ×g. These techniques are widely used in the last decade for the diagnosis. Sample processing Bees were observed at the laboratory. PHYLIP package 3. 2).6.1). surveillance and molecular epizootiology of virus infections in honeybees.

but were not found in any of the investigated samples. Hungary and Croatia. NT= not tested **Newly mated queens were investigated BQCV CBPV DWV IAPV KBV SBV 30% 9% 91% 0% 0% 49% 54% 0% 72% NT 0% 2% 40% 0% 24% 29% 6% NT NT 10% 49% 7% 58% 95% 0% NT NT 0% 0% NT NT 0% 61% 1% 11% 40% 255 . f: forward primer. Four honeybee viruses. Slovenia and Croatia (Berényi et al. Forgách et al. Gregorc and Bakonyi. Primer name ABPV 23fa ABPV 24ra BQCV 3fb BQCV 4rb CBPV 111fc CBPV 426rc DWV 2345fd DWV 2779rd IAPV 3042fe IAPV 3799re KBV 5406ff KBV 5800rf SBV 1fg SBV 2rg Primer sequence (5´to 3´) Primer position on the genome GTGCTATCTTGGAATACTAC AAGGYTTAGGTTCTACTACT AGTAGTTGCGATGTACTTCC CTTAGTCTTACTCGCCACTT TGTCGAACTGAGGATCTTAC GACCTGATTAACGACGTTAG ATTGTGCCAGATTGGACTAC AGATGCAATGGAGGATACAG ATTGAGAGTTGCCAAGGAGT GTCTGTGCTTCGATCACAAT GATGAACGTCGACCTATTGA TGTGGGTTGGCTATGAGTCA ACCAACCGATTCCTCAGTAG CCTTGGAACTCTGCTGTGTA 7928-7947 8527-8546 252-277 710-729 111-130 407-426 2345-2364 2760-2997 3042-3061 3780-3799 5406-5425 5781-5800 221-240 689-708 Length of the amplified product (bp) 618 472 315 434 758 395 487 Nucleotide positions refer to the published sequences of aABPV (GenBank accession number AF150629). Table 2: Occurrence of honeybee viruses in four central European countries Country n* year ABPV 2003Austria 131 68°% 2004 199952 37% Hungary 2004 72 2007 71% 81 2006 12% Slovenia** 72 2008 10% Croatia 82 2010 11% *n= number of samples. Hungary.. eIAPV (accession number EF219380). BQCV. DWV and SBV were detected in all four countries. r: reverse primer Results Occurrence of honeybee viruses in Central European countries Between 1999 and 2010 we have been investigating the occurrence of the most important honeybee viruses in four central European countries: Austria. The detection frequencies are summarised in Table 2. 2008. Tlak Gajer et al. dDWV (accession number AJ489744).. The presence of KBV and IAPV were tested in Austria. Hungary and Croatia. cCBPV (accession number AF375659). bBQCV (accession number AF125252). 2012. 2014). The occurrence of CBPV was tested and detected in Austria. fKBV (accession number AY275710) and gSBV (accession number AF092924).First International Symposium of Veterinary Medicine – ISVM2015 Table 1: Oligonucleotide primer pairs used in RT-PCR assays. ABPV. 2006.

This finding indicates genetic recombination between the viruses (Tapaszti et al. while Austrian and further Polish viruses clustered together (Bakonyi et al.. and Sacbrood virus – SBV) in four central European countries (Berényi et al. Hungary and Poland revealed that the central European viruses are genetically distinct from ABPVs detected in the USA. but were distinct from other three genetic lineages containing CBPVs from France. Also. however were genetically distinct from Varroa destructor virus 1 (Berényi et al. In the case of BQCV. 2006. This can lead to outbreaks of disease and induce significant losses. and French viruses. Belgium and Uruguay (Blanchard et al.. 2002). this inevitably causes vital organs to dysfunction (Békési et al. Despite the great diversity of collection origin. Discussion Our studies described the presence of five different honeybee viruses (Acute bee paralysis virus – ABPV. Usually. The phylogenetic relationship of one Austrian SBV was investigated. and the United Arab Emirates were investigated. This means that clinical signs appear only when virus replication is initiated and infection becomes systemic. Canada. while some BQCVs from Poland formed a separate group. Other predisposing factors include.. India. the control of honeybee virus infections must be based on optimal keeping and breeding conditions (avoiding the above-mentioned predisposing factors) with a particular attention to varroa-control. however clustered differently depending on the investigated genome region. cold weather. Germany. 1988). New Zealand. Black queen cell virus – BQCV.. 2005) and viruses may directly spread through the lesions induced by the mite (Ball. Hungary. It was found closely related to SBVs from Germany. Swiss. 1999). Slovenia. With the spread of Varroa destructor almost worldwide. Hungarian Austrian and Polish viruses formed common groups. and parasites. Spain. When cells of honeybees are infected with virus particles.. Therefore. 2009).. Tlak Gajer et al. Deformed wing virus – DWV.. the sequences has shown high level of genetic conservation. 2008. Sri Lanka. The DWVs. the possibility for specific treatment or prevention for certain honeybee virus infections (IAPV and DWV) were reported by using RNA silencing technologies 256 . but more distantly related to SBVs from the United Kingdom.. Infestation with the parasitic mite Varroa destructor is a major predisposing factor which has a weakening effect on the honeybee (Yang and Cox Foster. fungi. This has led to use of the term “bee parasitic mite syndrome” (Hung et al. Nepal and South Africa (Grabensteiner et al. 2001).. DWV (Tentcheva et al. Phylogenetic analysis of CBPVs revealed that Austrian. The genetic relationships between DWVs collected in Austria. closely related to Polish ABPVs. 2004) as well as KBV (Chen et al. 2007).. 1996). 2004). dysentery. Some Polish BQCVs. overcrowding and further infectious agents such as bacteria. The investigations revealed that the infection rate of the Hungarian honeybee colonies have been increasing within the last years (Tapaszti et al.. attention has been focused on viruses of bees because of the role of the mite in transmission of a number of these infections and their connection with colony mortality (Ball and Allen. Additionally. 1989). 2009). 1999). environmental pollution. in the United Kingdom and in South Africa. Hungarian ABPVs formed a monophyletic group. Gregorc and Bakonyi. Poland.. for example nosema infestation. intoxications.First International Symposium of Veterinary Medicine – ISVM2015 Genetic relationships between central European honeybee viruses Our phylogenetic studies with ABPVs from Austria. Simultaneous infections with different virus species in colony level have been frequently diagnosed. Japan (“Kakugo virus”). Forgách et al. 2014).. Hungarian and Polish viruses formed a common genetic lineage with German. therefore phylogenetic analysis could not reveal statistically supported clustering of the sequences. 2012. 2010). it has been experimentally proven that these mites carry ABPV (Békési et al. honeybee virus infections are not apparent as they remain in a latent state within individuals and spread among bee populations at a low level. the South African reference sequence was genetically distant from the central European viruses. Nepal. Chronic bee paralysis virus – CBPV. they cannot work efficiently.

Zhang X.. 12. 7. 60. Bakonyi T. 72. Biol. Kramer M. 7.. 3.Z.. Cavallaro. Bee World. Teixeira E.. 3605-3611. 144.. 1996 Azzami K. Chen et al.S. 113. EUR 11932 EN..: The incidence and world distribution of honey bee viruses. Lipkin W.D. Köglberger H.. Udine. References 1. 5. Bakonyi T..eu/food/animal/liveanimals/bees/docs/honeybee_health_communication_en..L. Apidologie.Q.. Pechhacker H.. 2002 Ball B. Evans J. Schurr F. The results of our studies indicate that movement and importation of non-apparent infected stocks of bees may introduce viruses into areas where they are not endemic. Appl Environ Microbiol. pathogenesis and implications for honey bee health.... Li Z.: The transmission of deformed wing virus between honeybees (Apis mellifera L.J. 689-702. 1999 Chen Y. Tautz J. Ball B.: The prevalence of pathogens in honey bee (Apis mellifera) colonies infested with the parasitic mite Varroa jacobsoni. Apidologie.First International Symposium of Veterinary Medicine – ISVM2015 (Maori et al.. Kryger P... 63-74. active immunisations (vaccinations) are not applicable for the prevention of bee colonies from virus infection or from the development of virusassociated disease manifestations. In: P.. Boncristiani H. 334-338. Berthoud H. 73... It is therefore important to identify bee virus infections and take this aspect into consideration in domestic and international transport and trade of honeybees and bee products. Ann. Allen M. :e1004261. Invert. Olivier V. Appl... Drummond F.V. Varroa destructor.L. Ritter W. 4.. Kramer M. 2007 Blanchard P. ed. 1-2..V.L. 1989. Dobos-Kovács M.europa. Ritter W.P. Li C. 6. Martin S. Wu L.Y.: Israeli acute paralysis virus: epidemiology.... 2012... Munn and R. 11.. 14.V. (2010): http://ec.. 2012 Bailey L. Pettis J. Because the dominance of innate immunity and lack of immune memory in bees. 2014). Bakonyi T... Allen M. Rusvai M.. Zhou J.. Biol.: Varroa jacobsoni as a virus vector. 47.. 73. 15.F. 237-244. 157.: Infection of honey bees with acute bee paralysis virus does not trigger humoral or cellular immune responses... In: Proceedings of a Meeting of the EC. Solter L.D.K. Bakonyi T. Antùnez K. Beier H. ed. Chen W. Feldlaufer M. Huang S. Szendroi A. 141162.. J. Appl.. 9.: Molecular evidence for transmission of Kashmir bee virus in honey bee colonies by ectoparasitic mite..pdf 257 .. Pathol. 10.S.P. Topolska G. Ribière M.. 8. van Engelsdorp D.V.: The incidence of virus diseases in the honey bee.W.F. Zhao Y. 2009 Bowen-Walker P. Ball B.. Rusvai M.F. Köglberger H. 2009.J.K... Cardiff: International Bee Research Association. 441448. 1997. 77.. Ball B. 35.. Koeglberger H.. 241-244. Thiéry R.. Smith B.. 4. Zhou A. R. Delaplane K... Spivak M. Derakhshifar I. 43-48. DeGrandi-Hoffman G. 101-106. Desai et al.: Varroa and viruses. Palacios G.. PLoS Pathog.. Arch Virol. Li J....G. Nowotny N. 2414-2420.. 1988 Ball B.C.... 13. Microbiol. 4. Higes M. Dobos-Kovacs M. 10.I. Derakhshifar I. Visscher P. vol.. 2004 Communication from the Commission on honeybee health. Pettis J... 2014 Chen Y.. Celle O.: Phylogenetic analysis of deformed wing virus genotypes from diverse geographic origins indicates recent global distribution of the virus. 2006 Berényi O. Acta Vet.: Occurrence of acute paralysis virus of the honeybee (Apis mellifera) in a Hungarian apiary infested with the parasitic mite Varroa jacobsoni. Lee M. 2.. 1967 Bakonyi T. Békési L. Varroa! Fight the mite. Brussels. 33.. Nowotny N. 11-15. Gunn A....) by the ectoparasitic mite Varroa jacobsoni Oud. Hung. Corona M. Virus Res.Experts Group..: Detection of acute bee paralysis virus by RT-PCR in honey bee and Varroa destructor field samples: screening of representative Hungarian apiaries. 319-324. 11.. Appl. Environ. Ann. Hamilton M.. Evans J.... Farkas R.. Kasprzak S. 1999 Berényi O.. Commission of the European Communities. Zheng H.: Occurrence of six honeybee viruses in diseased Austrian apiaries.: Phylogenetic analysis of the RNAdependent RNA polymerase (RdRp) and a predicted structural protein (pSP) of the Chronic bee paralysis virus (CBPV) isolated from various geographic regions.P. Jones.. Haubruge E. Belgium...

F.L. Nordstom S. Briese T. Bakonyi T.: Prevalence and seasonal variations of six bee viruses in Apis mellifera L.: Research strategies to improve honeybee health in Europe..: IAPV. Gallai N. 1.) by double-stranded RNA ingestion.: Honey bee colony losses. Hui J. Gauthier L.. Zappulla N. Massachusetts. Le Conte Y. Desai S. Buchler R. Acta Vet. Kolodziejek J..: Reduction in deformed wing virus infection in larval and adult honey bees (Apis mellifera L. Tsur E..K. 810-821. Biol. Kovágó C. 5848.. Vaissière B. Derakshifar I..: First detection of Kashmir bee virus in Hesse.. Nei M. Maori E.. Hamilton... 27.. Insect Mol Biol. Wochenschr.. 93-104.L. Lipkin W.. Moosbeckhofer R. Sunderland. Carter M. Currie R.. Palacios G. Gustav Fischer Verlag Jena. Hansen H. Peterson N. 2009 37...: A mézelő méh (Apis mellifera L. 132. low or severe Varroa jacobsoni infestations. Ecological Economics. Knox D.: Genetic analysis and phylogenetic comparison of Black queen cell virus genotypes. 136. Neumann P. 2731-2739. Stuttgart.. 2009. 227-234. Le Conte Y.: Contemporary Queen Rearing. Immunol.. Appl.. Settele J. 1-6. Department of Genome Sciences University of Washington Box 357730 Seattle.. Gregorc A. Grabensteiner E.J.: Varroa mites and honey bee health: can Varroa explane part of the colony losses? Apidology. Nowotny N. 29.. a bee-affecting virus associated with Colony Collapse Disorder can be silenced by dsRNA ingestion.D. Shimanuki H. Dadant and Sons... Tapaszti Z..J. 49....: The role of viruses in bee parasitic mite syndrome.L... Conlan S. 104-114. Bee. Simons J.. Kalev H. Moran N.L.aspx?PageID=569#ancor 19. Whyard S. 446455. J. 3-4. Topolska G. 81. Fries I.: Prevalence of pathogenic bee viruses in Hungarian apiaries: situation before joining the European Union.: PAUP*.: A metagenomic survey of microbes in honey bee colony collapse disorder.. Evans J. Sela I. Drysdale A. Boecking O.: Diagnostik und Bekämpfung von Bienenkrankheiten. Version 3.D... 2008 21. 2012 18. 12-15.E. 139. Zhai J. Forgách P.L. Kalkstein A. Davison S.A. Insect Mol Biol.... Magyar Állatorvosok Lapja. 22. Tapaszti Z. 1979 26.C. Quan P.First International Symposium of Veterinary Medicine – ISVM2015 16. 18.S. Moritz R. Aarhus A... Tierarztl..E. 2004 20.: Viral infections in queen bees (Apis mellifera carnica) from rearing apiaries.: Economic valuation of the vulnerability of world agriculture confronted with pollinator decline. 15-19.. Apidologie.fao. Bakonyi T. Phylogenetic Analysis Using Parsimony (*and Other Methods). 21. 1996 25.. Swofford D. 283-287.. Version 4. 2011 35.. 55-60.. 2010. Cousserans F. Nowotny N. 2004 33. 98. Paxton R.org/site/569/DesktopDefault.. Berl... 4. Evol. Neumann P.. Illinois. Paldi N.. Mol. Munch.) vírusos fertőzéseinek előfordulása magyarországi méhészetekben.. Apidologie. Holmes E.: MEGA5: Molecular evolutionary genetics analysis using Maximum Likelihood.. 2010 36. Kumar S. Ritter W. Bergoin M. 2002 34. Bakonyi T. FAO 2013: http://faostat.. 475-484.. Licek E. 30.. and Varroa destructor mite populations in France.A. 119-125..A. 353-363. Eu Y. Glick E. Microbiol. Peterson D. 318. Brno. Pettis J. Cui L. 8. 70.. Am.. Res. Forgách P....I. 41. 28. Rusvai M. WA 98195-7730 USA... Tentcheva D..: Sacbrood virus of the honeybee (Apis mellifera): rapid identification and phylogenetic analysis using reverse transcription-PCR. 68. Evolutionary Distance. 2009 28. 235-238.M. Fries I..C. 2007 17.. Hung A. 7185-7191. de Miranda J. 1999 31..6b... Tamura K......F.... 2010. Apic.W. 2010.. J Invertebr Pathol.-M. Korpela S... J. Stecher G.: Virus infection in Nordic honey bee colonies with no.. Lab. 227-242. Forgách P. Germany. Ellis M. Dainat B. Geiser D..... Nowotny N... Salles J. 731-732...: PHYLIP Phylogeny Inference Package. and Maximum Parsimony methods. Pechhacker H. 2. Ritter W. Felsenstein J..F. Hornig M. Tapaszti Z. Carreck N. 2004 258 . Hutchison S. Martinson V. Sinauer Associates.. 41. Clin. van Engelsdorp D.J. 2012 24. Envir. Rusvai M. Egholm M. Siede R. Diagn. Ritter W. 2001 23. Colin M. Shafir S. 117. Bakonyi T. Vet Microbiol. 1996.. 32..H. Cox-Foster D. Laidlaw H. Rusvai M. 30. Science.

.. Acad. Rennich K. Spleen A.. 51.. Kristiansen P. J.. 701-706.... 2012. Soroker V... Yang X. Nat.. Kralj J. Sheppard W. 102. Nguyen B. Res.. for the winters of 2008-9 and 2009-10. 2012: http://worldtradedaily. 44. Özk r m A.H. Santrac V.G. Nowotny N. Suarez A.: Impact of an ecto parasite on the immunity and pathology of an invertebrate: evidence for host immunesuppression and viral amplification. Topolska G... 2012. Ramsay G.. Wilkes J. Mutinelli F.F. Johnston J.. Tsutsui N.. Brodschneider R.. van Engelsdorp D. Crailsheim K. Pettis J.. Whitfield C.. Andonov. 2005 259 . Pisa L. Weaver D. Clark A. Wei S. Lee K. Wilson M. Henson M.R.. Vejsnæs F... Higes M.. Kauko L.. S. Gajda A. Kezic N. Smith D.W.....L.. Proc. 642-645. 1997 39. Word Trade Daily. 42.. 51. Israel and Turkey. Hayes J. Coffey M. Berlocher S.... Selwyn Wilkins S. 6. 2014 40. Res.First International Symposium of Veterinary Medicine – ISVM2015 38.K.. Peterson M. Apic. Kiprijanovska H. the Bee Informed Partnership: A national survey of managed honey bee 2010-11 winter losses in the USA: results from the Bee Informed Partnership..M. 74707475. Uzunov A.. Jeanmougin F.. F Pernal S. Martin Hernandez R. Plewniak F.F. Andree M... van der Zee R. Gibson T. Behura S... Apis mellifera.. Dahle B. 115-124..S.: Prevalence and distribution patterns of seven different honeybee viruses in diseased colonies: a case study from Croatia.com/2012/07/28/honey-world-production-topexporters-top-importers-and-untied-states-imports-by-country/). Thompson J.D. J. Kence M. China. 45... Tlak Gajger I. Gray A.. Otten C. Kolodziejek J. USA. 1. Kence A.. Chlebo R. Charrière J-D. 314.. 5799. Bakonyi T.. Higgins D. 41.. Sci.. Underwood R.... Caron D.V. Lengerich E. Europe. Science.G. 1. Apic. 100-114. 25. Cox-Foster D.: The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools... 2006 43. Snyder R.J. Drazic M.: Thrice out of Africa: ancient and recent expansions of the honey bee.K.. Nucleic Acids Res..D..S.. 4876-4882... Roccasecca K....: Managed honey bee colony losses in Canada. Apidologie.

Vojvodina Province Introduction Wild boar (Sus scrofa scrofa) numbers have dramatically increased over the past 60 years and the species also shows a more widespread distribution (Artois et al. Wu et al. one National park Fruška gora. The material for this research included enclosed hunting grounds. According to available data of the Veterinary directorate of the Ministry of Agriculture and Environmental protection. but its density varies from country to country (Laddomada. Tamaš Petrović1 1 Scientific veterinary Institute “Novi Sad”. Prodanov-Radulović et al.First International Symposium of Veterinary Medicine – ISVM2015 Invited lecture THE MOST COMMON HEALTH DISTURBANCES DETECTED IN WILD BOARS IN ENCLOSED HUNTING GROUNDS IN VOJVODINA PROVINCE Jasna Prodanov-Radulović1*..ns. Laaksonene and Paulsen. 2011). 2011). 2008.. Increasing food availability and climatic change provide optimal conditions for a rapid wild boar multiplication and expansion (Wu et al. In Vojvodina Province.. but also a higher contact rate between hosts (Ruiz-Fons et al. Novi Sad.. The population of wild boar in 15 member states of European Union (EU) has been roughly estimated between 800. clinical examination of live and gross pathological examination of dead and/or shot diseased wild boars.. 2013. virusological testing (ELISA test.000. 2008). 2000).ac. On the basis of the achieved results it may be concluded that wild boars could be source of different endoparasites species.2/km2 to over 20/km2. Also. which not only means a larger number of hosts available for the transmission of disease.000 and 1 milion heads.. 2001. The clinical examination was performed from the safe distance at the feeding place. The following research methods were applied: epidemiological investigation. Hunting grounds are managed by two public enterprises. 2015. also two hunting association. where clinical signs of health disorders and dead of different categories of wild boars were recorded. the applied research methods included: bacteriological testing.rs Abstract The control of health status of wild boar population is quite demanding and it is not easy to achieve. Igor Stojanov1. there is one public enterprise „Vojvodinašume“ with 17 hunting grounds. By gross pathological examination it was discovered that in the largest number of animals the health problems were mainly connected to the parasitic infestations and bacterial infections of digestive and respiratory organs. Radoslav Došen1.00 heads and the density of the wild boar population ranges from a minimum of 0. In the laboratory. the population of wild boars was aproximatelly estimated on 30. Sedlak et al. HI test and RT-PCR) and parasitological examination. Keywords: wild boars.. one private hunting ground and 86 hunting associations. in the Republic of Serbia. often is not possible entirely to perform a complete diagnostic examination in wild boars in each evaluated case. 2014a). Serbia * Corresponding author: jasna@niv. Wild boar pathogens are highly relevant not only for the livestock industry but also for wildlife conservation and for the hunting industry (Došen et al. The aim of this research was to evaluate the most common health disturbances detected in wild boars in enclosed hunting grounds in Vojvodina Province. there are about 300 hunting grounds with wild boars. Knowledge of diseases circulating in wildlife populations can be 260 . four National parks in wich hunting is allowed and 5 hunting grounds are managed by Ministry of Defence. enclosed hunting grounds. In Serbia.

2013). Prodanov et al. focusing on detected diseases that are epidemiologically and economically important to the health of both wild boar and domestic swine populations.. 261 . 2009b. It should be taken into consideration that domestic animals and humans usually have never been exposed to pathogens common for wild pigs. providing ideal conditions for pathogen transmission from wild to domestic pigs and humans. thus getting in contact with wild boars. In areas in which traditionally raising freeroaming domestic pigs has been introduced in the woods. In our research during the epizootiological and clinical examination. where they share forest habitat with wild boar population. Prodanov-Radulović et al. meat. Animal health surveillance is routinely applied to domestic animals. In some regions. especially near the river banks. observations made of the carcass and viscera (Laaaksonen and Paulsen. 2008). Hunting and consumption of wild boar meat enables direct contact of humans and wild pigs. production which is often referred to as a feral pig or feral hog (Ruiz-Fons et al. 2011. Wu et al... Domestic pigs move freely in the woods.. 2009). after summer pasture.. Prodanov-Radulović et al. 2009a. 2008). and thus are highly susceptible to infection (Ruiz-Fons et al. Hunters have a greater than average risk of encountering various pathogens communicable from animals to people. In the most of the cases. Prodanov-Radulović et al. The parallel increase of outdoor piggeries has led to a higher risk of contacts... hybridization with the wild boars has led to crossbreeding.. They can also diminish the value of the end products obtained from game....First International Symposium of Veterinary Medicine – ISVM2015 important not only for conservation and livestock production but also for public health (Boadella et al. Prodanov-Radulović et al. often is not possible entirely to perform a complete diagnostic examination in wild boars in each evaluated case (Petrović et al. In Vojvodina Province a certain number of wild boars is controlled and reared in an enclosed hunting ground while the number of free-ranging population is mainly unknown (Prodanov et al. 2002... Ruiz-Fons et al. 2015). Prodanov-Radulović et al. wild boar meat and derivates are a likely source of human infections (Boadella et al.. Also. Because pigs and wild boars belong to the same species. domestic pigs are returning into the pens. 2012. 2013a).. 2012). 2014a). but limited data exist on the prevalence and distribution of infectious agents of wild boars in Vojvodina Province. The objective of our study was to evaluate the most common health disturbances detected in wild boars in enclosed hunting grounds in Vojvodina Province. compromises the health surveillance programs carried out both populations (Frölich et al. between wild boars and domestic pigs. recognized as a relevant risk factor for disease transmission between wildlife and domestic animals. 2008). 2009a. and thus of disease transmission. It is especially important that owners of the free-roaming animals in the same time have backyard pigs (Prodanov et al. Meng et al. Because several million wild boars are harvested and consumed yearly in Europe. The ways of handling the carcass. 2012. they share the same pathogens (Prodanov et al. The overabundance of wildlife. 2015. It can be assumed that direct contacts between wild boars and domestic pigs kept in outdoor farms occur occasionally (Došen et al... 2013. after shoting. 2013b). Wildlife is a reservoir for several economically important diseases and epizootiologic surveys are needed. One of the characteristics of outdoor swine production in some regions of Vojvodina is raising freeroaming domestic pigs. Migrating and roaming animals can carry pathogens over long distances (Laaaksonen and Paulsen.... 2009b). 2009b). Prodanov et al.. 2015). 2011). we discovered the existence of this type of animal hybrids in the backyards of the owners who practice extensive grazing (Prodanov et al. especially in large wild boar populations (Garcia-González et al. 2013a. which provides favourable conditions for infection transmission. domestic pigs are kept outdoors on the pasture. However.. Many diseases may cause external symptoms and abnormal behaviour in game animals. offal and hides have an effect on this risk (Laaaksonen and Paulsen. the assessment of game animal health is based on medical history of the game and. 2009b).

the case history data revealed the problem in piglets category with clinical signs of growth retardation. gall-bladder and renal pelvis were examined with routine techniques for the detection of helminth parasites. clinically diseased wild boars (animals showing staggering gait. Streptococcus beta haemolyticus and Actinobacillus pleuropneumoniae were detected. spleen. easy to catch and a large number of dead piglets were discovered. In addition.First International Symposium of Veterinary Medicine – ISVM2015 Material and Methods The material for this research comprises two different sources with the aim to perform health control wild boars population in enclosed hunting grounds in Vojvodina Province. In few animals. The piglets were reluctant to move. the examination of the trunci and internal organs deriving from wild boars was carried out. lungs. mediastinal lymph nodes) Pasteurella haemolytica. was done. IDEXX Laboratories. heart. Results and Discussion Wild boars diseases caused by bacteria On the several examined hunting grounds. Beside this. the trachea and bronchi were filled with a foamy exsudate mixed with small number of lung worms in the respiratory pathways. patohistological examination (lungs) and serology testing (sera samples). Microscopic examination determined whether the isolated bacteria were Gram positive or not and whether it is a coccoid or rod-like organisms. sedimentation and McMaster’s method). As a part of health control program of wild boars. Lung. The detailed gross pathological examination. The serology testing included classical swine fever (indirect immunoenzyme test kit: HerdChek CSFVAb. Isolation of bacteria from tissue samples deriving from dead pigs was performed by standard aerobic and microaerophilic cultivation. Macroscopically. fatigued. 262 . The following research methods were applied: epidemiological evaluation. USA) and porcine parvovirus (haemagglutination inhibition test). liver. according to the specially adopted protocol. By standard bacteriological testing on tissue samples (lungs. with long bristling hair and arched back) were shot by hunters. regularly shot by hunters. In order to check the wild boars in which the hunters noticed some signs of abnormal behaviour and/or signs of diseases. purple to gray areas of consolidation of lung tissue were detected (Pneumonia fibrinosa in statu hepatisatiois rubrae et griseae). Streptoccocus alfa haemolyticus. The determination was carried out by determining the biochemical characteristics of the isolated bacteria. clinical examination of live and gross pathological examination of dead wild boars. As a part of health control program. digestive tract. the lung lobes were very similar to the hepato or pancreatic tissues. the gross pathological examination of carcasses of dead or diseased animals shot by hunters and laboratory testing of their organs and tissue samples was performed. with an aim to not interfere with regular hunting procedure. and taking the samples for laboratory examination. standard laboratory testing for detection the presence of aerobic and anaerobic bacteria in tissue samples (mediastinal and mesenterial lympho nodes. each animal carcass was thoroughly analysed by gross pathology examination for the presence of helminths. The gross pathological examination revealed changes dominantly in the respiratory tract: severe necrotizing pleuropneumonia and the presence of multiple abscesses in the lung tissue (Pneumonia apostemosa disseminata). kidney) deriving from dead wild boars. A parasitological examination was carried out with fecal material extracted from the rectum of each animal after necropsy (zinc sulphate flotation. In cooperation with the hunting societies and local veterinary service gathering of sera samples of hunted wild boars was organized. liver.

2015). In the treatment. unlike A. pleuropneumoniae increased with age and body weight. Subclinically and chronically infected pigs may enter a permanent carrier state. Survivors of acute infections become carriers. consistent sampling of the same sites. less frequently in the nasal cavity (Boadella et al. It should be stressed that overdense regional game populations are a predisposing factor for the disease (Laaaksonen and Paulsen. harbouring A. Prodanov-Radulović et al. The clinical and pathologic outcome of infection depends on serovar and virulence factors. most attention has been devoted to diseases that are under official surveillance and control in either pigs. mesenterial lympho nodes) derived from diseased shot and dead wild boars the presence of Escherichia coli and Escherichia coli haemolytica was detected. overexertion. spleen.. Even the most pathogenic strains are not capable of infecting a healthy lung. Transmission occurs via aerosols or direct contact between pigs. the bacteria from the genus Pasteurella can cause epidemics with high mortality rate (Laaaksonen and Paulsen.. and the infectious agent is located mainly in nerotic lung lesions and/or in the tonsils.. Starvation and poor condition of mothers/dams set the scene for an outbreak of the disease. Actinobacillus pleuropneumoniae DNA was amplified from tonsils of 34. Prevalence of A. Prodanov-Radulović et al. Common clinical symptoms in wild boars include hanging of head and severe functional disorder of respiratory organs (Laaaksonen and Paulsen. infectious pressure. wild boar or both. 2006). 2012). pleuropneumoniae DNA was 35. Monitoring wildlife diseases faces a number of wildlife-specific constaints. 2015). Infection pressure is also increased when the number of diseased animals is high and the population is dense (Laaaksonen and Paulsen. Pleuropneumonia caused by A. such as poor state of nutrition. and stress factors (Reiner et al. pleuropneumoniae loads in lungs and tonsils likely demonstrates the higher colonization of tonsil tissue with A. immunity. In only few examined enclosed hunting grounds.First International Symposium of Veterinary Medicine – ISVM2015 In various game animal species.. The discrepancy between A. 2013a). Most common gross pathology findings included moderate signs of gastric and intestinal infection and enlarged mesenterial lymph nodes. It is consider that the outbreak of the disease in wild boars requires stressful and predisposing factors. liver. breed. Applying bacteriological testing on tissue samples (kidney. pleuropneumoniae is one of the important bacterial diseases of the respiratory tract of the pig and occurs in most pig-keeping countries (Boadella et al. 2006). overdensity of population. although it cannot be excluded that lungs were categorized as false negatives. but also on age. 2013b). including sampling difficulties regarding proper sample and site stratification.. while other infections have received comparatively less effort. 2012). Reiner et al. and limitations of the diagnostic test available for wildlife (Boadella et al. 2010).. 2015. usually the same antibiotics are used in the treatment of bacterial diseases of domestic pigs and wild boars. Actinobacillus pleuropneumoniae is considered an obligate parasite of the porcine respiratory tract and there are no other natural hosts. depending on the virulence of bacterium.e. unfavourable weather conditions and great number of parasites. 2015. pleuropneumoniae (Le Potier et al. In Europe.8%. Escherichia coli bacteria cause a group of enteric diseases mostly found in young wild boars (Laaaksonen and Paulsen.8% and from lungs of 6. the clinical signs (greyish to brownish diarrhea) of the enteric infection were observed. (2010) discovered that the overall prevalence of wild boars that were PCR-positive for A. Higher prevalences in tonsils without gross pathologic signs of pleuropneumoniae suggest colonization of most of these animals by non-pathogenic or low-pathogenicity serotypes (Reiner et al. by clinical examination of wild boars during the feeding. hygiene. Bacteria have a genetic ability to mutate and develop strains that 263 .... 2012). Disease outbreak usually requires predisposing factors. The bacteria from the genus Pasteurella is probably the most frequent and damaging invader in the lung i. tipically secondary invader and was never isolated in the bronchial tree of healthy pigs. 2010). pleuropneumoniae in wild boars. pleuropneumoniae in sequestra or well-encapsulated abscesses in the lung and in tonsillar crypts (Le Potier et al.4% of wild boars. 2015).

may cause great problems in the health care of humans and animals (Došen et al. However. The manifestation of disease is often directly comparable to the severity of parasitic infection (Laaaksonen and Paulsen. 2015). In addition. dry and dull hair and diarrhea (Laaaksonen and Paulsen. these parasites are significant in dense animal populations. 2015). with shrunken eyes and tough dry hair. swollen abdomen. In the prevention. as well as when starvation occurs. and Hyostrongylus sp. Wild boar diseases caused by parasites By gross pathology examination. Macracanthorhinhus hirudinaceus. Trichuris suis. which were like mucoid plugs filling the respiratory pathways (Metastrongylosis pulmonum summ). correct location and hygiene of game feeding grounds is important (Laaaksonen and Paulsen. In all examined cases. A large amount of clear.. diseases may be caused especially by large roundworms (Ascaroidea). Consequently. Strongylidae and Ascaroidea) that parasitize in the gastrointestinal tract are frequently found in wild boars (Prodanov-Radulović et al. no gross pathology lesions were detected in the gastrointestinal tract of examined wild boars. This. In that case. 2014). Oesophagostomum sp. pathomorphologically the presence of numerous abscesses (Pneumonia apostematosa disseminata) in lung tissue were detected. edematous and reddened with marginal emphysema and consolidation. they can cause weakening of the animal and significant mortalities. The wild boars were emaciated and slow gait. effervescent content in bronchi and bronchioles. the pathohystological examination were performed and in two examined shot wild boars Pneumonia 264 . gross pathological examination of trunci and internal organs deriving from shot wild boars was performed. wasting. 2011). fatigued. the adult forms of several gastrointestinal parasites were discovered: Ascaris suum. It is important to distinguish between a parasitic infection. parasites of the gastrointestinal tract do not cause problems under normal conditions. In most of the shot healthy. Roundworms (Trichostrongylidae. An adult parasite inhabiting the stomach or intestines of a host animal produces eggs that are passed to the environment in feces. The parasite from genus Coccidia reproduces in the intestines and damages the intestinal lining. Applying parasitological control of the intestinal content and/or faecal material extracted from the rectum. In the cases when macroscopically changes on the lung tissue were noticed. As part of health control program of clinically diseased wild boars shot by hunters. 2013a). mixed with a large number of lung worms. in most of the examined cases. white nematodes 4-7 cm long were visible in the trachea and bronchial trees. 2015). the transmission of the parasite increases and infection pressure grows. the case history data revealed the problem in piglets category (signs of growth retardation). Parasites. In several cases. In general. The piglets were described as reluctant to move. and changes caused by them. and their spread is self-limiting. animals with a parasitic infection can present a weight loss. The infection is transmitted to another animal via feces-contaminated food or water. causing diarrhea and intestinal dysfunction of host animals and produce egg-like oocysts to their feces. and a disease caused by parasites. the gross pathology examination revealed changes dominantly in the respiratory tract: purulent nasal discharge. All lobes of the lungs were diffusely swollen.. the presence of Protozoa of genus Eimeria (Coccidia) was detected. together with poorly planned treatment or mass uncontrolled use of antibiotics.First International Symposium of Veterinary Medicine – ISVM2015 are resistant to antibiotics. Also. In several examined hunting grounds. important precautions include game animal feeding ground hygiene and prevention of contacts between game and production animals (Laaaksonen and Paulsen. Trichuroidea. In the control. and lagging behind the pack were noticed. In dense populations. However.. are the most common findings that a hunter confronts in game handling. which practically all animals have. easy to catch. by clinical examination clinical signs of respiratory infection in young wild boars were detected: dispnoea and intensive coughing („thumping“). the presence of eggs from several parasites was discovered: Trichuris suis. foamy fluid and numerous slender. 2015. coccidian may become a significant cause of mortality in young animals. diseased or dead found wild boars originated from different enclosed hunting areas the presence of lung worms was established. Prodanov-Radulović et al. Clinically.

the symptoms of which may include deterioration of general condition. 2011). 2011).. 2013b). Yoon et al. weight loss and mortalities. 2007).) in the trachea.5 to 10 cm in diameter. Lungworms are often encountered as highly prevalent helminthes in wild boars (ProdanovRadulović et al. 2015. which form part of the diet of wild boars and act as intermediate hosts for these parasites (Senlik et al.First International Symposium of Veterinary Medicine – ISVM2015 interstitiais was diagnosed. since the parasite cysts. 2015). An adult parasite dwells in the bronchial tubes of wild boars. The pearly gray.. adult parasites can be seen in the bronchial tubes.. The parasites intermediate hosts are herbivores and wild boars. 2011. dog. are most commonly found in the omentum. bronchi and in posteroventral parts of the diaphragmatic lung lobes were detected (Pneumonia verminosa). Inside the new host. as far as is known. Lung parasites of the genus Metastrongylus are considered one of the most important selective factors acting on wild boar population. an infected animal’s raw meat or organs should not be given to dogs or wild animals (Laaaksonen and Paulsen. by gross patology examination of shot wild boars. 2013b). Senlik et al. 2015) 265 . the eggs develop into larvae and are passed in feces to the ground.. 2011). Severe infections cause caught and inflammation of the lungs. which may cause an increase in the infection intensity (Da Silva and Muller. which get the parasites eggs to their intestines through food. liquidfilled cysts of the T. Järvis et al.. liver or peritoneum of wild boars. When the cystbearing animal is eaten by a carnivore. increasing the mortality of weaker young and adult animals because they may cause dyspnea. The scars left by them are greenish areas of 0. By gross pathological examination. 1. where it produces eggs. affecting more than 80% of pigs created in extensive system and considered one of the main causes of respiratory changes of these animals (Da Silva and Muller. By parasitological examination the presence of lung worms (Metastrongylus spp. In order to break a cycle. 2007). Mild infections are often asymptomatic. The uncontrolled use of anthihelmintics can lead to an excessive selection of resistant parasites. In Europe. The verminous processes are mainly located dorsocaudally in the lung (Prodanov-Radulović et al. The larvae burrow through the intestinal wall and form cysts in the body of intermediate host (Cysticercus tenuicollis). 2013a. the definitive hosts of the adult parasite are carnivores such as wolf. the larvae penetrate the intestinal wall and migrate via lymphatic vessels to the lungs. smaller cysts go easily unnoticed. In control. affecting more than 80% of pigs created in extensive system and considered one of the main causes of respiratory changes of these animals (Da Silva et al. Single. infection pressure can be diminished by preventing the development of dense game populations and maintaining good game feeding ground hygiene (Laaaksonen and Paulsen. 2015.. The reason for the high prevalence of lungworms may be the density of game population. the presence of parasitic cysts in the abdominal cavity were detected. In Europe.. do not cause symptoms to the intermediate host. these parasites have high prevalence. Each cysts contains one infectious larva. Tapeworms (Taenia hydatigena) is a ubiquitous parasite. Prodanov-Radulović et al. and permanent weight loss in addition to inflicting tissue damages which allow opportunistic infections of viruses and bacteria (Da Silva and Muller. 2013. lynx and fox. New animals are infected after ingestion of food that contain larvae. bronchopneumonia. 2013). The eggs are coughed up to the throat and travel via the pharynx to the intestines. the parasites life cycle is completed.. This result might be explained by the wide geographical distribution of different earthworm species. Despite the limited number of wild boars examined. Prodanov-Radulović et al. Young wild boars are thought to ingest a higher number of earthworms than adults and therefore may have a higher level of parasitism (Garcia-González et al. these parasites have a high prevalence.. In the intestines. 2013). 2013. 2013).. our study suggests these species are common and enzootic in wild boars in Vojvodina region (Prodanov-Radulović et al.. Järvis et al. slow growth. which often is the natural explanation of the spread of a parasite transmitted from animal to animal (Laaaksonen and Paulsen.. thus completing the parasitic life cycle (Laaaksonen and Paulsen. Sporadically. 2010).5 to 2 cm in size in the lungs (Laaaksonen and Paulsen. 2015). hydatigena tapeworm.

However. who ten act as intermediate hosts and the infection causes a so called hydatid disease (hydatidosis) (Laaaksonen and Paulsen. Mycotoxins can get to wild animal food from grass of fodder made from grass. On entering the body. In year 2010 the serological control of CSFV antibodies in wild boars population included significantly larger number of animals i. The cysts are often pearly grey colour and contain clear liquid with thousands of small. Different fungal species (Fusarium. However. Having in mind all the facts. The eggs produced by the parasite are spread to the environment through the host animals feces. When the animal and cysts are ingested by carnivores. the occurrence of mycotoxins cannot be controlled. 2015). from silage and grain feed (Laaaksonen and Paulsen. The serological control of the CSFV presence in wild boars population in Vojvodina region was even more intensified during years 2011-2012. the potential problem of mycotoxicosis was suggested. 2014b).. slow growth and mortality in piglets was discovered. E. Mycotoxicoses in wild boars In two examined enclosed hunting areas. trace of fecal content on the hind body parts and on the ground were found.First International Symposium of Veterinary Medicine – ISVM2015 The other detected parasitic agent in examined wild boars is cysts of a tapeworm. the parasite forms cysts that contain a large number of infectious larvae. staggering gait. in 36 positive results i. From examined blood samples.. the toxins possibly produced by fungi may cause a group of different symptoms that are often difficult to recognize (Prodanov-Radulović et al. The definitive hosts of E. Penicillium genera) produce mycotoxins in food and cause intoxication to those animals that eat the contaminated food. whose intestines are inhabited by adult parasites. In total 2038 samples were examined: 996 sera samples 266 .e. perhaps due to difficulty of reaching a diagnosis.e. granulosus are canines. weight loss and reproductive disturbances.granulosus infection can be contracted by humans. diarhoea. 2015). Serological examination in year 2009 on the presence of specific antibodies against CSFV (ELISA test) comprised only 259 blood samples obtained from wild boars in the hunting area of Vojvodina region and it revealed negative result. Wild boar diseases caused by viruses In cooperation with the hunting societies and local veterinary service gathering of sera samples of hunted wild boars was organized. In nature. An animal suffering from severe infection and large cysts in abdominal cavity or lungs is more easily killed by carnivores. the problem of diarrhoea. Typical cysts (hydatid cyst) are commonly found in the liver of the wild boars. the entrance of mycotoxins into the nourishment of game animals can be avoided with careful hygiene of game animal feeding grounds. the parasites life cycle is completed (Rojo-Vazquez et al. The clinical examination was performed from the safe distance at the feeding place. Inside the intermediate host. This assists in the completion of the parasites cycle. 2014b). The number of cysts may vary from a single one to over a hundred cysts. in total 471 tissue samples and 455 blood samples were examined. Aspergillus. The signs of weakness and growth retardation. often wolves. and further via food to the intermediate host. the presence of specific antibodies against CSFV was detected. infectious larval forms of the parasite. Their size varies. Symptoms caused by mycotoxins in animals depend on the toxin and the ingested dosage. Echinococcus granulosus. 2015). Diagnosis is difficult to make as the mycotoxin content is very small and several toxins can be found in the same sample (Prodanov-Radulović et al. depending on the duration of the infection. do not offer feed from the ground but from a feeding device that prevents the feed from getting wet (Laaaksonen and Paulsen. In the feed control a significant quantity of moldy corn was discovered. Clinical symptoms vary from organ-destroying acute intoxications to chronic states of intoxication that may include reduced appetite. using only feed that would be acceptable for production animals. 2011). Fungal intoxication has rarely been reported in game animals. applying reverse transcription-polymerase chain reaction (RT-PCR) analysis the presence of viral genome was not established in tissue samples deriving from shot wild boars..

. 2008. where low prevalence of antibody to PPV was reported (Montagnaro et al.. This could explain the presence of antibodies against CSFV in some of examined sera samples. In one enclosed hunting ground. The highest prevalence of seropositive animals was associated with the hunting areas in Bačka and Srem districts. with modified live (China strain) vaccine. 2008)... genus Pestivirus and of great economic concern for the pig farming industry (Artois et al. according to the history data and clinical signs detected in wild boars (a small number of newborn piglets. Having in mind migratory characteristics of population. We believe that this is connected with the tradition of keeping domestic pigs in woods (especially in Srem district). epidemiological links between CSFV infections in wild boars and domestic pigs have been repeatedly reported. 2010). 2000. Prodanov et al. The high prevalence of PPV antibody suggests this virus is endemic in our wild boar populations. CSF monitoring program in Serbia is primarily focused on the serological investigations of blood samples and control of tissue samples by RTPCR from hunted wild boar. In Europe. Clinically.. 2009b. Rossi et al. 2005). applying RT-PCR analysis the presence of CSFV genome was not established in tissues samples deriving from shot wild boars in Vojvodina (Prodanov-Radulović et al. 2002. 2006). During the visit of hunting area it was noticed that the fence was not entirely surrounding the area and there were parts without fence. this could facilitate contact with domestic pigs located in forest habitat. Montagnaro et al. thus increasing possible contact and transmission of diseases between wild boars and domestic swine (Prodanov et al... By additional epidemiological evaluation. 2005). 2005). However. Vengust et al. 2014a).. 2012. the results of the epizootiological questionnaire indicated that CSFV may be present in hunting grounds in the region of Danube River. 2006. 2013a.. The inveterate tradition to keep domestic pigs at free range and the consequent contacts with the wild boars are considered the major cause of outbreaks of CSF.. Roic et al. mainly in Germany (Ruiz-Fons et al. PPV is highly prevalent in wild boars. lymph node. Rossi et al. the clinical examination was feasible only in a certain number of wild boars located in specially separated. The disease in the wild boar population was diagnosed and/or serologically confirmed in several Central and Eastern European countries (Artois et al. stillborn and mummified piglets in the litters).... 2009b). 2006). except Italy. fenced area. 2014a).. 2014a). 2009b. 2005. implying that the wild boars population represents also a source of infection with CSFV (Prodanov et al. Vengust et al. no abnormal mortality has been reported in the analyzed districts of Vojvodina region (Prodanov-Radulović et al. ProdanovRadulović et al. Prodanov-Radulović et al.. However. Sampling is performed randomly based on the density of the wild boar population in different regions (Prodanov –Radulović et al. it was discovered that some of the examined sera samples from certain hunting grounds that tested positive were a consequence of previous vaccination against CSFV in the past. CSFV has been reintroduced periodically into domestic pigs via contact with infected wild boars (Le Potier et al.. Applying serological examination (HI test) of blood samples. 2014a). we cannot exclude the possibility that vaccinated wild boars may have been sampled and detected as positive in the survey. Moreover.. Therefore. In some European countries. with an incidence ranging from 14 to 57 % (RuizFons et al.. In research conducted in 2013. 2009b). 2010. Classical swine fever (CSF) is a viral disease caused by a member of Flaviviridae family. Rossi et al.. At present. which seems to facilitate disease persistence (Laddomada. the problem of PPV infection was suggested. Once again. Although prohibited from 1983 in Serbia.First International Symposium of Veterinary Medicine – ISVM2015 and 1042 tissue samples (spleen.33%) of the 300 examined samples tested PPV positive.. 267 . Rossi et al. CSFV vaccination of wild boars may have been applied for a while after vaccine ban (Prodanov et al. in 33 sera samples the presence of CSFV specific antibodies was detected.. 2002. and kidney). antibodies against PPV were widely distributed among the wild boar population in Vojvodina province: 148 (49.

even the prohibition of extensive grazing. Jakov. Frölich K.. 2007 9. Petrović T.. The study underlines the importance of improving surveillance strategies for pathogens shared between wildlife and domestic animals and the need to increase disease awareness of hunters.: The uncontrolled use of antibiotics in pig production . Artois M. Pérez-Martin J. Alcaide Alfonso M. M. The gross pathological examination discovered that in the largest number of animals the health problems were mainly connected to the parasitic infestations and bacterial infections of digestive and respiratory organs. Pušić I. Laaaksonen S. 4-13... Boadella M.. 2001 2.. 49. Stojanov I. Došen R. Science and Technological Development. Frontera Carrión E.. Guberti V. 150. 97 5. 2013 8. W.: Incidence and control of CSF in wild boar in Europe.: Seroprevalence Evolution of Selected Pathogens in Iberian Wild Boar.Y. 2000 10. The Veterinary Journal. Wageningen Academic Publishers. 17-20 October. Vet Microbiol.a threat to public health. Thiede S. 2nd International symposium on hunting 'Modern aspects of sustainable menagement of game population'...: A Review of Mutual Transmission of Important Infectious Diseases between Livestock and Wildlife in Europe. 162. Veterinary Parasitology. Järvis T. Avoiding close contact between wild boars and domestic animals is of logical importance in disease control and eradication programmes. 2013 4.First International Symposium of Veterinary Medicine – ISVM2015 Conclusion On the basis of the achieved results we can conclude that wild boars could be source of different endoparasites species.F. Kozikowski T.: Man.: Hunting hygiene. Kapel Ch. Laddomada A. In the future. Journal of Wildlife Diseases. Prodanov-Radulović J. Prodanov-Radulović J. 395–404. Mägi E. Republic of Serbia References 1.: Epidemiologic Study of Lung Parasites (Metastrongylus spp. 121-130. 141-152. Having in mind this fact.. Acknowledgements This paper is a result of the research within the project TR 31084. Ruiz-Fons J. 2012 3. Transboundary and Emerging Diseases. Serbia organized by Faculty of Agriculture. Da Silva D.. Moks E.. Ann. the special attention should be given to active surveillance of wild boars population in the areas where close contact with domestic swine is possible. a better connection between veterinary service and experts from hunting area is needed in order to solve to problems comprehensive way. Acad. Grubač S.. and Paulsen P. Mart n J... organized by Institute of food technology. wild and domestic pigs : Major risk points in disease transmission and perspective.. 20-24 6..1.. which facilitate transmission of pathogens. 2014. Sci. Stojanov I. 157-162. Ratajac R. The measures should include the serological monitoring of wild boars and free-roaming domestic swine. Segales J.. 2013. Calero-Bernal R. Talvik H. The obtained serological results suggest that wild boars have direct or indirect contact with domestic pigs. 2013. Discovered parasitic infestations in the evaluated wild boars are economically significant because of retardation in the growth and weigh gain. pathological examination of the trunci deriving from shot wild boars.E.... Delahay R. financed by the Ministry of Education. and Cheeseman C.. farmers and veterinary practitioners. 2015 268 .Vicente J. Pušić I. Došen R.. Novi Sad. XVI International congress Feed technology.: Control of Infectious Diseases of Wildlife in Europe. Müller G.. Garcia-González A.. N. and Gortazar.: Parasites of the respiratory tract of Sus scrofa scrofa (wild boar) from commercial breeder in southern Brazil and its relationship with Ascaris suum.. C. Book of Abstracts.: Helminths of wild boar in the isolated population close to the northern border of its habitat area. Parasitol Res 112:13531356. 73.59. 969. A.. 366-369. 2002 7. October 28-30. Novi Sad.. Gamito-Santos J. Novi Sad.) in Wild Boar (Sus scrofa) in Southwestern Spain. 2014.

Bronnert S. Taylor D.. Novi Sad.: Clinical and pathomorphological diagnostics in control of health status of wild boars.. 3. 2697-2707. Lupulović D.1.. Hernendez-Gonzalez A. Novi Sad.: Verinozna pneumonija divljih svinja. Fromont E. Došen R. Rossi S. Petrović T.A..: Wild boars as sources for infectious diseases in livestock and humans... Belgrade.. Lazić S. 25. Došen R. Trans.. Petrović T.: A review of viral diseases of the European wild boar: Effects of population dynamics and reservoir role. Serbia. Proceedings The 9th Regional Symposium in Animal Clinical Pathology and Therapy „Clinica veterinaria“. Belgrade. 2 . Lupulović D. Oxford: Blackwell Publishing. E.. J. Meng X. Journal of Wildlife Diseases.4 October. Anim. Soc.... 10th . 2. Balatinec J..3. Pisanelli G. Prodanov-Radulović J. 19-25. 2009a. D’Allaire. 26-28 September. Iovane V.: A serological survey on porcine reproductive and respiratory syndrome (PRRS) virus infection in Serbian wild boars population. 220-224 20. Biotechnol. Reiner G. In: Diseases of swine. EuroPRRS2012 Symposium Understanding and combating PRRS in Europe. Polaček V. Stojanov I. Pontier D..: Cystic Echinococcosis in Spain: Current Situation and Relevance for Other Endemic Areas in Europe. Longo M. Barrat J. 10th International Symposium Modern Trends in Livestock Production...133. Došen R.133-134 16. Francos-Von Hunefeld M.. Pardo-Liedias J. 2012 24. Pušić I.. 1.F..1182-1188 19. Fresen C. Serbia. Stojanov I.. ed..Beograd.. Hars J.: Classical swine fever and other pestiviruses. P.: The interaction between the swine infectious diseases agents and low levels of mycotoxins in swine feed... Sasso S. Jemersić L. Pušić I.. and Sriranganathan N. 2013a. De Martino L.. Maljković M. organized by Institute for Animal Husbandry. organized by Faculty of Veterinary Science. 3rd International symposium on hunting Modern aspects of sustainable management of game population. 158-169. organized by Faculty of Agriculture... Došen R. 2009b 17. Ghiurmino G. Brunetti E. 551-555. Willems H.. Orlić D.. 2008 269 . Alamo-Sanz R.. Proceedings.: Prevalence of Antibodies to Selected Viral and Bacterial Pathogens in Wild Boar (Sus scrofa) in Campania Region... Lindsay D. 2009 13.. Orlić D. Le Potier M. Došen R. Roslin Institute. Husb. Petrović T. COST Action FA902.. Stojanov I.. Petrović T..pntd.. Pušić I. 87-88 15. 1. 2014a 21. Anim.131–137. Marčić D. Maljković M... Keros T. Prodanov J. Roić B..12th October 2012.First International Symposium of Veterinary Medicine – ISVM2015 11... 2013b. Pacholek X.... Vannier. Petrović T. Zimmerman. Montagnaro S. Prodanov-Radulović J. Prodanov-Radulović J.: Prevalence of antibodies to selected viral pathogens in wild boars (sus scrofa) in Croatia in 2005–06 and 2009–10.. Cordero-Sanchez M... Phil. Polaček V.: The control of classical swine fever virus presence in wild boars population.: Incidence and persistence of classical swine fever in free-ranging wild-boar (Sus scrofa). 0000893.. S. Prodanov-Radulović J. J. Pušić I. 2014b 22. Došen R. 2006.. Ruiz-Fons F.. med. Subotica. Arh.: Health status control of wild boars in the hunting area of Vojvodina region. 30. Lazić G. Stojanov I. PLoS Negl Trop Dis. Urošević M.vet. Živkov-Baloš M. 2010 14. Siles-Lucas M. Baldi L. Prodanov J.. Italy. Zemun ..1371 /journal.. Epidemiol.. 5-6.433-444. 2011 25.... Radulović G. 2010 23. Crucière C... Gortázar C. S.: Antibodies to selected viral disease agents in hunted wild boars in Vovodina region... 2012. e893.. Došen R.. organized by Balkan Wildlife Scientific Society... 559568. 17-20 October.. R..: The bacterial infections of respiratory tract of wild boars. 2011 18. Jun 19-21 Jun.doi: 10. 5.. 316–319. Journal of Wildlife Diseases. Grubač S.. Haak I. Biotechnol. Budapest.... Orlić D..: Prevalence of Haemophilus parasuis infection in hunted wild boars (Sus scrofa) in Germany. Prodanov-Radulović J. Artois M... Lupulović D. Segalés J. 2nd International symposium on hunting Modern aspects of sustainable management of game population.. 48. Došen R. Pušić I. 309-322 12. 9th edn. Prodanov-Radulović J. Vet J. Pagnini U. Journal of Wildlife Diseases.. Straw B. J... Mesplede A. 149153. 46. Pušić I... Terzić S. Radulović G... Serbia.. Novi Sad. Infect.. 176. Stojanov I. B 364. Nava D..Florijancic T. J. 2005 26. Rojo-Vazquez F.2. Proceedings. Husb. Stojanov I.. 879885. 46. Hungary.

J. Bartova E. 2008 28..: Antibodies to Selected Viral Disease Agents in Wild Boars from the Czech Republic. 404-408... Hinić V.-C. Korea. Kramer M.777–780. Akyol C..: Lung Worm (Metastrongylus elongatus) Infection in Wild Boars (Sus scrofa) of the Demilitarized Zone. 85. Brodard I. Kim J.: Helminth infections of wild boars (Sus scrofa) in the bursa province of Turkey. Journal of Wildlife Diseases. Ryser-Degiorgis M-P. Grom J. 2010 270 . 46(3). 31. Fattebert J..: Free ranging wild boar: a disease threat to domestic pigs in Switzerland? Journal of Wildlife Diseases. 1052-1054.. Cirak V. Hüssy D. Sedlak K.. Abril C. 47. 247–249.V.. B. Vengust G.. Kim H..3. Girisgin O. 44. Journal of Helminthology.. 2006 30. 2011... A. Bidovec J.Y. Vet. Machova J.First International Symposium of Veterinary Medicine – ISVM2015 27.. Thűr B. Med. Yoon B. Senlik B.-T.. 868-879. 4.: Monitoring of Classical Swine Fever in Wild Boar (Sus scrofa) in Slovenia. 53. 2011 29. Journal of Wildlife Diseases. Wu N.

2005. Clinical Center of Serbia.. 1993. Tylkowska et al. Ancylostomidae spp. Michigan 19 % . Vladimir Terzin3. Amoebae spp at 6. Zoran Tambur6. University Singidunum.5%.91% (45/98) soil samples and 72.com Abstract A steady increase in the number of dogs is a serious sanitary-epidemiological problem of urban areas.25%. Utrecht 23% . Tokoshima 63 % and etc (Gothe and Reichler. Commenting on the results of parasitological examination of green areas in in cities around the world.. Belgrade. Faculty Futura. Keywords: dogs.1% and 6. Giardia intestinalis at 16. 2003).6%. Parasites contamination were detected at 45. 2008.32% and 21. Eimeria canis 7. In order to monitor the contamination in the Belgrade area since 1993 continuously monitors the contamination of public areas for the presence of parasites originating from dogs (Pavlović et al.5%.0%. Serbia 6. Faculty of Veterinary Medicine. Serbia 8.14% and 12. Kansas 20. 2010. University in Belgrade.. 271 .5% dog faeces.First International Symposium of Veterinary Medicine – ISVM2015 CONTAMINATION OF PUBLIC PLACES AT CENTRAL BELGRADE MUNICIPALITIES WITH DOGS PARASITES IN PERIOD 2013-2014 Ivan Pavlović 1.. 2005. Dubravka Jovičić2. Pavlović and Surla. Belgrade. Borivoje Savić8. Pavlović. Miloš Pavlović5. Belgrade. is the current epidemiological problem in urban areas. Toxacaris leonina at 14.. 32 %. pets and stray. Dublin. 1997.9% and 25. at 18. Serbia * Corresponding author: dripavlovic58@gmail. environmental contamination Introduction The presence of a large number of dogs. In our paper we presented results of our examination performed at central Belgrade municipalities in period 2013-2014. From these reason at Belgrade we had parasitological research of that places continuously since 1993. Belgrade. Those animals permanent contaminated those areas with faeces which present a significant health problem from human. If it is known that more than 5% of the contaminated urban areas pose a serious threat to people's health is our opinion that this is not to comment (Woodroff. and Taenia-type helminths at 5. Dipyllidium caninum at 19. Veterinary Ambulance Pet&Vet. Serbia 3. Belgrade. 1976). zoonoses. whose droppings dirty sidewalks and green areas. Veterinary Ambulance Petweellnes Eva.36% and 22. Jansen et al. 2011). we will see that those polution in Madrid is 9%. Military Medicine Academy.32% and 22.6%. Belgrade. Trichuris vulpis at 16.6% and 7.28% and 18.5%. Serbia 4.. Elaine et al. Demirci et al.6% . 2009. London 15-17 % . Lalošević and Laošević.5% (58/80) dog faeces.63% soil samples and 72. Serbia 5. New Belgrade. Toxocara canis were found at 31. Scientific Veterinary Institute of Serbia. Dragana Petković4. Here we presented results of our examination performed at central Belgrade municipalities in period 2013-2014. 2006. 2010). City Institute of Public Health. 1990.5% and and Isospora canis 10. parasites. In close cohabitation stray animals and pets oriented on the same surface movement in the immediate environment of people and contamination of public areas eggs zoonotic parasite species leads to constantly attend on the possibilities of human infection (Mangaval and Pavlović. Cielecka et al. Belgrade. Paris and Prague 28 %.28% and 15. Snežana Radivojević7. Dragana Terzin3. Slobodan Stanojević1 1. Serbia 2. Serbia 7.75%.

32% and 21.First International Symposium of Veterinary Medicine – ISVM2015 Material and Methods Samples of grass and soil with green areas in our climate condition were collected from March to October.5%.6%. Trichuris vulpis at 16.14% and 12. 2012). this study was performed for scientific purposes and were unprofitable (which is sometimes caused misunderstanding in the institute). with special emphasis on the protection of human and animal health.5%.5% (58/80) dog faeces. 2012) A special segment of solving this problem in Belgrade has been the adoption of problem-solving strategies non-owner of dogs and cats in the city of Belgrade. 2005. combining the method of euthanasia without (no kill strategy) and CNR method "catch . Assessment of the infection will be performed by the methodology described by McMaster and Stoll and determination of eggs and oocysts based on morphological characteristics (Beugnet et al.25%. Pavlović et al. with sedimentation method.1% and 6. which was adopted at the Belgrade City Assembly held 21. the presence of the locations parasite eggs was found 65.75%.36% and 22. 2007). On the basis of the control of parasitic contamination of land from parks and other green areas between 1993 and 2002 (Pavlović et al..catch ..32% and 22.28% and 15. exception of three occasions when the city government paid for this study (in 2002.63% soil samples and 72.91% (45/98) soil samples and 72. and the sedimentation .90% of the examined samples.treat . At the same time more shelters for dogs has been built and a regular parasitological examination of parks and green areas in the city was introduced (Pavlović and Terzin. the flotation method.. 2007). Results Parasites contaminations were detected at 45. Toxacaris leonina at 14. 1981. at 18.9. grass and sand. In developing this strategy for the City of Belgrade and its implementation was guided by the principle of humanity.flotation method (Euzeby. Eimeria canis 7. Throughout this period.neuter -release). Ancylostomidae spp. The contamination has been established at 45. 2011 and 2012).let " ( CNR ..0%. The examination is carried using native preparation. 2012. Pavlović and Stevanović. During 2011 in some parks are form of eco zones or parks for dogs (Pavlović and Terzin. Toxocara canis were found at 31.9% and 25. objectives and measures to solve the problem in terms of non-owner dogs carry out administration of local government. Discusion Epidemiological study of parasites contamination in the area of Belgrade is the research carried out continuously since 1993. The following progress has been made by introducing during 2008-2009 in central city districts has taken root system of baskets with plastic bags from dog feces (Dogi-pot system).2011.6% and 7.90% of the area (Pavlović et al. The city of Belgrade has become one of the few cities that have a strategy to solve the problem of non-proprietary dogs and it is a document that defines the principles. Material for examination was taken on the basis of indicators of bioclimatic conditions prevailing in the same area leading to the method of bioclimatograme by Uvarov. 1997. and Taenia -type helminths at 5. This was followed by the first reactive in terms of cleaning the playgrounds so that in the period 2003-2007. 2008).5% and and Isospora canis 10. Giardia intestinalis at 16.5%. 2000). On the basis of parasitic control of soil contamination from the parks during the 2012 presence of parasite eggs was found in over 40% less than in the period 2008-2009.5% dog faeces.28% and 18. Terzin et al.6%. 272 . Amoebae spp at 6. Dipyllidium caninum at 19. Samples of dog’s faeces are raised with the same location in the same intervals as samples of soil..

2010 Elaine A. 6.: Basic measure to control and sanation of parasitic contamination of green areas in urban environmental condition. Kulišić Z. In: Atlas of Medical Parasitology.: Toxocara ova in praks and send boxes in the city of Utrecht.: Diagnostic Experimental des Helminthoses Animales.. Beograd..C. 1993 Lalošević D..61-65.. Milutinović M.. 16.F.. Kulišić Z. Tropical and Parasitology Service Amedeo di Savoia Hospital Turin. Zadužbina Andrejević. Korkmaz M. 5.: Toxocara canis: Nachweishaufigkeit und Befallsextensitet bei Muterhundien und ihre wurfen unterschiedlicher Rassen und Halting. 12. 155-156 Pavlović I.. 3.rezultati parazitološkog ispitivanja centralnih parkova Beograda. 1-4.First International Symposium of Veterinary Medicine – ISVM2015 At last two years (2013-2014). Mišić Z.: The influence of the new strategy to resolve the problem of ownerless dogs and cats in Belgrade on the preservation of environmental conditions.: Rezultati parazitološkog pregleda zelenih površina opštine Stari grad tokom 2002. Abstracts of International Conference on Environment and Sustainable Development. Krstić D. 7....Janković Lji. Terzin V. VI beogradska konferencija sa međunarodnim učešćem.) for more than 30% compared to the previous period and high possibility to human infection. Ćurčin K. godine 143-150. Abstracts book of International Scientific Conference on Globalization and Environment.. Lalošević V. 11. 2006. Radenković B. 133-134 Pavlović I. van Wijngšarden T. 78-79 Pavlović I. Beograd.: Intestinal Parasites (Helminths) Cestoides Order: Cyclophyllidea Dipyllidium caninum. CD rom Pavlović I.P. To solve that problem we must to back to permanent parasitological control of public places. Momčilović J.. 2. Terzin D. Schreurs M.. Beugnet F. Iranian Journal of Parasitology. 14. 233-237 Pavlović I. Tara.. Veterinarski glasnik. 5..Polack B.. Kaya S. 143-150 Pavlović I.. Proceedings of the VIII International Symposium In Animal Clinical Pathology And Therapy Clinica Veterinaria. Zbornik radova Stručnog skupa kontrola štetnih organizama u urbanoj sredini. Book of Abstracts for the 273 .. Beograd. Ar doğan B. 1981 Gothe R. ITVS. 4..: Geohelminths – emerging zoonotic disease in urban areas.1-2. Terzin V.. Kalianxis.. ed. Unit A.2007. Zbornik radova XI savetovanja dezinfekcija.. Reichler I. 118-119.200. 100-110. Knjiga apstrakata konferencije Životna sredina i ljudsko zdravlje sa međunarodnim učešćem. 2003.4.: Toxocariasis: visceral larva migrans in children. Dang H.. Kulišić Z. dogs fecal and parasites contamination of public places (parks. 9. Kulišić Z. 13. 2008 Mangaval J.2008 Demirci M.: Higijenski aspekt gradskih parkova . . Beograd. 1990 Jansen J. Surlan N... Bosna i Hercegovina. Paris.1997 Pavlović I. Turin. dezisekcija i deratizacija u zaštiti životne sredine sa međunarodnim učešćem. Ćurčin Lj. 293-300... Tijdschr Dieregneeskund. Paris. Stevanović S.. Pavlović I. Petković D. 2. Carlo Denegri Fondation & Infectious Disease. 2005..: Toxocariasa – larva migrans in humans and animals. Jornal de Pediatria..Karamelo. Regina L.: Seroepidemiological Investigation of Toxocariasis in the Isparta Region of Turkey. 15. CD rom Pavlović I. Suddeutchlande Tierrätzlitche Praxis 18. van Knapen F.. Vučinić M. Rocha T.: Atlas of Coproscopy. Reference 1. 10.. Carvalho A. Neum. Those result with increase of number of non-owner dogs.. 51. 8. Milutinović M.: Rezultati parazitološkog ispitivanja peščanih igrališta za decu u užem centru Beograda. 2007.S. green areas and etc. 2009.: Metode parazitološke kontrole kontaminiranosti zelenih površina u urbanim sredinama.: Parasites contamination of grasy areas of Belgrade in period 2003 . activities related to the parasitological control of green areas will terminate and implementation of Strategies for addressing non-owner of dogs in the City of Belgrade will partially apply. 2.. Önal S. Çetin E. 2011 Euzeby J. 87. Beograd. 11. 2005... 5259.

Beograd. Pilarczyk B. 69-74 18. 1976 274 .Damnjanović B...W. 19. Marković M. Wiadomooeci Parazytologiczne. 84.First International Symposium of Veterinary Medicine – ISVM2015 International Scientific Conference on Innovative Strategies and Technologies in Environment Protection. 2012.Radenković. 56. Woodruff A. 269–276. Gregorczyk A.44-46 17. Poland. Zbornik predavanja XXXIII seminar za inovacije znanja veterinara.. 2010... Vukićević-Radić O. Dimitrijević S. Templin E. Tufegdžić N. Prokić B.: Strategija grada Beograda o zbrinjavanju napuštenih pasa i mačaka.: Toxocariasis as a public health problem. Terzin. 29-31... Tylkowska A. V. Environent and Health.. Pavlović I. 3..: Gastrointestinal helminths of dogs in Western Pomerania.. Čukić B. 2012..

Belgrade. Through the surveillance and monitoring of Trichinella spp. Human health problem is mainly the consequence of high prevalence of infection in domestic animals. many are present in the endemic district of Branicevo and Podunavlje. infection was detected in domestic and wild animals. spiralis or T. After examination of muscle samples from wild and domestic animals for presents of Trichinella larvae. Serbia 4 Faculty of Veterinary medicine. in wild boars (Sus scrofa). Key words: Trichinella spp. wolves (Canis lupus). The aims of the present study were to define risk factors in transmission of Trichinella spp. in domestic animals and synanthropic and wild animals.First International Symposium of Veterinary Medicine – ISVM2015 RISK FACTORS IN DOMESTIC AND WILD CYCLES OF TRICHINELLA SPECIES Milena Zivojinović1*.com Abstract In the Balkan region of Europe. Trichinella spp. in domestic pigs and synanthropic and wild animals through surveillance and monitoring of Trichinella spp. These zoonotic parasites are a serious problem for the human health and animal husbandry in Serbia. 12000 Pozarevac. the owners of pig farms and slaughterhouses and hunter’s associations about the risk of transmission of these zoonotic agents. infections are endemic. infections are endemic. transmission Introduction In the Balkan region of Europe. hunting section. stray dogs (Canis familiaris) and domestic pigs (Sus scrofa domestica) we investigated presents and possible pathways for transmission of Trichinella species.. zoonotic. wild. Serbia * Corresponding author: povetinst_milenaz@hotmail. GIS (Geografical Information System) was used for mapping the spatial distribution of Trichinella spp. The aims of the present study were to define risk factors in transmission of Trichinella spp. The identification of Trichinella spp. Ljiljana Sofronic Milosavljević2. and dumps). domestic. scavenging on garbage dumps by pigs and dogs. Trichinella spiralis and Trichinella britovi were the only two species identified in the isolates as single or mixed infections. Serbia Institute for the Application of Nuclear Energy – INEP. especially swine. and include intentional feeding of food waste containing pork scraps. Ministry of Agriculture and Environmental protection. University of Belgrade. Dunavska 89. Trichinella spp. 2005). genotyping was performed by multiplex PCR. Serbia 3 Veterinary Directorate. red foxes (Vulpes vulpes). The results point out the circulating of Trichinella species by a domestic or a sylvatic cycle. and disposing of animal carcasses in the field which allows sylvatic animals to scavenge on carcasses of infected domestic swine and increases the probability of transmission to new hosts. Trichinella spp. positive animals allowed to identify the foci of transmission and to inform the veterinary services. Budimir Plavsic3 Zoran Kulisic4. These zoonotic parasites are a serious problem for the human health and animal husbandry in Serbia (Cuperlovic et al. infected animals and all defined point of interest (pig farms.. Belgrade. University of Belgrade. According to the most important risk factors for trichinellosis in the domestic and sylvatic cycles (Pozio. the transmission between these two cycles and the role of some host species as reservoirs of T. among wild and domestic animals in this region. slaughterhouses. 275 . 2007). golden jackals (Canis aureus). Sonja Radojicic4 1 2 Veterinary Specialistic Institute ‘‘Pozarevac’’. Ivan Dobrosavljevic1. britovi or of both species in Serbia.

infected animals and all defined point of interest (pig farms. The epizootiological surveillance of swine trichinellosis was performed using data from the Animal Notification System..First International Symposium of Veterinary Medicine – ISVM2015 Materials and methods Through the surveillance and monitoring of Trichinella spp. GIS (Geographical Information System) was used for mapping the spatial distribution of Trichinella spp. we investigated presents and possible pathways for transmission of Trichinella species in domestic and wild animals. 118 red foxes (Vulpes vulpes).Gradiste. slaughterhouses. V. Pig meat samples were examined by trichinoscopy and/or artificial digestion at veterinary stations. Larvae were identified at the species level by multiplex PCR at the International Trichinella Reference Center (ISS.it/crlp). 276 . During the period 2010. 30 stray dogs and from 338 wild animals including 174 wild boars (Sus scrofa). Crnice and Zabari as endemic Trichinella districts and established measures for control (Zivojinovic et al. and 4 wolves (Canis lupus). In the case of a positive finding. counted in triplicate and fixed in absolute ethyl alcohol for molecular typing. 2075/2005 (European Community) and the Manual of Standards for diagnostic tests and vaccines for terrestrial animals of the World Health Organization for Animal Health (OIE.707 domestic pigs. information was submitted to veterinary inspectors. the pig owner supplied a new sample. 2008). 42 golden jackals (Canis aureus). The re-emergence of trichinellosis was officially recognized in 1999 and in 2003. laboratory results. according to Regulation (EC) No. M. veterinary services. Results and Discussion Trichinellosis is the one of most important zoonosis in the regions Branicevo and Podunavlje. Italy) and at the INEP. Trichinella larvae recovered after artificial digestion were washed three to five times in cold water.iss. Golubac. When the sample size or types of muscle were inadequate. Kucevo. government declared parishes Pozarevac. 2009). muscle samples were collected from 192. veterinary ambulances and slaughterhouses. The worm burdens were expressed as the number of larvae per gram of muscle tissue (LPG). and dumps). Figure 1 – Trichinella prevalence in the region of Branicevo and Podunavlje in period 1995-2012. hunting section. Rome. geographical and epizootiological surveillance data. Muscle samples from wild animals provided by hunters were analyzed by artificial digestion at the VSI of Pozarevac. according to the protocol accredited at the European Union Reference Laboratory for Parasites (http://www.

systematic rodent control and improvement of biosafety measures at pig production facilities. Trichinella infections were detected in 27 wild animals (7. The decrease in prevalence can be explained by the continued application of the control program organized at the VSI which is based on: the identification of all the pig farms.78%) red foxes. A significant increase (0. antihelminthic treatment of pigs with mebendazole. hunters and consumers was also included in the control program.99%). Swine that have been examined at slaughterhouses are mainly from big farms with high level of biosecurity measures which is in accordance with determined t value (t=10. britovi was detected only in population of wild animals: 1 wild boar. 40. Trichinella infection was detected in 25 (11..98% were with Trichinella infection. The larvae isolated from 25 pigs were identified as T. 8 (19.07%) pigs.First International Symposium of Veterinary Medicine – ISVM2015 Results from meat inspection at Branicevo and Podunavlje regions over an 18-year period (1995– 2012) indicated that the level of Trichinella prevalence in slaughter domestic swine was relatively steady from 1995 to 1998 (Figure 1). In fact. All of them were stray dogs from municipality Pozarevac. The LPG was from 0.27%) (Zivojinovic et al.2. the incidence declined from 2006 to 2010 with low increase in 2011 (0.707 No of Trichinella infected 13 123 136 % 0. spiralis 277 . At slaughterhouses from 116. 1 red fox and 4 wolves. while at industrial farms that percent was 0%. In the last 100 years. The common habit of hunters is leaving animal carcasses in the field after skinning or removing and discarding the entrails.01 0. from the total number of pigs from households. 2009). Trichinella infection has been detected in 123 (0..966 75. T. 2006). T.707 muscle samples Trichinella infections were detected in 136 (0.85%) samples.15%) (Fig. Thereafter. During the same period. spiralis. 13 samples (0. Table 1 – Results of examinations domestic pigs in slaughterhouses and households in districts of Branicevo and Podunavlje in 2010 Location of examination Slaughterhouses Households In total No of examinated pigs 116. concomitant with a decrease in farms.16 0.839%) was observed from 1999 to 2004 followed by a significant decrease in 2005 (0. in Europe over the past 100 years has facilitated a great expansion of wild boar (Sus scrofa) populations in some regions and increased transmission of Trichinella to animals and humans. which increases the probability of transmission to new hosts (Pozio and Murrell.04 to 3. 1 golden jackal. T.741 households. During the period 2010. The education of farmers.07 We isolated 211 samples of domestic pigs which originated from households where Trichinella infection was found in 2010 and 150 samples of pigs from big industrial farms.01) in percent of positive findings at slaughterhouses and slaughtering at households (Table 1). 2010). which included 7 (4.01%) were positive. spiralis was detected in 5 red foxes and 3 wild boars. In total of 30 dogs from Branicevo and Podunavlje districts Trichinella infection were found in 7 (23.05%) golden jackals and 4 wolves (Table 2). The worm burdens were expressed as the number of larvae per gram of muscle tissue (LPG) and it was from 0. 1). while from 75. mix infection with T.118) and statistically significant difference (p<0. while 186 (88. from 192.02%) wild boars.741 192.33%).03 to 20. spiralis was the only specie found in dog population. the increase in forests and fallow land.16%) pigs.15%) samples were negative.966 samples. 8 (6. and the traceability of infected animals (Zivojinovic et al.

water currents in the backyard and near the backyard. spiralis and T. 2009). the husbandry conditions on 90% of these backyard farms are very poor due to the intentional feeding of food waste containing pork scraps. Introduced to the Animal Notification System (ANS) and approached only by licensed users. 2006.. britovi circulate among wild and domestic animals (Blaga et al. the most important risk factors for domestic cycle are: 1) the intentional feeding of food waste containing pork scraps (Gamble et al.99%) The larval burdens related to T. the Danube River forms a natural border between Serbia and Romania where T. spiralis and T. Table 2. spiralis ranged from 0.First International Symposium of Veterinary Medicine – ISVM2015 and T.12.2. 2009). Kubursnica.05%) 4 (100%) 27 (7. Danube. britovi was detected in 2 red foxes and 1 golden jackal. britovi are the two main species circulating in Europe (Pozio et al. former parasitological examinations of slaughtered swine from the same farm. Mlava. swine age category.12 to 8.45 and mixed infections with both T. 2000) or intentional or unintentional exposure to carcasses of dead swine or wildlife.93%) 8 (6..g. anti-helminthic treatment of swine. Results of examinations wild animals by artificial digestion in districts of Branicevo and Podunavlje in 2010. these risks are usually encountered in free-range pasturing 2) pigs allowed to scavenge on garbage dumps 3) feeding of wild game carcasses or scraps from hunting 4) horses fed with pork scraps or with carcasses of fur animals 5) sled dogs fed with carcasses of other dogs or of game in the arctic 6) the use of carcasses of slaughtered fur animals as food for other fur animals present at the farm 7) the use of meat of slaughtered crocodiles to feed other farmed crocodiles as observed in Zimbabwe 8) the use of pork scraps to feed young crocodiles as demonstrated in Papua New Guinea. spiralis and T. type of production (fattening or reproduction). 2009) and in particular in the Romanian counties bordering Serbia (Blaga et al. Pek.. whether breeding of swine was the only occupation of the owner. the spatial and temporal patterns of Trichinella infections in domestic pigs have been recorded for Branicevo and Podunavlje area (Zivojinovic et al. The lowest and the highest worm burdens were detected in a wild boar and in a golden jackal..11 to 19. Our results. britovi from 0. presence of stagnant water. According to Pozio and Murrell.. T. existence of Trichinella infected swine in the yard. In our work. Jasenica. spiralis in domestic pigs as well as wild animals hunted near human settlements. 2011). support the role of wolves as 278 . small waterways and ponds where they can be in touch with wildlife. Also. Veliki Lug). We identified risk factors such as the behavior to raise pigs near rivers (e. 2010). as well as those from other authors (Cvetkovic et al. scavenging of pigs in garbage dumps and the improper disposing of pig carcasses in the field. Morava..78%) 8 (19. T. number and species of all animals on farm. respectively. data collected contributed to a better knowledge on endemic foci and traceability. britovi from 0. feeding practices (whether swine are fed with scraps or whether they have access to free ranging). breeding conditions. epizootiological data were obtained by a questionnaire which included data on the type of farm. contact with swine from other husbandries or with wild animals. Furthermore for 10 settlements of this region. which explained the finding of T. Animal species No of examinated samples No of Trichinella infected animals (%) Wild boars (Sus scrofa) Red foxes (Vulpes vulpes) Golden jackals (Canis aureus) Wolves (Canis lupus) In total: 174 118 42 4 338 7 (5..97 to 7. Since 2006.

routes and track. points of interest – proximity of main roads. offered a new approach and possibilities for the eradication or control of infectious diseases. (Zivojinovic et al. it is mandatory to report Trichinella findings in pigs to the veterinary services (Plavsic et al. hunting sections. Figure 1 – Geographical location of big industrial swine farms (n = 5) in Branicevo and Podunavlje region Figure 2 – Geographical location of hunting sections (26) in Branicevo and Podunavlje region 279 . Taiwan) that contains maps. 2009) because of their zoonotic potential. garbage dumps). forests with wild animals.First International Symposium of Veterinary Medicine – ISVM2015 the main reservoir of T. britovi in Serbia. such as Geographical Information Systems (GIS). longitude) of farm/ premises where Trichinella infection has been detected. water currents. and 2) all collected by application of GARMIN Map Source (Garmin. We used geographical data included location (latitude.. industrial farms and slaughterhouses (Figure 1. waypoints. The first report of GIS application in Serbia was for surveillance and monitoring of Trichinella spp. 2010) at district Branicevo. object relationship (proximity of piggeries to stagnant water.. Application of tools for epizootiological investigations in veterinary medicine. GIS is particularly useful for research conducted in small areas strongly impacted by man. In Serbia.

Veliko Gradiste.britovi) 280 T. Kucevo. According to geographical distribution at Branicevo district.spiralis and T. all settlements were recognized for the presence of Trichinella infection. Golubac. spiralis was present. britovi. but at Podunavlje district only T.82% of investigated territory we confirmed presents of Trichinella species (Figure 3).britovi. Velika Plana and Smederevska Palanka) which present 81. at territory of nine (Pozarevac.First International Symposium of Veterinary Medicine – ISVM2015 Spatial and temporal patterns of Trichinella infection were made for the Branicevo and Podunavlje. Smederevo. Malo Crnice. . From 11 investigated municipalities. Figure 3 – Geographical location of Trichinella infected domestic pigs in Branicevo and Podunavlje region Figure 4 – Geographical location of Trichinella species in Branicevo and Podunavlje region ( T. Mix infection with T. Zabari. we identified presence of T.spiralis. spiralis and T.

Cirovic.. M. 218–221.. Vet Parasitol.g.: Re-emergence of trichinellosis in southeastern Europe due to political and economic changes. The husbandry conditions on 90% of backyard farms with Trichinella infection are very poor. SofronicMilosavljevic. Pek. Malo Crnice. S. Blaga. Vasilev. Golubac. 60-82. britovi circulate among wild and domestic animals (Blaga et al. We also marked all 26 hunting sections at this territory in aim to investigate Trichinella infection in wild animals. 5. 3.. 2009). Boireau.. 232–235. red foxes.. Morava. the owners of pig farms and slaughterhouses and hunter’s associations about the risk of transmission of these zoonotic agents. Parasitol.. Possibility of sylvatic animals fed with carcasses of infected swine is present. scavenging of pigs in garbage dumps and the improper disposing of pig carcasses in the field (Zivojinovic et al. 2010). Veliki Lug) small waterways and ponds where they can be in touch with wildlife (Zivojinovic et al. Mlava. 159. 159–166.. Jasenica. A. Pigs and dogs allowed scavenging on garbage dumps (Zivojinovic et al. Petrovac and Zagubica). Kucevo. Trichinella spiralis and Trichinella britovi were the only two species identified in the isolates as single or mixed infections (Figure 4). Cozma. S.. Pozio. 56. Bessonov A. J.. 2013). Vasilev. Schenone H. spiralis and T... J. E.: International Commission on Trichinellosis: recommendations on methods for the control of Trichinella in domestic and wild animals intended for human consumption. For 10 out of 256 settlements of this region. The identification of Trichinella spp. 2009 Cuperlovic. the Danube River forms a natural border between Serbia and Romania where T. K. 2.. Five big industrial farms were recognized as Trichinella free (Figure 1). Gherman. spiralis in domestic pigs as well as wild animals hunted near human settlements can be explained by the behaviour to raise pigs near rivers (e. necessary for monitoring parasite flow between the domestic and sylvatic cycles (Figure 2). There is a influence of human action such as the habit of living animal caracasses in the field. Zhu X.Regulation (EC) No 2075/2005 of the European Parliament and of the Council of 5 December 2005 laying down specific rules on official controls for Trichinella in meat. C. 2011 European Community (2005) ... In population of wild boars. Lj. 2005 Cvetkovic. Danube. Nockler K.. Veliko Gradiste.A..: First report of Trichinella britovi 177 in Serbia. P. especially for free range pigs which are common in this area. Vet. Cuperlovic K. van Knapen F. The finding of T. There is intentional feeding of food waste containing pork scraps. 2000 281 . Off. 132. D. positive animals allowed to identify the foci of transmission and to inform the veterinary services. Pavlovic. Gajadhar A. Conclusion According to our results.R. which increase the probability of transmission to new hosts. G.... Djordjevic. V..S. Vet. Gamble H. D.. References 1. Parasitol.. Acta Parasitol.393-408.First International Symposium of Veterinary Medicine – ISVM2015 Trichinella infection hasn’t been confirmed in two municipalities Petrovac and Zagubica. 93.: Trichinella species circulating among wild and domestic animals in 174 Romania. we concluded that risk factors for circulating Trichinella species between domestic and wild species are numerously at Branicevo and Podunavlje district.. R.. EC.. Teodorovic. golden jackals and wolves Trichinella infection has been confirmed in seven municipalities (Pozarevac. Marucci. Zocevic. 2013).. V. Kubursnica. 4. Trichinella infection only in population of wild animals at territory of those two municipalities Petrovac and Zagubica indicated high risk for domestic pigs. L 338.

39.. Sofronic-Milosavljevic Lj.. Plavsic. 71–79.. 2009 11. 2006Pozio... G.. Pozio E. Sofronic-Milosavljevic. Dimitrijevic G. Interisano M.. Zivojinovic M.: Hosts and habitats of Trichinella spiralis and 196 Trichinella britovi in Europe. Boireau. 136-138.. Murrell K.. Pozio E... Pozio E. 358-360. S. Lazic M. Parasitol. 2013 282 . N... Petrovic M. Musella. prevention and control of trichinellosis... 368-439.. Lj.) 59. Taxonomy.First International Symposium of Veterinary Medicine – ISVM2015 6. R. M. Krnjajic.. Vet.. F. 2009 8. Marucci. 31-35. Milanovic. 195 P. 10....: Systematics and epidemiology of Trichinella. Stanojevic. Micovic. V.: Trichinella infections in different host species of an endemic district of Serbia. Vet. D. Nedic... Adv. (Beogr. Guidelines for the surveillance. 305-313 7. E.. Plavsic B. Parasitol. Parasitol. G. 159.: Trichinella prevalence in swine in an endemic district in Serbia: Epidemiology and control. 2008). Cringoli. management. 63. 189 Tajdic. Zivojinovic. Z. Radojicic. La Rosa.. 17. Cvetkovic J. Int. 99–108. Asanin. Acta Vet.. 2009 9. S. D. FAO/WHO/OIE. Parasite. Rinaldi.. Sofronic-Milosavljevic Lj. 194. Radojicic S. Zivojinovic M. biology and epidemiology of Trichinella parasites. Z.. Kulisic Z.D. The Manual of Standards for diagnostic tests and vaccines for terrestrial animals of the World Health Organization for Animal Health (OIE. Parasitol.. 369373. S. 2007.:Application of GIS in epizootiological surveillance of swine trichinellosis in one endemic district in Serbia. B.. G.. L. Kulisic.. Galati. 2010 12.: Veterinary information management system (VIMS) in the process of notification and management of animal diseases. J.

First International Symposium of Veterinary Medicine – ISVM2015

INSIGHT INTO THE PRESENT PESTICIDE CONTAMINATION AND COPEPODS
STATUS (Crustacea: Copepoda) OF SURFACE WATER IN IRRIGATION CANALS IN
VOJVODINA
Vojislava Bursić1*, Gorica Vuković2, Aleksandra Petrović1, Maja Meseldžija1, Tijana Zeremski3,
Aleksandar Jurišić1, Dragana Rajković1
1

Department of Environmental and Plant Protection, Faculty of Agriculture, University of Novi Sad, Novi Sad, Serbia
2
Institute of Public Health of Belgrade, Serbia
3
Institute of Field and Vegetable Crops, Novi Sad, Serbia
* Corresponding author: bursicv@polj.uns.ac.rs

Abstract
The concern about environmental and health issue related to pesticides makes it important to
understand the possible hazards associated with their use and how to minimize risks. The use of
agrichemicals has been steadily increasing in the country during the last three decades and has
continued to grow in recent years. The fate of pesticides in the environment depends, above all, on
their persistence, but also on the characteristics of soil and water. In order to avoid harmful effects
on health and the environment due to the exposure to pesticides and to obtain more data which
would be the basis for the list-legislation setting the maximum residue levels of pesticides in surface
waters, the work on it needs to be ongoing and thorough. In order to gain the insight into the present
pesticide contamination of surface water, two main irrigation canals in Vojvodina (Serbia) Čelarevo
and Vrbas were examined for the pesticide residue content and presence of copepods as
bioindicators by sampling water monthly from December 2013 to November 2014. The aim of this
work was to determine the trace levels of twenty-one pesticides and the products of their
transformation in irrigation canals, from triazine and urea herbicides and their influence on
copepods species diversity and abundance in canal water. A simple multiresidue method was used
for the determination of herbicides in surface water using LC-MS/MS with ESI. The water analyses
pointed at the detection of the pesticides whose detected values are above the maximum available
concentrations – MACs in the period from May to October. Species identification and zooplankton
abundance calculation were conducted by the filtration of the water samples and examination of the
residues using a stereo camera BTC TCA-3.0C with the maximum magnification of 160x. The
water samples obtained from the locality Čelarevo had high abundance of copepods from two
genera (Diaptomus and Cyclops) in summer. However, in the water samples from the locality Vrbas
no copepod species were found due to the pesticide residues presence.
Keywords: pesticide residues, copepods, fresh water, canals

Introduction
Among all anthropogenic chemicals, the pesticides may cause the most serious problems in the
environment as they are chemicals specifically designed to kill organisms (both the pest target and
other non-target organisms) and they are released into the natural environment intentionally
(Hanazato, 2001). The pesticides used in agriculture, forestry and water management demonstrate
multiple effects on molecules, cells, tissues, organs, individuals, populations and communities.
The presence of zooplankton is crucial in aquatic ecosystems because of their leading role in
maintenance of freshwater food chains as a necessary link between the primary producers, primary
and secondary consumers and decomposers. They provide food for the predator species, especially
283

First International Symposium of Veterinary Medicine – ISVM2015

amphibians and fish, and due to their fast and strong metabolic activity they also recycle certain
nutrients, and therefore feed on living material or detritus dissolving it. In aquaculture, copepods
have a multiple role: food for small fish, micropredators of fish and other organisms, fish parasites,
intermediate hosts of fish parasites and as hosts and vectors of human and animal diseases (Piasecki
et al., 2004).
According to Hanazato (2001), zooplanktons are one of the most sensitive animal groups to the
toxic effects of the chemicals. However, Braginskiiet al. (1979) have concluded that depending on
concentration, the pesticides may either suppress or stimulate the plankton organisms, although,
regarding the zooplankton, pesticides almost always lead to their elimination in freshwater
biocenoses. The abundance, species diversity and seasonal population dynamics of zooplankton
represent very sensitive and accurate bioindicators of freshwater ecosystems conditions, such as
water quality, eutrophication, pollution levels and presence of contaminants. Zooplanktons as well
as other aquatic organisms prefer habitats which have stabile and constant physical, chemical and
biological features. Variations in one or more of these abiotic and biotic factors could lead to stress,
migrations or even death of zooplankton individuals. Balakrishna et al. (2013) emphasize that
zooplankton has been widely used in assessment of aquatic pollution, because of their sensitivity to
small changes in the environment, short generation time and possible parthenogenesis. According to
Day (1990), zooplankton are known to accumulate persistent lipophilic chemicals, particularly the
organochlorine pesticides to concentrations greater than those found in their environment, and
therefore contribute the pesticide residues increase and maintenance in the higher trophic levels.
A lot of studies worldwide have confirmed the negative effect of pesticide residues on the
zooplankton in freshwater bodies worldwide (DeLorenzo et al., 2002; Mukherjee et al., 2010;
Stampfli et al., 2011; Dhembare, 2011), as well as on the freshwater copepods (Day, 1990;
Hanazato, 2001; Piasecki et al., 2004; Yiğit, 2006).
The intensive use of pesticides during recent decades has led to the accumulation of their residues in
the environment which especially endangers water quality in the canals in Serbia. Since the water of
rivers and canals are used for drinking and irrigation purposes not only in Serbia but in the whole
world as well, it has become imperative to study the extent and magnitude of pesticides in these
water bodies (Bursić et al., 2013). Data on pesticide residue effects on zooplankton in smaller water
bodies in Serbia are rare, so this study was aimed in obtaining preliminary insight into the present
pesticide contamination of two irrigation canals in Vojvodina and its effect on copepod species and
populations.

Material and Methods
In order to gain the insight into the present pesticide contamination of surface water and copepod
status, two main irrigation canals in Vojvodina, Čelarevo and Vrbas were examined by sampling
water monthly from December 2012 to October 2013, away from the zone of the direct influence of
waste water and tributaries influx. The water samples for analytical analysis (500 ml) were taken
according to the guidelines for taking samples of surface water from rivers and streams SRPS ISO
567-6. This water samples were stored in amber bottles in the dark, at 4 °C, during transport to the
laboratory until further analyses. The trace levels of twenty-one pesticides and the products of their
transformation in irrigation canals, from triazine and urea herbicides were determined. The water
samples (1000 ml) for qualitative and quantitative analysis of copepod status were taken using
Standard Ruttner Water Samplers (1000 ml volume). In order to increase positive sampling results
plankton nets were used for qualitative determination of species diversity. All samples were stored
in plastic bottles, properly labelled and transported to the laboratory for the further analysis.

284

First International Symposium of Veterinary Medicine – ISVM2015

Analytical method
The sample preparation was performed by OASIS HLB cartridges (200 mg). They were conditioned
with 2 ml of methanol and 2 ml of HPLC - grade water. After conditioning step, 250 ml volume of
water was enriched on OASIS HLB cartridge with the flow rate settled between 3 and 10 ml/min.
The cartridge was flushed with 10 ml of HPLC - grade water. Pesticides were eluted from the
sorbent with 5 ml dichloromethane and collected in the 12 ml amber glass vial. The solvent was
evaporated in the stream of nitrogen in the Techne - Dry block and the residue was dissolved in the
0.25 ml of initial mobile phase. An amount of 10 µl was injected into LC-MS-MS system.
Stock standard solutions for each of the analyses were prepared in acetonitrile at 100 µg/ml and
stored in the dark at 4 °C. Standard solutions of the mixtures of all compounds at concentrations
ranging between 10 ng/ml and 200 ng/ml were prepared by appropriate dilution of the stock
solutions in acetonitrile. High purity standards (mixture of pesticides) were purchased from LGC
Standards.
The analytical conditions for the determination of pesticides are shown in Table 1. In LC-MS-MS,
data acquisition was performed in multiple reaction monitoring (MRM) modes.
Table 1. LC-MS/MS l conditions
HPLC
Column
Column temperature
Mobile phase
Flow rate
Injection
MS
Ionisation
Nebulizer gas
Dry gas
Vaporiser
Charging Voltage
Capillary

Agilent 1200
XBridge C18, 150 x 3.0 mm, 3.5 µm, Waters
40 °C
A = 0.1 % HCOOH in methanol
B = 0.1 % HCOOH in water
A: B = 70 : 30
0.5 ml/min
10 μl
Agilent 6410
ESI
50 psi
5 L/min at 350 °C
250 °C
2000 V
3500 V

Copepode sampling
The sampling of copepod species was conducted by the filtration of the water samples (1000 ml)
and examination of the residues, using a stereo camera BTC TCA-3.0C with the maximum
magnification of 160x. The copepod species were identified up to genera level according to Dussart
(1969) identification keys.

Results
Analytical method
MRM conditions for QQQ and coefficients of correlation with validation parameters are presented
in Table 2.The obtained limits of quantification - LOQs for all twenty-one investigated pesticides
were 0.020 µg/l (Fig. 1).

285

First International Symposium of Veterinary Medicine – ISVM2015

In the samples obtained from the canal Vrbas twelve pesticides were detected during the whole
research period. The highest concentrations have had terbuthylazine-desethyl in May and prometryn
in July 2013 (Graph. 1.).

Fig. 1. TIC MRM chromatogram from NE7500 0.1 μg/mL

Table 2. MRM conditions for QQQ and coefficients of correlation with validation parameters
Pesticide

MRM transition
(m/z)

MW

Atrazine

215

Carbetamide

237

Chloridazon

221

Chlorotoluron

212

Cyanazine

240

Desethylatrazine

187

Desisopropyl-atrazine

173

Dimefuron

338

Diuron

232

Ethidimuron

464

Isoproturon

206

Linuron

248

Metabromuron

258

Metamitron

202

Metazachlor

277

Methabenzthiazuron

221

Metolachlor

283

Propazine

229

Simazine

201

Terbuthylazine

229

Terbuthylazine-desethyl

201

216→174
216→ 96
238 → 72
238 →192
222 →104
222 → 92
213 → 46
213 → 72
241 →214
241 →104
188 →146
188 →104
174 →104
174 → 68
339 →256
339 →140
233 → 72
233 →160
265 →208
265 →162
207 → 72
207 →165
249 →160
249 →182
259 →170
259 →148
203 →104
203 →175
278 →134
278 →210
222 →165
222 →150
284 →252
284 →176
230 →146
230 →188
202 →132
202 → 96
230 →174
230 →104
202 →146
202 →110

286

tR (min)

R2

Recovery±RSD
(%)

16.724

1.000

82.93±5.77

10.464

0.9998

91.10±5.17

4.959

0.9998

91.20±5.10

16.209

0.9998

85.83±4.90

10.912

0.9998

82.30±6.17

6.165

0.9997

88.63±5.93

3.036

0.9999

76.43±6.73

22.103

0.9981

76.27±6.97

18.474

0.9999

76.57±3.97

3.628

0.9987

107.77±6.93

18.056

1.000

68.87±8.93

22.163

0.9998

74.37±6.57

16.469

0.9997

73.33±6.00

4.401

0.9998

72.00±4.63

18.067

1.000

81.63±5.50

16.830

1.000

83.83±4.97

24.409

0.9996

74.47±5.80

22.054

0.9993

73.53±6.77

11.658

0.9999

83.93±5.23

22.499

0.9996

70.70±7.60

13.948

0.9997

85.63±8.62

First International Symposium of Veterinary Medicine – ISVM2015

The water samples from the canal Čelarevo have had eight detected pesticides, only from May till
October 2013, when the concentration of prometryn was the highest (10.57μg/l). High
concentrations were obtained also for terbuthylazine-desethyl in May (Graph. 2.)

Graph. 1. Detected pesticides in the samples from canal Vrbas (detected concentration – μg/l)

Graph. 2. Detected pesticides in the samples from canal Čelarevo (detected
concentration – μg/L)

Copepode samplings
During one year research period, no copepod species were found in the water samples obtained
from the canal Vrbas. Only two genera, Cyclops and Diaptomus were detected in the canal
Čelarevo, with very low population densities (Tab. 3.).The highest abundance for Cyclops sp. was
detected during September and for Diaptomus sp. during August 2013.
287

First International Symposium of Veterinary Medicine – ISVM2015

Čelarevo

Vrbas

Tab. 3. The copepods population densities (ind/l)
dec. 12

jan. 13

feb. 13

mar. 13

apr. 13

maj. 13

jun. 13

jul. 13

avg. 13

sep. 13

okt. 13

nov. 13

Cyclops sp.

0.00000

0.00000

0.00000

0.00000

0.00000

0.00000

0.00000

0.00000

0.00000

0.00000

0.00000

0.00000

Diaptomus sp.

0.00000

0.00000

0.00000

0.00000

0.00000

0.00000

0.00000

0.00000

0.00000

0.00000

0.00000

0.00000

Cyclops sp.

1.33333

0.66667

1.33333

2.00000

3.33333

3.33333

6.66667 14.00000 16.66667 17.33333 12.00000 10.00000

Diaptomus sp.

0.00000

0.66667

0.66667

1.33333

2.66667

4.00000

5.33333

9.33333 13.33333 12.66667

9.33333

6.66667

Discussion and Conclusion
Based on the results of the pesticide residues analyses in the canal water and in accordance with
Directive 2008/105/EC, which by Annex X defines the list of priority substances in water
management policy comprising 33 pollutants out of which 14 are pesticides. Our research work
pointed at the detection of the pesticides which are not on that list but whose detected values are
above the maximum available concentrations – MACs.
Twelve herbicides were registered in the water samples from the canal Vrbas and eight from the
canal Čelarevo. Although water samples obtained from the canal Čelarevo have had lower number
of detected pesticides, their concentrations were higher (over 10 μg/L) comparing to results
acquired from the canal Vrbas.
The small values for population densities of copepod species in spring could be explained by the
fact that neonates are most sensitive to pesticides (Hanazato, 2001). Therefore, populations
composed of a large proportion of neonates are more sensitive to pesticides, which are frequently
happened in a growing phase, when the production of the neonates is intensive. Low population
densities and species diversity of copepods could be also conditioned by their annual fluctuations.
Normally, zooplankton abundance is higher in spring and autumn and lower in summer and winter,
as their abundance is limited by nutrient availability (Yigit, 2006).
The pesticides that have had the highest concentration at both localities were terbuthylazinedesethyl and prometryn. According to Kegley et al. (2014) there are no valid data for aquatic
ecotoxicity ground water contamination of terbuthylazine-desethyl, although terbuthylazine itself is
highly toxic for zooplankton and moderately toxic for fish. The same authors emphasize that this
pesticide demonstrates multiple effects on zooplankton, such as accumulation, intoxication and
mortality. Prometryn is slightly too moderately toxic for zooplankton, causing intoxication and
mortality and potential ground water contaminant (Kegley et al., 2014).
However, all pesticides have had low concentrations at both localities, so apparently they are not
the main reason for none (Vrbas) or small copepod population densities (Čelarevo). According to
Day (1990), organophosphate insecticides, the synthetic pyrethroids, many herbicides and their
residues may not be detectable in the organisms (not bioaccumulated to any extent) and have no
observable biological effects, but the organism may experience a toxic effect. Furthermore, such
chemicals present a problem in the assessment of environmental damage from pesticide
contamination and techniques to detect the effects of very low concentrations of these nonlipophilic pesticides in natural waters on biota need further development (Day, 1990). Braginskii et
al. (1979) state that low concentrations of pesticides could have a stimulating effect on the
functional activity of bacterial plankton and changes coupled with this in biogeochemical cycles of
nitrogen and phosphorus, as well as the elimination of the water fleas from the zooplankton
promotes the development of the “secondary” eutrophication and increase the biomass of the
phytoplankton.

288

First International Symposium of Veterinary Medicine – ISVM2015

The main environmental hazard resulting from accumulated residues of pesticides in zooplankton is
their transfer to higher trophic levels (Day, 1990). In conclusion, pesticides along with the abiotic
and biotic factors play a crucial role in copepods species diversity and population dynamics.
Consequently, analysis of pesticides and their residues in the water, as well as their interaction with
zooplankton are important issues in ecotoxicologial and environmental studies.

Acknowledgement
The authors acknowledge the financial support of the Ministry of Education and Science, Republic
of Serbia, Project Ref. III43005 and TR31072.

References
1.

2.
3.

4.
5.

6.

7.
8.
9.
10.
11.
12.
13.

Balakrishna D., Mahesh T., Samatha D., Ravinder R.T.: Zooplankton Diversity Indices of Dharmasagar
Lake, Warangal District (A.P.). International Journal of Research in Biological Sciences, 3/3, 109-111,
2013
Braginskii L.P., Breskaravainaya V.D., Shcherban' E.P.: Reaction of freshwater phyto- and zooplankton
to pesticides. Biol Bull Acad Sci USSR, 6/4, 487-493, 1979
Bursić V., Gvozdenac S., Vuković G., Cara M., Pucarević M., Lazić S., Vuković S., Zeremski T., Inđić
D. (2013): Comparative study of pesticide residue levels in water from irrigation canal with LC-MS/MS
and biological methods, Proceeding bookof 3rd International Conference of Ecology “Essays on
Ecosystem and Environmental Research”, May 31- June 5., 2013. Tirana, Albania, 870-874
Day K.E.: Pesticide residues in Freshwater and Marine Zooplankton: A Review. Environmental
Pollution, 67, 205-222, 1990.
DeLorenzo M.E., Taylor L.A., Lund S.A., Pennington P.L., Strozier E.D., Fulton M.H.: Toxicity and
Bioconcentration Potential of the Agricultural Pesticide Endosulfan in Phytoplankton and Zooplankton.
Arch. Environ. Contam. Toxicol., 42, 173-181, 2002
Dhembare A.J.: Diversity and its Indices in Zooplankton with Physico-Chemical Properties of Mula
Dam Water Ahmednagar, Maharashtra, India. European Journal of Experimental Biology, 1/4, 98-103,
2011
Dussart B.: Les Copépodes des eaux continentales. (D'europe Occidentale), Tome II: Cyclopoïdes et
Biologie. Paris, 1969.
Hanazato T.: Pesticide effects on freshwater zooplankton: an ecological perspective. Environmental
Pollution, 112, 1-10, 2001.
Kegley S.E., Hill B.R., Orme S., Choi A.H.: PAN Pesticide Database, Pesticide Action Network, North
America (Oakland, CA, 2014), http:www.pesticideinfo.org
Mukherjee B., Nivedita M., Mukherjee D.: Plankton diversity and dynamics in a polluted eutophic lake,
Ranchi. Journal of Environmental Biology, 31/5, 827-839, 2010
Piasecki, W., Goodwin A.E., Eiras J.C., Nowak B.F.: Importance of Copepoda in Freshwater
Aquaculture. Zoological Studies, 43/2, 193-205, 2004
Stampfli N.C., Knillmann S., Liess M., Beketov M.A.: Environmental context determines community
sensitivity of freshwater zooplankton to a pesticide. Aquatic Toxicology, 104, 116-124, 2011.
Yiğit S.: Analysis of the Zooplankton Community by the Shannon-Weaver Index in Kesikköprü Dam
Lake, Turkey. Tarim Bilimleri Dergisi, 12/2, 216-220, 2006.

289

First International Symposium of Veterinary Medicine – ISVM2015

A SEROLOGICAL SURVEY ON AUJESZKY'S DISEASE IN WILD BOARS IN THE
REGION OF VOJVODINA IN SERBIA
Sava Lazić1*, Vesna Milićević2, Gospava Lazić1, Ljubiša Veljović2, Diana Lupulović1, Jasna
Prodanov-Radulović1, Jelena Maksimović-Zorić2, Siniša Grubač1, Radoslav Došen1,
Tamaš Petrović1
1
2

Scientific Veterinary Institute „Novi Sad“, Novi Sad, Serbia
Institute of Veterinary Medicine of Serbia, Belgrade, Serbia
* Corresponding author: lazic@niv.ns.ac.rs

Abstract
The article presents the results on the presence of specific antibodies against Aujeszky's disease
(AD) virus in blood samples of wild boars hunted in the territory of the Autonomous Province of
Vojvodina in R. Serbia during hunting season 2013-2014. Blood samples were collected during the
evisceration of internal organs in hunted wild boars, from the abdominal vein or heart chamber.
Examination for the presence of specific antibodies against AD was carried out in two virology
laboratories: Scientific Veterinary Institute of Serbia (Belgrade) and Scientific Veterinary Institute
"Novi Sad" (Novi Sad), using commercial ELISA kits for the detection of antibodies against AD.
The study included 434 blood samples of wild boars, originating from 6 locations, that is, epizootic
units in Vojvodina. According to the evaluation of the hunting organizations for the aforementioned
hunting season, the total population of wild boars in the 6 epizootic units included 7,065 animals.
Thus, this examination encompassed 6.14% of the total number of wild boars in the area of
Vojvodina Province.
Antibodies against AD were detected in 179 samples, making 41.24% of the total number of blood
samples. The greatest number of seropositive wild boars was established in epizootic unit of Srem,
where specific IgG anti-AD antibodies were detected in 68 (51.52%) of 132 tested samples. Also,
high percentage of seropositive samples was determined in the epizootic unit of West Bačka. In
total, 118 samples were analyzed, and 49.15% thereof reacted positive. The lowest rate of
seropositive samples was detected in the unit of Severna Bačka. In this epizootic unit, 24 blood
samples were tested, and antibodies against AD were found in 6 samples, which are still considered
high seropositivity percentage with 25% of positive animals.
The results of this examination indicated that Aujeszky's disease virus infection is widespread in the
population of wild boars in the territory of Vojvodina.
Keywords: Wild boar, Seroprevalence, Aujeszky’s disease, ELISA
Introduction
Wild boar (Sus scrofa) populations are found in many regions worldwide. The role of wild boar as a
reservoir of some viruses, and thus a possible source of infection for domestic swine and other
animals is still unclear (Müller et al., 2011; Ruiz-Fons et al., 2008). Aujeszky’s disease (AD,
pseudorabies) is a notifiable disease caused by Suid herpesvirus 1 (SuHV), syn. Aujeszky’s disease
virus (ADV), which belongs to the family Herpesviridae, subfamily Alphaherpesvirinae, genus
Varicellovirus (Mettenleiter, 2000). The Aujeszky’s disease virus (ADV) is an important pathogen
of pigs and infects almost all mammalian species except man (Keros et al., 2014; Pannwitz et al.,
2012). However, pigs are the only animal species that can survive the infection with ADV, which
accounts for its ability to be subclinically (latently) infected (Martinez-López et al., 2009) while
infected individuals of all other animal species succumb to the disease without shedding the virus
(Komáromi and Szabó, 2005). Because of the substantial economic losses AD causes to the pig
industry, it represents one of the most dangerous diseases in domestic pigs (Pannwitz et al., 2012).
290

First International Symposium of Veterinary Medicine – ISVM2015

In Europe, ADV has been eliminated from domestic pig populations in many countries (Müller et
al., 2011). However, despite the tremendous progress made to control and eliminate the disease in
domestic pigs, ADV infections appear to be widespread in populations of non-domestic swine,
including feral pigs, wild boar and hybrids, across the world (Pannwitz et al., 2012). First evidence
for the occurrence of ADV in wild boars was reported from the USA, Italy, and the Netherlands in
the mid-1980s (Müller et al., 2000). In recent years, ADV infections in wild boar populations have
also been reported from many European countries, including the Czech Republic, France, Slovenia,
Croatia, Poland, Russia, Switzerland and Spain (Albina et al., 2000; Sedlak et al., 2008; Župancic et
al., 2002; Vengust et al., 2006). Direct impact of AD in wild boar population dynamics is
considered to be low, but AD outbreaks with associated wild boar mortality have been reported and
restrictions to wild boar movements may also have an impact on wild boar production for hunting
(Ruiz-Fons et al., 2008).
There are no recently published data concerning detection the ADV in wild boars population in
Vojvodina province. However, Müller et al. (2011) have reported an ADV infection in border
regions between Hungary and Serbia, and Keros et al. (2014) suggested the possibility of virus
spread, especially among wild boars, between the borders of Croatia and Serbia. It should be
stressed that domestic pig population in Vojvodina is enzootically infected with ADV (Pušić et al.,
2011). One of the characteristics of outdoor swine production in some regions in Vojvodina
Province is raising free-roaming domestic pigs, where they share forest habitat with wild boars
(extensive grazing) (Prodanov-Radulović et al., 2011). In such conditions, the contacts between
wild boars and domestic pigs kept in woods (free range) may occur occasionally (Albina et al.,
2000). Since wild boars and domestic pigs have the same susceptibility to various infections,
including Morbus Aujeszky virus, there is a major concern to monitor the epidemiological situation
of wild boars especially when control measures in domestic pigs are implemented. The aim of the
current study was to investigate the presence of ADV antibodies in hunted wild boars of Vojvodina
region.

Material and methods
Blood samples and sampling procedure
Blood sampling was performed within the framework of monitoring of classical swine fever in wild
boar population pursuant to the “Instruction for monitoring of classical swine fever in wild boars in
2013 and 2014” (Veterinary directorate, No. 323-02-8407/2013-05, dated 28/10/2013). During
evisceration of internal organs of hunted wild boars, determination of animal’s age and blood
sampling was performed. The age was determined according to the number of molar teeth in the
lower jaw. All hunted animals were distributed into 4 age categories: 0-6 months, 6-18 months, 1.52.5 years and older than 2.5 years. Blood sampling was performed by puncture of abdominal vein
and/or heart chamber using disposable sterile plastic syringes and injection needles. The samples
were transferred into sterile 5 mL tubes and transported to the laboratories. Each sample was
accompanied by a Form containing relevant data on the hunting ground, shooting date,
identification number of hunted boar, material sample and animal’s age. Separation of blood serum
was performed by the method of spontaneous coagulation and/or centrifugation. Separated blood
serum was poured into the 2mL „eppendorf“ cuvettes and frozen at -20°C until testing. In this
manner, 434 wild boar blood serum samples were collected for the purpose of this research.
Localities for blood sampling
The territory of Vojvodina is divided into 6 epizootiological units that correspond with the
administrative regions, except for Banat epizootiological unit composed of two administrative
regions (North Banat and Middle Banat). The number of collected samples according to
291

First International Symposium of Veterinary Medicine – ISVM2015

epizootiological units was as following: Srem -132; West Bačka – 118; South Bačka – 117; North
Bačka – 24; Banat - 22 and South Banat – 21.
Blood sample examination
Detection of antibodies against Aujeszky’s disease virus was performed in the laboratories of the
Institute of Veterinary Medicine of Serbia, Belgrade and Scientific Veterinary Institute “Novi Sad”
in Novi Sad using commercial ELISA kits Ingezim ADV TOTAL and IDEXX PRV/ADV gB Ab
test.
Results
The obtained results were displayed in Tables. Data on the presence of ADV-specific antibodies in
the examined samples in relation to the number of examine samples and number of wild boars in
epizootiological units in Vojvodina, are presented in Table 1.
Table 1. Number of wild boars, number of examined blood sera and findings according to epizootiological
units in Vojvodina
No.

Epizootiological
unit

Srem
1
West Bačka
2
South Bačka
3
North Bačka
4
Banat
5
South Banat
6
Total

No. of wild
boars

No. of examined
blood sera

2,080
1,445
1,670
130
540
1,200
7,065

132
118
117
24
22
21
434

% of examined
samples compared
with the total number
of wild boars
6.35
8.17
7.00
18.46
4.07
1.75
6.14%

Finding: Number (%)
Positive

Negative

68 (51.52)
58 (49.15)
34 (29.06)
6 (25.00)
6 (27.27)
7 (33.33)
179(41.24)

64 (48.48)
60 (50.85)
83 (70.94)
18 (75.00)
16 (72.73)
14 (66.66)
288(58.76)

According to the data in Table 1, the greatest number of examined wild boar blood samples
originated from the epizootiological unit of Srem, which is characterized by the largest wild boar
population in the territory of Vojvodina. The number of samples examined in this epizootiological
unit was 132, and ADV-specific antibodies were detected in 68 samples indicating a seroprevalence
rate of 51.52%. High ADV seroprevalence of 49.15% was established in wild boars from West
Bačka epizootiological unit. However, in other epizootiological units, the ADV seroprevalence
ranged between 25% and 33%, indicating that more than a quarter of wild boar population in
Vojvodina is infected with Aujeszky’s disease.
The finding of antibodies against Aujeszky’s disease was presented according to the age of
examined wild boars. The data on the total number of examined blood samples and antibody finding
according to epizootiological units and animals’ age are displayed in Table 2.
Table 2: The finding of antibodies against Aujeszky’s disease according to the age of examined wild boars
from epizootiological units of Vojvodina
Epizootiological
unit
Srem
West Bačka
South Bačka
North Bačka
Banat
South Banat
Total

0-6 months
Exam Pos. (%)
14
6 (42.9)
4
0
8
2 (25)
4
0
3
1 (33)
0
33
9 (27.3)

Neg.
8
4
6
4
2
24

6-18 months
Exam. Pos.(%)
40
16 (40)
40
20 (50)
53
11(20.8)
14
2 (14.3)
9
1 (11)
10
2 (20)
166
52(31.3)

Neg.
24
20
42
12
8
8
114

292

1.5-2.5 years
Exam Pos.(%)
32
17 (53.1)
26
10 (38.5)
22
8 (36.4)
1
1
3
0
7
3 (42.6)
91
39(42.9)

Neg.
15
16
14
0
3
4
52

> 2.5 years
Exam Pos.(%)
46
29 (63)
48
28(58.3)
34
13(38.2)
5
3 (60)
7
4 (57)
4
2 (50)
144 79(54.9)

Neg.
17
20
21
2
3
2
65

the highest percentage of seropositive wild boars. 2014.First International Symposium of Veterinary Medicine – ISVM2015 As obvious from Table 2. Republic of Serbia. The lowest and highest seroprevalence rates were established in piglets below 6 months and boars > 2. high percentage of seropositive animals was detected in age categories > 2.3% and 50%. the following seroprevalence rates were reported in some countries: 51% in central Italy (Lari et al.2%. 2002. the highest prevalence of seropositive animals was established in the age category > 2.9%. In Srem epizootiological unit.3% Further research of Aujeszky’s disease in wild boars is necessary.5 years (144).. was recorded in the age category above 2.9%. wild carnivores.. however. 2002). The analysis of the results on seroprevalence of Aujeszky’s disease in Germany. The seroprevalence of Aujeszky’s disease in hunted wild boars in several countries and regions in Europe is variable. The results of several authors suggested the highest seroprevalence rates in oldest age categories of wild boars (Müller et al. However. As regards the age category. In South Bačka. 54. However.. and 30% in Slovakia (Sedlak et al. Republic of Serbia. being 27.5 years old being 27. being 38. Vengust et al. 2008). which was monitored throughout 24 years in 66 regions. Wild boars are potential infection reservoir for domestic pigs but also for other animals such as hunt dogs. Komáromi et al. virus identification in hunted wild boars using molecular methods has been increasingly reported during the past few years. especially in the aspect of the spread and persistence of the virus among the wild boar population. 2012).. 2006). whereas seropositivity rate among other age categories ranged between 20% and 36%. According to our results. ranging from 40% to 53%.. in some regions.. 2006.54% in Maslovačka Gora in Croatia (Župančić et al. 2006). 26% in Slovenia (Vengust et al.5 years. 63%. the seroprevalence rate reached even more than 30% during 2006 and 2007 (Pannwitz et al. The percentage of seropositive wild boars gradually increases with increase of animals’ age. The infection has commonly been confirmed by serological examination. Župancic et al. ranges between 0. Discussion The presented results indicate the presence of ADV infection in the population of wild boars in the territory of Vojvodina. Thus.5 years.3% and 54. whereas lowest rates were recorded in piglets below 6 months.5 was 54. the majority of examined wild boars were from the age category 6-18 months (166) and > 2. whereas only 33 examined animals were piglets from age category below 6 months. 2012.. Analysis of presented data on seroprevalence of Aujeszky’s disease according to age category of examined wild boars indicates close correlation of our results with those reported in the literature. antibodies against Aujeszky’s disease were detected in all age categories of wild boars in the epizootiological units of Srem and South Bačka. respectively.4 and 15. being 58. 2005) as well as from numerous countries in Europe and America (Müller et al. 293 . 2006).9%. In the unit of West Bačka.. etc. presented in this article are similar to the results reported in the majority of European countries. 2011). the percentage of seropositive animals of all age categories was quite high in this region. respectively..5 years and 6-18 months. yet generally high. The results on seroprevalence of Aujeszky’s disease among the wild boar population in Vojvodina region.. Molecular characterization of isolates of ADV in wild and domestic pigs as well as of virus isolates in other animal species could contribute to better understanding and elucidation of numerous epidemiological aspects of persistence and spread of Aujeszky’s disease in the environment. The occurrence of the disease in wild boars was confirmed and reported by several authors from neighbouring countries such as Croatia and Hungary (Keros et al. Lari et al.. the seroprevalence of Aujeszky’s disease in hunted wild boars older than 2.

. Dežđak D.. 53. Kramer M. Prpić J... 6.. 875-882. Burkhardt S.... Klupp BG.. 2005 Lari A.: Eradication of Aujeszky’s disease from a large-scale pig farm. porcine reproductive and respiratory syndrome. Hahn EC.: The transmission and spreading routes of Aujeszky’s disease in swine population. 7.. 176. 4.: Prevalence of antibodies to classical swine fever. Stojanov I.. 15.. Szabó I. 10–16. Prodanov-Radulović J.. 9. Tottewitz F. and bovine viral diarrhoea viruses in wild boars in Croatia. Stojanović D. 44. & Gortazar C. Biotechnol. Aujeszkyʼs disease. Le Potier M.: A review of viral diseases of the European wild boar: effects of population dynamics and reservoirs role. Le Gal S. Petrović T.F.J.. Klopries M. Valencak Z.. Hoffmann L.. 53 (4). Husb. Bourbao G.: A long-term serological survey on Aujeszkyʼs disease virus infections in wild boar in east Germany. Prev... Čač Ž.: Risk assessment and cost-effectiveness analysis of Aujeszky’s disease virus introduction through breeding and fattening pig movements into Spain. Journal of Veterinary Medicine. Lojkić M. 42 (2). Carpenter TE. Epidemiol. 140... Lorenzi D. Hahn EC. Jemeršić L. 62. Schaarschmidt U. 13.. Albina E.: Antibodies to selected viral diseas agents in wild boars from the Czech Republic. 156. Brnić D. Journal of wildlife diseases. Aujeszkyʼs disease (AD) and porcine reproductive and respiratory syndrome (PRRS) virus infections in French wild boars from 1991 to 1998.. Veterinary Microbiology. Leforban Y.. 2000 Müller T. 27-34. Nieper H. Infect. Med. 10. Jemeršić L. Acta Veterinaria Hungarica.. 512519. Bedeković T. 1691-1705.. Mesplede A. Chenut G.. Bidovec A.: Epizootical characteristics of Aujeszky's disease in Vojvodina region and biosecurity concerns. Lupulović D.. Starešina V. Conraths FJ. References 1. Acta Veterinariy Hungarica..... Archiv Virology. Selhorst T... and Müller T. Veterinary Research.. 5. 2011 Ruiz-Fons F. 4.: Aujeszkyʼs disease (pseudorabies) virus: the virus and molecular pathogenesis.. 2. 43-57. Jukić B. 27(3).. 319-324. Journal of Veterinary Medicine... Anim. Poli A. dedek J. Segales J..Anim. 8. Biotechnol. 2000 Müller T. Freuling C... 2008 Vengust G. Science and Technological Development of the Republic of Serbia.... 2006 Župancic Ž. 31. 2008 Sedlak K. 24-27. Nigrelli D.. 158–169.. Hlinak A. Vetrinary Journal. 99-115... 27. Vet. Denzin N. which was financially supported by the Ministry of Education. Došen R. 11. 3. Mettenleiter TC.. 90.. 3. Bartova E.: A serological survey on classical swine fever (CSF). Journal of Wildlife Diseases. Roić B.. Faccini S. 2006 Martinez-Lopez B... Freuling C.: Pseudorabies virus in wild swine: a global perspective. Pušić I.. 348-358. 2000 Keros T.: Characterisation of pseudorabies virus in domestic pigs and wild boars in Croatis..First International Symposium of Veterinary Medicine – ISVM2015 Acknowledgments The research was carried out in the framework of the Project No TR 31084. 14.. Series B: Infectious Diseasess and Veterinary Public Health. 2009 Mettenleiter TC. Brocchi E. Series B: Infectious Diseasess and Veterinary Public H 294 . 12. Stojanov I. 2011 Pušić I..Husb... 77. Machova J.. Conraths F. Došen R.. 777-780. Ratajac R..: Pseudorabies virus in European wild boar from central Italy. Kramer M. Infectious Disease Review. 2014 Komáromi M.: A serological survey of selected pathogens in wild boar in Slovenia. 515–524. Sanchez-Vizcaino JM. 2..: Pseudorabies virus infection (Aujeszkyʼs disease) in wild swine.. 2011 Pannwitz G.. 2012 Prodanov-Radulović J. Mettenleiter T.867-874.

Novi Sad. There is also more direct faecal contamination of the environment from humans and animals. as current treatment practices are unable to provide virus-free wastewater effluents (Bosh et al. for example by bathers or by defecation of farm animals and free-range or wild animals onto surface waters or soil. infection and disease (Sobsey and Meschke. soil. Several waterborne outbreaks of viral gastrointestinal 295 . such as norovirus. Siniša Grubač1. NoV GI. in total 60 surface water. adenovirus. 2013). Department of Biology and Ecology. human. and autumn (November-December). as well as indicate whether the examined surface waters could present a possible hazard for animal and public health. The presence of seven ((human (HAdV. transport and persistence in environment is directly related to the potential for and risk of transmission. animal (PAdV and BPyV) and zoonotic (HEV)) viruses in surface water and sewage samples was tested by real-time PCR (qPCR) and reverse transcription real-time PCR (RT-qPCR) assays. They are shed in extremely high numbers from infected individuals and they are stable in the environment for extended periods of time. Tamaš Petrović1 1 2 Scientific Veterinary Institute “Novi Sad”. they can survive for prolonged periods in the aquatic environment. hepatitis E and A viruses. Sava Lazić1. air. Serbia Introduction The environment receives. Some of these viruses have been suggested as a parameter for evaluating viral pollution of environmental waters (La Rosa et al. After the enteric viruses are discharged into water.. 2006). Water could be contaminated through direct inflow of untreated sewage. The presence of animal and human. Viruses can be transmitted through various environments (water.First International Symposium of Veterinary Medicine – ISVM2015 VIRUSES IN ENVIRONMENT: SITUATION IN VOJVODINA PROVINCE OF SERBIA Gospava Lazić1*. Pathogenic viruses are routinely introduced into the environment through the discharge of treated and untreated wastes. maintains and transports etiological agents to susceptible hosts. maintains and transports etiological agents to susceptible hosts. can cause infection and disease. Surface water is subject to faecal contamination from a variety of sources. Dejan Bugarski 1.. animal and zoonotic viruses were chosen to estimate the possible existence of route of human and animal faecal contamination.com Abstract The environment receives. Enteritic viruses can survive the water disinfection processes that eliminate bacteria (Carratala et al. especially zoonotic viruses in environment is intensively studied and monitored in a lot of countries worldwide. NoV GII and HAV). Serbia * Corresponding author: gospaval@gmail. human and especially zoonotic viruses in environment is intensively studied and monitored in a lot of countries worldwide. The viruses transmitted by the respiratory and faecal-oral routes. The results show that the potential risk for public and animal health exists if the examined surface waters are used in agricultural and recreational purposes and present the need for assessing water sources for viral contamination to help protect public health. or surfaces) and persist enough in these vehicles to represent a health threat. 2003). In Vojvodina Province in Serbia. host exposure. sewage. Viruses are shed in extremely high numbers in the faeces of infected individuals. and 6 untreated sewage samples were collected at 33 locations during two sampling periods: summer (July-October). Some of the human. Petar Knežević2. 2012). The animal. Keywords: environment.. Human exposure to even low levels of some pathogenic viruses in the environment. Vojvodina. Faculty of sciences. Novi Sad. Serbia University of Novi Sad. animal and zoonotic viruses. Diana Lupulović1.

HAdV has also shown to be very stable in the environment and resistant to water treatments (Rodr guez-Lazaro et al. enteric viruses have been linked to more acute conditions. streams. 2010. 2013). These include adenoviruses.. or works only with partial function. 2003). can persist for a very long time in water. as well as from some large cities in Serbia. PAdV have been proposed as porcine faecal contamination indicators (Maluquer de Motes et al. Girones and Bofill-Mas. 2015).. In spite of the existence of reported cases of pneumoenteritis or encephalitis. PAdV have been often isolated from apparently healthy pigs (Fong and Lipp 2005). water could be also contaminated from overflows of treatment plants impacted by flooding events. 2010). treated waters and swimming pools (Bofill-Mas et al. These viruses are extremely contagious. picornaviruses (enteroviruses and hepatitis A virus).. noroviruses (NoV) are very common cause of both endemic and epidemic gastroenteritis (Teunis et al.. caliciviruses. Atmar. parvoviruses. The burden of calicivirus (including NoV) has been clearly documented in 296 . 2008. storm water runoff. 2013). lakes. and other nonenveloped viruses that can be shed in faeces (and in some cases urine) from infected individuals and can be present in faecal wastes and faecally contaminated environmental samples (Sobsey and Meschke.. 2004. Norovirus Noroviruses belongs to the family Caliciviridae and has its own genus Norovirus.. Human adenoviruses (HAdV) have been proposed as indicators of the presence of human viral pathogens in the environment. Many of the viruses are important pathogens of their human and animal hosts. astroviruses. 2011.. which may also be zoonotic (Wyn-Jones et al. 2005). Petrović. sewage systems. 2009). 2003). 2013). although some of them do not always cause severe illness or high mortality rates (Sobsey and Meschke. Since less than 10 virus particles can lead to infection and disease. including meningitis and paralysis (Spinner and di Giovani. especially from small towns and villages. The prevalence and distribution of animalspecific viruses in environmental waters must be determined in order to validate the use of these viruses for source tracking purposes (Fong and Lipp. is seldom implemented. may contain animal adenoviruses. Additionally. Adenovirus Adenoviruses are members of the family Adenoviridae and the genus Mastadenovirus (Sinclair et al. Rivers. or through direct inflow of untreated sewage (Lazić et al.. especially from slaughterhouses. 2011). and coastal waters are regularly contaminated by septic tanks.. Silva. 2011). porcine adenoviruses (PAdV) do not normally produce clinically severe pathologies (Maluquer de Motes et al. such as waters in lakes and rivers. sapoviruses. Faecal Contamination of the Environment The presence of viruses in water is evidence of faecal contamination because they are excreted by infected individuals and do not belong to natural microbial population (Faccin-Galhardi et al. agricultural run-off or run-off of the animal manure used in agriculture and effluents from inefficiently operated sewage treatment plants. 2004). Especially important are a variety of non-enveloped enteric and respiratory viruses. papovaviruses.First International Symposium of Veterinary Medicine – ISVM2015 illness have been documented. because they are prevalent in environmental waters and successfully detected in different environmental samples. Viral pathogens transmitted through water Water is an important vehicle for the transmission of enteric viruses. These agents are adapted to the hostile environment of the gut and in most cases. 2001). Sewage. The treatment of waste water and sewage. Besides gastrointestinal illnesses. and HEV.

1998). Sava. Italy.. and DTD.. 2006. GIII and GIV are zoonotic and may infect animals (La Rosa et al. 2006. Great Backa. 2010. HAVs have been detected in different water environments: wastewaters. HAV infections result in numerous symptoms. France and the United States (La Rosa et al. 10 samples were collected from 5 urban beaches and 5 locations in protected natural areas.. 2009).. 2013). untreated urban sewage and wastewater inflow directly into the different surface waters. 2012) In US. While GI and GII are restricted to humans. followed by jaundice. and are in line with the results of many other studies conducted around the world (Rusiñol et al... Girones and Bofill-Mas. In Serbia. Silva et al.. Human pathogenic viruses were detected in 35% of 297 . KCIII canals and Palic Lake. 2013). probably as a result of an increased pathogenicity and/or transmissibility of new strains (La Rosa et al. The sampling locations for surface waters were chosen near all larger towns and as close as possible to a few intensive animal production farms. HAdV has been proposed as an indicator of the presence of human viral pathogens in the environment (Bofill Mas et al.. treated effluents. the infection can also cause liver damage. 2012). anorexia. noroviruses causes an estimated 23 million cases per year (Sinclair et al..33% (26/60) samples in Danube. HEV has been detected in different water environments. These viruses have been suggested as potential bovine markers (Hundesa et al.First International Symposium of Veterinary Medicine – ISVM2015 numerous geographical areas worldwide (Rodr ´guez-La´zaro et al. The sewage treatment plants usually do not exist. Polyomaviruse Bovine polyomaviruses (BPyVs) are members of the family Poliomaviridae and the genus Poliomavirus. Situation in Vojvodina Province comparing to the situation in Europe A number of studies have been carried out with the aim of estimating the risks from viral contamination related to the release of wastewater into surface waters.. The most prevalent virus found was HAdV which was detected in 43. Results of our study confirm this observation. and autumn (November-December). 2014. including fever.. malaise. 2011). the virus can survive over 6 weeks in river water (Rodr ´guez-La´zaro et al. 2012). Pina et al.. nausea and abdominal discomfort.. 2013. In total. 2012). Silva et al. in Spain. 2012). 2012). 60 water samples were collected in 2007 from four sampling sites situated along the river Wieprz. The surface water samples were collected at 30 locations during two sampling periods: summer (July-October). including urban sewages.treatment sewage systems on place. 2011. Girones et al.. Kern et al. infectious HEV particles have been reported to occur in sewage. Begej and Krivaja Rivers... In Poland. The four major genotypes (GI to GIV) belonging to a single serotype. 2012). 2009).. 60 samples of untreated surface water and 6 samples of untreated urban sewage samples were tested by qPCR and RT-qPCR. BPyV do not lead to clinically severe diseases in cattle (Girones and Bofill-Mas. Among these water samples. 2009). Moreover. For example. Hepatitis E virus Hepatitis E viruses (HEV) excreted in faeces and urine constitutes a significant proportion of pathogens present in sewage (Sinclair et al. Hepatitis A virus Hepatitis A virus belongs to the family Picornaviridae and has its own genus Hepatovirus (Sinclair et al. Water is considered to be the most important source of infectious virus because it can survive for long periods in this environment. or there are only mechanical and partial. In Europe NoV epidemics have been reported to increase in both incidence and severity. surface waters and drinking waters (La Rosa et al. indicating the existence of a potential public health risk from the contamination of surface water with HEV (La Rosa et al..

1998).: Noroviruses: State of the Art.. Danube and Begej Rivers. Our results are in accordance with the results of the studies conducted in Hungary. Great Backa. and Rakovac stream. Begej and Krivaja Rivers. 23 river water samples from two sites with different levels of faecal pollution were tested. 2014).. and in the third urban sewage system only NoV GII was found in one of two sampling occasions. 298 . In Spain. 117–126.First International Symposium of Veterinary Medicine – ISVM2015 samples. and were present throughout the whole year (Kozyra et al.67%) and 2 (3. On both sampling occasions in two urban sewage systems HAdV and NoV GII and in one occasion NoV GI were detected. 2. Science and Technological development. 2011).3% of samples.L. and suggest the necessity for further and more extensive studies.. and DTD. Petrović et al..33%). One of the possible reasons for these results is because the animal production in Serbia has been quite low in recent years due to the economic crisis (Lazić et al. Viruses such as norovirus and adenovirus may be highly prevalent in sewagepolluted recreational waters (Wyn-Jones et al. R.33%) samples in Krivaja.. Sava. Viruses were not detected in 25% (3/12) of the examined surface waters (Tisa and Jegricka Rivers.