PROCEEDINGS
Publisher
Scientific Veterinary Institute Novi Sad, Novi Sad, Serbia
Editor in Chief
Dr Tama Petrovi, Senior Research Associate
Technical Editor
Dr Tama Petrovi, Senior Research Associate
Printed by
Multidizajn, Novi Sad
250 copies
Novi Sad, 2015
ISBN: 978-86-82871-36-1
ORGANISERS
SCIENTIFIC VETERINARY INSTITUTE NOVI SAD
and
INSTITUTE OF VETERINARY MEDICINE OF SERBIA
GENERAL SPONSOR
ORGANIZING COMMITTEE
Dr Miroslav irkovi, Principal Research Fellow - President
Dr Dobrila Jaki-Dimi,Principal Research Fellow
TECHNICAL SECRETARIAT
Jelena Babi, DVM, MSc, Research Assistant
Biljana Boin, DVM, MSc, Research Trainee
Nikola Bakmaz, Secretary
Dobrisav Vukovi, IT engineer
Vera Proki, librarian
SCIENTIFIC COMMITTEE
Dr Tama Petrovi, Senior Research Associate President (Serbia)
Dr Miroslav irkovi, Principal Research Fellow (Serbia)
HONORARY COMMITTEE:
Dr Sran Verbi, prof dr Sneana Bogosavljevi Bokovi, prof dr Zoran Mai, Vladimir Pavlov, Branislav
Bogaroki, prof dr Dragan Glamoi, prof dr Vlada Teodorovi, prof dr Radovan Pejanovi, prof dr Milan
Popovi, prof dr Zora Mijaevi, prof dr Brana Radenkovi Damjanovi, prof dr Nikola Gruji, prim dr
Dragan Ili, doc dr Vladimir Petrovi, prof dr Dine Mitrov, prof dr Nihad Fejzi, doc dr Boris Habrun, prof
dr eljko Cvetni, prof dr Andrej Kirbi, prof dr Tadej Malovrh, prof dr Boris Stegny, prof dr Paul Pirsan,
prof dr Gheorghe Darabus, dr Teodor Dujin, dr Radovan Pavlovi, dr Ivana Kovini, dr Marijana Gali, dr
Ksenija Stevanovi, dr Milan urjanovi, dr Mira Velhner, dr Dragan Milievi, Petar Matijevi, prof dr
Dragan efer, dr Aleksandar Lonarevi, dr Milenko uti, dr Vojin Iveti, dr Sneana Jankovi, dr Vesna
orevi, dr Jovanka Levi.
3
PREFACE
Concept of One Health is a strategy which enrolls several disciplines in all aspects of
human and animal health care and environment protection. This kind of approach to solving
different public health issues proved to be the best practice of preservation of public health on a
global level. For this reason a need for different, unique and multidisciplinary perspective has been
recognized.
In Vrdnik, from 21st to 23rd of May, 2015, First International Symposium of Veterinary
Medicine will be held, named One Health New challenges. At the Symposium, the existence of
One Health initiative in Serbia, our region and also broader international surrounding will be
analyzed and also current topics and different perspectives will be discussed. The main goal of
Symposium is primarily to gather all the people interested in the topic of One Healthconcept.
Also it would be essential to perceive a large number of issues of this platform, the possibilities of
improvement on national, regional and international level and to propose future activities and
recognized challenges which are possible at this moment. It is very important that the participants of
the symposium are researchers and experts of different occupations, because of the broader
initiative proposals and different perspectives for the same issues.
A successful implementation of One Health concept cannot be done without cooperation
and exchange of opinions among doctors, veterinarians, agronomists, technologists, biologists, etc.
It is needed to perceive a particular problem from a perspective of different professions and
expertise, regardless if the topic is a zoonozis, emergent and infectious diseases, food safety,
antimicrobial resistance, etc. Only with a One Health concept and approach there can be an
appropriate response to the challenges that come up with the aim of preservation of public health
and environment. Basically this concept represents a mutual effort of different disciplines which
operate locally on a national level, and also globally, so that optimal health of humans, animals and
ecosystems is achieved. Necessary interdisciplinary requires a continuous cooperation among
epizootiological and epidemiological service, infectologists, veterinary practitioners, doctors, food
safety experts, biologists, environmentalists and other above mentioned disciplines.
At the One Health New challenges Symposium, work of experts, researchers and their
collaborators of different occupations, profiles and research groups will be presented. The
Symposium is supported by the Ministry of education, science and technological development,
Ministry of agriculture and environment protection, Province Secretary of science and technological
development, Province Secretary of agriculture, aquaculture and forestry and our sponsors. I would
like to use this opportunity and express my great gratitude to the companies and institutions which
have sponsored our Symposium One Health New challenges, or helped in any other way.
Special thanks, I owe to the stuff of Scientific Veterinary Institute Novi Sad, as well as the stuff
from Scientific Veterinary Institute of Serbia, for the help with organization and a successful
Symposium!
President of Organizing Committee
Prof. Dr Miroslav irkovi
Director of Scientific Veterinary Institute Novi Sad
.
Content
Page
PROGRAM
10 - 18
Key note speach: One Health Concept role and importance of veterinarians.
Milijan Jovanovi, Miroslav irkovi
19 - 26
27 - 104
Session 1
DISEASES OF FARM ANIMALS
Plenary lecture: EIA and EVA two equine viral diseases present in Europe
Aymeric Hans
28 - 35
Invited presentation: The voluntary programme for control and eradication of bovine viral
diarrhoea virus infections in Slovenia.
Ivan Toplak, Peter Hostnik, Danijela Rihtari, Joe Grom
36 - 41
42 - 49
Immune response and protective effect of vaccine against listeriosis in sheep in Serbia. Dragan
Baci, Blagoje Dimitrijevi, Mila Savi
50 - 56
Oral fluid as a potential sample for viral diseases detection in pigs. Vesna Milicevi, Branislav
Kureljusi, Jelena Maksimovic-Zori, Ljubisa Veljovi, Vladimir Radosavljevi, Nemanja
Jezdimirovi, Bozidar Savi
57 - 63
Mycobacteria in animals in Slovenia: from cattle to aquarium fish. Mateja Pate, Darja Kuar,
Urka Zajc, Vlasta Jeni, Diana ele, Gorazd Vengut, Joe Stari, Joica Jeek, Katarina Logar,
Tina Pir, Petra Bandelj, Brane Krt, Matja Ocepek
64 - 70
Sanitary and quality conditions of imported bulls semen in Serbia analyzed at "NIV-NS"
(retrospective from 2010-2014). Aleksandar Milovanovi, Tomislav Barna, Milovan Joviin, Jelena
Api, Sava Lazi, Igor Stojanov, Miroslav Uroevi
71 - 79
The health status of breeding stallions for natural breeding and artificial insemination,
regulatory compliance in European Union, South America and West Balkan. Miroslav I.
Urosevi, Luis Losinno, Aleksandar Milovanovi, Dragisa Trailovi, Slobodanka Vakanjac, Jelena
Petrovi, Natasa Filipovi
80 - 86
Sperm pathological forms and acrosomal membrane integrity in boar AI dose on pig farms in
AP Vojvodina (Serbia). Jelena Api, Aleksandar Milovanovi, Tomislav Barna, Milovan Joviin
87 - 91
Echinococcus granulosus of domestic pigs: a case control study. Doroteja Mari, Jasna ProdanovRadulovi, Igor Stojanov, Sinia Gruba, Ivan Pui, Vladimir Polaek
92 - 96
The prevalence of aspergillosis in poultry and control measures - our experience. Milo
Kapetanov, Dragana Ljubojevi, Igor Stojanov, Milica ivkov-Balo, Milo Peli, Marko Paji
97 - 104
105 - 188
106 - 114
Invited presentation: The determination of qualities in cereals silages supplemented with pumpkin
and carrot.
Milica ivkov-Balo, Sandra Jaki, Milovan Joviin
115 - 123
124 132
Effects of fed diets with a different n-6/n-3 PUFAs ratio on oxidative stability, and physicochemical properties of chickens meat. Dragan Milievi, Dejana Trbovi, Zoran Petrovi, Breda
Jakovac-Strajn, Ivan Nastasijevi, Nenad Perunovi, Mirjana Luki
133 141
Ecological safe production of smoked common carp meat. Jelena Babi, Brankica Kartalovi,
Jelena Petrovi, ore Okanovi, Biljana Boi, Milo Peli, Miroslav irkovi
142 147
Effect of diet on improving fatty acid composition of pig meat. Radmila Markovi, Milica
Todorovi, Sran Panti, Milan Balti, Jelena Ivanovi, Dobrila Jaki-Dimi, Dragan efer, Branko
Petrujki, Stamen Radulovi
148 156
157 165
The influence of climatic factors in Serbia on mycotoxin production. Sandra Jaki, Milica ivkovBalo, Nadeda Prica, Zoran Mai, Ksenija Nei, Igor Jaji, Biljana Abramovi
166 172
Radioactivity of the soil in Vojvodina (northern province of Serbia). eljko Mihaljev, Dragana
Ljubojevi, Miroslav irkovi, Milica ivkov-Balo, Sandra Jaki, Brankica Kartalovi, Nadeda
Prica
173 177
178 182
Effects of dietary hot red pepper addition on productive performance and blood lipid profile of
broiler chickens. Nikola Puvaa, Ljiljana Kostadinovi, Dragana Ljubojevi, Dragomir Luka, Sanja
Popovi, Jovanka Levi, Olivera uragi, Rade Jovanovi
183 - 188
Session 3
189 - 241
190 195
Invited presentation: An overview of the recent studies on tick borne pathogens in Serbia.
Sara Savi, Branka Vidi, Aleksandar Potkonjak, eljko onka
196 - 203
204 212
213 219
Species diversity and life stages dominance of hard ticks (acari: ixodidae) at Vojvodina hunting
resorts. Aleksandra Petrovi, Aleksandar Jurii, Ivana Ivanovi, Aleksandar Potkonjak, Vuk Vraar,
Dragana Rajkovi
220 228
229 233
Vector-borne infection (Ehrlichia canis) clinical case. Zlatko Dimeski, Biljana Petrovska, Zivko
Gacovski, Goce Cilev, Elena Buntevska, Bojan Stamadziovski
234 - 236
237 241
Session 4
242 311
243 250
Invited presentation: Virus infections of the honeybee (Apis mellifera l.) in central Europe.
Tams Bakonyi, Petra Forgch, Ale Gregorc, Ivana Tlak Gajger, Lszl Bksi, Mikls Rusvai,
Norbert Nowotny
251 259
Invited presentation: The most common health disturbances detected in wild boars in enclosed
hunting grounds in Vojvodina province.
Jasna Prodanov-Radulovi, Radoslav Doen, Igor Stojanov, Tama Petrovi
260 270
Contamination of public places at central Belgrade municipalities with dogs parasites in period
2013-2014. Ivan Pavlovi, Dubravka Jovii, Vladimir Terzin, Dragana Petkovi, Dragana Terzin,
Milo Pavlovi, Zoran Tambur, Sneana Radivojevi, Borivoje Savi, Slobodan Stanojevi
271 274
Risk factors in domestic and wild cycles of Trichinella species. Milena ivojinovi, Ivan
Dobrosavljevi, Ljiljana Sofroni Milosavljevi, Budimir Plavi, Zoran Kulii, Sonja Radojii
275 282
Insight into the present pesticide contamination and copepods status (Crustacea: Copepoda) of
surface water in irrigation canals in Vojvodina. Vojislava Bursi, Gorica Vukovi, Aleksandra
Petrovi, Maja Meseldija, Tijana Zeremski, Aleksandar Jurii, Dragana Rajkovi
283 289
A serological survey on Aujeszky's disease in wild boars in the region of Vojvodina in Serbia.
Sava Lazi, Vesna Milievi, Gospava Lazi, Ljubia Veljovi, Diana Lupulovi, Jasna ProdanovRadulovi, Jelena Maksimovi -Zori, Sinia Gruba, Radoslav Doen, Tama Petrovi
290 294
Viruses in environment: situation in Vojvodina province of Serbia. Gospava Lazi, Sinia Gruba,
Bugarski Dejan, Diana Lupulovi, Sava Lazi, Petar Kneevi, Tama Petrovi
295 300
301 305
The unusual colony losses in the region of Vojvodina. Jelena Babi, Sara Savi, Miroslav irkovi,
Igor Stojanov, Ivan Pihler, Nada Plava
306 - 311
Session 5
312 389
AQUACULTURE
Plenary lecture: Converting waste landfill in pond areas.
Miroslav irkovi, Brankica Kartalovi, Milo Peli, Nikolina Novakov, Dragana Ljubojevi, Sanja
Jovani, eljko Mihaljev
313 320
321 326
Invited presentation: Link between lipid quality of cyprinid fish species and human health.
Dragana Ljubojevi, Miroslav irkovi
327 339
Seasonal variations of physico chemical parameters of the pond. Brankica Kartalovi, Miroslav
irkovi, Milo Peli, Sanja Jovani, Nikolina Novakov, Biljana Boi, eljko Mihaljev
340 - 345
346 350
351 356
Body traits and chemical composition of carp grown in production systems with different level of
intensification. Liliana Hadzhinikolova, Angelina Ivanova, Tania Hubenova
357 361
Meat lipid quality in carps (yprinus carpio L) grown in production systems with different level
of intensification. Angelina Ivanova, Liliana Hadzhinikolova
362 368
Results of breeding of juveniles of huchen (Hucho hucho) obtained by insemination with fresh
and cryopreserved sperm in artificial conditions. Nataa Radojkovi, Aleksandra Milokovi,
Simona Kovaevi, Tijana Velikovi, Sneana Simi, Miroslav irkovi, kos Horvth, Vladica
Simi
369 373
374 378
The effect of OTC and flumequine antibiotic in fresh feed for the control of erythrodermatitis in
common carp (Cyprinus carpio L.). Milo Peli, Brankica Kartalovi, Dragana Ljubojevi, Nikolina
Novakov, Dalibor Todorovi, Biljana Boi, Miroslav irkovi
379 384
Malignant anaemia of the carps. Biljana Boi, Nikolina Novakov, Milo Peli, Dalibor Todorovi,
Miroslav irkovi
385 - 389
Session 6
390 444
391 400
401 404
404 413
The role of veterinary medicine in One Health concept. Branka Vidi, Sara Savi, Stanko Bobo,
Nadeda Prica, Miodrag Radinovi
414 419
The concept One World, One Health in the Macedonian state institutions. Misho Hristovski,
Blazho Janevski, Martin Josheski
420 433
More than two years without detection of wild rabies virus in Slovenia. Peter Hostnik, Jedert
Maurer Werning, Breda Hrovatin, Danijela Rihtari, Ivan Toplak
434 438
439 444
Session 7
445 - 484
ANTIBIOTIC RESISTANCE
Invited presentation: Potential spread of antimicrobial resistance via drinking water in livestock
husbandry.
Igor Stojanov, Jasna Prodanov Radulovi, Milo Kapetanov, Jelena Petrovi
446 - 453
454 461
Antimicrobial activity of blackberry juice from Serbia on animal pathogens. Tamara Krsti,
Ljiljana Suvajdi, Sran Stojanovi, Tama Petrovi, Maja Bekut, Neboja Ili, Zoran Suvajdi
462 467
Antibiotic resistance to fluoroqionoles in Salmonella spp.: Recent findings in Serbia and brief
overview of resistance mechanisms and molecular typing methods. Maja Velhner, Gordana
Kozoderovi, Zora Jelesi
468 472
473 478
Random amplified polymorphic DNA analysis RAPD and resistance to antimicrobial agents in
Salmonella spp. isolated from poultry flocks in Southern Baka and Srem region. Dalibor
Todorovi, Maja Velhner, Bojana Pruni, Marko Paji, Dubravka Milanov, Vladimir Polaek, Dejan
Bugarski
479 - 484
485 488
489 - 492
493 498
PROGRAM
Thursday, May 21, 2015
13:00 15:30
Registration of participants
Main Hall entrance
15:30 17:40
15:30 15:50
Plenary lecture: EIA and EVA two equine viral diseases present in Europe. Aymeric Hans
(ANSES - French Agency for Food, Environmental and Occupational Health & Safety)
15:50 16:05
Invited presentation: The voluntary programme for control and eradication of bovine viral
diarrhoea virus infections in Slovenia. Ivan Toplak, Peter Hostnik, Danijela Rihtari, Joe Grom
(National Veterinary Institute, Veterinary Faculty, University of Ljubljana)
16:05 16:20
16:20 16:30
Immune response and protective effect of vaccine against listeriosis in sheep in Serbia. Dragan
Baci, Blagoje Dimitrijevi, Mila Savi
16:30 16:40
Listeriosis: a continuous challenge in veterinary practice. Majda Golob, Mateja Pate, Darja Kuar,
Matja Ocepek, Irena Zdovc
16:40 16:50
Oral fluid as a potential sample for viral diseases detection in pigs. Vesna Milicevi, Branislav
Kureljusi, Jelena Maksimovic-Zori, Ljubisa Veljovi, Vladimir Radosavljevi, Nemanja
Jezdimirovi, Bozidar Savi
16:50 17:00
Mycobacteria in animals in Slovenia: from cattle to aquarium fish. Mateja Pate, Darja Kuar,
Urka Zajc, Vlasta Jeni, Diana ele, Gorazd Vengut, Joe Stari, Joica Jeek, Katarina Logar,
Tina Pir, Petra Bandelj, Brane Krt, Matja Ocepek
17:00 17:10
Detection of infected goats with CAE virus-control measures and prevention. Miodrag
Radinovic, Marija Paji, Stanko Bobo, Branka Vidi, Sara Savi, Annamaria Galfi
17:10 17:20
Sanitary and quality conditions of imported bulls semen in Serbia analyzed at "NIV-NS"
(retrospective from 2010-2014). Aleksandar Milovanovi, Tomislav Barna, Milovan Joviin, Jelena
Api, Sava Lazi, Igor Stojanov, Miroslav Uroevi
17:20 17:30
10
18:00 20:00
11
08:30 13:10
Paralel Sessions
08:30 10:30
08:30 08:45
08:45 09:00
09:00 09:15
Invited presentation: Mycotoxicological assessment of feed in Serbia in 2014 in the light of new
legislation. Ksenija Nei, Sandra Jaki, Milica ivkov-Balo, Bojana Pruni (Institute of
Veterinary Medicine of Serbia, Belgrade, Serbia)
09:15 09:25
Development of probiotic cultures for domestic animals. Nataa Goli, Katarina Veljovi,
Miroslav Dini, Nikola Popovi, Marija Miljkovic, Milan Koji, Igor Mrvaljevi, Amarela TerziVidojevi
09:25 09:35
Effects of fed diets with a different n-6/n-3 PUFAs ratio on oxidative stability, and physicochemical properties of chickens meat. Dragan Milievi, Dejana Trbovi, Zoran Petrovi, Breda
Jakovac-Strajn, Ivan Nastasijevi, Nenad Perunovi, Mirjana Luki
09:35 09:45
09:45 09:55
Ecological safe production of smoked common carp meat. Jelena Babi, Brankica Kartalovi,
Jelena Petrovi, ore Okanovi, Biljana Boi, Milo Peli, Miroslav irkovi
09:55 10:05
Development of starter cultures for fermented dairy products based on autochthonous lactic
acid bacteria. Amarela Terzi-Vidojevi, Katarina Veljovi, Duanka Popovi, Ivana Strahini,
Maja Tolinaki, Milica Nikoli, Sanja Mihajlovi, Milan Koji
10:05 10:15
Effect of diet on improving fatty acid composition of pig meat. Radmila Markovi, Milica
Todorovi, Sran Panti, Milan Balti, Jelena Ivanovi, Dobrila Jaki-Dimi, Dragan efer,
Branko Petrujki, Stamen Radulovi
10:15 10:30
12
11:00 13:10
11:00 11:20
11:20 11:40
Invited presentation: Virus infections of the honeybee (Apis mellifera l.) in central Europe.
Tams Bakonyi, Petra Forgch, Ale Gregorc, Ivana Tlak Gajger, Lszl Bksi, Mikls Rusvai,
Norbert Nowotny (Faculty of Veterinary Science, Szent Istvn University, Budapest, Hungary)
11:40 12:00
Invited presentation: The most common health disturbances detected in wild boars in enclosed
hunting grounds in Vojvodina province. Jasna Prodanov-Radulovi, Radoslav Doen, Igor
Stojanov, Tama Petrovi (Scientific Veterinary Institute Novi Sad, Novi Sad, Serbia)
12:00 12:10
Roe deer vs. Red deer papillomavirus an odd pair in delta-papillomavirus evolution and
ecology. Kroly Erdlyi, Alessandra Scagliarini
12:10 12:20
12:20 12:30
Bacillus thuringiensis as the model for the development of reliable method for the detection
and quantification of spore of Bacillus anthracis from environmental samples. Vera
Sedlackova, Iva Kubikova, Petr Kralik
13
Occurrence of Toxoplasma gondii in domestic pigs and wild boars in the Czech Republic.
Michal Slany, Lea Jakubcova, Nikol Reslova, Alena Lorencova
12:40 12:50
Risk factors in domestic and wild cycles of Trichinella species. Milena ivojinovi, Ivan
Dobrosavljevi, Ljiljana Sofroni Milosavljevi, Budimir Plavi, Zoran Kulii, Sonja Radojii
12:50 13:00
Insight into the present pesticide contamination and copepods status (Crustacea: Copepoda)
of surface water in irrigation canals in Vojvodina. Vojislava Bursi, Gorica Vukovi,
Aleksandra Petrovi, Maja Meseldija, Tijana Zeremski, Aleksandar Jurii, Dragana Rajkovi
13:00 13:10
Paralel Sessions
08:30 10:30
08:30 08:50
08:50 09:10
Invited presentation: An overview of the recent studies on tick borne pathogens in Serbia.
Sara Savi, Branka Vidi, Aleksandar Potkonjak, eljko onka (Scientific Veterinary Institute
Novi Sad, Novi Sad, Serbia)
09:10 09:30
09:30 09:40
09:40 09:50
Species diversity and life stages dominance of hard ticks (acari: ixodidae) at Vojvodina
hunting resorts. Aleksandra Petrovi, Aleksandar Jurii, Ivana Ivanovi, Aleksandar Potkonjak,
Vuk Vraar, Dragana Rajkovi
14
Babesia spp. in ticks parasitizing wild canids in Serbia. Ratko Sukara, Salem Juwaid,
Dimosthenis Chochlakis, Sanja aki, Darko Mihaljica, Duko irovi, Sneana Tomanovi
10:00 10:10
Diversity and spatial distribution of sandflies (diptera: psychodidae) and possibility of reemergence of leishmaniasis in Serbia. Slavica Vaselek, Gizem Oguz, Nazli Ayhan, Sara Savi,
Trentina Di Muccio, Ozge Erisoz Kasap, Yusuf Ozbel, Vladimir Ivovi, Luigi Gradoni, Bulent
Alten, Duan Petri
10:10 10:30
11:00 13:00
11:00 11:20
Plenary lecture: Converting waste landfill in pond areas. Miroslav irkovi, Brankica
Kartalovi, Milo Peli, Nikolina Novakov, Dragana Ljubojevi, Sanja Jovani, eljko Mihaljev
(Scientific Veterinary Institute Novi Sad, Novi Sad, Serbia)
11:20 11:35
11:35 11:50
Invited presentation: Link between lipid quality of cyprinid fish species and human health.
Dragana Ljubojevi, Miroslav irkovi (Scientific Veterinary Institute Novi Sad, Novi Sad,
Serbia)
11:50 12:00
Seasonal variations of physico chemical parameters of the pond. Brankica Kartalovi, Miroslav
irkovi, Milo Peli, Sanja Jovani, Nikolina Novakov, Biljana Boi, eljko Mihaljev
12:00 12:10
The impact of benthic and planktonic bacteria on microbiological status of the digestive tract
of carp (Cyprinus carpio). Vesna orevi, Miroslav irkovi, Dragana Ljubojevi, Vesna
Jankovi, Dejana Trbovi, Radivoj Petronijevi, Danka Spiri
12:10 12:20
A closer look at toll-like receptor 4 (TLR4) and toll-like receptor 20 (TLR20) of common carp
(Cyprinus carpio). Danilo Pietretti, Maria Forlenza and Geert Wiegertjes
12:20 12:30
12:30 12:40
15
Body traits and chemical composition of carp grown in production systems with different
level of intensification. Liliana Hadzhinikolova, Angelina Ivanova, Tania Hubenova
12:50 13:00
Meat lipid quality in carps (yprinus carpio L) grown in production systems with different
level of intensification. Angelina Ivanova, Liliana Hadzhinikolova
13:00 13:10
14:30 14:45
Invited presentation: Important zoonotic viral diseases of wildlife and their impact on human
health. Diana Lupulovi, Gospava Lazi, Jasna Prodanov-Radulovi, Tamas Petrovi (Scientific
Veterinary Institute Novi Sad, Novi Sad, Serbia)
14:45 15:00
15:00 15:15
Invited presentation: Comparation of Rhodococcus equi of human and animal origin. Ljiljana
Suvajdi, Maja Velhner, Maja Bekut, Gordana Boji, Tamara Krsti, Zoran Suvajdi, Milenko
Lazi (Faculty of Medicine, Department of Pharmacy, University of Novi Sad, Serbia)
15:15 15:25
The role of veterinary medicine in One Health concept. Branka Vidi, Sara Savi, Stanko
Bobo, Nadeda Prica, Miodrag Radinovi
15:25 15:35
The concept One World, One Health in the Macedonian state institutions. Misho Hristovski,
Blazho Janevski, Martin Josheski
15:35 15:45
More than two years without detection of wild rabies virus in Slovenia. Peter Hostnik, Jedert
Maurer Werning, Breda Hrovatin, Danijela Rihtari, Ivan Toplak.
15:45 15:55
Hepatitis E virus in the Czech Republic. Petra Vasickova, Monika Kubankova, Petr Kralik
16
Seroprevalence of hepatitis E virus in commercial pig farms, backyard pigs and slaughtered
pigs in the region of the city Belgrade. Branislav Kureljui, Boidar Savi, Nemanja
Jezdimirovi, ore Cvetojevi, Jasna Kureljui, Dobrila Jaki-Dimi, Oliver Radanovi, Vesna
Milievi, Danka Masli-Striak, Vojin Iveti
16:05 16:15
16:15 16:25
Sepsis and meningoencephalitis caused by Streptococcus suis bacteria a case report. Vesna
Turkulov, Grozdana anak, Sinia Sevic, Mila Rajkovi, Dajana Lendak, Ljiljana ivanovi
16:25 16:35
16:35 17:00
17:00 19:00
17:00 17:30
17:30 17:45
17:45 18:00
Invited presentation: Antimicrobial activity of the essential oils from some aromatic medicinal
plants cultivated in Serbia. Radomir Ratajac, Marina eki Stoi, Aleksandar Milovanovi,
Igor Stojanov (Scientific Veterinary Institute Novi Sad, Novi Sad, Serbia)
18:00 18:10
18:10 18:20
Antimicrobial activity of blackberry juice from Serbia on animal pathogens. Tamara Krsti,
Ljiljana Suvajdi, Sran Stojanovi, Tama Petrovi, Maja Bekut, Neboja Ili, Zoran Suvajdi
18:20 18:30
The concept of reserve antibiotic. Maja Bekut, Ljiljana Suvajdi, Tamara Krsti
18:30 18:40
Antibiotic resistance to fluoroqionoles in Salmonella spp.: Recent findings in Serbia and brief
overview of resistance mechanisms and molecular typing methods. Maja Velhner, Gordana
Kozoderovi, Zora Jelesi
18:40 18:50
Research on the antibiotic resistance APEC strains isolated from broilers, in the western part
of Romania. Iancu Ionica, Viorel Herman, Ctan Nicolae
18:50 19:00
17
1 9 : 0 0
Main Hall
Symposium Conclusions and Closing Remarks
Chairs: Miroslav irkovi, Tama Petrovi
09:00 09:30
09:30 09:40
Closing Remarks
09:40 12:30
End of Symposium
18
Abstract
The One Health concept is defined as the collaborative efforts of multiple disciplines, working
locally, nationally and globally, to reach optimal health for people, animals and the environment.
One Health is a new phrase, but the concept extends back to ancient times and can be traced as far
back as to the Greek physician Hippocrates.
In the late 19th century, German physician and pathologist Rudolf Virchow (18211902), to
indicate the infectious disease links between animal and human health, coined the term "zoonosis",
and said "...between animal and human medicine there are no dividing lines nor should there be".
The phrase "One Medicine" was developed and promoted by an American veterinary
epidemiologist Calvin W. Schwabe (19272006).
The term One Health is used in many different contexts. However, there appears to be some
confusion as to what the term really means. Some authors consider the terms One Medicine, One
Health and One World-One Health-One Medicine to be entirely synonymous.
Because in the early year of 21st century emerging zoonotic diseases created several international
crises governments and scientists worldwide recognized that greater interdisciplinary collaboration
was required to prevent and control diseases such as bovine spongiform encephalopathy (BSE),
severe acute respiratory syndrome (SARS), highly pathogenic avian influenza (HPAI H5N1) and
etc. It had highlighted the need for professional collaboration and that such collaboration should
include not only physicians and veterinarians, but also wildlife specialists, environmentalists,
anthropologists, economists and sociologists, among others. The One Health concept recognized
that the health and wellbeing of humans, animals and ecosystems are interconnected. The concept
One Health has been adopted with great enthusiasm by the veterinary profession. Veterinarians
have opportunities and responsibilities to protect the health and well being of people, animals and
ecosystems in all the areas in which they work: food security, food safety, antibiotic sensitivity
testing, research on zoonoses, emerging infectious diseases, ecosystem protection, and comparative
medical research. The tripartite group FAO/OIE/ WHO promotes and supports One Health
approach. We see One Health as a concept that would drive new research ideas and greater
collaboration.
Keywords: animals, ecosystem, humans, One Health, zoonoses
Introduction
The One Health Concept is a worldwide strategy for expanding interdisciplinary collaborations and
communications to improve all aspects of the health and welfare of humans, animals and the
environment. It could be defined as the collaborative efforts of multiple disciplines, working
locally, nationally and globally, to reach optimal health for people, animals and the environment
(Gibbs, 2014).
The term One Health is used in many different contexts and by people with varying backgrounds.
However, there appears to be some confusion as to what the term really means, and it is used in a
19
wide range of contexts, often including or bordering concepts such as infection biology, contagious
diseases, zoonotic infections, evolutionary medicine, comparative medicine, and translational
medicine.
Some authors consider the terms One Medicine, One Health and One World, One Health, One
Medicine to be entirely synonymous (Gibbs and Anderson, 2009) while others point out some
differences, which are subtly nuanced (Lerner and Berg, 2015). It is certain that the term One
Health most commonly used today and has the widest and comprehensive meaning, which refers
not only to infectious diseases but also encompasses the general public health, comparative
medicine and ecology.
History
One Health is a new phrase, but the concept extends back to ancient times. The recognition that
environmental factors can impact human health can be traced as far back as to
the Greek physician Hippocrates (c. 460 BCE c. 370 BCE) and his text "On Airs, Waters, and
Places". in which he promoted the concept that public health depended on a clean environment.
(Anon, 2015).
Also, in India on a stone edict, laid down by the roadside, written in the time of King Ashoka
(ca. 304 BC-232 BC), a common concern about the health of humans and animals:
. . . everywhere has Beloved-of-the-Gods, King Piyadasi, made provision for two types of medical
treatment: medical treatment for humans and medical treatment for animals. Wherever medical
herbs suitable for humans or animals are not available, I have had them imported and grown.
Wherever medical roots or fruits are not available I have had them imported and grown. Along
roads I have had wells dug and trees planted for the benefit of humans and animals (Lerner and
Berg 2015).
20
In recent history, the great advocate of a unique approach to medicine was the founder of modern
pathology German pathologist Rudolf Virchow (Rudolf Virchow, 1821-1902) (Figure 1) which is
its position formulated in the following statement: Between animal and human medicine there is
no dividing line-nor should there be. The object is different but the experience obtained constitutes
the basis of all medicine. The son of a butcher, Virchow noted the link between diseases of
humans and animals and coined the term zoonosis to indicate the infectious disease links between
animal and human health. He described the life cycle of Trichinella spiralis in swine and its
zoonotic consequences. Another pathologist, William Osler (1849-1919), a Canadian physician was
also ardent supporter of unique medicine. He briefly studied in Germany with Virchow and after he
got a lectureship in the Medical Faculty of McGill University in Montreal. He lectured to not only
medical students, but also he demonstrated anatomy and pathology on a daily basis to the veterinary
students from the Montreal Veterinary College. As an active participant in comparative pathology,
he became vice president and later president of the Veterinary Medical Association.
In the early 20th century Virchow concept is beginning to fade and lose interest in the medical
and veterinary profession, which develop as an independent discipline. In the middle of the
twentieth century Calvin Schwabe (1927-2006), a veterinary epidemiologist and parasitologist at
the University of California, Davis School of Veterinary Medicine, established a modern approach
to the role of animals in human health which developed and promoted through concept One
Medicine. His concepts of One Medicine were based on the close relationship between humans,
domestic animals and public health. Schwabe proposed a unified human and veterinary approach to
zoonoses in the 1964 edition of his monograph Veterinary Medicine and Human Health which
has reached the third edition that appeared in 1984(Cardiff et al, 2008).
The term One World-One Health was first introduced at the meeting of the Wildlife Conservation
Society (WCS), which was held in New York in 2004. At this meeting were adopted 12
recommendations to embrace and protect both medicine and ecosystem health. This series of
recommendations became known as the Manhattan Principles, in recognition of the fact that the
meeting was hosted by Rockefeller University in New York (Gibbs, 2014).
The idea of greater collaboration between veterinary and medical profession over time more and
more developed in the USA. In 2006, the American Veterinary Medical Association (AVMA)
established the One Health Initiative Task Force, and a year later in 2007, the American Medical
Association unanimously approved a resolution calling for increased collaboration between the
human and veterinary medicine. The term One Health had entered the medical and scientific
lexicon (Cardif et al. 2008; Gibbs, 2014; Kaplan et al.2009).
The World Veterinary Association (WVA) recognizes and supports the Tripartite Concept Note
titled Sharing responsibilities and coordinating global activities to address health risks at the
animal-human-ecosystem interfaces jointly developed and adopted by the World Organization for
Animal Health (OIE), World Health Organization (WHO) and the Food and Agriculture
Organization of the United Nations (FAO) in 2010 (Anon, 2014). The tripartite note clearly
recognizes that addressing health risks at the human-animal-ecosystem interface requires strong
partnerships among all stakeholders.
21
The importance of One Health concept in the modern world is increasingly gaining in, it is not
difficult to understand because that about two-thirds (60.3 %) of emerging infectious diseases
(EID) result from zoonoses; the majority of these have their origin in wildlife (71.8%) and have
been increasing in recent years. A major finding was that there was a high correlation between EID
origins and socio-economic, environmental and ecological factors, thereby providing a mechanism
by which areas (called emerging disease hotspots) where EIDs are most likely to originate.
Global resources to combat the emergence of infectious disease are not well allocated as most of the
research and surveillance activities are occurring in countries that do not fit the predicted sites from
which new diseases are likely to emerge. Humans serve as a primary reservoir for only 3% of
known zoonotic pathogens (Frank, 2008).
In the early years of the 21st century with the advent of diseases such as highly pathogenic avian
influenza (HPAI H5N1) severe acute respiratory syndrome (SARS), Middle East respiratory
syndrome (MERS), Bovine spongiform encephalopathy (BSE) AIDS, Ebola, West Nile virus,
hantavirus infections and others diseases that had the potential to become pandemic, including
extensive human mortality, created several international crises (Gibbs, 2005). Governments and
scientists worldwide have found themselves facing a great challenge and recognized that greater
interdisciplinary collaboration was required to prevent and control of these diseases. Some believe
that the One Health concept was just created and developed in fear of these diseases (Gibbs,
2014).
With the development of technology, air and water transport, the world has continued to shrink.
Microorganisms can travel by plane across the world in time frames shorter than their incubation
periods. Nowhere is remote and no one is disconnected(Frank, 2008). Special problems are
caused by vectors transmitted diseases. Country borders do not exist for vector-borne diseases
(Vali et al, 2015).
The population of the world is increasing from the current 7 billion, is projected to reach 9 billion
in 2050. The increase in population will require greater need for safe and quality food of animal
origin (Wall, 2014). Food safety, combating microbial resistance to antibiotics, climate change and
wildlife conservation are further mega-concerns where One Health can make contributions.
As a starting point for an explanation of "One Health concept" many authors have taken symbolic
umbrella model (Figure 2), which was developed in Sweden and from which we can see the
complexity of the concept. A number of scientific fields are present under the umbrella of One
Health (see the top row circles): biology, human medicine, veterinary medicine, public health,
environmental chemistry, and health economy, to mention some of the most important ones. The
concept of health could be defined on at least three different levels: the individual level, the group
or population level, or the ecosystem level (Lerner and Berg, 2015).
Health is a state of complete physical, mental and social well-being and not merely the absence of
disease or infirmity. It is the outcome of a complex of several inter-dependent medical, economic,
socio-cultural, environmental and ecological factors. Peoples health and wellbeing, and equally
animal health and welfare are strongly interlinked. Both also influence and are impacted by the
health of the environment. Health is a precondition for wellbeing and respectively welfare.
Wellbeing and welfare reinforce health.
Animals, domesticated and wild, play a key role in the wellbeing of people and the future of our
planet. They provide working power, food, protection, companionship and enjoyment, facilitate the
advancement of biomedical research, and are a crucial part of healthy ecosystems. Keeping animals
healthy is essential for the health and well-being of people and the environment (Mills and Hall,
2014). The man and animals in a broader sense belong to the one multispecies animal world in
22
which in some cases shared a common pathogen, and also they are together exposed to harmful,
toxic agents from the environment.
In the One Health concept, plant health is often perceived as a part of ecosystem health rather than
as a separate entity and has essential impact on human and animal health
Recognizing the basic fact that all humans and animals must eat to survive, it follows that since our
food sources are all derived directly or indirectly from plants we must protect plant life on this earth
to maintain healthy humans and healthy animals. Thus, plant pathogens play a direct and indirect
role in the ecological existence of human and animal species. We need human doctors (physicians)
and animal doctors (veterinarians), as well as plant doctors (plant pathologists) to work together
for the common good of all species. How to plant health can affect the health of animals, animal
products safety and health of people and which problems of that might arise, well you can see
from our example from 2013 regarding the appearance of larger amounts of aflatoxin in corn
grain and corn products.
Besides their role in the preservation of ecosystems and the importance as a source of food plants
will be in the future more and more used in the protection of animal health. Recent advances in
immunology and in biotechnology, demonstrated the feasibility and advantages of plant-based
production platforms for various recombinant proteins with therapeutic use, including, subunit
vaccines, complex antibodies and immunogenic virus-like particles. Plant made therapeutic
products are currently on the cusp of widely entering biotechnology markets. To date, vaccines
been made against chicken infectious bronchitis virus (IBV) and infectious bursal disease virus
(IBDV), enterotoxigenic E. coli (ETEC) and porcine transmissible gastroenteritis coronavirus
23
(TGEV), bovine herpes virus (BHV) and bovine viral diarrhea virus (BVDV) (Kolotilin et al.,
2014).
enhancing the health and welfare of animals (e.g., through treatment and prevention of
diseases and promotion of animals physical and mental wellbeing);
improving the health of people (e.g., through detection and prevention of zoonotic diseases);
ensuring safer animal products for human consumption (e.g., through preventing foodborne
diseases and food frauds; and overseeing best practices for use of animal medicines);
protecting the environment (e.g., through conservation, prudent use of medicines, and
chemicals, and the careful disposal of waste);
competencies in the use of antimicrobials and thus insuring their effectiveness in both
animal and human medical practice; in the use of antimicrobials and thus preserve their
effectiveness in veterinary and medical practice (Anon, 2014).
Comparative medicine
Comparative medicine is the study of disease processes across species and is based on the study of
naturally occurring diseases of animals that also afflict humans Comparative medicine is, by
definition, based on the idea of comparing humans to one or more chosen animal species, or the
other way around. Hence, it has limitations from a veterinary point of view, as veterinarians are also
often interested in comparing different animal species with each other, that is, making comparisons
that include several different species but not necessarily always including Homo sapiens. Animals
suffer from many of the same chronic diseases such as heart disease, cancer, diabetes, asthma, and
arthritis as humans. Sometimes a disease entity is recognized in animals long before it is recognized
in humans. The concept of comparative medicine is very old. The ancient Greeks understood that
dissecting and studying animals could yield important clues to understanding human diseases. The
24
musculoskeletal system is particularly well-suited to comparative medicine studies since acute and
chronic disorders of bones and joints have the same counterparts in humans and animals.
Information gained from one species can be directly translated to another, thereby advancing the
diagnosis and treatment of musculoskeletal disorders. Some of the solutions in orthopedic surgery,
such as a particular method of fixation in fractures were first applied in veterinary practice (Cook
and Arnoczky, 2009).
In the United Kingdom has been established the Comparative Clinical Science Foundation to fund
comparative studies in cancer, aging and genetic disorders (http://www.onemedicine.org.uk/).
Comparative sequence analyses demonstrate extensive genetic homologies among species.
Furthermore, it has been proven that mutations of one gene in one species cause a similar disease in
other species. For example, the virus discovered to cause sarcomas in chickens by Peyton Rous and
others, 100 years ago harbours the gene associated with cancers in rats, mice and human. As the
genes and diseases are the same, the medicine will be the same: the genetic version of One
Medicine or One Health approach (Cardiff, 2008). Isolation and cloning of a gene associated with
human disease, when inserted into and expressed by the mouse genome, recapitulates the disease in
the mouse. Clearly, one gene can cause the same disease in another species. In modern biological
science is dominated by molecular biology and there is a need to learn more and more about less
and less. To enhance interdisciplinary scientific collaboration, like the existence of "Open access
publishing", there is thinking about creating "Open access bio-banks" where will be kept
biological material (be it tissue, blood, fecal samples, effluent water, or anything else possibly
relevant) that would be available to scientists who perceive certain problems from different
aspects (Lerner, 2015).
Conclusion
The advancement of the health and well-being of people and animals depends on effective and
sustained collaboration between varied professions and disciplines, both in the public and private
sectors. Observation of animal health and welfare, public health, zoonotic and environmental
problems as a separate discipline and entities would have in a long term, limited impact on
solving global problems. For continuous improvement it is necessary a broad interdisciplinary
holistic approach to develop effective action that fully emphasizes One Health philosophy. It is
time to consider whether One Health will prove to be a short-lived response to a spate of emerging
diseases that apparently threatened to the world, or a paradigm shift that will lead to a wider and
deeper commitment to interdisciplinary action addressing the protection and needs of society in the
21st century. We have an optimistic attitude, and we hope that the future will most likely bring
25
more collaborations of veterinarians from all fields with multiple professions such as public health,
human medicine, bio-engineering, animal science, environmental science, and wildlife. Together,
we are stronger to fight disease, and we are, indeed, wiser.
References:
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Anon, The Internet Classics Archive. Hippocrates. "On Airs, Waters, and Places". 400 BCE. Translated
by Francis Adams. 2015, http://classics.mit.edu/Hippocrates/airwatpl.html
Anon: World Veterinary Association Position on One Health Concept, 2014, www.worldvet.org.
Cardiff RD, Ward MJ, Barthold SW: One medicine - one pathology: are veterinary and human
pathology prepared? Laboratory Investigation, 88: 18-26, 2008.
Cook JL, Arnoczky SP. "The One Health Concept in Comparative Orthopaedics." One Health
Newsletter Florida
Department
of
Health.
Summer
2009;
vol.
2,
issue
3.
http://www.doh.state.fl.us/environment/medicine/One_Health/OHNLSummer2009.pdf.
Frank D: One world, one health, one medicine - Presidents Message. Canadian Veterinary Journal,
49(11): 1063-1065, 2008.
Gibbs EPJ:The evolution of One Health: a decade of progress and challenges for the future, Veterinary
Record 174: 85-91, 2014.
Gibbs EPJ, Anderson TC: One World-One Health and the global challenge of epidemic diseases of
viral aetiology, Veterinaria Italiana, 45(1): 9-18, 2009.
Kaplan B, Kahn LH, Monath TP: The brewing storm, Veterinaria Italiana, 45(1): 9-18, 2009.
Kolotilin I, Topp E, Cox E, Davriendt B, Conrad U, Joensuu J et al.: Plant-based solutions for veterinary
immunotherapeutics and prophylactics. Veterinary Research 2014, 45: 117.
Lerner H, Berg C: The concept of health in One Health and some practical implications for research and
education: what is One Health? Infection Ecology and Epidemiology 2015, 5: 25300 http://dx.doi.org./10.3402/iee.v5.25300.
Mills D, Hall S: Animal-assisted interventions: making better use of the human-animal bond Veterinary
Record, 174: 269-273, 2014.
Osterholm MT, Moore KA, Kelley S, Brosseau LM, Wong G, Murphy FA et al.: Transmission of Ebola
viruses: what we know and what we do not know. mBio 2015, 6(2): e0013715.doi:10.1128/mBio.00137-15.
Vali M, Radojii S, Obrenovi S, Stevi N, Vasi A: Vektori kao rezervoari I prenosioci infektivnih
bolesti ivotinja, Zbornik predavanja XXXVI Seminara za inovacije znanja veterinara, 2015, 3-18.
Verner-Carlsson J, Lhmus M, Sundstrm K, Strand TM, Verkerk M, Reusken C et al.: First evidence
of Seoul hantavirus in the wild rat population in the Netherlands. Infection Ecology and Epidemiology
2015, 5: 27215 - http://dx.doi.org/10.3402/iee.v5.27215.
Wall P: One Health and the food chain: maintaining safety in a globalised industry, Veterinary Record,
174: 189-192, 2014.
26
________________________________________________________________________
Session 1
DISEASES OF FARM ANIMALS
Full Papers
_______________________________________________________________________
27
Plenary lecture:
EIA AND EVA TWO EQUINE VIRAL DISEASES PRESENT IN EUROPE
Aymeric Hans1
1 ANSES-Dozul Laboratory for Equine Diseases, Virology Unit, France
* Corresponding author: Aymeric.HANS@anses.fr
Abstract
Equine infectious anemia (EIA) and Equine Viral Arteritis (EVA) are two equine diseases of
importance to international trade listed by the World Organization for Animal Heath (OIE). Equine
infectious anemia is caused by a virus (EIAV) belonging to the retroviridae family, genus
Lentivirus as the Human Immunodeficiency Virus (HIV) and has a worldwide distribution. EIAV
causes a persistant infection associated to recurrent febrile episodes. Asymptomatic infected
animals are the viral reservoir and can transmit the virus to others equids. EIAV is bloodborne and
transmitted primarily via biting flies, but also iatrogenically if non-sterile needles or surgical
equipment are used. Insects mainly horseflies and stable flies are mechanical vectors:
although the virus does not replicate within the insect, the infectious virus can remain in its
mouthparts for several hours after biting. Equine arteritis virus (EAV), the causative agent of EVA,
is a member of the Arteriviridae family. EAV infects equidae and may be transmitted through
respiratory and venereal routes. EAV can persist in the reproductive tract of stallions only.
Following the primary infection, up to 70% of stallions can be persistently infected and shed the
virus in their semen sometimes for life. These shedder stallions spread the virus in the horse
population during breeding or when their semen is used for artificial insemination. The financial
consequences of these diseases are potentially huge, since EIAV positive horses are in general
slaughtered and stallions shedding EAV in the semen lose their value. Moreover, EAV infection
may cause abortion in pregnant mares and the death of young foals. Romania and Italy are the most
European countries affected by EIA. The disease is endemic in Romania whereas only sporadic
cases have been notified in others European countries. Also, EVA cases are mainly sporadic in
European countries with very few descriptions of pathogenic strains leading to death or abortion
in pregnant mares. To better understand and prevent the viral spread in equine population
epidemiological surveys as well as molecular characterization of strains isolated in Europe are
investigated.
Keywords: Virus, Equine, notifiable diseases, Phylogeny
28
The disease progresses and can be divided in three distinct phases. In its acute phase, the horse
shows serious clinical signs that can lead to the animal death. The chronic stage is characterized by
a recurrence of clinical phases such as pyrexia and anemia, whereas the final stage is asymptomatic
(Hammond et al., 2000; Leroux et al., 2001) with no overt signs of disease. However, these
unapparent carriers never eliminate the virus and represent an economical threat for the equine
industry. Moreover, they remain a source of infection for other horses (Issel and Adams, 1982).
Virus is transmitted mainly by infected blood through biting flies, but also by contaminated
instruments when non-sterile needles or dental equipment are used (Foil et al., 1983; Hawkins et al.,
1973). Insects, mainly horseflies and stable flies, are mechanical vectors: while the virus does not
replicate within the insect, the infectious virus remains in its mouthparts several hours after biting
(Williams et al., 1981). The virus is disseminated most effectively by this type of mechanical
vector-borne transmission when horses are gathered for equestrian events.
EIA Control is based on identification of unapparent carriers by detection of EIAV antibodies using
serological tests. The Agar Gel Immuno-Diffusion test (AGID) known as a Coggins test (Coggins et
al., 1972) is the most widely used to confirm an EIA case. Recently, some Enzyme Linked-Immuno
Sorbent Assays (ELISA) have been developed as well as immunoblots (Issel et al., 2013). EIA test
is required for horse importation/exportation and for stallions prior semen collection or in hand
breeding. Basically, leisure horses not used for breeding purposes are barely tested for EIA, thus
EIA outbreaks are often detected by a veterinarian following suspicious clinical signs in a horse
farm. Since year 2000, more and more outbreaks of EIA have been reported in Europe and USA.
Stallions serving naturally in certain breeds must also be tested in accordance with their stud
book recommendations. A negative Coggins result must be produced in the three months
prior to the first service then every three years.
Furhtermore, voluntary surveillance is recommended and a test for EIA should be performed
whenever there is a change of ownership. All exported equidae must be tested in accordance with
the health requirements of the importing country. Imported equidae must also be screened for EIA
according to the exporting country, the type of importation (temporary, definitive or readmission
after temporary export) and the type of use (slaughter or other). Screening is not mandatory for
equids transported within the EU except for those from Romania. This measure was introduced in
2010 (2010/346/EU) following several cases of EIA in the United Kingdom, Belgium and France in
2009 and 2010 among equids imported directly from Romania.
2012 outbreaks
In 2012, the French network of accredited laboratories carried out 15,691 serological analyses of
which 27 tested positive. The 27 positive analyses involved eight equines in two distinct outbreaks
in two counties: Vaucluse and Gard. These two outbreaks were discovered following the
appearance of clinical signs that were suggestive of EIA (listlessness, weight loss, anaemia, nasal
bleeding, etc.).
Vaucluse outbreak
The primary outbreak was declared on January 30th, 2012, after confirmation of the infection in a
16 year-old part-bred Arabian gelding that showed suggestive clinical signs such as fever, nasal
bleeding, swelling of the lower abdomen, hind legs and the penile sheath, and pale mucus
membranes. The APDI order for the outbreak site was issued on February 2nd, 2012, requiring
restriction of movements and testing of all horses on the site. This site held seven other horses, three
of which were also diagnosed with an EIAV infection on February 6th, 2012 and all four infected
horses were euthanised on February 9th, 2012.
The epidemiological surveys covered a six-month period from August 2011 to January 2012 and
identified (1) all horses that had been in contact and at risk for EIA infection and (2) all horses
present within a 1 km radius of the outbreak site.
These surveys revealed that some of the four infected horses had participated in an endurance race
in September 2011 in Vaucluse. As a result, more than 180 horses were identified as being at risk of
EIA infection; no cases of infection were detected among those 180 horses. Despite the high
number of at-risk horses exposed during the endurance race in late September 2011, the virus
transmission was not demonstrated outside of the outbreak site, and there was no secondary
transmission to horses off site.
Gard outbreak
The primary EIA outbreak declared in September 2012 in Gard involved six horses of the
Camargue, Pura Raza Espaola (PRE) Andalusian, Barb and Merens breeds. The index case, which
exhibited fever (40C) and low haematocrit levels (16%), was originally thought to be infected with
babesiosis (for which it tested positive), and was treated for this disease. In the absence of
subsequent improvement, the veterinarian suspected an EIA infection and, noting the poor state of
its health (massive weight loss of about 100 kg), the horse was euthanised.
The epidemiological survey was first carried out on horses present within 500 meters of the primary
outbreak site as well as on all horses that had been in contact with the infected horses during the
four months period preceding the confirmation of the outbreak. The surveys identified 378 at-risk
30
contact horses, among which only 364 could be sampled. Of these 364 horses, 3 were tested
positive for EIA.
Molecular epidemiology
To genotype the EIA strains isolated from various outbreaks, gag gene (1400 nucleotides long) was
sequenced. The 2012 EIA outbreaks led to the identification of eight seropositive horses. Virus
isolates were characterised from five of the eight horses. The phylogenetic analysis, carried out
using the MEGA 5.0 software package, was used to compare and classify the viruses isolated in
2012 with respect to those isolated previously in France and those reported in the literature (Figure
1).
Figure 1: Phylogenetic analysis of 50 EIA isolates using MEGA 5.0. Analysis performed using the full gag
gene sequence (1400bp).
The obtained phylogenetic tree shows that the isolates from the outbreak declared in Vaucluse and
Gard were not only different from each other but also from those identified previously in France, in
particular those isolated in Var in 2009 (Ponon et al., 2011). Although there were indications from
the epidemiological field survey that there was an epidemiological connection between the
Vaucluse and Gard outbreaks via the purchase, sale or trade of horses, this hypothesis was not
confirmed by phylogenetic analysis. In contrast, data of this phylogenetic study show that Vaucluse
and Gard outbreaks had two distinct origins because the sequenced virus isolates were not identical.
Furthermore, the seropositive horses in the Vaucluse outbreak were infected by two different
isolates (Figure 1). The isolate characterised from horse 12D134 shows that it was related to isolates
sampled in 2007 on donkeys in Ardche county (Reme et al., 2009). However, no epidemiological
31
connection could be established from the field surveys between horse 12D134 and the Ardche
donkey euthanised in 2007. Likewise, the viral isolates characterised from horses 12D128 and
12D131 were similar to the virus isolated in 2010 in Dordogne county on a cull trotting horse. Once
again, no epidemiological connection was demonstrated between these two outbreaks. Moreover,
the isolates characterised from horses 12D899 and 12D903, found in Gard county, were similar to
viruses isolated in Italy in the past few years (Hans et al., 2012).
32
Figure 2: Phylogenetic analysis by Maximum Likelihood method. The analysis involved 87 nucleotide
sequences
33
During the summer of 2007, an outbreak of EVA occurred in Normandy, France. Only draught and
saddle horses were affected. This 2007 outbreak occurred following the used of semen
contaminated by EAV for insemination. The objectives of this study were to undertake a thorough
epidemiological investigation to identify shedders stallions following the 2007 EVA outbreak as
well as the molecular characterization of EAV isolates encountered in France.
A total of 35 positive semen samples and 5 tissues samples from aborted foetuses were analyzed in
this study. All of them have been collected between 2007 and 2010. The evolutionary history was
inferred by using the Maximum Likelihood method based on the Data specific model. Evolutionary
analyses were conducted in MEGA5 (Tamura et al., 2011). The phylogenetic tree has been
constructed using 87 sequences (figure 2). 52 of them have retrieved from Genbank database and 35
were from viruses isolated in France between 2007 and 2010. Analysis was performed using the
3kb sequences covering ORF2 to ORF7 of the EAV genome.
The phylogenetic tree constructed shows that EVA viruses circulating in France belong to 3 groups
defined as the American group (AG), the European subgroup 1 (EU1) and European subgroup 2
(EU2). Nevertheless the majority of viruses belong to the European group, since only one virus
from the American group has been isolated in France during these 3 years. Interestingly, virus
responsible of the 2007 outbreak in Normandy belongs to the European subgroup 2 and seems to be
slightly different from viruses that use to be isolated in France before the outbreak. Indeed, all viral
isolates which are related to the 2007 outbreak formed a smaller group inside the European
subgroup 2. This genetic feature might explain the severity of the clinical signs and the
pathogenicity of the virus that caused several deaths in 2007
This work gives a clear and precise view of equine arteritis viruses strains that are circulating in
France. EAV isolates belong to the 3 groups described in the literature AG, EU1 and EU2.
Nevertheless the majority of them are from the European lineage. In addition, EAV viruses isolated
during the 2007 outbreak grouped in the European subgroup 2 and are slightly divergent from the
ones seen in France the past years. This genetic diversity might explain the severity of clinical signs
and the higher mortality rate seen during this outbreak. Investigations are in progress to understand
and decipher the pathogenic features of this isolate.
References
1.
2.
3.
4.
5.
6.
7.
Balasuriya, U.B., Go, Y.Y., Maclachlan, N.J., 2013. Equine arteritis virus. Veterinary microbiology.
Bryans, J.T., Crowe, M.E., Doll, E.R., McCollum, W.H., 1957a. Isolation of a filterable agent causing
arteritis of horses and abortion by mares; its differentiation from the equine abortion (influenza) virus.
The Cornell veterinarian 47, 3-41.
Bryans, J.T., Doll, E.R., Knappenberger, R.E., 1957b. An outbreak of abortion caused by the equine
arteritis virus. The Cornell veterinarian 47, 69-75.
Cavanagh, D., 1997. Nidovirales: a new order comprising Coronaviridae and Arteriviridae. Archives of
virology 142, 629-633.
Coggins, L., Norcross, N.L., Nusbaum, S.R., 1972. Diagnosis of equine infectious anemia by
immunodiffusion test. American journal of veterinary research 33, 11-18.
Foil, L.D., Meek, C.L., Adams, W.V., Issel, C.J., 1983. Mechanical transmission of equine infectious
anemia virus by deer flies (Chrysops flavidus) and stable flies (Stomoxys calcitrans). American journal
of veterinary research 44, 155-156.
Glaser, A.L., de Vries, A.A., Rottier, P.J., Horzinek, M.C., Colenbrander, B., 1996. Equine arteritis
virus: a review of clinical features and management aspects. The Veterinary quarterly 18, 95-99.
34
9.
10.
11.
12.
13.
14.
15.
16.
Hammond, S.A., Li, F., McKeon, B.M., Sr., Cook, S.J., Issel, C.J., Montelaro, R.C., 2000. Immune
responses and viral replication in long-term inapparent carrier ponies inoculated with equine infectious
anemia virus. Journal of virology 74, 5968-5981.
Hans, A., Ponon, N., Zientara, S., 2012. Situation pidmiologique de lanmie infectieuse des quids
en France et en Europe de 1994 2011. Bull. Acad. Vt. France 165, 27-34.
Hawkins, J.A., Adams, W.V., Cook, L., Wilson, B.H., Roth, E.E., 1973. Role of horse fly (Tabanus
fuscicostatus Hine) and stable fly (Stomoxys calcitrans L.) in transmission of equine infectious anemia
to ponies in Louisiana. American journal of veterinary research 34, 1583-1586.
Holyoak, G.R., Giles, R.C., McCollum, W.H., Little, T.V., Timoney, P.J., 1993a. Pathological changes
associated with equine arteritis virus infection of the reproductive tract in prepubertal and peripubertal
colts. Journal of comparative pathology 109, 281-293.
Holyoak, G.R., Little, T.V., McCollam, W.H., Timoney, P.J., 1993b. Relationship between onset of
puberty and establishment of persistent infection with equine arteritis virus in the experimentally
infected colt. Journal of comparative pathology 109, 29-46.
Issel, C.J., Adams, W.V., Jr., 1982. Detection of equine infectious anemia virus in a horse with an
equivocal agar gel immunodiffusion test reaction. Journal of the American Veterinary Medical
Association 180, 276-278.
Issel, C.J., Scicluna, M.T., Cook, S.J., Cook, R.F., Caprioli, A., Ricci, I., Rosone, F., Craigo, J.K.,
Montelaro, R.C., Autorino, G.L., 2013. Challenges and proposed solutions for more accurate serological
diagnosis of equine infectious anaemia. The Veterinary record 172, 210.
Leroux, C., Craigo, J.K., Issel, C.J., Montelaro, R.C., 2001. Equine infectious anemia virus genomic
evolution in progressor and nonprogressor ponies. Journal of virology 75, 4570-4583.
Ponon, N., Moutou, F., Gaudaire, D., Napolitan, L., Le Guyader, E., Hans, A., 2011. Bilan de la
surveillance de lAnmie Infectieuse des Equids en France en 2010: gestion de deux pisodes
asymptomatique. Bulletin pidmiologique sant animale-alimentation, 54-55.
17. Reme, A.M., Klotz, S., Guix, E., Hans, A., Ponon, N., Moutou, F., 2009. Anmie infectieuse des
quids: deux foyers rcents en Ardche et dans le var. Bulletin pidmiologie sant animalealimentation BE 33. Rola, J., Larska, M., Rola, J.G., Belak, S., Autorino, G.L., 2011. Epizotiology and
phylogeny of equine arteritis virus in hucul horses. Veterinary microbiology 148, 402-407.
18. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum
parsimony methods. Molecular biology and evolution 28, 2731-2739.
19. Timoney, P.J., McCollum, W.H., 1993. Equine viral arteritis. The Veterinary clinics of North America.
Equine practice 9, 295-309.
20. Vairo, S., Vandekerckhove, A., Steukers, L., Glorieux, S., Van den Broeck, W., Nauwynck, H., 2012.
Clinical and virological outcome of an infection with the Belgian equine arteritis virus strain 08P178.
Veterinary microbiology 157, 333-344.
21. Williams, D.L., Issel, C.J., Steelman, C.D., Adams, W.V., Jr., Benton, C.V., 1981. Studies with equine
infectious anemia virus: transmission attempts by mosquitoes and survival of virus on vector mouthparts
and hypodermic needles, and in mosquito tissue culture. American journal of veterinary research 42,
1469-1473
35
Invited lecture
THE VOLUNTARY PROGRAMME FOR CONTROL AND ERADICATION OF BOVINE
VIRAL DIARRHEA VIRUS INFECTIONS IN SLOVENIA
Ivan Toplak1, Peter Hostnik1, Danijela Rihtari1, Joe Grom1
1. University of Ljubljana, Veterinary Faculty, National Veterinary Institute, Ljubljana, Slovenia
* Corresponding author: Ivan.Toplak@vf.uni-lj.si
Abstract
In Slovenia the control of bovine viral diarrhea viral (BVDV) infection was started 1994. About
half of the bovine herds were recognized with BVDV antibody positive animals. During last twenty
years only limited progress towards the eradication was achieved. With the beginning of year 2014,
according to new national rules, which prescribes the conditions for recognition, acquisition and
maintenance, a free status of BVDV for an individual herd can be achieved, if specific requirement,
based on laboratory testing, and preventive measurements are implemented in a herd. The basis of
voluntary programme is identification and certification of herds which are free of virus. For the
recognition of officially BVDV free status of herd the breeder should provide two consecutives
laboratory testing at intervals of at least six months in all animals which are during the sample
collection in the age group of 7 to 13 months, with negative results for antibodies. The farmer will
then maintained the status by the implementation of preventive measures and each year renewed
this status with one laboratory testing of all animals in the age group of 7 to 13 months. If herd is
recognized as BVDV positive, it can start with the acquisition programme through the identification
and elimination of persistently infected animals and laboratory testing all newborn calf for BVDV
during one year of period.
At the beginning of year 2015 in Slovenia already 11 bovine herds are officially free of BVDV.
First herds with officially BVDV free status confirming, that this practice is a good and cost
effective solution for our farmers. All herds with recognized BVDV free status are presented on
web site of The administration of the Republic of Slovenia for food safety, veterinary and plant
protection. We hope that voluntary programme is first step towards the eradication of BVDV at
national level.
Keywords: bovine viral diarrhoea virus, diagnostics, eradication, cattle
Introduction
Bovine viral diarrhea (BVD) is a disease of cattle that reduces productivity and may increases death
loss. It is caused by bovine viral diarrhea virus (BVDV), a member of the Pestivirus genus of the
family Flaviviridae (Lindenbach and Rice, 2001). BVDV is distributed throughout the world, with
endemic areas detecting antibodies among 70100 % of herds, while in some European countries
such as Sweden, Norway, Finland and Austria, the disease has already been eradicated
(Obritzhauser et al., 2005; Houe et al., 2006). BVDV is spreading by close contact (nose-to-nose)
between cattle and produce heavy economic losses in infected herds.
Virus is shedding by both acutely and persistently infected (PI) animals, but levels of shedding are
much higher in PI cattle, which are the natural reservoir for the virus. Foetuses that become infected
between 30 and 125 days of gestation and survive the infection may be born as BVDV infected
calves (Brownlie et al., 1989). The BVDV infection will persist for the life of the calf, hence the
term ''persistent infection'', or PI. The incidence of PI animals is estimated between 0.3 and 2.6 %
36
(Baker, 1995). PI animals are the main source of infection in infected herds and tend never to reach
their productive potential and growth because of reduced fertility and increased susceptibility to
other diseases (Loneragan et al., 2005). By removing the source of infection (PI animals) from the
population the disease can be controlled (Houe et al., 2006). Blood tests are the most frequently
used method to identify BVDV in live animals, but also other samples such as skin biopsies (taken
from the ear), milk or even oral swab samples can be collected for detection of virus (Kenedy et al.,
2006; Fulton et al., 2009; Toplak et al., 2015).
The monitoring of herds infected with BVDV in Slovenia started in 1994, but the disease is likely to
be present in breeding farms for centuries (Grom and Barli-Maganja, 1999, Toplak, 2004). Since
1994, all bulls in breeding and artificial insemination centers are under supervision based on the
regular laboratory testing (Hostnik et al., 2002). Since this time, the collection centres are free of
BVDV, which are important preventive measures in a country to prevent spreading of BVDV by the
semen. During the period 1996 and 2003 from 260 to 312 breeding herds BVD were monitored for
the detection of antibodies (Toplak et al, 2002, Toplak, 2004). Young bulls are tested for BVD
antibodies and BVDV genome just before entering the breeding centres and later once per year in
centres. Before 2014 only few reports of successful elimination of BVDV was published for
Slovenia (Toplak et al., 2001; Toplak, 2004; Stari et al., 2010).
Molecular methods are used for molecular epidemiology studies to confirm the transmission of the
BVDV between infected herds. Comparison of the nucleotide sequences of BVDV strains obtained
from different infected herds in the 5'-non-coding or Npro region of the viral genome reviled not
only identical strains in different herds, but also introduction of new strains from abroad (Toplak et
al., 2002, Toplak, 2004). The results of genetic typing of 52 BVDV strains collected between 2004
and 2013 from infected Slovenian herds have shown that the identified strains of BVD virus were
classified into the same subgroup of genotype 1 (1b, 1d, 1f, 1g) as have been detected in years 1998
to 2004 confirming that the same strains have been circulating more than a decade in infected herds
(Toplak, 2004, Toplak et al., 2014). BVDV strains of genotype 2 were not identified in Slovenia.
Although it is difficult to estimate the disease cost because of variable infection many cost-benefit
analysis proved the positive impact of BVDV elimination at herd and eradication at national level
(Houe, 2003, Hsler et al., 2012). With the beginning of 2014, new national rules determining the
conditions for recognition, acquisition and maintenance of a herd status, free of BVDV (Uradni list
Republike Slovenije no. 107/2013) were introduced. This program is modification of the BVDV
eradication programs successfully established at national level in Sweden, Norway, Finland,
Denmark and Austria (Lindberg and Alenius, 1999; Obritzhauser et al., 2005). After one year of
experiences some breeders already achieved significant progress in health status, implement
preventive measures and maintenance of BVDV free status in the herds. In this paper, we would
like to present some experiences with new rules and some preliminary results.
37
Results
During the period between January 2014 and April 2015 in total 1.138 samples were collected from
99 individual cattle herds and tested for antibody detection. Sera samples were tested by ELISA
38
(Svanovir BVDV Ab, Svanova) for detection of specific antibodies against BVDV and samples
were interpreted according to producer instructions. First herd with BVDV free status was officially
confirmed in July 15, 2014. Until April 2015, official recognition of BVDV free status was
confirmed already for 13 individual herds.
Between January 2014 and April 2015 in total 2.186 individual serum samples from newborn calf
and cattle were collected from 86 different herds and tested for BVDV genome by RT-PCR as
previously described (Toplak et al., 2015). Out of 2.186 tested animals 64 (2.92 %) were detected
BVDV genome positive animals by RT-PCR method.
Scheme 1: The algorithm for recognition, acquisition and maintenance of BVD free status - the basic
principles for voluntary program, which was started in Slovenia in January 2014.
Discussion
The first voluntary program providing officially recognized BVDV free status for individual herds
in Slovenia started in January 2014. Veterinary faculty from Ljubljana together with Administration
for Food Safety, Veterinary and Plant Protection and private practitioners prepared the conditions
for farmers, which want to apply for BVDV free status. The basic principle of first voluntary
program is laboratory testing of young stock together with preventive actions of farmer to prevent
reintroduction of BVDV. Although the BVDV infection is endemic in Slovenia with about 30 % of
infected cattle herds, still more than half of herds are free of BVDV. For this reason, more than
hundred cattle farmers already started with first step for recognition of BVDV free status.
According to herd size, number of animals which need to be tested, is usually between 5 and 10.
This is important information for farmers who covers all costs, including laboratory testing. After
39
first negative results in a herd, the same herd needs to be tested after six month to prove the stability
of herd. First 13 herds which have already been officially recognized with BVDV free status are
promising, that new rules were accepted from farmers and recognition of BVDV free status have
important value to improvement the production on a farm. The initial testing of herds for antibodies
gives also opportunity for farmers to start with the control BVDV in infected herd. The BVDV
positive herds can take the actions through the identification and elimination of persistently infected
animals from a herd. These animals secreted the BVD virus into the environment, especially with
nasal discharge, saliva, feces and urine. In BVDV infected herd newborn calf are constantly
infected within a few months after the birth, expressing clinical symptoms and get sick because of
acute phase of the disease. After two to three weeks, specific antibodies can be detected by ELISA
and those antibodies are present in the blood throughout life. If the mother is positive for BVD
antibodies, calves receive colostral antibodies, by sucking colostrum, which remain in the blood up
to 3 months, in rare cases up to 8 months of age. During the laboratory testing it was recognized
that individual animals from the sampled age group of 7 to 13 months were low antibody positive in
ELISA test, usually with percent positive values between 10 and 20, so we suggest retesting them
after one month. The important preventive measure is also that animals must be separated by
physical or natural barriers from herds with a lower status and only negative animals may be
introduced into herd through quarantine. Farmer needs to be careful about this, not to lose BVDV
negative status. In the infected herd, BVDV is quickly transmitted between animals of all ages and
this feature of BVD virus can be successfully used in laboratory tests. Screening of the age group of
young animals in the herd (aged 7 to 13 months) assures us that based on the results specific
antibodies the current situation regarding BVDV infection in the whole herd is recognized.
BVDV positive animal may not be sold, because those animals are the main source for spreading
BVDV infection into new herd. The identification of PI in infected herds was successful and 64
new PI animals were detected last year. Our system is still without record of slaughtering those
BVDV positive animals and these needs to be corrected as soon as possible. At the moment the
action and responsibility is on farmer. If such BVDV positive animal is send to other herd this will
act like a boomerang, because it will extended the circulation of virus in population and maintain
the BVDV infection in the herds.
Conclusion
New rules which were adopted for the first time in Slovenia define the conditions for recognition,
acquisition, maintenance and withdrawal of BVDV free status. Veterinary Faculty is offering to a
breeder special package of discounts for laboratory testing of samples and reduced the time from
sample reception to the results on one week. For the recognition and maintenance of BVDV free
status, only a small proportion of the entire herd need to be tested, which allows lower costs and the
recognition of the BVDV free status for many breeders. Program is on voluntary basis and gives no
compulsion to breeders which can at any stage of the control decide to deviate from the target. The
common aim for farmers and veterinarian is healthy herd and healthy animals. Breeders who are
selling and buying animals will benefits based on BVDV free status. They can decide what kind of
animals want buy for a fixed price. The new rules based on voluntary program have already been
implemented and widely accepted and we believe that it provides a good solution for our farmers.
Our neighbouring countries such as Austria, Italy and Switzerland were already implemented or
finished similar BVD national program. Thus, the next step will be moving from voluntary to
national program.
Acknowledgments
Special thanks to Breda Hrovatin, Jedrt Maurer Wernig and group from The Administration of the
Republic of Slovenia for Food Safety, Veterinary Sector and Plant Protection, private veterinary
40
practitioners and farmers for collaboration in program. Thanks to Polona Beron for technical
assistance during sample testing. This research was financially partly supported by the Slovenian
Research Agency, program group P4-0092 (Animal Health, Environment and Food Safety).
References
1. Baker JC.: The clinical manifestations of bovine viral diarrhea infection. Vet Clin Nort Am Food Anim
Pract 11: 425445, 1995
2. Brownlie J, Clarke MC, Howard CJ: Experimental infection of cattle in early pregnancy with a
cytopathic strain of bovine virus diarhoea virus. Res. Vet. Sci. 46, 307311, 1989
3. Fulton RW, Hessman BE, Ridpath JF, et al.: Multiple diagnostic tests to identify cattle with bovine viral
diarrhea virus and duration of positive test results in persistently infected cattle. Can J Vet Res 73: 117
124, 2009
4. Hsler B, Howe KS, Presi P, Strk, KDC.: An economic model to evaluate the mitigation programme for
bovine viral diarrhoea in Switzerland. Prev. Vet. Med. 106, 162173, 2012.
5. Hostnik P, Toplak I, Barli-Maganja D, Kosec M, Grom J. Predlog programa kontrole in izkoreninjenja
okub z virusom bovine virusne diareje v osemenjevalnih centrih, v vzrejaliih in rejah bikovskih mater
Vet. nov. 11: 449-456, 2002
6. Houe H, Lindberg A, Moennig V.: Test strategies in bovine viral diarrhea virus control and eradication
campaigns in Europe. J Vet Diag Invest 18: 427436, 2006
7. Houe H.: Economic impact of BVDV infection in dairies. Biologicals 31, 137143, 2003
8. Kennedy JA, Mortimer RG, Powers B.: Reverse transcription-polymerase chain reaction on pooled
samples to detect bovine viral diarrhea virus by using fresh ear-notch-sample supernatants. J Vet Diag
Invest 18: 8993, 2006
9. Lindberg ALE, Alenius S.: Principles for eradication of bovine viral diarrhea virus (BVDV) infections in
cattle populations. Vet Microbiol 64, 197-222, 1999
10. Lindenbach BD, Rice CM.: Flavivirdae: the viruses and their replication. In: Fields virology, ed. Knipe
DM, Howley PM, 4th ed., Lippincott Williams & Wilkins, Philadelphia, PA, 2001, 9911041
11. Loneragan GH, Thomson DU, Montgomery DL, et al.: Prevalence, outcome and health consequences
associated with persistent infection with bovine viral diarrhea virus in feedlot cattle. J Am Vet Med
Assoc 226: 595601, 2005
12. Obritzhauser W, Fuchs K, Kfer J.: BVDV infection risk in the course of the BVDV eradication
program in Styria/Austria. Prevent. Vet. Med. 72, 127132, 2005
13. Stari J, Laiek D, Raspor P, Gaperlin B, Jeek J, Toplak I. Bovina virusna diareja (BVD) in opis
zdravljenja okuene mlene reje. Vestnik Veterinarske zbornice Slovenije. 3: 9-13, 2010
14. Toplak I, Barli-Maganja D, Hostnik P, Grom J. Ugotavljanje perzistentnih izloevalcev virusa bovine
virusne diareje (BVD) v seroloko pozitivnih rejah bikovskih mater v Sloveniji Vet. nov. 3: 97-102,
2001
15. Toplak I, Barli-Maganja D, Hostnik P, Grom J.: Genetic heterogeneity of bovine viral diarrhoea virus
(BVD) strains isolated in Slovenia. Slov. vet. res. 39: 113-123, 2002
16. Toplak I: Molecular epidemiology of bovine viral diarrhoea virus (BVDV) in Slovenian breeding cattle
herds, Doctoral thesis, University of Ljubljana, Veterinary Faculty, 1-142, 2004
17. Toplak I, Rihtari D, Hostnik P, Grom J.: Molekularna epidemiologija virusov bovine virusne diareje
(BVD) ugotovljenih v Sloveniji med leti 1997 in 2014. V: MAJDI, Gregor (ur.). 5. slovenski
veterinarski kongres 2014 = 5th Slovenian Veterinary Congress 2014, Portoro, 14.-15. November 2014,
(Slovenian veterinary research, 2014, suppl. 16). Ljubljana: Veterinarska fakulteta, 2014, 23-24.
18. Toplak I, Rihtari D, Hostnik P, Mrkun J.: The usefulness of two molecular methods for the detection of
persistently infected cattle with bovine viral diarrhea using oral swab samples. Slov Vet Res, 52, 23-30,
2015
41
Invited lecture
COMPARISON OF MACROSCOPIC AND MICROSCOPIC LESSION IN MESENTERIAL
LYMPH NODES IN PIGS NATURALLY INFECTED WITH MYCOBATERIUM AVIM
SUBSP HOMINISSUIS
Vladimir Polaek1*, Jasna Prodanov-Radulovi1, Dejan Vidanovi2 Sanja Kovaevi-Aleksi3
1
2
Abstract
Mycobacterium avium, belonging to the Mycobacterium avium complex (MAC), is divided into the
subspecies avium, paratuberculosis and silvaticum. More recently, M. avium subsp avium has been
further divided into M. avium subsp avium and M. avium subsp. hominissuis. M. avium subsp
hominissuis (MAH) is a bacterium which causes mycobacteriosis both in pigs and humans and most
common diseases of children and immune-compromised humans. The most important
morphological characteristic of infections caused by MAH and other mycobacteria is granuloma
formation. Granuloma is a unique structure and within it the growth of mycobacteria is in
accordance with anti-bacterial effector mechanisms of the host.
In our study we compared macroscopic and microscopic lessons in formalin fixed paraffin
embedded (FFPE) samples of mesenterial lymph nodes from tuberculin positive pigs. FFPE lymph
nodes were also examined by real-time PCR for IS1245. Post mortem examination was performed
on 100 pigs. Granulomatous lesions compatible with mycobacterial infection were found in
mesenterial lymph nodes in 88 pigs. Macroscopic lesions were detected in 43 pigs, while 45 pigs
manifested only microscopic lesions. In 12 pigs, no lesions were detected. The granulomas were
composed of focal accumulation of inflammatory cells in which macrophages, epithelioid cells,
multinucleated giant cells and lymphocytes predominated. Caseous necrotic areas were present in
some granuloma. Numerous eosinophils and myofibroblasts were present within the granuloma.
Our results show that routine meat inspections at slaughterhouses may fail to detect microscopic
lessons caused by M. avium subsp hominissuis and in certain cases could pose a threat for consumer
health.
Keywords: Mycobaterium avium subsp hominissuis, mycobacteriosis, granuloma, meat inspections
Introduction
Mycobacterium avium, belonging to the Mycobacterium avium complex (MAC), is divided into the
subspecies avium, paratuberculosis and silvaticum (Inderlied et al., 1993). More recently, M. avium
subsp avium has been further divided into M. avium subsp. avium and M. avium subsp. hominissuis
(Mijs et al, 2002; Turenne et al, 2007). M. avium subsp. hominissuis (MAH) is a ubiquitous
microorganism which lives both in water and soil and causes mycobacteriosis of pigs and human
population, mostly in children and immunocompromised humans (Agdenstein et al., 2014; Alvarez
et al., 2011; Domingos et al., 2009; Falkinham et al 1996; 2001; Johansen et al., 2014; Matlova et
al., 2004, 2004a, 2005; Biet et al., 2005; Hilbor et al., 2008; Yajko, 1995). One of major hallmark of
MAH infections in pigs are localized granulomatous lesions on lymph nodes of digestive tract
or/and on lymph nodes in the head (Thorel et al, 2001; Hybia et al, 2008; Polaek, 2010).
Generalized disease is less common and can affect internal organs such as liver, spleen or kidneys
though not always, are found at the meat inspection in slaughterhouses, without a previous detection
42
of clinical symptoms of the disease (Agdestein et al., 2012; Thoen, 2006). An annual study of a
slaughterhouse in the Netherlands shows that caseous changes have been detected in 0.5% of
examined lymph nodes of slaughtered pigs out of which 50% were infected with Mac (Komijn et
al., 2007). The available data suggests that certain herds of pigs exhibited granulomatous changes
in 30-50% of slaughtered pigs where M. avium was detected (van Ingen et al., 2010). As a routine
tuberculin skin test is not performed on pigs in most countries, the main source of information about
the occurrence of tuberculosis is the data gathered at meat control in slaughterhouses (Cvetni et al.,
2007; Agdestein et al., 2012). On the other hand, a large number of infected animals may fail to
detect by routine meat inspection at slaughterhouses since the changes at some stages of Mac
infections arent macroscopically visible (Komijn et al., 1999; Tirkkonen et al., 2007; Polaek,
2010). This paper will present the results of macroscopic and microscopic changes on mesenteric
lymph nodes of the pigs naturally infected with M. avium subsp. homminissuis.
Results
Macroscopic examination showed that mesenteric lymph nodes were enlarged with or without
bordered areas of caseous necrosis. I.e. calcification. The diameter of the limited areas of caseous
43
necrosis, i.e. calcification was most commonly 1-2 mm, although in some cases it was larger than
10 mm (Image 1.).
The presence of M. avium subsp. hominissuis has been confirmed in a previous study by real time
PCR detecting IS1245 (Agdestein et al. 2011, Polaek 2010).
Picture 1. Macroscopic changes on mesentric lyph nodes infected with M. avium complex A limited area of
caseous necrosis on the cross section of a mesenteric lymph node (A-B). Disseminated areas of caseous
necrosis and dystrophic calcification on the cross section of a mesenteric lymph node (C-F).
The first group included granulomas dominated by macrophages (epithelioid cells) and
lymphocytes. Caseous necrosis in granuloma centre was not detected in this group. Eosinophil
granulocytes were located between macrophages and lymphocytes, diffusely dispersed in a
granuloma. Epithelioid cells have light cytoplasm and vesicular nucleus with scarce chromatin. In
order to expand phagocytic capacity, several epiteloid cells are merged into polynuclear giant cells.
At this stage, granulomas contain 1-2 giant cells on average. Out of the total of 100 examined
samples of swine mesenteric lymph nodes, 19 belonged to the first histological group- 15 of them
were from macroscopic group A (no visible changes on lymph nodes) and 4 were from the group B
(with visible changes on lymph nodes).
The second group contained granulomas with morphological characteristics of circumscript lesions
with outer layer formed of myofibroblasts. These cells are commonly elongated or oval, located on
the periphery of granulomas, which separates it from the surrounding tissue. Individual
myofibroblasts with different phenotype are located diffusely in a granuloma. The central part of
the granulomas from the second group is modified by the areas of caseous necrosis. In some cases
dystrophic calcification in the form of dark blue deposits of irregular shape and uneven size is
detected. The thickness of connective tissue capsule is more conspicuous in big granulomas in the
areas of central necrosis. The number of polynuclear cells is significantly smaller than in the
granulomas from the first group. Morphological characteristics of granulomas from the second
group were found in 8 samples- 5 of them belonged to the macroscopic group A (with no visible
changes on lymph nodes), while 3 samples were classified into macroscopic group B (with visible
changes on lymph nodes).
Granulomas with distinctive and ever-present caseous necrosis and/or calcification in the centre
were in the third group. Necrotic area in the centre and clearly conspicuous connective tissue layer
on the periphery narrow the zone of epithelioid cells and lymphocytes and form a layer where
eosinophil granulocytes are found. Their distribution is distinctive on the periphery which is why
these cells from the 3rd group are peripherally located, between myofibroblasts, with irregular shape
in the connective tissue outer layer. They can even be found outside the belt. Giant polynuclear cells
were not found in these granulomas. A great majority of mesenteric lymph node samples (61)
belonged to the third histological group. 25 of them were in the macroscopic group A (with no
visible changes on lymph nodes), while 36 were in group B (with visible changes on lymph nodes).
(Table 1)
Morphological characteristics of the above mentioned granuloma types, in different stadiums of the
same tissue samples overlap in some cases. The criterion for classification in such situations was the
presence of dominating changes on a sample. Out of the total number of examined samples there
were 12 pigs that showed neither macroscopic nor microscopic changes typical of tuberculosis.
These lymph nodes were classified into macroscopic group A (Table 1).
Table 1. Overall results of both macrocopic and microscopic examinations of pig mesenteric lymph
nodes
microSCOPIC
changes
No changes
(Group A)
scopic
MACRO
No
changes
With changes
(Group B)
Group 1.
changes
Group 2.
Group 3.
12
15
25
57
(45)
36
43
12
19
61
45
Picture 2. Microscopic changes on mesenteric lymph nodes of the pigs infected with Mycobaterium avium
complex : A-microscopic group 1, B,D-microscopic group 2, C, E- multinucleated giant cells and Fmicroscopic group 3.
Discussion
This paper deals with morphological changes on mesenteric lymph nodes in pigs that were
previously diagnosed with positive tuberculin skin reaction. Molecular method determined the
presence of M. avium subsp hominissuis genome.
Granuloma is a unique structure and within it the growth of mycobacteria is in accordance with
anti-bacterial effector mechanisms of the host (Co et al., 2004). Granulomatous tip of inflammatory
46
Acknowledgements:
This study was supported by Project TR 31084 of Ministry of Education, Science and
Technological Development, Republic of Serbia. Also we would like to express our grateful to
47
Tone Bjordal Johansen and her colleagues from Norwegian Veterinary Institute (Oslo) for help with
molecular examinations and Danka Vukainovi for help with manuscript and translation.
References:
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
lvarez J., Castellanos E., Romero B., Aranaz A., Bezos J., Rodrguez S., Mateos A., Domnguez L., de
Juan L. Epidemiological investigation of a Mycobacterium avium subsp. hominissuis outbreak in swine.
Epidemiology and Infection. 2011;139(1):143148
Agdestein A., Johansen T. B., Polaek V., Lium B., Holstad G., Vidanovi D., Aleksi-Kovaevi S.,
Jrgensen A., ultauskas J., Nilsen S. F., Djnne B. Investigation of an outbreak of mycobacteriosis in
pigs. BMC Veterinary Research. 2011; 7, 63.
Agdestein A, Johansen TB, Kolbjrnsen , Jrgensen A, Djnne B, Olsen I. A Comparative study of
Mycobacterium avium subsp. avium and Mycobacterium avium subsp. hominissuis in experimentally
infected pigs. BMC Veterinary Research. 2012; 8: 11. doi:10.1186/1746-6148-8-11.
Agdestein A., Olsen I., Jrgensen A., Djnne B., Johansen T. B. Novel insights into transmission routes
of Mycobacterium avium in pigs and possible implications for human health. Veterinary Research.
2014; 45.
Biet F, Boschiroli ML, Thorel MF, Guilloteau LA. Zoonotic aspects of Mycobacterium bovis and
Mycobacterium avium-intracellulare complex (MAC) Vet Res. 2005;36: 411436.
Co, D.O., Hogan, L.H., Kim, S.I., Sandor, M., 2004. Mycobacterial granulomas: key to a long-lasting
host-pathogen relationship. Clin. Immunol. 113, 130-136.
Cvetni Z, Spicic S, Benic M, Katalinic-Jankovic V, Pate M, Krt B, Ocepek M. Mycobacterial infection
of pigs in Croatia. Acta Vet Hung. 2007; 55:19.
Domingos M., Amado A., Botelho A. IS 1245 RFLP analysis of strains of Mycobacterium avium
subspecies hominissuis isolated from pigs with tuberculosis lymphadenitis in Portugal. Veterinary
Record. 2009; 164(4):116120.
Falkinham JO III. Epidemiology of infection by nontuberculous mycobacteria. Clin Microbiol Rev.
1996; 9:177215.
Falkinham J. O., III, Norton C. D., Lechevallier M. W. Factors influencing numbers of Mycobacterium
avium, Mycobacterium intracellulare, and other mycobacteria in drinking water distribution systems.
Applied and Environmental Microbiology. 2001; 67(3):12251231.
Hilborn E. D., Yakrus M. A., Covert T. C., Harris S. I., Donnelly S. F., Schmitt M. T., Toney S., Bailey
S. A., Stelma G. N., Jr. Molecular comparison of Mycobacterium avium isolates from clinical and
environmental sources. Applied and Environmental Microbiology. 2008;74(15):49664968.
Hibiya, K., Kasumi, Y., Sugawara, I., Fujita, J., 2008. Histopathological classification of systemic
Mycobacterium avium complex infections in slaughtered domestic pigs. Comp Immunol Microbiol
Infect Dis 31, 347-366.
Inderlied CB, Kemper CA, Bermudez LE. The Mycobacterium avium complex. Clin Microbiol Rev.
1993; 6:266310.
Johansen TB, Agdestein A, Lium B, Jrgensen A, Djnne B. Mycobacterium avium subsp. hominissuis
Infection in Swine Associated with Peat Used for Bedding. BioMed Research International. 2014;
2014:189649. doi:10.1155/2014/189649.
Mijs W, de Haas P, Rossau R, Van der Laan T, Rigouts L, Portaels F, Van Soolingen D. Molecular
evidence to support a proposal to reserve the designation Mycobacterium avium subsp. avium for birdtype isolates and M. avium subsp. hominissuis for the human/porcine type of M. avium. Int J Syst Evol
Microbiol. 2002; 52:15051518.
Matlova L., Dvorska L., Palecek K., Maurenc L., Bartos M., Pavlik I. Impact of sawdust and wood
shavings in bedding on pig tuberculous lesions in lymph nodes, and IS1245 RFLP analysis of
Mycobacterium avium subsp. hominissuis of serotypes 6 and 8 isolated from pigs and environment.
Veterinary Microbiology. 2004; 102(3-4):227236.
48
49
Abstract
In this study the protective effects of two bivalent inactivated vaccines were evaluated. Vaccines
were prepared from Listeria monocytogenes, serotypes 1/2a and 4b, as the most frequent in our and
surrounding epidemiological areas. Vaccine A consists of whole L. monocytogenes bacteria cells,
inactivated with 0.4% formaldehyde and aluminium hydroxide as a carrier. Vaccine B contains
0.1% saponin in addition to ingredients of vaccine A. Evaluations of these vaccines were performed
in 60 sheep, divided into four groups (n=10) with a corresponding negative control group (n=5).
After 14 days, boosterisation of all animals was performed. In order to evaluate the immune
response, blood samples were obtained every 14 days during the next 6 months. Antibody titres
were determined by microaglutitation (MAT) and complement fixation tests (CFT).
Comparative analyses of antibody titres, induced by vaccines A and B, show that the later (with
saponine) significantly increased the level of antibody titres (p<0.01). The levels of immune
response were also significantly impacted by the total number of bacteria and vaccine dosages
(p<0.01).
The bivalent vaccine containing 0.1% saponin (vaccine B) in 5.0 ml x 106 cfu/ml (colony-forming
units per milliliter) dosage shows a protective effect after challenge with L. monocytogenes. The
protective levels of antibody were 1/80 and 1/16, determined by MAT and CFT, respectively.
Antibody titres were significantly higher after boosterisation (p<0.01) and protective levels could be
detected in sera of vaccinated animals during the next 6 months.
Therefore, it is strongly recommended to perform boosterisation two weeks after initial vaccination.
Keywords: Listeria monocytogenes, vaccine, immune response, protective effect, saponin, sheep
Introduction
Listeria monocytogenes, a gram-positive, facultative intracytosolic bacteria, is the causative agent
of listeriosis, a severe disease associated with a high mortality rate. Nearly all domestic animals are
susceptible to L. monocytogenes infection, but animal listeriosis most commonly occurs in
ruminants. Listeriosis is also an important food-borne zoonosis (Farber and Peterkin, 1991; Regan
et al., 2005). In ruminants, among which sheep are the more commonly affected, listeriosis is
usually represented by three distinct clinical syndromes; septicemia, encephalitis
(meningoencephalitis), and abortion. Ovine listeriosis has also been associated with mastitis, some
ophthalmic lesions, such as keratoconjunctivitis and gastroenteritis (Wagner et al., 2000; Clark et
al., 2004; Otter et al., 2004; Gasanov et al., 2005).
Listeria is widely distributed in the natural environment and has been isolated from soil surface,
rotten vegetables and pasture herbage. Domesticated ruminants play a key role in the maintenance
of Listeria spp. in the rural environment through a continuous faecaloral enrichment cycle (Picoux,
2008). The main source of infection in ruminants is poorly fermented silage with a pH above 5.0
5.5 and within pockets of aerobic deterioration (microaerophilic microorganisms). In general, the
disease is more frequent in winter and early spring. This risk during the winter season is associated
50
with the fact that Listeria can grow at temperatures where growth of other pathogens is inhibited
due to excessive cold (psychrophilic microorganisms) (Radostits et al., 2007).
L. monocytogenes can be distinguished in 16 serovars on the basis of somatic and flagellar antigens
and there is genetic diversity between serovars (Beumer and Hazeleger, 2002). Two virulent
serovars (l/2a and 4b) are most commonly isolated in farm animal diseases in Serbia (unpublished
data). These strains can multiply in macrophages and monocytes and produce a haemolysin,
listeriolysin O (LLO), which is the virulence determinant of the organism (Bennett and Weaver,
2001; Amagliani et al., 2006).
The recovery rate is higher if treatment is administered early in the course of the disease.
Antibiotics (ampicilline and gentamicin) must be administered for a prolonged period, because
recovery can take as long as one month (Low and Donachie, 1997). Treatment of severely ill or
recumbent animals with listeriosis is rarely successful (George, 2002). Immunoprophylaxis (i.e
vaccination) has proved itself over the past 120 years to be by far the most efficient and costeffective method of controlling infectious diseases. Nevertheless, vaccination is not always an
innocuos procedure, and its use must always be accompanied by a careful assessment of the risks
and benefits of the procedure (Tizard, 2006).
Taking into account all of the above mentioned, the objective of this study was to evaluate the
protective effects of two inactivated, bivalent vaccines prepared from two of the most frequent
serotypes of L. monocytogenes in our and surrounding epidemiological areas.
Results
Examining the blood serum on day zero, (before commencing with the vaccination), employing the
method of slow agglutination, it was determined that the sheep included in the experiment were
seronegative for 1/2a and 4b L. monocytogenes serotypes.
Results of sheep antibody titres obtained by the method of microagglutination
Titres of agglutinized antibodies in sheep vaccinated with vaccine A ranged within the interval from
1/20 to 1/80, while in sheep which received vaccine B, the titres ranged from 1/40 to 1/320 (results
not shown).
It has been determined by statistical analysis that the average antibody titre was highest in the
animal group IV which received the vaccine B, the dose being 5.0 ml (17.69 1.11), while the
lowest titre was in the animal group I which received the vaccine A, the dose being 2.5 ml (12.96
1.25) (Fig. 1). Comparing the average values of antibody titres, a high statistical difference was
determined between all the studied groups (p<0.01). Comparing antibody titre values between the
groups that received different doses of vaccine B, no statistical differences were detected (p>0.05).
Analyzing the trend of agglutinized antibody titre movement, after applying vaccine A in a dose
range from 2.5 to 5.0 ml during 24 weeks, it has been detected that the titre gradually increases,
reaching maximum values on the sixth and fourth week respectively, followed by a fall (Figure 2).
52
A very similar tendency of movement has the antibody titre after the application of vaccine B with a
dose of 2.5 ml. The titre gradually rises and reaches its peak on the eigth week after vaccination,
followed by a downfall (Figure 2).
Analyzing the tendency of agglutinizing antibody titre movement after application of vaccine B,
with doses of 2.5 and 5.0 ml, during 24 weeks, it has been determined that the titre gradually
increases, reaching its maximum value on the sixth week followed by a gradual fall (Figure 2). A
very similar tendency of movement is shown by the antibody titre after applying the vaccine B with
a dose of 2.5 ml. The titre gradually rises, reaching its highest level on the eight week after
vaccination, followed by a gradual fall (Figure 3).
Figure 1. Average titres of antibody following the application of vaccines A and B in different
dosages, determined by MAT. Group I versus group II, p<0.01; Group II versus group III, p<0.01; Gruop
III versus group IV, p>0.05
Figure 2. The trend of agglutinized antibody titres movement during 24 weeks period following the
application of vaccine A in 2.5 and 5.0 x 106 cfu/ml, determined by MAT. CI Confidential Interval
53
Figure 3. The trend of agglutinized antibody titres movement during 24 weeks period following the
application of vaccine B in 2.5 and 5.0 x 106 cfu/ml, determined by MAT. CI Confidential Interval
Discussion
Vaccination is a very useful tool in preventing infectious diseases, if there is an elicitation of
effective, protective antibodies. Two major criteria must first be satisfied in determining whether
vaccination should be used to control a specific disease. First, it must be established that the
immune system can protect against the disease in question. Second, before using a vaccine, we must
be sure that the risks of vaccination do not exceed those associated with the chance of contracting
the disease itself (Tizard, 2006; Radostits et al., 2007).
Since the therapy of listeriosis is currently under discussion and does not always offer good results,
listeriosis being a serious zoonosis (Braun et al., 2002), the aim of this study is to evaluate the
efficiency of our experimental inactivated vaccine in contributing to the control and suppression of
listeriosis. On the basis of isolation and serotypization, it has been determined that serotypes 1/2a
and 4b L. monocytogenes dominate on our epizootological region, as well as in the surrounding
countries (unpublished data). This is the reason why in our study we selected the above mentioned
L. monocytogenes strains.
The key factors for the vaccine quality and adequate immune response are: the number of
microorganisms in the vaccine, degree of attenuation or means of inactivation, combination of
bacterial antigens in the vaccine, as well as the type of added adjuvant, time of vaccination and
revaccination (Gudding, 1989).
It has been established that the total number of microorganisms in the vaccine, as well as the vaccine
dose, have an effect on the immune response (Linde et al., 1995). For this reason, the animals in our
54
experiment were vaccinated with various doses of vaccine, 2.5 and 5.0 ml 106 cfu/ml. On the basis
of the fact that we used pathogen L. monocytogenes serotypes, their inactivation was achieved with
formalin with the addition of aluminium hydroxide as the carrier (Szemeredi and Padanyi, 1989).
We determined that the antibody titre is significantly higher if the studied vaccine is applied as a dose of
5.0 ml 106 cfu/ml, in relation to the dose of 2.5 ml 106 cfu/ml (Figs 1 and 3). Comparing antibody
titres in animals immunized with vaccines A and B, it has been determined that the addition of saponin
in vaccine B, at a dose of 0.1%, significantly supports the immune response (Lhopital et al., 1993;
Linde et al., 1995). These results are expected due to the fact that saponin is a nonspecific activator of
the immune system (Tizard, 2006).
Antibody titres obtained by vaccines with saponin differ significantly when compared to titres obtained
by applying vaccines without saponin. Titre levels of agglutinated antibodies applying the vaccine
containing saponin ranged from 1/40 to 1/320, while with vaccines lacking saponin, the values ranged
from 1/20 to 1/80.
The aim of revaccination is the boosterization, i.e. obtaining higher antibody titres (Tizard, 2006). In the
present study, 14 days after vaccination, a revaccination has been performed. It is evident that the
agglutinated antibodies persisted in the serum of animals six months after vaccination, specifically with a
higher titre after the application of vaccine B with a dose of 5.0 ml 106 cfu/ml (Figs 4, 5 and 6). The
vaccinal titre obtained in this way was in the range of 1/80 to 1/320, determined by MAT. Our results
are in agreement with the results of other authors (Ivanov, 1985; Gudding, 1989; Linde, 1995), who
suggested revaccination for a more efficient protection from L. monocytogenes.
With the intention of checking the quality and efficiency of the prepared vaccine, an artificial
infection was initiated (Mencikova et al., 1989). Taking into account that by applying vaccine B,
with a dose of 5.0 ml 106 cfu/ml, the highest antibody titre was obtained. The examination was
performed on five sheep with average titre levels for this group of animals. Monitoring the health
conditions of the studied sheep during the period of 30 days, we determined that the bivalent vaccine
prepared from inactivated listeria serotypes with saponin and dose of 5.0 ml 106 cfu/ml, protected the
studied animals after artificial infection, the protective titre having a value of 1/80 for MAT, i.e. 1/16
applying CFT. These results are in agreement with those previously reported by Nowacki et al. (1987)
and Tzora et al. (1998).
Since the studied vaccine has not shown toxicity and was efficient in the protection of sheep after
artificial infection, such a vaccine with additional research and evaluation on a larger number of
animals could find its application in the control of listeriosis in flocks where listeriosis appears
more frequently resulting in greater economic losses (Ivanov et al., 1977; Mencikova et al., 1989;
Regan et al., 2005).
In conclusion, in this study, we demonstrated that antibody titres were significantly higher after
boosterisation and that protective levels could be detected in sera of vaccinated animals during the
next 6 months. Therefore, it is strongly recommended to perform boosterisation two weeks after
initial vaccination.
Acknowledgements
Financial support for this study was provided by the Ministry of Education Science and
Technological Development, Republic of Serbia (Grant No 31085).
References
1.
2.
Amagliani G.C., Giammarini E., Omiccioli E.G., Merati G., Pezzotti G., Filippini G., et al.: A
combination of diagnostic tools for rapid screening of ovine listeriosis. Res Vet Sci, 81, 185189, 2006
Bennett W.R., Weaver R.E.: Serodiagnosis of Listeria monocytogenes. Bacteriological Analytical
Manual, 58-72, 2001
55
Beumer R.R., Hazeleger C.W.: Listeria monocytogenes: diagnostic problems. Immun Med Microbiol,
35, 191197, 2002
Braun U., Stehle C., Ehrensperger F.: Clinical findings and treatment of listeriosis in 67 sheep and
goats. Vet Rec, 150, 38-42, 2002
Brugere-Picoux J.: Ovine listeriosis, Small Rumin Res, 76, 12-20, 2008
Clark R.G., Gill J.M., Swaney S.: Listeria monocytogenes gastroenteritis in sheep. NZ Vet J, 52, 46-47,
2004
Farber J.M., Peterkin P.I.: Listeria monocytogenes, a food-borne pathogen. Microbiol. Rev, 55, 476
511, 1991
Gasanov U.D., Hughes P., Hansbro M.: Methods for the isolation and identification of Listeria spp. and
Listeria monocytogenes. FEMS Microbiol Rev, 229, 851875, 2005
George L.W.: Listeriosis, In Smith, BP, (Ed), Large Animal Internal Medicine, Mosby, St Louis, 946949, 2002
Gudding R., Nesse L.L., Gronstol H.: Immunisation against infections caused by Listeria
monocytogenes in sheep. Vet Rec. 125, 111114, 1989
Ivanov M., Draganov T., Dikova M.: Study on the active immunoprophylaxis of sheep listeriosis. Cent
Vet Res Inst, Sofia, 324329, 1977
Kumar H., Singh B.B., Bal M.S., Kaur K., Singh R., et al: Pathological and epidemiological
investigations into Listeria encephalitis in sheep. Small Rumin Res, 71, 293297, 2007
Lhopital S., Marly J., Pardon P., Berche P.: Kinetics of antibody production against listeriolysin O in
sheep with listeriosis. J Clin Microbiol, 31, 15371540, 1993
Linde K., Fthenakis G.C., Lippmann R., Kinne J., Abraham A.: The efficacy of a live Listeria
monocytogenes combined serotype 1/2a and serotype 4b vaccine. Vaccine, 13, 923926, 1995
Mencikova E., Snirc J., Gubran D., Smola J., Mara M.: Experimental listeriosis in immunized sheep.
Acta Microbiol Hung, 36, 331334, 1989
Nowacki J., Lewandowska S., Konopa M., Przymus J.: Studies on the safety and efficacy of a live
vaccine against Listeria infection in lambs. Medycyna Weterynaryjna, 46, 259261, 1991
Otter A., Houlihan M.G., Daniel R.G., Kirby F.D., Shock A., Higgins R.J.: Ovine gastrointestinal
listeriosis. Vet Rec, 154, 479, 2004
Radostits O.M., Gay C.C., Hinchcliff K.W., Constable P.D.: Veterinary Medicine. A Textbook of the
Disease of Cattle, Horses, Sheep, Pigs and Goats (10th ed.), Saunders, Philadelphia, 2007, 356-402.
Regan E.J., Harrison G.A.J., Butler S., McLauchlin J., Thomas M., Mitchell S.: Primary cutaneous
listeriosis in a veterinarian. Vet Rec, 157, 207, 2005
Szemeredi G., Padanyi M.: A ten years experience with inactivated vaccine against listeriosis of sheep.
Acta Microbiol Hung, 36, 327330, 1989
Tizard I.:, In: Veterinary Immunology, WBC Saunders 7th Ed, 2006, 365-392.
Tzora A., Fthenakis G.C., Linde K.: The effects of inoculation of Listeria monocytogenes into the ovine
mammary gland. Vet Microbiol, 42, 245-253, 1998
Wagner M., Podstatzky-Lichtenstein L., Lehner A., Asperger H., Baumgartner W., et al: Prolonged
excretion of Listeria monocytogenes in a subclinical case of mastitis. Milchwissenschaft, 55, 36, 2000
56
Abstract
Diagnosing infectious diseases in pigs is laborious work, as it involves taking blood or swab
samples which is very stressful for pig; it is time consuming, independently whether piglets or
adults are meant to be sampled. Since the most of viruses are excreted orally, and taking into
consideration experiences in human medicine, oral fluid started to be investigated as a potential
sample for diseases detection.
There are many advantages of this kind of sampling. By testing oral fluid more animals can be
screened, than by individual testing of blood or swabs. This method is welfare friendly means of
monitoring disease, working towards better productivity. The results represent the status of the herd
not of the individual animals. Having in mind that most of viruses can be excreted before clinical
signs; this is a very useful tool for early detection of the disease. Oral fluid is collected by giving the
cotton ropes to the animals to chew it. The ropes are afterwards processed in the laboratory in order
to extract oral fluid which then could be tested for the presence of different markers, such as
viruses, bacteria, antibodies etc. On the selected pig farms, we installed the ropes in the pens, to be
easily accessed and attractive for pigs. Collected oral fluid samples have been tested on PRRS,
PCV2 and SIV. Initial results suggest that oral fluid sampling could provide a low-cost, noninvasive method to assess the health status of pigs. Additional work on technique validation is
needed.
Keywords: non invasive sampling, oral fluid, PRRS, PCV2, SIV
Introduction
Accurate and reliable laboratory diagnosis in modern swine production is the request. It is of same
importance for early disease detection, surveillance and monitoring purposes. Although pigs are
intelligent animals which remember rewards, sampling for them is very stressful and affects their
welfare. Traditional sampling methods require skilled personnel and is time consuming since is
individually based. Serum samples are, the most often, used for infectious diseases diagnosis. But
there are many limitations in serology results interpretation that are linked with estimation of time
when infection occurred, presence of maternal antibodies, but also with early stages when
antibodies are not detectable. In particular, the need to handle and bleed animals presents a
significant risk for further spread of diseases (Mur et al., 2013).
Gold standard in infective disease diagnosis is agent detection. Permanent infectious disease
monitoring, molecular epidemiology and tracking disease back, which are of high priority in high
density farms, are possible only by capturing the virus or viral genome. Many causative agents of
infectious diseases are excreted even before onset of clinical symptoms, making it important to
detect them as early as possible.
57
For these purposes, live animals are needed to be sampled; swabbing is the most often used
technique. Taking nasal swabs is not difficult, but needs individual sampling. Oral fluid is an
alternative specimen that could potentially replace nasal swabs.
In human medicine, oral fluid specimens have been used for infective agents detection but also for
hormones, toxins and drugs (Prickett and Zimmerman, 2010). Nowadays, for HIV (Connolly et al.,
2004) and measles (Carr et al., 2009) surveillances, oral fluid samples are preferred because of it
safety, efficiency, cost effectiveness and large number of samples availability.
Porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2),
swine influenza virus (SIV), foot and mouth disease virus (FMDV), classical swine fever virus
(CSFV) and African swine fever virus (ASFV) are shed in oral fluid which has been proved to be
accurate diagnostic specimen (Ramirez et al., 2012). It has been shown that oral fluid can be used
also for antibody detection. There are many advantages of oral fluid collection: requires no catching
or killing of animals and is feasible to get it from farmed pigs (Hoffman et al., 2008) and from wild
boar (Chichkin et al., 2012).
Rope sampling is a non-invasive method of oral fluid collection which allows detection of various
infectious agents and assists with disease surveillance. It is less laborious to perform and causes less
stress to animals. Basically, oral fluid samples are collected from individual pigs or pens of pigs by
allowing them to chew on cotton rope placed in the pen for 2030 min. Oral fluid is extracted
manually from the rope and further processed in the laboratory (Prickett et al., 2008). Once
collected, oral fluid must be cooled immediately and transported to the laboratory as soon as
possible because of very active saliva enzymes which tend to inactivate viruses, in particular if virus
isolation test is going to be performed.
Rope sampling and oral fluid testing is, at some circumstances, even more sensitive than swab
testing. It has been shown that rope sampling was able to detect FMDV 6 days prior to visual
clinical observations in unvaccinated and infected pigs. However, saliva swabs were positive 3 days
before the rope samples (Vosloo et al, 2012).
However, this method has its limitations. The amount of oral fluid sample collected is dependent on
animal behavior. Sick animals show less interest in the ropes. When sampling was performed in
pens, it has been seen that sick animals come to chew on ropes only after healthy pigs got bored
(Vosloo et al, 2013).
How much important control of infective disease, in particular transboundary ones, in big farms is
well known. But, majority of swine population in the world is kept in small size, backyard holdings,
with low biosecurity that, despite almost perfect tools for disease control in developed countries,
heavily can affect the risk of disease spreading (Depner et al., 2013). Wild life plays the same role.
Rope sampling of free ranging pigs and wild boar can possible overcome these limitations for
disease control in this epizootic niche.
New techniques always arise suspicion on their improvement comparing to traditional ones.
Usually, people are distrust when ever new technique requires no contact with animals. Such
reactions were seen when surveyed owners were asked about oral vaccination (Mogner et al., 2015).
Infective disease surveillance in swine sector in Serbia is at very low level. This is possibly due to
the demanding sampling but also to the cost of individual testing. Swine production is a kind of
production where herd level of diseases status should be assessed, so therefore there is no need for
individual testing. In this case, group sampling sensitivity is the most important factor.
In this experiment, we wanted to show that disease detection is possible with alternative sampling
methods which do not require animal catching, in local, field conditions. For this purposes, we
selected 2 farms where respiratory diseases were previously confirmed. The objective of this study
was to conduct a preliminary assessment of the feasibility of detecting PRRSV, PCV2 and SIV in
58
oral-fluid samples. Fine tuning of the method, depending on the disease stage and number of
animals per pen, is still needed.
Results
From each farm, 2 samples were tested. One sample was taken from animals old 12-16 weeks, and
another one from pigs older than16 weeks.
Oral fluid collection on both farms, in the field conditions, using ropes was very easy. Pigs were
very interested in a new object in their pens and chew on ropes continuously for 30 minutes,
replacing one another. All ropes stayed fixed in pens, not damaged. Each rope was quite well
sodden with saliva which volume was enough for performing the laboratory tests. There was no
difference in behaviour and interest in ropes between different age groups.
Clinically, farm I reported respiratory disorders in all age categories 6 weeks ago. Pigs were treated
with antibiotics and on sampling day all pigs had no fever, occasionally coughing was heard and
pigs were in recovery stage.
On second pig farm, respiratory disease was in acute phase. Pigs had fever, anorexia, nasal
discharge, sneezing and labored breathing.
59
Results of molecular tests showed that samples from the farm in recovery stage were negative on
PRRV, PCV2 and SIV. In the farm with acute respiratory disease, PRRS and SIV infections were
confirmed.
In one oral fluid sample, on real time RT-PCR genome of Influenza Virus A was detected, Ct value
28,7. In two samples, genome of PRRSV was confirmed. All samples, from both farms were
negative on PCV2 (Table 1).
Table 1: Results of oral fluid samples tested on SIV, PRRSV and PRV2 presence
Virus
Result (%)
PRRSV
PCV2
SIV
2/4 (50)
0/4 (0)
1/4 (25)
Farm I
Pen 1 12-16 w
negative
negative
negative
Pen 2 >16w
negative
negative
negative
Farm II
Pen 1 12-16 w
positive
negative
negative
Pen 2 >16w
positive
negative
positive
Discussion
Swine Influenza Virus was detectable in porcine oral fluids by real-time RT-PCR. SIV is
transmitted via nasopharyngeal route, in direct contact between animals by droplets and aerosols of
nasal secretions. Virus excretion begins within 24 hours from infection and lasts 7-10 days (OIE,
2009) although Blaskovic et al. (1970) reported a case of a pig which had been shedding SIV over 4
months. Furthermore, swine influenza H1N1 virus has been recovered from pigs with no signs of
disease (Hinshaw et al., 1978). Carrier animals are rarely described but also considered as
responsible for Influenza virus introduction into uninfected herds (Merck Manual, 2008).
Pigs from the pen in which we confirmed SIV showed typical clinical signs of SIV. The infection
was in acute phase when amount of excreted virus is at highest level. Influenza A is present in pig
farms year round, but the outbreaks are most common in cold weather time, mainly in finishing pigs
(OIE, 2009).
Influenza in pigs can be diagnosed confirming presence of virus itself or immune response of the
host. Diagnostic tests that detect virus, viral proteins (antigens), or viral nucleic acid are Fluorescent
antibody (FA) test, AgELISA, RT-PCR and Virus isolation. Detection of circulating antibodies to
SIV can be performed by Hemagglutination inhibition test or Ab ELISA. Preferred samples are
nasal swabs, lung tissue and serum samples (Janke, 2000).
The results of the recent studies indicate that pen-based oral fluids provide an easy, effective, and
safe collection method for the detection of SIV with rapid testing methods such as real-time RTPCR (Detmer et al., 2011).
Oral fluid represents group sample and therefore its sensitivity should be considered. Romagosa et
al (2011) showed that pen-based collection of oral fluids is a sensitive method to detect influenza
even when within pen prevalence is low and when pigs have been vaccinated and highlight the
potential use of oral fluids for influenza surveillance (Romagosa et al., 2011).
Influenza A situation in Serbia is unknown. The virus presence has been rarely reported although
respiratory disorders are common in pig farms. Cost of individual tests and labour to get samples
for virology tests are possible reasons for this.
Another respiratory disease which heavily can affect health status of pigs is PRRS. However, in
some herds, infection can be asymptomatic. The virus is shed via saliva, milk, colostrum, urine,
faeces. Since proven that viral RNA could be detected in oropharingeal region of growing pigs up
to 251 days post infection nasal swabs are the sample of choice (OIE, 2008). Though, detection of
PRRS virus is the most reliable during the early stages of PRRS infection.
60
Viral antigen can be identified in infected fresh tissue, preferably lung, by direct fluorescent
antibody test. PCR or in situ hybridization is used to demonstrate viral RNA. Serology may be
helpful in confirming the presence (seropositivity) and stage (high levels of antibody in recent
infections) of PRRS infection in the herd.
In experimental conditions, PRRSV can be detected in oral fluid for approximately 4 weeks after
exposure ( Opriessnig et al., 2006). Field data showed that this period can be prolonged up to 8
weeks (Prickett et al., 2008a). Since the diagnostic window for PRRS is much larger than for SIV,
we succeeded to detect PRRV in oral fluid samples in both oral fluid samples from one farm. PRRS
surveillance if individually based is very costly. Using oral fluid for surveillance purposes, more
animals can be tested whereas number of samples and tests is less. Making surveillance and disease
control plans, sempling method sensitivity should be considered in order to be replaced with
appropriate number of animals to be samples in order to achieve the aim of the plan.
Porcine circovirus 2 is ubiquitous in domestic pigs. At some circumstances, PCV2 cause
postweaning multisystemic wasting syndrome (PMWS), reproductive failure, enteritis, respiratory
disease, porcine dermatitis and nephropathy syndrome (PDNS) or a combination of these
(Opriessnig et al.,2007). PMWS most commonly affects 2-4 month-old pigs, although the disease
has been also described in younger and older animals (Segals et al., 2005). PCV2 is transmitted
horizontally excreting virus in nasal secretions, saliva, faeces and serum (Shibata et al. 2003) and
vertically (Pensaert et al. 2004).
Limited data on the amount of PCV2 in nasal fluid and saliva following experimental infection is
available. The internationally accepted criteria to diagnose PMWS include the presence of
compatible clinical signs, lesions and moderate to high amount of the virus. Detecting the virus
itself doesnt` mean that it caused the disease but only evidence of virus infection (Caprioli et al.,
2006)
The positive and significant correlation found between amounts of PCV2 detected in lymphoid
tissues, sera and swabs suggests that nasal and rectal swabs are suitable indicators of the level of
PCV2 excretion (Lorenc et al., 2009)
Oral fluid sampling for PCV2 detection has been studied recently; showing that with these samples
PCV2 is detectable longer than 8 weeks. However, we didn`t detect PCV2 in oral fluid samples
probably because of low level of excreted virus in the stage where no other disorders have been
seen which we could linked to PCV2.
Diseases surveillance is fundamental to the control, elimination, or eradication of an infectious
agent and often requires large number of samples. Large number of samples requires labour and
time associated efforts. Due to these restrictions, in many farms, surveillance is abandoned or
inefficient. Having available and accurate alternative sampling methods that are cost and time
effective, simply to be performed, we believe that surveillance and disease control can be improved.
Detecting PRRSV and SIV in oral fluid, we showed that depending on stage, early disease detection
in farm condition is feasible. For precise characterization of method sensitivity, more experiments
are needed to be performed.
References
1.
2.
Blaskovic, D., Rathova, V., Kociskova, D., Kaplan, M.M., Jamrichova, O., Sadecky, E.: Experimental
infection of weanling pigs with A-swine influenza virus. 3. Immunity in piglets farrowed by antibodybearing dams experimentally infected a year earlier. Bull. World Health Organ. 42, 771777, 1970
Caprioli, A., McNeilly, F., McNair, I., Lagan-Tregaski, P., Ellis, J., Krakowka, S., McKillen, J.,
Ostanello, F., Allan, G.: PCR detection of porcine circovirus type 2 (PCV2) DNA in blood, tonsillar and
faecal swabs from experimentally infected pigs. Res Vet Sci, 81, 287-292, 2006
61
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Carr, M.J., Conway, A., Waters, A., Moran, J., Hassan, J., Hall, W.W., Connell, J.: Molecular
epidemiology of circulating measles virus in Ireland 20022007. J. Med. Virol. 81: 125129, 2009
Chichkin, Y., Gazaev, I. K., Tsybanov, S.Z and Kolbasov, D.V.: Non-invasive method of collecting
saliva from wild boar infected with African swine fever, Veterinaria, 6: 2628, 2012
Connolly, C., Shisana, O., Colvin, M., Stoker, D.: Epidemiology of HIV in South Africa results of a
national, community-based survey. S. Afr. Med. J. 94: 77781, 2004
Depner, Klaus; Milicevic, Vesna; Dietze, Klaas: New Non-Invasive Methods To Control And Eradicate
Transboundary Animal Diseases In The Back Yard And Free Ranging Pig Sector, GRF One Health
Summit 2013, Proceedings, 2nd GRF One Health Summit 2013, 17-20 November 2013, Davos,
Switzerland
Detmer E.Susan,1 Devi P. Patnayak, Yin Jiang, Marie R. Gramer, Sagar M.: Goyal Detection of
Influenza A virus in porcine oral fluid samples, J Vet Diagn Invest 23:241247, 2011
Donadeu, M., Arias, M., Gomez-Tejedor, C., Aguero, M., Romero, L.J., Christianson, W.T., SanchezVizcaino, J.M.: Using polymerase chain reaction to obtain PRRSV-free piglets from epidemically
infected herds. Swine Health Prod. 7: 225261, 1999
Hinshaw VS, Bean WJ , Webster RG, Easterday BC: Prevalence of Influenca viruses in swine and the
antigenic and genetic relatedness of influenca viruses from men and swine, Virology, 84: 51-62, 1978
Hoffman, P., Prickett, J., Zimmerman, J., et al. Implementation and validation of swine oral fluid
collection in a commercial system. Proceedings of the 39th Annual Meeting of the American
Association of Swine Veterinarians , pp. 301-302. San Diego, California, USA, 2008
Lorenc, Grau-Romaa, Charlotte K. Hjulsager, Marina Sibila, Charlotte S. Kristensend,Sergio LopezSoria, Claes Enec, Jordi Casala, Anette Btnere, Miquel Nofrar asa,Vivi Bille-Hansenc, Lorenzo
Frailea, Poul Baekbod, Joaquim Segalsa, Lars E. Larsen: Infection, excretion and seroconversion
dynamics of porcine circovirus type 2 (PCV2) in pigs from post-weaning multisystemic wasting
syndrome (PMWS) affected farms in Spain and Denmark, Veterinary Microbiology 135, 272282, 2009
Janke H. Bruce: Diagnosis of Swine Influenza, Swine Health Prod. 8 (2): 79-84, 2000
Monger VR, Stegman JA, Dukpa K, Gurung RB, Loeffen WL: Evaluation of Oral Bait Vaccine
Efficacy Against Classical Swine Fever in Village Backyard Pig Farms in Bhutan, Transbound Emerg
Dis. 2015 Feb 7. Doi 10.1111/tbed.12333, 2015
Mur, Lina, Gallardo Carmina, Soler Alejandro, Zimmermman Jeffrey, Pelayo Virginia, Nieto Raquel,
Sanchez-Vizcaino Jose Manuel, Arias Marisa: Potential use of oral fluid samples for serological
diagnosis of African swine fever, Veterinary Microbiology 165: 135139, 2013
OIE: PRRS: the disease, its diagnosis, prevention and control, Report of the OIE ad hoc group on
porcine reproductive respiratory syndrome, Paris, 9 - 11 June 2008
OIE
Technical
Disease
Cards.
Last
updated
June
2009,
http://www.oie.int/fileadmin/Home/eng/Animal_Health_in_the_World/docs/pdf/Disease_cards/SWINE
_INFLUENZA.pdf
Opriessnig T, McKeown NE, Harmon KL, Meng XJ, Halbur PG: Porcine circovirus type 2 infection
decreases the efficacy of a modified live porcine reproductive and respiratory syndrome virus vaccine.
Clin Vaccine Immunol.13:923929, 2006
Opriessnig, T., Meng, X.J., Halbur, P.G.: Porcine circovirus type 2 associated disease: update on current
terminology, clinical manifestations, pathogenesis, diagnosis, and intervention strategies. J. Vet.
Diagn.Invest.19, 591-615, 2007
Pensaert, M.B., Sanchez, R.E., Jr., Ladekjaer-Mikkelsen, A.S., Allan, G.M., Nauwynck, H.J.: Viremia
and effect of fetal infection with porcine viruses with special reference to porcine circovirus 2 infection.
Vet Microbiol 98, 175-183, 2004
Prickett, J., Simer, R., Christopher-Hennings, J., Yoon, K.J., Evans, R.B., Zimmerman, J.J.: Detection
of porcine reproductive and respiratory syndrome virus infection in porcine oral fluid samples: a
longitudinal study under experimental conditions. J. Vet. Diagn. Invest. 20: 156163, 2008
62
63
Abstract
Slovenia was officially declared free of bovine tuberculosis (bTB) in 2009 although the proportion
of tuberculin test positive herds and animals in the past 40 years did not exceed 0.08% and 0.07%,
respectively. In the last two decades, a single case of bTB in cattle of Slovene origin was confirmed
by the culture method. However, bTB was detected recently in cattle imported from an EU member
state with a relatively high prevalence of bTB.
Among nontuberculous mycobacteria (NTM) in farm animals, the majority of isolates identified in
the past 15 years belonged to Mycobacterium (M.) avium which was mostly isolated from pigs.
After 2003, when compulsory slaughterhouse inspection of pigs was abolished, sporadic M. avium
isolates were obtained from cattle, poultry, pet birds, reptiles and zoo animals.
Aquarium fish are also an important reservoir of NTM. Two studies on NTM in ornamental fish in
Slovenia (2001-2004 and 2009-2011), which included 142 fish from several pet shops, revealed that
the majority (~80%) of aquarium fish harbour NTM. The predominant species was M. fortuitum.
The proportion of M. marinum, the most important zoonotic pathogen among NTM in fish, was
relatively high (~10%).
Between 2010 and 2013, the first survey on mycobacterial infections in wildlife in Slovenia was
conducted, including 306 apparently healthy free-range wild animals belonging to 13 species.
Members of M. tuberculosis complex were not detected, but a number of NTM were identified in
11.8% animals, with M. peregrinum being the most prevalent, followed by M. avium and M.
intracellulare. Some of the NTM were most probably reported for the first time in certain wildlife
hosts.
Paratuberculosis has become a common disease of ruminants in Slovenia. After a few
seroprevalence studies showing relatively low prevalence of disease in cattle herds in the past, it
recently became clear that presumably a lot more dairy cattle herds are affected and that up to 89%
of the animals within a herd may be infected with M. avium subsp. paratuberculosis. These facts
call for immediate implementation of measures necessary to control the disease.
Keywords: Mycobacterium, farm animals, wildlife, fish
Introduction
Bacteria of the genus Mycobacterium commonly cause pathologies or mortality in humans and
animals worldwide. Their infections are notoriously difficult to treat due to the unique cell wall of
mycobacteria and their natural resistance against many chemical or physical agents. Three main
groups of mycobacteria can be identified, namely the obligate pathogens from the Mycobacterium
tuberculosis complex (MTBC; e.g. M. tuberculosis, M. bovis, M. caprae) causing tuberculosis, the
obligate pathogens M. leprae and M. lepromatosis causing leprosy, and the nontuberculous
mycobacteria (NTM) causing skin/soft tissue disease, pulmonary disease, lymphadenitis or
disseminated disease. NTM are also called mycobacteria other than tuberculosis (MOTT), atypical,
opportunistic or environmental mycobacteria as being ubiquitous in soil and water (Dawson, 2000).
64
They usually do not cause disease in the immunocompetent humans despite the continuous
exposure to low levels, since the majority of human-mycobacteria interactions are self-curing
colonizations (Primm et al., 2004). Not to be overlooked, however, the release of potent
immunomodulators during the immune system activation may result in downstream effects like
allergies and irritations of the bowel (Primm et al., 2004). Some species of mycobacteria are very
difficult to grow in vitro as they are fastidious and take long periods to develop in culture; species
can be divided into slow and fast growers. They are widespread and typically found in water and
food sources, with the exception of obligate pathogens not found as free-living mycobacteria.
0.1%. A decade later it dropped to 0.01%. Slovenia was declared officially free of bTB only in 2009
due to administrative reasons even though a single case of bTB in cattle of Slovene origin has been
culture-confirmed in the last 25 years (Ocepek et al., 2014). However, due to abolished quarantines
in the European Union, the situation can change at any time. Indeed, a case of bTB has already been
detected, caused by M. caprae in a herd consisting of cattle imported from an EU member state
with a relatively high prevalence of bTB (Pate et al., 2012).
Even though M. tuberculosis primarily causes TB in humans, several cases of infections have been
described also in domestic animals, mostly in those living in close contact with diseased humans.
Therefore, humans with active TB are regarded as the main source of infection for animals, which
may sometimes develop classical form of TB. With regard to domestic animals, M. tuberculosis
infection was most frequently reported in cattle. We described such a case ten years ago; our case
was the first human-to-cattle transmission of M. tuberculosis to be proven by a modern genotyping
method (Ocepek et al., 2005).
causing both localized and disseminated infections in man. M. fortuitum and M. chelonae usually
cause superficial lesions via skin wounds, but pulmonary disease and cervical lymph node infection
may also occur. Most M. marinum infections are cutaneous, with the hands being commonly
affected (Dolenc-Volj and olnir-Dov, 2010).
The first study on mycobacteria in fish in Slovenia was conducted between 2001 and 2004, when 35
aquarium fish were investigated and 29 were positive for mycobacteria. M. fortuitum, M. marinum
and M. gordonae were most frequently isolated, followed by M. chelonae and M. peregrinum.
Approximately one fifth of fish harboured M. marinum (Pate et al., 2005). The latest study
encompassed 107 apparently healthy ornamental fish belonging to 20 species that were investigated
in the period from 2009 to 2011. Almost 80% of the investigated fish were positive for
mycobacteria, among which the common fish pathogens M. fortuitum, M. marinum and
M. chelonae were discovered, in addition to M. peregrinum/septicum, M. gordonae, M. arupense,
M. kansasii, M. ulcerans and M. setense (Pate et al., 2014).
The results of our studies demonstrate that the vast majority of ornamental fish available in pet
shops in Slovenia harbour mycobacteria, among which the potentially pathogenic species for
humans are predominant. A particularly striking fact is a relatively high percentage of M. marinum,
which is the main causative agent of cutaneous mycobacteriosis in humans. Therefore, it is of great
importance to increase the awareness of workers in fish industry, aquarium hobbyists and medical
staff. The most important step towards decreasing the possibility to acquire mycobacterial
infections from fish is to wear waterproof gloves whenever cleaning the aquarium and handling the
fish, even when preparing them for a meal. With this simple precaution, many could avoid a longlasting therapy with antimicrobials.
between 1995 and 2001, using various serological tests and including different categories and
numbers of cattle (Ocepek et al., 1999, 2002). For the period between 2002 and 2007, no data on
paraTB prevalence are available. In 2008, a seroprevalence study was conducted in which animals
older than two years were screened for Map in randomly selected cattle herds. The study showed
that the true prevalence at the herd level was almost the same as in 1999 and that it was fairly low
(18.49%) compared to many European countries (Kuar et al., 2011).
The results from our previous studies, concerning the comparisons of different diagnostic tests for
paraTB, suggested that the specificity of the ELISA kits used is questionable and showed a need for
highly sensitive and specific method to detect subclinically infected animals which are the main
cause of maintained herd infection and of spread of infections between herds and premises. Lack of
sufficiently sensitive, specific, reliable and fast laboratory tests can lead to underestimation of the
proportions of Map shedders in herds.
Therefore, we then introduced a high-yield DNA extraction method coupled with quantitative realtime PCR (qPCR) to detect Map in cattle faeces. The study, which included faecal culture, milk
ELISA, milk qPCR and faecal qPCR, was performed on the samples of 141 subclinically infected
dairy cattle of all age categories from a farm with a history of paraTB. The results suggested that
the proportion of low-level Map shedders in cattle populations tested in the past was most likely
underestimated. In addition to detecting a surprisingly high proportion of Map shedders within a
herd (89%), we demonstrated a negative influence of Map infection to milk production already in
the first lactation heifers (Logar et al., 2012). Furthermore, later studies indicated that presumably a
lot more dairy cattle herds are infected with Map. In the last study, eight randomly selected big
dairy herds were monitored for the presence of Map-antibodies. These were detected in all herds
while in half of them culture-positive animals were found (Stari et al., 2011).
Vaccination can be used as a measure to control the disease; however, as it hampers diagnostics of
paraTB and interferes with tuberculin skin testing, the opinions on its use vary. Vaccination
prevents the occurrence of clinical signs and reduces the shedding of Map in faeces and milk. The
latter was observed during our vaccination trial performed in two heavily infected dairy herds; in
addition, the vaccination contributed to increased annual milk yield (Ocepek et al., 2014). However,
hygienic measures are of crucial importance for controlling the disease.
As Slovenia has not yet implemented any measures for the prevention and control of the disease, a
significant increase in the prevalence of paraTB in the majority of big dairy herds is expected in the
forthcoming years. Certain EU member states have already implemented strict preventive measures
which request paraTB negative status of the herds providing milk for public consumption.
Economic losses faced by the Slovenian breeders of Black and White cattle due to paraTB are
estimated at 1 to 5 million euro per year. Therefore, it would be reasonable to introduce the control
and eradication program which would encompass systematic screening of the disease and
certification of infection-free herds. This would enable the farmers to buy non-infected animals and
increase the animal value in trading. However, this goal cannot be successfully pursued without
participation of the government, veterinarians, cattle breeding associations and the cattle breeders
themselves.
Acknowledgements
Mycobacteria research was funded by the Slovenian Research Agency (Grant P4-0092). Milojka
etina, Alenka Usenik and Nataa Peterka are thanked for their technical assistance over the years.
References
1.
Dawson D.J.: Mycobacterial terminology. Journal of Clinical Microbiology, 38, 3913, 2000
68
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
Dolenc-Volj M., olnir-Dov M.: Delayed diagnosis of Mycobacterium marinum infection: a case
report and review of the literature. Acta Dermatovenerologica APA, 19, 35-39, 2010
Kent P.T., Kubica G.P.: Public Health Mycobacteriology. A Guide for the Level III Laboratory. Atlanta,
GA, USA, US Department of Health and Human Services, Public Health Service, Centers for Disease
Control, 1985
Kirschner P., Springer B., Vogel U., Meier A., Wrede A., Kiekenbeck M., Bange F.C., Bttger E.C.:
Genotypic identification of mycobacteria by nucleic acid sequence determination: report of a 2-year
experience in a clinical laboratory. Journal of Clinical Microbiology, 31, 2882-2889, 1993
Kunze Z.M., Portaels F., McFadden J.J.: Biologically distinct subtypes of Mycobacterium avium differ
in possession of insertion sequence IS901. Journal of Clinical Microbiology, 30, 2366-2372, 1992
Kuar D., Ocepek M., Logar K., Pate M., Krt B.: Seroprevalence of cattle paratuberculosis in Slovenia
in 2008 and a comparison of data from current and previous studies. Slovenian Veterinary Research, 48,
39-44, 2011
Lane D.J.: 16S/23S rRNA sequencing. In: Nucleic Acid Techniques in Bacterial Systematics. John
Wiley & Sons, New York, NY, USA, pp. 115-147, 1991
Logar K., Kopin R., Bandelj P., Stari J., Lapanje A., Ocepek M.: Evaluation of combined highefficiency DNA extraction and real-time PCR for detection of Mycobacterium avium subsp.
paratuberculosis in subclinically infected dairy cattle: comparison with faecal culture, milk real-time
PCR and milk ELISA. BMC Veterinary Research 8: 1-22, 2012
Ocepek M., Posedi J., Pislak M.: Prevalence of bovine paratuberculosis in Slovenia in 1997 and 1998.
Zbornik Veterinarske Fakultete Univerze v Ljubljani, 36, 111-119, 1999
Ocepek M., Krt B., Pate M., Poganik M.: Seroprevalence of paratuberculosis in Slovenia between 1999
and 2001. Slovenian Veterinary Research, 39, 179-185, 2002
Ocepek M., Pate M., olnir-Dov M., Cvetni .: Tuberculosis in cattle caused by IS901+
Mycobacterium avium subsp. avium: a case report. Veterinrn medicna, 48, 47-50, 2003
Ocepek M., Pate M., Zolnir-Dovc M., Poljak M.: Transmission of Mycobacterium tuberculosis from
human to cattle. Journal of Clinical Microbiology, 43, 3555-3557, 2005
Ocepek M., Pate M., Maurer Wernig J., Pir T.: Eradication of bovine tuberculosis in Slovenia.
Delegates handbook, VI International M. bovis Conference June 16-19, 2014, Cardiff, UK, organized
by British cattle veterinary association, 2014, 73
Ocepek M., Stari J., Jeek J., Logar K., Zajc U., Bandelj P., Pate M.: Effect of vaccination against
paratuberculosis on fecal shedding and productivity of heavily infected cattle herds. Program &
abstracts, 12th International Colloquium on Paratuberculosis, June 22-26, 2014. Parma, Italy, organized
by International Association for Paratuberculosis, 2014, 148
Pate M., Jeni V., olnir-Dov M, Ocepek M.: Detection of mycobacteria in aquarium fish in Slovenia
by culture and molecular methods. Diseases of Aquatic Organisms, 64, 29-35, 2005
Pate M., Svara T., Gombac M., Paller T., Zolnir-Dovc M., Emersic I., Prodinger W.M., Bartos M.,
Zdovc I., Krt B., Pavlik I., Cvetnic Z. Pogacnik M., Ocepek M.: Outbreak of tuberculosis caused by
Mycobacterium caprae in a zoological garden. Journal of Veterinary Medicine Series B, 53, 387-392,
2006
Pate M., olnir-Dov M., Ocepek M.: Tuberculosis as a zoonosis: importance and diagnostics.
Medicinski Razgledi 51 (Suppl. 6), 119-125, 2012
Pate M., Kuar D., olnir-Dov M., Jeni V., Ocepek M.: Akvarijske ribice v lui mikobakterijskih
okub ljudi = Aquarium fish in the light of human mycobacterial infections. Enboz, 11, 4-7, 2014
Primm T.P., Lucero C.A., Falkinham J.O. III: Health impacts of environmental mycobacteria, Clinical
Microbiology Reviews, 17, 98106, 2004
Slany M.: A new cultivation-independent tool for fast and reliable detection of Mycobacterium
marinum. Journal of Fish Diseases, 37, 363-369, 2013
Stari J., Zadnik T., Logar K., Ocepek M.: Diagnostic of paratuberculosis on 8 big dairy farms in central
Slovenia. Veterinarska stanica 42, suppl. 1, 78-81, 2011
69
70
Abstract
During the period from 2010 to 2014 Scientific veterinary institute "Novi Sad" (NIV-NS) was
responsible for quality control of 44 quarantines with 344,485 imported doses in 710 batches from
248 bulls, originating from 10 different countries (EU countries, USA and Canada) and 18 different
breeding centers.
Samples were analyzed for bacterial count (expressed as colony forming units - CFU/mL) and
bacterial types, virus gene presence of IBR/IPV, BVD and Schmallenberg virus. Semen quality was
tested by CASA (Computer Assisted Sperm Analyzes), flow citometry and cytology sperm quality
parameters. Complete analyses were performed on 550 semen samples of 248 bulls.
Dominantly, semen traits were in accordance to relevant national and international standards
(Official Journal of R. Serbia 38/2014 and OIE). However, 43 batches (32 bulls from 15
imports), with total of 21.826 straws (6.33% of all imported straws) were rejected/destroyed
because of different and prominent discrepancy, related to improper transportation (liquid nitrogen
leaking), presence of the genome of Bovine viral diarrhea virus, opportunistic pathogen bacteria
(Citrobacter freundii), elevated bacterial count (CFU from 40-780103), but mostly were rejected
because of low semen quality (10 of 15 cases). E.g., recorded sperm total motility ranged between
9.30-56.70% (average 35.709.60%), progressive motility 1.7-28.8% (16.775,20%), total motile
cells per straw 8.11106 (1,70-15,10106), progressive motile cells 0.36-7.0106 (3.761.40106,
CASA) and live sperm cells with intact acrosome (LIA) 4-55% (33.679.75%) and pathologic
forms (5-65%) from cyto-morphological studies. LIA cells by flow cytometry were 15.22 to
64.26% with average of 39.2412.02%.
EU semen trading policy is devoted only to sanitary conditions and semen quality is a matter of
standard operative procedure (SOP) of breeding center. Semen of lower quality (up to dead-non
motile semen) could be expected from imported semen.
Keywords: bull, semen, quarantine, quality and sanitary condition
Introduction
Republic of Serbia has a long tradition of cows farming, bulls semen production and semen import.
First semen production and insemination started in 1951 with fresh semen (Perkovi, 2011) and first
import of frozen semen in 1976 (frozen semen of Simmental bulls for insemination of sires
mothers). Commercial semen imports started from 1989-1990 with Montbliarde frozen semen
from France (Perkovi, unpublished data), and then continued with Simmental breed from West
Germany and Austria, together with Holstein breed from USA.
From that period, semen import, storage, breeding plans and distribution were a privilege and
obligation of breeding centers. After 2011 first distributive centers were registered and semen
import became more intensive and versatile, including many worldwide breeding centers and local
71
companies involved in semen trading and several cattle breeds become available to our market.
Nowadays semen import in Serbia is carried out trough 3 registered breeding centers and 10 semen
distributive companies. Most of significant producers of semen from the globe are presented on our
market now, selling semen of the best genetic value and those with commercial value.
General directives for intra-Community semen trading are regulated by 88/407/EEC directive.
Intercommunity trading between non EU trading is regulated by Commission for implementing
decision 2011/630/EU (bovine species from third countries). Regulations of semen storage centers
(semen distributive centers) are regulated with Directive 88/407/EEC.
None of this directive is regulating minimal hygiene conditions of produced semen (level of
bacterial contamination and bacterial type) or minimal technical guidelines of produced semen (e.g.
minimal number of live motile cells, maximal percentage of pathology forms).
OIE Terrestrial Animal Health Code from 2003 had guidelines related to count of saprophytic
bacteria in semen doses. Thawed semen should not contain more than 5,000 CFU per semen
sample, including saprophytic bacteria, fungi, moulds and yeasts. Regulations in some countries are
even stricter (2), and allows up to 500 CFU/ml of saprophytic microorganisms. Presence of
opportunistic pathogen bacteria is not recommended. Explanation was that presence of
opportunistic pathogen bacteria in the sterile uterus of potentially immunocompromised individuals
or herd cattle may present a risk for the occurrence of reproductive and other health problems in
animals or humans (3, 4, 5). Current OIE Terrestrial Animal Health Code from 2010 is missing
these paragraphs. Reason for this is not stated and it is not known to this the first author of this
article.
Some countries had established their own health criteria for bulls' semen clearing semen quality and
hygiene. Generally, Republic of Serbia is following these positive EU recommendations, but
current status of non-EU country allow to have national regulations that more precisely regulate
semen import, stressing on semen quality traits (minimal producing requirements regarding hygiene
and semen quality; Official Journal of R. Serbia 38/2014).
Results
During the period from 2010 to 2014 Scientific Veterinary Institute "Novi Sad" (NIV-NS) was
responsible for quality control of 44 quarantines with 344,485 imported doses in 710 batches from
248 bulls. Out of 710 imported batches, 562 were analyzed (79.15%). Complete analyses were
performed on 550 conventional and 22 sexed semen samples of 248 bulls. Sexed semen represented
only 3.85% of all analyzed semen batches.
Semen originated from 10 different countries (Austria, Germany, Denmark, Croatia, Czech
Republic, Slovakia, Netherlands, USA and Canada) and from 18 different breeding centers. Most
often imports were from Croatia (15 times), Netherlands (7), Switzerland and Canada (5).
Table 1. Overview of the basic details of the number of quarantines, imported of conventional semen
batches, total bulls semen doses, performed analyses and rejected semen doses by exporting countries
subjected to analyses at NIV-NS during period 2011-2014.
Imported
Country
Austria
Canada
Croatia
Czech Rep.
Denmark
Germany
Netherlands
Slovakia
Switzerland
USA
TOTAL 10
Analyzed:
of imports
Samples
Batches bulls of doses bulls
(quarantines)
(batches)
3
57
4
28,009
4
24
5
86
54
53,950
54
78
15
225
73
115,464
73
207
1
10
2
4,790
2
10
1
24
5
6,300
5
8
2
82
20
40,100
20
52
7
55
27
22,157
27
52
1
7
1
4,455
1
7
5
114
37
54,350
37
67
4
50
25
14,910
25
45
44
710
248 344,485 248
550
of rejected:
semen
bulls batches
doses
14
23
13,376
1
1
502
8
10
4,070
4
4
1,967
1
1
690
1
1
500
2
3
721
21,826
31
43
Table 2. Imported semen samples/analyses according to bulls breed and imported countries for conventional
semen (N=550).
Breed
Country
Austria
Canada
Croatia
Czech Rep.
Denmark
Germany
Netherlands
Slovakia
Switzerland
USA
TOTAL
2
2
6
4
10
74
87
20
10
7
28
34
31
34
251
4
4
24
180
37
7
32
280
2
1
3
15
21
1
1
Table 4. Basic details of the rejected bulls semen doses (main reasons for rejection, number of
quarantines/imports, imported batches, bulls and number of doses) that was subjected to analyses at NIV-NS
during the period from 2011 to 2014.
Imported
of imports
doses % of all
batches
bulls
of doses
(quarantines)
rejections
Viral presence (BVD)
1
1
1
502
2.30%
Bacterial unsoundness
3
10
5
2,916
13.36%
Semen quality criteria
10
29
23
16,741
76.70%
Improper transport (N2 leaking)
2
3
3
1,667
7.64%
TOTAL
100%
16*
43
32
21,826
*15 imports were rejected, in one a combination of high bacterial load and low semen quality was noted
Reason for rejection
Reasons for semen rejection were classified as viral presence, bacterial unsoundness, low semen
quality or improper transport (liquid nitrogen leaking).
In 15 cases from 44 imports (quarantines) one of the mentioned reason for rejection were noted,
presenting incidence of 34.09%. One quarantine had combination of low semen quality in 2 batches
and high bacterial presence in 6 batches.
Viral genome presence of BVD by RT-PCR technique was noted in one batch of one imported
bulls' semen.
Bacterial unsoundness represented in 3 imports, on 5 bulls and 10 batches, representing 23.25%
(10/43) of rejected batches and 13.36% of all rejected doses (2,916/21,826; Table 5). From all
semen analyzes this is represented 1.81% of all batches (10/550) and only 0.85% of all imported
semen.
Bacterial contamination with Citrobacter Freundii (an opportunistic microbe that is accountable for
quite a few significant opportunistic infections) isolated in monoculture, in concentration of 1.000
CFU/ml was noted in one case and rejected as a potential risk for uro-genital infections (Milanov
and all., 2012; Joaquin and all., 1992; Badger et all, 1999). Other 9 rejections were because of high
bacterial load of saprophytic and/or opportunistic microorganism (40,000 to 780,000 CFU/ml,
averaging 237,778232,313 CFU/ml). This was several times over technical normative for semen
quality.
Main reason for semen rejecting was improper semen quality (29/43 cases; 67.77%), with total
rejections of 16,741 doses from 21,826 rejected doses (76.70%; Table 4). Low semen quality was
registered in 10 imports, in 29 batches and in 23 bulls. This represented 5.27% of all imported
semen batches (29/550) and 4.86% of all imported semen doses (16,741/344,485).
75
Bull
Batches
Import A
Bull A
Batch 1
Batch 2
Batch 3
of
doses
300
375
150
Batch 4
410
Batch 5
325
Batch 6
375
Batch 7
260
Batch 8
Batch 9
Batch 10
10
185
300
236
2.916
Bull B
Import B
Bull C
Bull D
Import C
TOTAL: 3
Bull F
5
Bacterial load
Isolated bacterial strain
(CFU/ml)
1.000 Citrobacter Freundii
350.000 Enterobacter aerogenes and Bacillus sp.
200.000 Corynebacterium sp. and Bacillus sp.
Corynebacterium sp., Bacillus sp., and
160.000
Staphylococcus sp.
Bacillus sp., Staphylococcus sp. and
130.000
Micrococcus sp.
Enterobacter aerogenes, Bacillus sp. and
780.000
Corynebacterium sp.
Bacillus sp., Staphylococcus sp. and
340.000
Micrococcus sp.
80.000 Bacillus sp. and Staphylococcus sp.
60.000 Enterobacter aerogenes
40.000 Enterobacter aerogenes
-
Regarding CASA parameters, average total motility of 29 rejected semen was 35.479.6%
(minimal value 9.30%, maximal 56.70%), progressive motility 16.775.50% (from 1.70% to
28.80%) and fast moving spermatozoa 19.10% (from 2.00-35.70%). Average total motile sperm
cells were 8.11106 (1.70-15.10106).
Table 6. Descriptive statistic of the CASA parameters of rejected deep frozen bulls' semen (29 semen
samples)
Descriptive
statistic
values
Mean
Minimum
Maximum
Std.Dev.
Coef.Var.
St. Error
1. Number of
spermatozoa
million million in
in ml
dose
90.90
22.72
29.10
7.30
133.90
33.50
22.26
5.56
24.48
24.47
3.87
0.97
2. Total motility
after
thawing
35.47%
9.30%
56.70%
9.61%
27.08
0.02
million
in dose
8.11
1.70
15.10
2.95
36.35
0.51
3. Progressive
motility
after
million
thawing
in dose
16.77%
3.76
1.70%
0.36
28.80%
7.00
5.50%
1.40
32.81
37.32
0.01
0.24
4. Percent of
fast moving
spermatozoa
19.10%
2.00%
35.70%
6.83%
35.77
0.01
On cyto-morphological analyses of deep frozen bull semen (29 semen samples) average percentage
of normal live sperm cells was 33.6712.01 (4.00-55.00%) and total abnormalities 42.7612.01%
(5.00-65.00% ).
Sperm chromatin structure assay (SCSA) of rejected deep frozen bulls' semen indicated average
sperm chromatin defects in 9.509.00% of spermatozoa, ranging from 0.40-32.10% (29 semen
samples) detected by flow cytometry. On membrane permeability test (sperm vitality test, livedead), intact sperm membrane was detected in 30.489.67% sperm cells, ranging from 1.60-43.80%
(23 semen samples). On sperm membrane and acrosome integrity assay (24 semen samples) live
spermatozoa with intact acrosome was detected in 39.2412.02% sperm cells, ranging from 1,6043,80% (23 semen samples); booth detected by flow cytometry. Total damaged acrosomes (DA)
in sperm cells were present in 31.5114.30% (ranging from 2.52-65.38%).
76
Descriptive statistic
values
Mean
Minimum
Maximum
Std.Dev.
Coef.Var.
St. Error
Total
Live spermatozoa
LI
LDA
L
ABN
1.
2.
3.
4.
5.
6.
7.
8.
42.76
5.00
65.00
12.01
28.10
2.09
33.67
4.00
55.00
9.75
28.97
1.70
2.39
0.00
26.00
4.51
188.54
0.79
32.67
13.00
64.00
10.60
32.45
1.85
2.00
0.00
8.00
2.26
113.19
0.39
11.88
2.00
30.00
7.02
59.11
1.22
6.88
0.00
35.00
7.81
113.53
1.36
42.76
5.00
65.00
12.01
28.10
2.09
( L=Total live/unstained spz.; LIA=Live spz. with intact acrosome; LDA=Live spz. with damaged acrosome; DA=Damaged acrosome - total;
PPD=Protoplasmatic droplet-total; I BN=Primary abnormalities; II BN= Secondary abnormalities; ( ABN= Total abnormalities).
Table 7. Descriptive statistic of sperm chromatin structure assay (SCSA) of rejected deep frozen bulls' semen
(29 semen samples) by flow cytometry
Descriptive statistic
1. DNA status
values
(DNA %)
undamaged
damaged
Mean
90.51
9.50
Minimum
67.93
0.40
Maximum
99.60
32.10
Std.Dev.
8.97
9.00
Coef.Var.
9.91
94.68
St. Error
1.61
1.62
Table 8. Descriptive statistic of membrane permeability test (sperm vitality test, live-dead) for rejected deep
frozen bull semen (24 semen samples) by flow cytometry
Descriptive statistic
1. Membrane status (%)
values
Undamaged
Damaged
(live)
(dead)
Mean
30.48
69.52
Minimum
1.60
56.20
Maximum
43.80
98.40
Std.Dev.
9.67
9.67
Coef.Var.
31.72
13.91
St. Error
1.97
1.97
Table 9. Descriptive statistic of sperm membrane and acrosome integrity assay for rejected deep frozen bull
semen (23 semen samples) by flow cytometry
Descriptive statistic
Detection of specific subpopulations of spermatozoa (%)
values
LIA
DI
LDA
DDS
L
DA
1.
2.
3.
4.
5.
6.
Mean
43.33
39.24
16.56
16.88
27.34
31.51
Minimum
22.94
15.22
0.60
0.34
2.02
2.52
Maximum
66.42
64.26
47.42
51.00
56.18
65.38
Std.Dev.
13.06
12.02
15.03
16.05
12.73
14.30
Coef.Var.
30.15
30.64
90.71
95.10
46.56
45.39
St. Error
2.72
2.51
3.13
3.35
2.65
2.98
( L=Total live spermatozoa; LIA=Live spermatozoa with intact acrosome; DIA=dead spermatozoa with intact acrosome; LDA=Live spermatozoa
with damaged acrosome; DDS= dead spermatozoa with damaged acrosome; DA=Damaged acrosome - total).
77
Discussion
Council directive 88/407/EEC is laying down the animal health requirements applicable to intraCommunity trade in and imports of semen of domestic animals of the bovine species. Bulls semen
produced for artificial insemination should fulfil sanitary requirements before the quarantine period
(requirements of the farm, AI station or quarantine), at herd and individual level (diagnostic tests on
the bull).
Intercommunity trading and EU to non EU trading is regulated by Commission for implementing
decision 2011/630/EU on imports into the Union of semen of domestic animals of the bovine
species from third countries. In both cases no strict or any technical guidelines for intra community
trade is mentioned that could serve as a general guideline regarding semen quality requirements or
for bacterial count in extended semen.
Quality of imported semen analyzed at NIV-NS dominantly was in accordance to relevant national
and international standards (Official Journal of R. Serbia 38/2014, Council directive 88/407/EEC
and OIE). However, 43 batches (32 bulls from 15 imports), with total of 21,826 straws (6.33% of all
imported straws) were rejected/destroyed because of different and prominent discrepancy, related to
improper transportation (liquid nitrogen leaking 1,667 straws), presence of the genome of Bovine
Viral Diarrhea Virus, opportunistic pathogen bacteria (Citrobacter freundii - 300 doses), elevated
bacterial count (CFU from 40-780103; 2,616 doses), but mostly were rejected because of low
semen quality (10 of 15 cases 16,741 doses).
France has established automatically generated system of on field data collecting trough coding of
cows and semen straws. Information of cows, used semen, insemination or rebreeding is
automatically sent to main computers by internet on the moment of insemination which allows that
fertility problems are quickly recognized. Serbia without this system is relaying on obligation of
veterinary service to inform breeding or distributing center on pregnancy rate of purchased bulls'
semen. Practically, this system is not working in most regions (lack of data collecting and data
summering). Complains often are coming directly from farmers instead of veterinarian
practitioners. Other way to have better insight of semen quality is to test semen with up to date
laboratory system taking in account that biology traits are not always in accordance with laboratory
results (Milovanovi and Barna, 2011), what was strong argument of importers when semen of low
quality was established, before declaration of national direction for semen quality (Official Journal
of R. Serbia 38/2014. With modern, up-to-date system of semen quality control and strong
argumentation (semen quality tested by several methods, photo and movie documentation, ISO
standardized bacteriology and virology laboratories/tests), semen rejection was accepted as normal
issue, and most domestic importers and foreign breeding centers as sellers are easier accepting
reasons for semen destroying.
Conclusion
EU semen trading policy is devoted only to sanitary conditions and semen quality is a matter of
standard operative procedure (SOP) of breeding center. Semen of lower quality (up to dead-non
motile semen) could be expected from imported semen.
Routine semen testing at the import and national recommendations of semen quality traits can be
comprehended as a good method for reduction of fertility problem generated by male infertility on
cattle farms in Serbia.
Acknowledgements
This work was supported by a grant from scientific project TR 031071 of Ministry of Education and
Science of Republic of Serbia
78
Reference:
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Badger LJ, Stins F. Monique, Kim KS; Citrobacter freundii Invades and Replicates in Human Brain
Microvascular Endothelial Cells, Infection and Immunity, 1999, Vol. 67, 8, 4208-15.
Barth AD, Oko RJ, 1989. Abnormal Morphology of Bovine Spermatozoa. Iowa State University Press,
Ames, IA, US.
Collection and processing of Bovine, small ruminant and porcine semen, OIE - Terrestrial Animal
Health Code,Chapter 4. 6, 2010.
Dr Stevan Perkovi, 60 godina rada stoarsko-veterinarskog centra Krnjaa, 1951-2011, onografija,
publisher: Stoarsko veterinarski Centar Krnjaa, print, Nauna KMD, Beograd, 2011.
ISO 8607:2003(E): Artificial insemination of animals -- Frozen semen of breeding bulls -- Enumeration
of living aerobic microorganisms, www.iso.org
Joaquin A, Khan S., Russell N., Al Fayez N: Neonatal Meningitis and Bilateral Cerebellar Abscesses
due to Citrobacter freundii, Pediatr Neurosurg 1991/1992; 17:23-4.
Joviin M, Neme , Boro I, Jakovljevi G, Kai M, Salma J, Glavoni L, 1997. Steonost krava u
zavisnosti od citolokog i mikrobiolokog kvaliteta zamrznutog semena bikova. Zbornik naunih radova
PKB Agroekonomik, 329-39.
Milanov D., Stojanovi D., Barna T., Milovanovi A.: Izolacija Citrobacter freundii iz duboko
zamrznutog semena bika - prikaz sluaja. Nauni simpozijum Reprodukcija domaih ivotinja i bolesti
novoroenadi, Divibare, 4-7. oktobar 2012, urednik Miodrag Lazarevi, Zbornik predavanja, Str. 125129, Beograd, Nauna KMD, 2012 (srp)
Milovanovi A., Barna T.: The modified thermoresistance test is not siutable for fertility prediction of
frozen-thawed bull semen. The 15th Annual Conference of the European Society for Domestic Animal
Reproduction (ESDAR), Antalya, Turkey 15-17 September 2011, Guest Editor Detlef Rath,
Reproduction in Domestic Animals, Str. 130-130, Berlin, Wiley-Blackwell, 2011.
Minimalni
pogoji
za
oploditveno
sposobnost
semena:
http://www.uradnilist.si/1/objava.jsp?urlid=200751&stevilka=2725
OIE Terrestrial Manual 2008, Chapter 2.4.8. Bovine Viral Disease
"IE
Terrestrial
Animal
Health
Code
2003",
http://www.oie.int/eng/normes/mcode/code2003/A_00127.htm
Pravilnik o uslovima u pogledu objekata, opreme, sredstava za rad i strunog kadra koje mora da
ispunjava centar za skladitenje i distribuciju semena za vetako osemenjavanje (Objavleno u
Slubenom glasniku RS, broj 6/11 od 4. februara 2011. godine
79
Abstract
Diagnostic and health condition control procedures of breeding stallions in Serbia are in accordance
with Regulation on the establishment of animal health care measures for 2014. Diagnostic tests for
breeding stallions are performed on each breeding animal one time in a year, and those include only
tests for Equine infectious anaemia. Nevertheless, the majority of horse owners and keepers tend to
follow their previous routines and preventive measures. When it comes to stallions, tests which are
conducted on horse-farm prior to breeding season include serum neutralization test for Equine
Herpes Virus -1 (EHV-1) and Equine viral arteritis.
What is the looming problem nowadays is that there is no existing system control whether would
that involve certain institutions or associations (sport or breeding animals). Examination of equine
sperm for arteritis is not a common procedure - however, in justified cases of doubt solely it is. On
the other hand, as an example of regulations in South America, we shall mention compulsory
measures in Argentina about the obligation of examination of Equine Viral Arteritis on stallions.
These are following: Every breeding association must submit a certification of negativity (serum
neutralization test) for Equine Viral Arteritis of all active stallions before the annual breeding
registration or AI. Frozen semen samples imported from foreign countries must be checked by state
laboratories for detection of viral presence by PCR before commercialization and insemination. On
balance, it can be emphasized, that in relation to further development of veterinary profession and
horse industry in Serbia as well, it is not recommended to a priori implement every EU model
currently, and completely, due to the difference in horse breeding between our system and similar in
EU countries. Nevertheless, in relation to mentioned legal framework and de facto situation in horse
breeding in Serbia, we would recommend thoroughly planned control and primarily to make
evidence of stallions used for breeding of mares in sport and rural areas.
Keywords: equine, semen, legislative, Serbia, EU
Introduction
The state of horse breeding and reproduction in Serbia
Horse breeding as an animal husbandry branch has a long and significant tradition in Serbia through
the use of horses in work, sport and nowadays increasingly more as a hobby. According to the
records from the Bureau for statistics of Serbia from 2014 here are 16.000 horses, which include
8.000 of mares and fillies. However, when it comes to the number of stallions there are no official
records. Although, those are the official records we consider them as not viable enough and they are
80
taken with caution owing to the fact that those do not reflect the actual state especially regarding the
breeding animals.
Moreover, the additional records available to us are containing the information about the population
size on the Province Vojvodina territory (Trivunovic, 2014). This report, from main breeding
organisation in the animal husbandry at the Faculty of Agriculture of Novi Sad from 2014, includes
only stallions that are registered, and are under the regular productivity control. The active
population counts 184 animals. Thus, there is an assumption that for breeding is used a larger
number of the breeding animals, however the breeders are not completely adjusted to breeding
programmes from the unknown reason whether they are not keeping records or they do not hand in
breeding reports to basic breeding organisations. In addition to those mentioned facts there have not
been a proper number of scientific publications when it comes to fertility and problems in horse
reproduction due to infectious disease in Serbia. In the continuation of this work we are going to
describe what are the laws that should be obeyed regarding the health conditions of stallions, if they
are compared with the legislation in Serbia (West Balkan) and EU.
Legislation about breeding stallions in Serbia
Diagnostic and health condition control procedures of breeding stallions in Serbia are in accordance
with Regulation on the establishment of animal health care measures for 2014 (Anonymous,
2014A). Diagnostic tests for breeding stallions are performed on each breeding animal one time in a
year, and those include only tests for Equine infectious anaemia (EIA). Nevertheless, the majority
of horse owners and keepers tend to follow their previous routines and preventive measures. When
it comes to stallions, tests which are conducted on horse-farm prior to breeding season include
serum neutralization test in blood sample for Equine Herpes Virus-1 (EHV-1) and Equine viral
arteritis (EVA).
Nevertheless, the present Program of measures states that in order to do establishment, monitoring
and prevention of Leptospirosis specific diagnostic examination (microscopic agglutination testMAT), is biannually conducted in stallions for natural mating and for semen production for
artificial insemination. Furthermore, there are no precise data about the number of breeding mares
and stallions that are under regular serological control for Leptospirosis in the herds in Serbia.
Owing to that, we cannot accurately determine the nature of epizootic situation for this contagious
disease.
What is the looming problem nowadays is that there is no existing system control whether would
that involve certain institutions or associations (sport or breeding animals). Examination of equine
sperm for EVA is not a common procedure - however, in justified cases of doubt solely it is.
In any case, in our country no systematic control of breeding animals for CEM (Contagious equine
metritis) is done which is hardening the insight on the field. However, there is existing risk of CEM
transmission during the import of breeding stallions and mares from the neighbour countries and
EU, as well as the stallions provided and borrowed for breeding.
Compulsory blood examination for EIA with the Coggins test has to be conducted in the following
cases: once in a year in the breeding horse-farms, horse-farms owned by Serbian Military Force,
sports horse-farms, stud sections, forests and other places of work, as well as in every herd
containing more than 10 horses; 90 days prior their arrival to hippodromes, fairies, exhibitions,
reviews, sporting competitions etc. If the owner of an animal sells the animal or alienates it in any
other way, the certificate about the examination of EIA must not be older than 30 days. Diagnostic
examination can also be done with ELISA test, with confirmation Coggins test in addition.
Equine viral arteritis
All newly purchased horses should be kept in quarantine and subjected to serological testing
81
examination. This applies to a negative status of the animal from a disease which should be
reported: Dourine, Glanders, Equine encephalomyelitis (all types including Venezuelan
encephalomyelitis), EIA, rabies, anthrax, AHS, Vesicular stomatitis.
The certificate of health in the case of a registered equine must be issued within 48 hours before
loading or no later than the last working day prior to loading, in the language of the country of
export of semen and at least one of the official languages of the EU. The health certificate is valid
for 10 days and consists of a single sheet. Interestingly, the experts of the European Commission, in
cooperation with the Ministry of Agriculture (as the competent body of the exporting country), may
do the examination on the spot, to the extent that is necessary to ensure the implementation of this
Regulation. The competent body shall provide all necessary assistance to the experts referred to in
paragraph in carrying out their work. If it is about the import of equidae from the third countries to
Croatia it is only allowed if those countries are officially enlisted by the European Commission.
This approval relates to the whole territory of a third country or to only a part of its area. We should
not neglect the legislation of the third country which applies in relation to animal health and
welfare.
The conditions to be met by the Centre for artificial insemination in EU are: That during the period
commencing 30 days prior to the date of semen collection until the date of dispatch of fresh / chilled
semen or until the expiry of a period of 30 days of mandatory storage of frozen semen possessed
only equidae which were free of clinical signs of CEM and EVA. That the above described semen
comes from donor stallions, which: on the day of collection of semen have not shown clinical signs
of an infectious or contagious disease; during at least 30 days prior to collection of semen have not
been used for natural mating; during at least 30 days prior to collection of semen have been kept on
farms where no equine animal showed clinical signs of EVA; during at least 60 days prior to
collection of semen have been kept on farms where no equine animal showed clinical signs of
CEM; according to the information / check the official veterinarian of the 15 days immediately
prior to collection of semen have not been in contact with equidae suffering from an infectious or
contagious disease; that they are subjected to the following tests in a laboratory approved by the
competent authority in accordance with a test program: Coggins test for EIA with negative result,
serum neutralisation test with serum dilution of 1 in 4, or with virus isolation test on an aliquot of
the entire semen of the donor stallion, with the negative result; a test for CEM carried out on two
occassions with an interval of seven days by isolation of Taylorella equigenitalis from preejaculatory fluid or a semen sample and from genital swabs taken at least from the penile sheath,
urethra and urethral fossa with negative result in each case.
That the stallions donors undergo one of the following testing programs: that at least 30 days prior
to and during the collection of semen continuously resident in the collection centre of semen and in
that period no equine animal in the centre has not come into direct contact with equidae of lower
health status than the one in the centre. Certainly, the exact date is stated when they carried out
indicated tests on samples of semen or blood.
During the completion of this certificate, parts that are not related to the shipment must be crossed
out. In order to prevent forgery of documents, the colour of the seal and signature of veterinarian
should differ from the colour of the printed text.
Discussion
Unfortunately, for now, in Serbia some kind of diagnostics includes only sport horses or other
categories of horses that are exposed to diagnosis because of bringing them to the event, fairs or
export.
83
The impression is that the most widely implemented serological diagnosis is the one of EIA.
Although the Ordinance on eradication EIA specifies the compulsory serological diagnostic
measures in horses once in five years it is highly dubious that this is fully carried out. This is
indicated by the occasional discovery of seropositive animals in the past 5 years. In contrast, most
sports horses are regularly controlled, sometimes several times a year, and it is partly regulated by
law, and partly by sporting regulations.
Regardless of whether it is possible titre of antibodies against influenza, herpes virus infection, or
EVA result of vaccination or infection it raises the question of what this finding means when we are
aware that a large number of horses are positive to all these diseases, without evidence of
vaccination.
There are some interesting experiences and research on the occurrence of EVA in Croatia in the
period from 2009 to 2012 (Kolakovi, 2013). According to the legislation in Croatia, EVA is
mandatory controlled with serological examinations of all stallions before the breeding season.
Serologically positive animals then are subjected to an overview of at least two semen samples for
the presence of the virus, with the PCR method. Stallions with a positive test for EVA in the sperm
must be excluded from breeding. The author concludes that this reduction in the number of stallions
serologically examined presents a significant risk of uncontrolled spread of EVA in the horse
population in Croatia. It underlines the need to careful approach when it comes to the
implementation of vaccination against this disease, because the mentioned measure cannot
eliminate the cause of the permanently infected stallions. Therefore, it is recommended to provide
vaccination of only seronegative animals under strictly controlled conditions with the required stay
in quarantine after the vaccination. In addition, vaccination, particularly in countries with unreliable
labelling and record-keeping of horses (i.e. Croatia and Serbia), completely loses the ability to
control the disease with serological examination, primarily because of the problems in
differentiating infectious and vaccination titre. Moreover, epizootic situation in Serbia, together
with the manner of keeping, manipulating and breeding animals, is not suitable to disease control
implementing vaccination against EVA.
As an example of regulations in South America (Argentina), we would mention compulsory
measures (National Animal Sanitary Service-SENASA- 434/01) in Argentina about the obligation
of examination of EVA on stallions. These are following: Every breeding association must submit a
certification of negativity (serum neutralization test) for EVA of all active stallions before the
annual breeding registration or artificial insemination. Frozen semen samples imported from foreign
countries must be checked by state laboratories for detection of viral presence by PCR before
commercialization and insemination.
In relation to the occurrence of Dourine, interesting is the situation in Italy (Calistri et al. , 2013),
where the disease was diagnosed in the regions Sicilia and Campagna in 2011. In Italy, the program
of measures requires examination of about 4000 breeding stallions annually to this parasitic
infection. Having established five outbreaks of Dourine in spring 2011, competent institutions have
made a plan to eradicate and above all to provide the determination of the prevalence of this disease
in Italy. Consequently were found two, but later seven outbreaks. It has been discovered that the
infection is created directly from infected individual coitus. Although Italy is considered the country
with developed horse breeding, this prevention of Dourine has been used to detect a number of
deficiencies in recording and registration of horses in the Central Database in relation to the
situation on the field. All this made it difficult to implement measures on eradication Dourine and
identify the source of infection. This refers to an uncontrolled mating mares (without proper
records), non-implementation of the prescribed veterinary measures and on the impossibility of
monitoring the movement of animals. This example confirms that effective control of infectious
diseases that occur occasionally involves primarily the establishment of effective communication
between veterinarians, authorized diagnostic institutes and laboratories, veterinary inspection,
84
government and international institutions which are responsible for recording the occurrence of
certain diseases and regular reporting when that is the case.
Conclusion
It can be concluded that the aforementioned regulations differ significantly only in the control of
CEM and EVA, which are the most actual epizootiological problem in Serbian horse population,
because we have no real information about their presence in horse studs in Serbia.
Actually it is understood the free status of centres for artificial insemination and horse studs of
especially dangerous infectious diseases, such as AHS. We believe that more important would be
consistent implementation of regulations related to the diagnosis of infectious diseases in stallions.
On balance, it can be emphasized, that in relation to further development of veterinary profession
and horse industry in Serbia as well, it is not recommended to a priori implement every EU model
currently, and completely, due to the difference in horse breeding between our system and similar in
EU countries. Nevertheless, in relation to mentioned legal framework and de facto situation in horse
breeding in Serbia, we would recommend thoroughly planned control and primarily to make
evidence of stallions used for breeding of mares in sport and rural areas.
Thus, based on these data, we propose appropriate measures. First of all, audits (as amended)
regulations and their alignment with the current EU directives, bearing in mind the epizootiological
epizootiological situation in the country and the region. As a prerequisite, it should be the training
of certified laboratories for fast and effective diagnosis of infectious diseases of horses, those that
are regularly or occasionally occurs in our country, as well as diseases that can potentially introduce
horses or otherwise from other countries. This mainly refers to identifying EVA in the sperm
(PCR), as well as with evaluation of genital swabs for CEM. However, as far as it is possible we
would not recommend vaccination against EVA. The reason for this is that the disease situation in
Serbia, the way of keeping animals, the use and breeding horses, including the records and marking
of animals, are not appropriate and in accordance with control of the disease by introducing just
these preventive measures.
To ensure effective diagnosis, it is necessary to review and offer laboratory analysis of all
veterinary institutes related to infectious diseases of horses. Constant communication and exchange
of information and experience would ensure effective coordination of all involved in the health care
of horses, and certainly with international organizations such as OIE and the relevant EU bodies.
Because of the introduction of legal solutions for immunoprophylaxis should enable simpler
procedure of import of vaccines for infectious diseases of horses. And last but not least, a crucial
measure for combating infectious diseases, breeding a horse and raising awareness of the
importance of this issue, both for the owner or holder of the animals themselves and veterinarians
who care about their health condition.
Acknowledgements
The presented work is part of the research done in the scientific projects TR-31084 and III-46005
granted by the Serbian Ministry of Education and Science.
Reference:
1. Anonymous: Council Directive 92/65/EEC, of 13 July 1992 laying down animal health requirements
governing trade in and imports into the Community of animals, semen, ova and embryos not subject to
85
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
animal health requirements laid down in specific Community rules referred to in Annex A (I) to
Directive 90/425/EEC. (OJ L 268, 14.9.1992, p.54), 1992.
Anonymous: Veterinary Law ("Off. Gazette of RS" No 91/2005, 30/2010), 2010.
Anonymous: Ordinance on animal health requirements when moving and imports equidae from third
countries ("Official Gazette of Croatia" No. 78/12), 2012.
Anonymous: Regulation on the establishment of animal health care measures for 2014. year ("Off.
Gazette of RS" No. 24/14), 2014A.
Anonymous, Regulation of marking semen, making evidence about producing semen, as well as
requirements when it comes to fulfilment of semen quality (Offizial Gazette of Serbia 38/14 from april
2014), 2014B.
Aurich Ch, Reproduktionsmedizin beim Pferd. Gynkologie Andrologie Geburtshilfe. Stuttgart,
Parey Verlag, 2010.
Bazanow AB, Jackulak, AN, Frcka BA, Staroniewicz MZ: Abortogenic viruses in horses, Equine Vet
Educ, 26, 48-55, 2014.
Calistri P, Narcisi V, Atzeni M: Dourine reemergence in Italy. J Equine Vet Sci, 33, 2, 8389, 2013.
urii B, Petrovi T, Uroevi M, Dimi-Jaki D, , Appearance and spread of Equine Viral Arteritis
(EVA) Republic in Serbia. Proceedings of the 10th International Congress of World Equine Veterinary
Association, Moscow, Russia, February 2008, 624.
Kolakovi J: "Serosurveillance of equine viral arteritis in Croatia and evaluation of control measures
during period 2009. 2012.", Graduate thesis. University of Zagreb, Faculty of veterinary medicine,
Croatia, 2013.
Trivunovic S.: The Main breeding organisation in the animal husbandry of the Faculty of Agriculture,
University of Novi Sad, 2014. https://sites.google.com/a/stocarstvo.edu.rs/glavna-odgajivackaorganizacija/publikacije
Uroevi I.M., Trailovi R.D., Salajpal K., Jaji I., Ili S.: Infectious diseases of equine reproductive
organs: preventive measures and erradication. Proceeding, The Horseville, Science and Profession, third
Regional Symposium Breeding, reproduction and healt care horses. Novi Sad, Serbia, 1-3 October
2012, 711-19
86
Abstract
The success of sows artificial insemination (AI) significantly depends on the quality of sperm used.
The presence of morphologically abnormal sperm significantly reduces the boar semen fertilization
potential. Additionally, the presence of such sperms indicates on various diseases and disorders, or
adverse effects of unfavourable environmental factors. Therefore, the aim of this study is to analyze
the presence of sperm morphological abnormalities, detected in the boars used for AI on farms in
AP Vojvodina (Serbia). Extended semen samples, from 111 AI boars, was tested on sperm and
acrosomal membrane integrity by flow cytometry. Supravital staining (eosin-nigrosin) according to
Bloom, was used to determinate the percentage of live, dead and pathological forms of sperm, as
well as sperm with intact or damaged acrosome. In average, live sperm was average 71%, of which
59% was with intact acrosome. Damaged acrosome was found in 13% live and in 17% dead sperm.
Pathological forms (PF) were found in 32.5% of sperm (20.7% primary and 11.5% secondary PF).
It is important to point out that only 19% of AI doses were categorized as a "first class", while 49%
of the AI doses were "outside of class" (not for use in AI). These results indicate a very poor quality
of examined AI doses. In conclusion, factors that can affect AI dose fertilizing capacity, in the on
farm artificial insemination technology, must be determined in detail.
Keywords: sperm, morphological abnormalities, AI, boars.
Introduction
In modern intensive pig production, more than 90% of sows are artificially inseminated (AI), by
using liquid diluted semen (Stani and Dragin, 2011; Lpez Rodrguez, 2012; Kalifa et al., 2014).
Fertilizing capacity of AI dose significantly depends on the quality of used semen. Sperm
concentration, progressive motility, percentage of viable cells and acrosome morphology are the
basic parameters of semen quality evaluation (Knox, 2004; Mircu et al., 2008; Maes et al., 2011).
To selection of the boars with a good reproductive performance, the prediction of sperm fertilizing
ability has a great economic importance, when expensive genetically superior boars is used in sows
artificial insemination (Gadea et al., 2004). For maximal reproductive exploitation of genetic
quality boar, large number of AI doses per one ejaculate, are often produced (Stani, et al., 2012).
This results in excessive semen extension (Johnson, 2000; Stani et al., 2012). However,
overextension of semen is the most common cause of reduced progressive motility and increased
number of abnormal sperm in AI doses (Maxwell et al., 2007; Caballero et al., 2008; Stani et al.,
2012), particularly sperms with acrosome damaged or disintegrated acrosomal membrane (Perez
Marcos et al., 1991; Kommisurd et al., 2002). Therefore, to achieve high fertility rate in artificially
inseminated sows, it is necessary to accurately control the quality of each ejaculate and extended
semen in AI dose.
The aim of this study was to analyze the presence of morphologically abnormal sperm in the
extended boar semen, used for AI on intensive pig production farms in Vojvodina Province
(Republic of Serbia).
87
*Laboratory for Reproduction in Domestic Animal, Scientific Veterinary Institute, Novi Sad.
1
Semen samples with parameters above or below of these values are classified as "out of class"
Results
The obtained parameters of tested diluted boar semen samples (AI doses), are shown in Table 2.
From the total of 71% live (unstained) sperm, 59% of them was with intact acrosome. Damaged
acrosome was found in 13% of live and in 17% of dead sperm cells. Various pathological forms
were found in 32.2% of sperm cells (abnormalities of head and/or principal piece of the sperm cell,
primary abnormalities - I ABN, in 20.7% and abnormalities of middle or rear part of the sperm tail,
secondary abnormalities - II ABN, in 11.5%).
From the total number of AI doses (n = 111), 49% of them was categorized as "out of class" (not for
use in AI), while only 19% of AI dose was a "first class", 16% of AI doses was "second class" and
16% of AI doses was "third class" (Fig. 1).
88
Table 2. The parameter values of tested diluted semen samples (AI doses)
Parameter value
Average
Variation
71.413,98
35.6 - 91.9
58.716,00
17.3 - 87.7
11.213,15
1.8 - 46.3
12.713,22
0.2 - 53.7
17.313,40
0.0 - 49.7
30.016,43
0.2 - 68.2
20.717,49
1 - 64
11.516,33
0 - 68
32.219,87
2 - 85
111
I ABN - Pathological changes of head and/or uper part of the sperm tail.
II ABN - Pathological changes of midle and/or rear part of the sperm tail.
Semen samples, %
60
49
50
N = 111
40
30
19
20
16
16
Second
Third
10
0
Out of class
First
Semen class
Fig. 1. Classes distribution of tested diluted semen samples
to naturally inseminated sows (Zveki, 2003; Gadea, 2005; Alm et al., 2006). On the other hand, it
has been shown that there is considerable variation among boars concerning the fertilizing capacity
of semen during storage (Waberski et al. 1994; Stani et al., 2003b).
In conclusion: to detected the reasons for large number of poor AI doses, following should be done:
(1) evaluate boar ejaculate quality, (2) check the boars healt status, (3) determine dilution rate of
each AI dose, and (4) check the storage and/or transport conditions of AI doses.
Acknowledgments
This work was supported by a grant from scientific project TR 031071 of Ministry of Education and
Science of Republic of Serbia.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Alm K., Peltoniemi O.A.T., Koskinen E., Andersson M.: Porcine Field Fertility with Two Different
Insemination Doses and the Effect of Sperm Morphology. Reprod. Dom. Anim., 41, 3, 210-213, 2006.
Caballero I., Vazquez M.J., Garca M.E., Parrilla I., Roca J., Calvete J.J., Sanz L., Martnez A.E.: Major
proteins of boar seminal plasma as a tool for biotechnological preservation of spermatozoa.
Theriogenology, 70, 13521355, 2008.
Gadea J., Selles E., Marco A.M.: The Predictive Value of Porcine Seminal Parameters on Fertility
Outcome U nder Commercial Conditions. Reprod. Dom. Anim., 39,303308, 2004.
Gadea J.: Sperm factors related to in vitro and in vivo porcine fertility. Theriogenology, 63:431444,
2005.
Johnson L.A., Weitze K.F., Fise, P., Maxwell W.M.C.: Storage of boar semen. Anim. Reprod. Sci., 62,
143-172, 2000.
Joviin M., Neme ., Boro I., Jakovljevi G., Kai M., Salma J., Glavoni L.: Steonost krava u
zavisnosti od citolokog i mikrobiolokog kvaliteta zamrznutog semena bikova. Zbornik naunih
radova PKB Agroekonomik, 329-39, 1997.
Khalifa T., Rekkas C., Samartzi F., Lymberopoulos A., Kousenidis K., Dovenski T.: Highlights on
artificial insemination (AI) technology in the pigs. Mac. Vet. Rev., 37, 1, 5-34, 2014.
Knox V.R.: Practicalities and Pitfalls of Semen Evaluation. Advances in Pork Production, 15, 315-322,
2004.
Kommisrud E., Paulenz H., Sehested E., Grevle I.S.: Influence of Boar and Semen Parameters on
Motility and Acrosome Integrity in Liquid Boar Semen Stored for Five Days. Acta Vet. Scand., 43, 4955, 2002.
Lpez Rodrguez, A.: Fresh boar semen: quality control and production (PhD Thesis). Faculty of
Veterinary Medicine, Ghent University, 2012.
Maes D., Lopez Rodriguez A., Rijsselaere T., Vyt P., Van Soom A.: Artificial Insemination in Pigs. In:
Artificial Insemination in Farm Animals (Dr. Milad Manafi, Ed.), 2011, 80-94.
Maxwell W.M.C., de Graaf S.P., Ghaoui R.E.-H., Evans G.: Seminal plasma effects on sperm handling
and female fertility. Soc. Reprod. Fertil., Suppl 64, 1338, 2007.
Milovanovi A., Barna T., Milanov D., Lazarevi M.: Model for cooperation between boarstuds and
laboratories for reproduction in boars semen quality control. Arhiv veterinarske medicine, 6, 1, 57-70,
2013.
Mircu C., Cernescu H., Knop I.Violeta, Frunz Ilinca, Ardelean V., Bonca G.H., Otava G., Zarcula
Simona, Gabriela Korodi Renate, Ardelean A.: Boar semen evaluation using casa and its relation to
fertility. Lucrri stiinifice medicin veterinar (Timisoara), 41, 203-212, 2008.
Perez Marcos C., Sanchez R., Palacio M., Pursel V.G., Perez Garcia T., Martin Rillo S.: Effects of
dilution rate on the motility and acrosome morphology of boar spermatozoa stored at 15C. Reprod.
Dom. Anim., 26, 112-116, 1991.
90
91
Abstract
Internal parasites of swine are very common in swine worldwide, sometimes compromising
production and occasionally the cause of clinical disease. One of the most important zoonotic
parasites that can be found in swine is a larval stage of Echinococcus granulosus. Adult
Echinococcus spp. cestodes occur in carnivores, and their larval cysts (hydatids) occur in various
herbivores and omnivores, including humans and swine. In carnivores, egg-laden proglottids pass
with the faeces, contaminating the environment. When ingested by a pig, the larva (oncosphere)
hatches in the small intestine, penetrates the intestinal wall, and enters the circulation. The liver
stops about 70% of the oncospheres, where they nidate and develop into hydatids. Hydatic disease
in pigs is not common finding on large swine farms, because biosecurity measuers are taken to
prevent the contact of swine with carnivores. However, this is not a case with the backyards and
free-range pigs, and they present the most frequent way of pig production in villages. The aim of
the paper is to present a finding of intensive parasitic infection (hydatic disease) in backyards pigs.
The material for this research included pigs from one backyard, where certain disorders and health
problems in weaned pigs were detected. The applied research methods included: anamnestical and
clinical evaluation, pathomorphological examination, parasitological laboratory testing for detection
and determination the presence of parasites in the organs and tissue samples (liver, lung) derived
from died pigs. Since in the evaluated backayard a sudden death in 10 weaners occurred, with
unspecific clinical signs, the gross pathology examination of 2 dead weaners was performed. The
nacropsy findings revealed the presence of enormous number of hydatid cysts on and in the liver
tissue. Also, a large number of free parasitic cysts were found in the abdominal cavity. By
parasitological examination of the liver and abdominal content, the presence of small parasitic cyst
of Echinococcus granulosus (2-5 mm) was detected. Based on the achieved results, it can be
concluded that Echinococcus granulosus infection is present in the backyards and free-roaming
pigs, where husbandry methods allow direct contact with domestic and wild carnivores.
Keywords: backyards, domestic pigs, Echinococcus granulosus
Introduction
Hydatidosis in pigs is caused by larval form of Echinococcus granulosus.
Echinococcosis/hydatidosis is a zoontic parasitic disease that poses a major health as well as
economic threat all around the world. In the etiology of the disease, two stages can be discerned: 1)
hydatid stage (cystic echinococcosis), which occurs in intermediate hosts (domestic and wild
omnivores, herbivores and humans); and 2) echinococcosis stage, which occurs in the dead-end
(definitive) hosts (animals from the families Canidae and Felidae), caused by the adult
Echinococcus spp. (Brunetti and Filice, 2008).
In Serbia, the highest percentage of infected pigs can be found in backyard and free-range pig
production systems (up to 75%). The percentage of infected pigs found on large swine farms (with
biosecurity measures) is also not negligible and adds up to 10% (Pavlovi et al., 1997).
92
A certain number of wild boars in our country are reared in controlled and enclosed hunting
grounds, while a number of free-ranging populations are mainly unknown. One of the
characteristics of outdoor swine production in some regions is raising free-roaming domestic pigs,
where they share forest habitat with wild boars. Contacts between wild boars and domestic pigs
kept in outdoor farms may occur occasionally. Since both animals have the same susceptibility to
various infections including hydatidosis, there is a major concern to monitor the epidemiological
situation of wild boars especially when control measures in domestic pigs are implemented
(Prodanov-Radulovi et al., 2014).
Uncharacteristically for tapeworms, the adult tapeworm is very small, only 5 mm in length. The
eggs produced by the parasite are very light and resilient (Laaksonen and Paulsen, 2015). The
infection of intermediate hosts occurs exclusively through the use of the contaminated water and
food. The source of the Echinococcus eggs contamination is to be found in the faeces of dead-end
(definitive) hosts, which is continuously being released into the external environment and ultimately
consumed by the pigs (Pavlovi and Ivanovi, 2006).
The development process of the hydatic cysts is the same in all intermediate hosts, including
humans. Once the digestive tract is reached, oncospheres (hexacanths) are released from the eggs,
penetrating through the intestinal mucosa and reaching the capillaries, from where, through vena
porta, the primary implantation site is reached - the liver (up to 70% share). Certain number of
oncospheres that mash the liver, arrive at the right heart via vena cava, proceeding towards the
lungs, the second most frequent implantation organ for hydatic cysts. The remaining hexacanths are
transferred, through the left heart, towards the other parts of the organism implanting kidneys,
eyes and seldom brain and bones. When oncospheres (hexacanths) are fixed to the mucous
membrane, the development of the cysts can begin. The cysts are continuously growing throughout
the whole life of the intermediate host (Pavlovi et al., 2011). Their size varies, depending on the
duration of the infection, from barely noticeable to cysts of 150 mm in diameter. The cysts are often
pearly grey colour and contain clear liquid with thousands of small, infectious larval forms of the
parasite (Laaksonen and Paulsen, 2015). They are under considerable pressure and in the case of
their rupture, the outcome is fatal.
In most of the cases the disease in pigs is asymptomatic and the losses primarily occur due to organ
failures caused by the implanted cysts. There are three main factors contributing to the spreading of
this infection in pigs: 1) the lack of pig breeders and dog owners knowledge concerning the life
cycle of the parasite and concerning its epidemic potential; 2) the percentage (share) of the infected
dogs as dead-end (definitive) hosts; and 3) hygienic circumstances, especially in pig breeding
practices.
The aim of this paper is to widen the awareness of the possibility of Echinococcus granulosus
epidemic mostly among the pigs bred in backyard and free-range pig production systems.
Since gross pathology findings had indicated the presence of significant pathomorphological
changes, an additional parasitological testing was performed.
Results
During the external gross pathological pathomorphological examination of dead pigs, carried out in
the backyard of the pig owner, a dirty slimy discharge of the nostrils was discovered at both pigs, as
well as a strong cyanosis of the skin in the area of proboscis and earlobe base with visible yellow
discoloration of the skin and mucous membranes. Mild palpebral oedema was also detected at one
of the dead pigs. The internal gross pathological pathomorphological examination, on the other
hand, revealed an amber coloured, free liquid, with fibrin strands in the chest cavity (Picture 1).
Picture 1. Chest and abdominal cavity: free liquid with fibrin strands
The examined tissues were also remarkable for mucosal and serosal yellow discolouration.
Individual bleeding on the side parts of the diaphragmatic lobes were present in the lungs, as well as
the hepatisation of apical and cardiac lobes. A few examples of Metastrongylus spp. were found in
the lumens of bronchi and bronchioles. The mediastinal lymph nodes were unchanged. Tonsils,
epiglottis, pharynx and larynx were also unchanged. The mandibular lymph nodes were unchanged.
Extremely yellow discolouration of endocardium was discovered. In the abdominal cavity, the free
liquid mixed with large amount of fibrin strands and free whitish, almost translucent, cystic
formations, like drops, the size of grain of wheat or rice, also was found (Picture 2a and Picture
2b).
94
The liver was significantly enlarged with rounded edges and with a small but very numerous cystic
formations protruding and dropping out of the liver tissue after cutting (Picture 3a). Hepatic
hemorrhage with considerable structural defects was present (Picture 3b).
The stomach was nearly empty, with expressed folds of mucous membranes and without changes in
the mucosa. The small and large intestines were almost empty, with only a small amount of content
and without changes in the mucous membrane. There was yellow discolouration of the kidneys with
no changes either under the capsule or on the transverse section. The bladder was full of dense,
distinctly yellow liquid content and without changes in the mucosa (Picture 4).
Considering the fact that echinococcosis/hydatidosis poses a major global threat, infection
monitoring must be carried out with care and perseverance all over the world. For example, on the
occasion of a pig slaughter in Lithuania, the examination of 684 pig livers revealed that
significantly more infected animals came from mini farms (applying the backyard and free-range
pig production systems and thus not maintaining strict biosecurity measures) then from large-scale
farms (Bruzinskaite et al., 2009).
In order to make progress in the fight against echinococcosis/hydatidosis, it is necessary to cut off
every rout of transmission of the infection. To this end, it should be made mandatory, that livestock
slaughter process is always carried out in slaughterhouses, and under constant supervision of
veterinary inspection services. It is also of paramount importance to report every case of the
infection to the veterinary inspection service from where animal originate and to document it. The
hygiene of the pig production practices and methods also affects the spread of the infection, which
makes it extremely important to maintain strict biosecurity measures, which also means control on
livestock movement, so that, in this particular case, the contact between the pigs and the
intermediate and definitive hosts (dogs, i. e. their faeces) would be made impossible. The
importance of widening of the global awareness of the problem as well as widening the access to
the knowledge of infection should also be emphasised. Through education, which should start from
school and also encompass instructing livestock breeders, butchers and dog owners on how to
prevent the infection, everyone should be familiar with the basic facts concerning this infection.
This education also means making wider public familiar with measures that should be undertaken,
in order to combat this zoonosis more successfully. The measures also include the dog
dehelmintisation, the control of dog movement and secure disposal of the organs contaminated with
hydatic cysts (by boiling, burning or handling in animal shelters).
Acknowledgements
This paper is a result of the research within the project TR 31084, financed by the Ministry of
Education, Science and Technological Development, Republic of Serbia.
References
1. Brunetti E., Filice C.: Echinococcus Hydatid Cyste Medicine Specialities Infectious Diseases Parasitic
Infections, http://emedicine.medscape.com/article/216432 - overview, 2008
2. Bruzinskaite R., Sarkunas M., Torgerson P. R., Mathis A., Deplazes P.: Echinococcosis in pigs and
intestinal infection with Echinococcus spp. in dogs in southwestern Lithuania. Vet Parasitol., 160, 3-4,
237-241, 2009
3. Ivanovi S., Pavlovi I.: Rairenost ehinokokoze kod svinja u ekstenzivnom dranju na podruju srednjebanatskog okruga. Tehnologija mesa, 40 (6), 302-303, 1999. Beograd, Srbija
4. Laaksonen S. and Paulsen P.: Hunting hygiene, Wageningen Academic Publishers, 2015
5. Pavlovi I., Iveti V., Valter D., Lonarevi A., Kulii Z., Dimitri A.: Ehinokokoza svinjaepizootioloki, epidemioloki i ekonomski znaaj. Zbornik radova 4. savetovanja veterinara Republike
Srpske sa meunarodnim ueem, 116, 1997. Tesli, Republika Srpska
6. Pavlovi I., Ivanovi S.: Ehinokokoza/hidatidoza, bolest ivotinja i ljudi, izd. Nauni institut za
veterinarstvo Srbije i Ministarstvo poljoprivrede, umarstva i vodoprivrede, 1-32, 2006. Beograd, Srbija
7. Pavlovi I.,Hadi I., ugi G., Aneli-Buzadi G., Vai D., Jovevski S.: Hidatidoza aktuelan problem
stoarske proizvodnje. Zbornik naunih radova sa XXV savetovanja agronoma, veterinara i tehnologa,
Institut PKB Agroekonomik, Vol.17, 3-4, 133-139, 2011. Beograd, Srbija
8. Prodanov-Radulovi J., Doen R., Petrovi T., Polaek V., Lupulovi D., Stojanov I., Gruba S.:
Antibodies to selected viral disease agents in hunted wild boars in Vovodina region, 3rd International
symposium on hunting, Modern aspects of sustainable management of game population, 149-153, 2014.
Zemun-Beograd, Srbija
96
Abstract
The fungi of the genus Aspegillus are ubiquitous saprophytic microorganisms which are, in certain
circumstances, responsible for clinical infections of respiratory tract in all poultry, particularly in
young birds. Aspergillus fumigatus, A. niger and A. glaucus are the most common isolated fungi in
the cases of pulmonary aspergillosis in poultry. Poultry is constantly exposed to these fungi in its
environment, and predisposing factors, such as long exposition, highly contaminated environment
and litter, high humidity in poultry houses, poor ventilation, as well as malnutrition and stress
contribute to the development of clinical manifestations of aspergillosis. The aim of the present
paper was to examine the effects of some factors on the incidence and prevalence of the clinical
form of aspergillosis in poultry. The possibility to control the disease by introduction of
prophylactic measures was also considered. The presence of Aspergillus sp. in poultry was analyzed
based on the results of clinical and laboratory tests carried out during 2000, 2010 and 2014. The
prevalence of aspergillosis was noted in poultry of different age, such as hatched eggs, young and
adult birds. Aspergillus sp. was isolated in the range of 3.85% to 36.14% from unhatched eggs, litter
and environmental and hatchery swabs. An increased trend in number of infected poultry flocks was
observed, especially in young birds. During the years 2000, 2010 and 2014, acute aspergillosis was
detected in 12, 16 and 21 commercial flocks of chickens and turkeys, respectively. Application of
proper sanitary-hygiene measures on poultry farms and hatcheries, as well as microbiological
control of feed are considered essential for an efficient control of spreading of infection.
Keywords: aspergillosis in poultry, humidity, temperature, feed
Introduction
Aspergillosis is a fungal disease of all poultry species, particularly of young birds. Most frequently
it occurs in turkey poults, chicks, ducklings and goslings (Kunkle, 2003; Beytut et al., 2004).
Aspergillus fumigatus is considered to be the most pathogenic and is the most frequent isolate from
pathologic lesions, while others like A. niger, A. flavus, A. terreus and A. glaucus can induce the
disease, too. The fungal spores are ubiquitous in nature. Exposure of poultry to fungi or spores
occurs after the introduction of contaminated litter and feed. Early infection is possible in hatcheries
if fungal contamination occurs.
Certain infectious diseases may contribute to aspergillosis, e.g. infectious bronchitis, coryza,
chronic respiratory disease, laryngotracheitis, Newcastle disease and fowlpox. It has been
speculated that extremely dry air and dust can cause the infection with Aspergillus because they dry
out the respiratory mucosa and protective effect of mucus is absent (Kristensen and Wathes, 2000).
Some geographic and seasonal regularity are observed in relation to the distribution of aspergillosis
outbreaks. Incidence of the disease decreases on poultry farms with stringent hygiene and good
nutrition management.
97
Influence of certain factors on the outbreak and spreading, as well as clinical features of
aspergillosis, were investigated in this paper. The possibility to control the disease by introduction
of prophylactic and intervention measures was discussed.
discovered one distinctive finding which was grouping of the chickens toward the source of fresh
air ("hunger for oxygen"; Figures 1 and 2).
Besides respiratory form, infection of eyes can also occur (Akan et al., 2001). In that case
protruding eye lids are observed because of formation of yellowish-cheesy small pellets around the
membrane nicticans with central ulceration (Figures 3 and 4). In our investigations, ocular infection
with Aspergillus was determined in two broiler flocks, at the age from 7 to 10 days. In subacute and
chronic infection, only one or several individuals in flock became ill. Clinical signs of depression,
inapetence, ruffled feathers and emaciation are common, sometimes chronic bronchopneumonia,
too (Martin et al., 2007; Islam et al., 2009) during the year 2010 and 2014 subacute and chronic
aspergillosis was not detected.
In the investigated period, acute aspergillosis was clinically noted. Postmortem findings included
nodules - aspergillus granuloma, oval or round shaped, single or in conglomerate, size of a pin head
to pea, located on air sacs, lungs and on visceral serosae of abdominal cavity, liver and intestines
(Figures 5 and 6). Granulomas, oval or round, single or in group of conglomerate, are typical
section finding in Aspergillus infected birds. They are located in thoracic and abdominal cavity and
on the liver surface. Their appearance resembles the one found in avian tubercullosis, but with
radial hyphae nets surrounded by reactive zone like granulation tissue. Generally, nodules are
present in almost all tissues, even in eyes and brain (Throne Steinlage et al., 2002; Mukaratirwa,
2006; Martin et al., 2007; Cacciuttolo et al., 2009; Islam et al., 2009; Stoute et al., 2009).
Figures 3 and 4. Ocular form of aspergillosis - yellowish cheesy pellets around the membrane nicticans.
99
Clinical signs and pathologic findings are not sufficient for diagnose, so laboratory confirmation by
isolation of Aspergillus sp. is necessary. The spores germinate well in laboratory conditions, on
standard media and at room temperature, producing green to green-blue colour colonies that become darker, even black over time (Figures 7 and 8). In order for the disease to be diagnosed other
respiratory agents need to be excluded, such as infectious bronchitis, coryza, chronic respiratory
disease and Newcastle disease, infectious laryngitis, tuberculosis and fowlpox.
In intensive poultry keeping, there are numerous sources of this important fungal infection. Feed,
particularly mashed, can be contaminated with high number of fungi and moulds (Akanetal., 2001;
Nei et al., 2005; krinjar et al., 2009; Kapetanov et al., 2012; Kapetanov et al., 2013).
Figures 5 and 6. The infected turkeys from aspergillosis; post-mortem finding: disseminated nodulesaspergillus granulomas in the lungs and serosal surfaces of organs in the abdominal cavity.
The infection in poultry may occur if litter, environment or hatcheries are contaminated. Fertile
eggs and embryos can be contaminated before or during the incubation, and Aspergillus sp. is found
in tissues of unhatched eggs and hatchery waste (Jacobsen et al., 2010). Warm and humid air in
hatchery provides ideal conditions for the survival of Aspergillus. Infected embryos die between
15th and 18th incubation day, which may cause a decrease in hatch-ability of up to 30%. Dust
containing more than 800 colonies per gram leads to prospective embryo infection (Kozi, 1967).
100
Eggshell can be contaminated in case of inadequate collection and storage of eggs. The spores are
most frequently isolated from alanto-chorion liquid, producing green colonies up to 2 cm in size.
During the years 2000, 2010 and 2014, Aspergillus sp. colonies were often detected in unhatched
eggs and swabs taken from the hatchery (Table 1). In order to prevent the contamination of embryos
and chickens at hatch, different sanitation programs are applied (Ivanov, 2008). The sanitation
programs are designed in such manner that the number of fungi and other potential pathogens is
maintained at an acceptable level. However, their total elimination is not realistic. Lately, some
reports have brought the attention to possible infection of reproductive tissues of hens and
concomitant disease (Egg Borne Aspergillosis or congenital aspergillosis). It is demonstrated that
intravenous and inhalation infection is possible (Femenia et al., 2007). Still, under natural
conditions, infection is predominantly induced by air and orally.
Using inadequate litter increases the possibility of infection at early age. Higher number of fungi,
longer exposition, particularly in combination with stressing procedures, like vaccination, beek
trimming etc., all contributes to aspergillosis. Different types of litter may be contaminated
unequally. Sajid et al. (2006) found significantly higher rate of infected eggs in flocks kept on
sawdust (67.74%) in comparison to rice hulls (32.26%). On the other hand, Islam et al. (2009) could
not clearly relate the incidence of aspergillosis to the type of litter used. In our investigations,
mycological control of litter and swabs taken from surfaces in poultry houses points to oversights
during sanitation and disinfection (Table 1). With respect to year 2000, the total number of samples
and the number of mycologically inadequate samples was nominally higher in 2010 and 2014.
Raising poultry under higher fungal contamination increases the risk of aspergillosis, especially in
immune compromised or sick birds. The influence of particular outer and environmental factors to
fungal survival are numerous (De Bey et al., 1995; GigIi et al., 2005; Karwowska, 2005; Nichita
and Tirziu , 2008). The spores of Aspergillus germinate better when the air is dry. Aspergillus sp. is
often isolated from dust, and since the largest proportion of dust particles is inhalable, dust is
considered to be the predisposing factor for aspergillosis outbreak (De Bey et al., 1995). The type of
ventilation and air humidity are also relevant (De Bey et al.. 1995; Gigli et al., 2005; Sajid et al.,
2006) as they can impact the concentration of Aspergillus in the poultry house (Nichita and Tirziu,
2008).
By using available data on meteorological conditions in the region, this paper aims at establishing
the connection between clinical aspergillosis and overall laboratory findings, as well as the climatic
factors. The official report of Hydrometeorological Service of the Republic Serbia, for the year
2010, shows extremely warm percentile distribution. During the summer of 2010 maximal daily
temperatures were often above 30 C, and the total number of tropical days was higher than the usual
in most parts of Serbia, except in mountain regions. However for 2014 besides the very hot days,
abundant precipitations were also characterized, leading to flooding of the rivers from their banks
and further to (some sort of) natural disasters.
Table 1 - Contamination of unhatched eggs, litter, swabs taken from the poultry houses and
hatcheries by Aspergillus sp.
Sample type
Year 2000
Number and
Total number
%of positive
of samples
samples
Year 2010
Number and
Total number
% of positive
of samples
samples
Year 2014
Number and
Total number
% of positive
of samples
samples
Unhatched eggs
481
33 - 6.86
617
62 - 10.05
746
74 9.91
Litter
39
9 - 23.07
42
15-35.71
112
32-28.57
94
34 - 36 17
111
39-36.14
171
31-18.13
Hatchery swabs
182
7-3.85
268
15 - 5.60
311
101
11 - 3.53
The Hydro-meteorological reports also show rainfalls of totally 110 to 150% of the average values
(taken from the period between 1961 and 1990) in most parts of Serbia, and the percentile
distribution was rainy, very rainy and extremely rainy. The rainfalls were extremely rainy in all
regions. During the selected years (2000, 2010 and 2014) average outer temperatures were high
throughout the whole year. The rainfalls, watery alluvium and relative humidity of air, were
significantly higher than usual. In order to survive and reproduce, fungi need certain humidity and
temperature level which is around and higher than 37C (De Bey etal., 1995; Karwowska, 2005;
Gigli et al., 2005; Sajid et al., 2006; Chate and Bhivgade, 2010).
The distribution of the aspergillosis outbreaks is influenced by some geographic and seasonal
differences, so it is more frequent in areas with high outer temperature and rainfalls (De Bey et al.,
1995; Karwowska, 2005; Madscn , 2006; Sajid et al., 2006). On the other hand, during winter, due
to inadequate environmental conditions and the fact that sometimes it is impossible to provide
optimal ambient for poultry, aspergillosis incidence increases. Some daily aberrance in the number
of Aspergillus in poultry houses was determined by Nayak et al. (1998). In our country, aspegillosis
outbreaks are more frequent in areas northern from the rivers Sava and Danube.
Microflora in poultry houses and farms in general, in our case the "population" of Aspergillus sp.,
contributes to the emission of biosol into atmosphere, especially during the warmer months
(Karwowska, 2005). The concentration of unwanted and potentially harmful gasses, dust, bacteria
and fungi in poultry house are changes depending on the age of poultry, particularly in broiler
chickens (Vuemilo et al., 2007). The air pollution impacts the health and productivity of poultry
(Nei et al., 2005). Also, certain species of fungi have toxinogenic and allergenic features so they
can disturb the health of people, either directly, in case of farmers, or in case of the rest of the population, indirectly, after emission into atmosphere (krinjar et al., 2009; Chate and Bhivgade , 2010).
It seems to be necessary to create and implement standards for adequate hygiene, epizootiological
and epidemiological conditions on farms and their environment.
Conclusions
The global warming and high relative humidity induced increase of incidence of some diseases,
including aspergillosis.
Poultry is constantly exposed to Aspergillus sp. in its environment, so high contamination and long
exposal contributes to clinical aspergillosis.
The success of therapy basically depends on the source of disease and degree of dissemination of
process. In acute cases, particularly in very young chickens, it would be wrong to rely on antifungal
therapy solely. Implementation of sanitary-hygiene measures in poultry houses and hatcheries, as
well as microbiological control of feed, is essential for prevention of significant losses.
Acknowledgement
This paper is a result of the research within the project TR 31071, financed by the Ministry of
Education, Science and Technological Development, Republic of Serbia
References
1.
2.
Akan M., Hazrolu R., Ihan Z., Sareyypolu B., Tunca R.: A case of Aspergillosis in a broiler breeder
flock. Avian Diseases, 46, (2): 497-501, 2001
Beytut E., Ozean K., Erginsoy S.: Immunohistochemical detection of fungal elements in the tissues of
102
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
goslings with pulmonary and systemic Aspergillosis. Acta Vetcrinaria Hungarica, 52, (1): 71-84, 2004
Cacciuttolo E., Rossi G., Nardoni S., Legrottag1ie R., Mani P.: Anatomopathological aspects of avian
aspergillosis. Veterinary Research Communications, 33: 521-527, 2009
Chate D. B., Bhivgade S. W.: Fungaldisease incidence inside poultry farm at ALISA. International
Referred Research Journal II, (15): 10-11, 2010
De Bey M. C., Trampel D. W., Richard J. L., Bundy D. S., Hoffman L. J., Meyer V. M., Cox D. F.:
Effect of environmental variables in turkey confinement houses on airborne Aspergillus and mycoflora
composition. Poultry Science, 74, 463-471, 1995
Femenia F., Fontaine J. J., Lair-Fulleringer S., Berkova N., Huet D., Towanou N., Rakotovao F., Granet
O. I., Le Loc'h G., Arne P., Guillot J.: Clinical, mycological and pathological findings in turkeys
experimentally infected by Aspergillus fumigatus. Avian Pathology, 36, (3): 213-219, 2007
Gigli A. C., Baracho M. S., Ns I. A., Silva R. A., Zago R., Dall'Anese F. P.: Diagnosis and evaluation
offungi presence in the air of two different ventilation systems for broiler houses. Revista Brasileira de
Ciencia Avicola, 7, (4): 205-208, 2005
Islam M. N., Rashid S. M., Juli M. S., Rima U. K., Khatun M.: Pneumomycosis in chickens: Clinical,
pathological and therapeutical investigation. International Journal of Sustainable Crop Production, 4,
(3): 16-21, 2009
Ivanov I.: Disinfection of eggs contaminated with some fungi and moulds. Trakia Journal of Sciences,
6, 98-101, 2008
Jacobsen I. D., Grosse K., Slesiona S., Hube B., Berndt A., Brock M.: Embryonated eggs as an
alternative infection model to investigate Aspergillus fumigatus virulence. Infection and Immunity, 78,
(7): 2995-3006, 2010
Kapetanov M., Potkonjak D., Stojanov I., ivkov-Balo M., Jaki S.: Importance of clinical and
pathological diagnostics of mycotoxicosis in fattening turkeys caused by T-2 trichothecene.
Proceedings, XV International Symposium Feed Technology, Feed to Food Cost Feed for Health Joint
Workshop Novi Sad, October 03-05, 2012, Novi Sad, Serbia, organized by Institute of Food
Technology, 2012, 304-309
Kapetanov M., Potkonjak D., Stojanov I., ivkov-Balo M., Jaki S.: Clinical and pathomorphological
diagnostics of mycotoxicosis in parent poultry flock caused by T-2 trychotecene. Matica Srpska Journal
for Natural Sciences, 124,137-143, 2013
Karwowska E.: Microbiological air contamination in farming environment. Polish Journal of
Environmental Studies, 14, (4): 445-449, 2005
Kozi L. I., Puha I. Eds.: Gajenje i zdravstvena zatita ivine. Odbor za izdavaku delatnost Saveza
veterinara i veterinarskih tehniara SFRJ, Beograd, 1967, 329-331.
Kristensen H. H., Wathes C. M.: Ammonia and poultry welfare: a review. World's Poultry Science
Journal, 56: 235-245, 2000
Kunkle R. A.: Fungal injections. In: Saif YM Ed., Diseases of poultry Ed. 11, Iowa State University
Press, Ames, 2003, 883-902.
Madsen A. M.: Exposure to airborne microbial components in autumn and spring during work at Danish
biofuelplants. The Annals of Occupational Hygiene 50, (8): 821-831, 2006
Martin M. P., Bouck K. P., Helm J., Dykstra M. J., Wages D. P., Barnes H. J.: Disseminated Aspergillus
flavus infection in broiler breeder pullets. Avian Diseases, 51, (2): 626-631, 2007
Mukaratirwa S.: Outbreak of disseminated zygomycosis and concomitant pulmonary aspergillosis in
breeder layer cockerels. Journal of Veterinary Medicine, 53: 51-53, 2006
Nayakv B. K., Nanda A., Behera N.: Airborne fungal spores in an industrial area; seasonal and diurnal
periodicity. Aerobiologia, 14: 59-67, 1998
Nei K., Mai Z., Sinovec Z.: Trovanja ivotinja izazvana sekundarnim metabolitima plesni.
Veterinarski glasnik, 59, (1-2): 41-57, 2005
Nichita I., Tirziu E.: Investigations on airborne fungi in poultry houses. Lucrari stiintifice Medicina
veterinara, XLI: 932-935, 2008
Regulations on the quality of animal feed: Official Gazette of the Republic of Serbia, 2010
103
104
________________________________________________________________________
Session 2
105
Invited lecture
GAME MEAT SAFETY WILD BOARS
Jelena Petrovi*, Milica ivkov Balo, ivoslav Grgi
1
Scientific Veterinary Institute Novi Sad, Rumenacki put 20, Novi Sad, Serbia
*Corresponding author: jelena@niv.ns.ac.rs
Abstract
Wild animal meat harvesting and processing is significantly different from classical livestock meat
production and represents a challenge by itself. Implementation of the concept "from forest to fork"
encompasses epidemiological difference between wild animals and livestock, influence of hunting
ground ecology, type of hunting, field evisceration of hunted game, meat inspection after shooting
or transport etc. The objective of this paper was to identify biological and chemical hazards
important for wild boar meat safety. Several hazards were analysed: Mycobacterium spp.,
Salmonella spp., Trichinella spp.,Toxoplasma spp., Alaria alata, microelements, and heavy metals.
Two criteria were established for hazards identification: evidence of shared pathogens presence in
wild boar population in specific geografical region and evidence of hazardeous pathogens spread
during handling, processing and consumption of wild boars meat. The research on the presence of
food borne pathogens in wild boars meat is still scarce, while the Trichinella spp. life cycle is
distinctly described and there are relevant data about epidemiology and natural reservoirs of the
parasite in this part of the Europe, however little is known about other food borne pathogens in wild
boar population. The presence of Salmonella spp., Toxoplasma gondii, Alaria alata is identified in
wild boar population in our region. The analysis of the results of the microelements and heavy
metals in wild boar meat has shown that no samples exceeded legally set limits, but our results
suggest that pollution of the biosphere with chemical contaminants should be systematically
monitored to identify potential increasing contamination tendencies. Programme for monitoring and
control of game meat safety should include control measures for live animals, control measures
during hunting and after shooting, guidelines for official meat inspection, control measures for
carcass processing and surveillance of chemical residues.
Keywords: meat, wild boar, food borne pathogens, microelements, heavy metals
Introduction
Wild boar (Sus scrofa) distribution covers the entire continental Europe; it is missing in British
Isles, Scandinavia and northern part of the European Russia. Wild boars in Serbia are native and
very abundant big game species. Excessive and irresponsible hunting resulted in demographic
decline in early 20th century. However, thanks to substantial changes of agricultural practice,
reduced number of natural enemies as well as game feeding policies in last four decades the game
population has recovered and is still increasing, not only in Serbia but also around Europe (Rippa et
al., 2012).
Game meat production chain is substantially different from the conventional production of meat
from domestic animals, thus presenting an unique challenge. The concept from forest to fork
encompasses the effects of hunting ground ecosystems, type of hunting/shooting, evisceration in the
field, meat inspection after slaughtering, transportation etc. The risk assessment regarding
alimentary pathogens in wild boars implies elucidation of some basic issues, i.e., identifying the
epidemiological difference between domestic and wild animals and determining the criteria for
evaluating the safety of wild game meat.
106
When speaking of wild animals, the disease control measures encompass the control of the diseases
that are transmissible from wild to domestic animals or directly to humans. Potential negative
environmental impact of measures and actions taken to the purpose of disease control is a specific
issue within the program of wildlife disease control.The opinion that complete eradication of
infectious and zoonotic diseases among wild animal population is virtually impossible is nowadays
widely accepted.
Domestic animals are raised for food and food production in controlled conditions, thus undergoing
the range of measures for health status control and ante and post mortem examinations at slaughter.
Contrary to that, game undergoes only a post mortem examination. In that respect, information on
certain diseases or mortality rates is lacking as well as the veterinary treatment, specific laboratory
testing, etc., thus restricting the proper evaluation of animals health status and prevention of their
entrance into the food chain.
The food safety criteria for assessing the safety of wild game meat are still lacking. They represent a
complex food-safety issue, since the majority of criteria relies on the average daily food intake,
which is highly specific in wild animals. The majority of the population consumes minor amounts
of game meat, but small population consumes pretty large quantities of game meat. The average
consumption of game meat among hunters families is estimated to be some 4kg meat per person,
i.e., family member (Ramanzin i sar., 2010).
The objective of this paper was to identify biological and chemical hazards of importance for wild
boar meat safety. Moreover, control measures for particular hazards are described, too.
Mycobacterium bovis
M. tuberculosis is considered the most important biological hazard in large game. Among the
wildlife population of Europe, three animals are considered major hosts of tuberculosis: badger,
wild boar and deer from the subfamily Cervinae. Wild boar can act as a direct source of human
107
tuberculosis infection, as well as the reservoir of infection in domestic animals (Gortazari i sar,
2008). Transmission of tuberculosis to humans occurs mainly by inhaling infectious aerosols,
consuming raw milk and, though somewhat less frequently, by consuming meat products
originating from infected animals. Some literature reports described potential infection routes from
wild boars to humans, including contact via the raw meat (Ashford et al., 2001).
Some 90% of known-infected wild boars with tuberculosis manifest calcified granulomatous lesions
in the mandibular lymph nodes. Moreover, 60% of these animals have generalized tuberculosis, i.e.,
lesions in multiple organs, predominantly in the head, thorax and abdomen. However, even
generalised tuberculosis in wild boar rarely causes visible loss of body condition (Martn-Hernando
et al., 2007). Hence, tuberculosis in wild boars is not manifested by specific clinical picture and
only the pathoanatomical examination can reveal suspect disease.
Wild boar tuberculosis has been reported in the last decades in at least 10 European countries:
Bulgaria, Croatia, France, Germany, Hungary, Poland, Portugal, Slovakia, Spain and the UK
(Gortzar et al., 2012). Wild boar experience much higher levels of exposure than deer (Vicente et
al., 2006). M. bovis prevalence in wild boar ranged from 46 to 52 % in three different surveys in
the Iberian Peninsula (Gortzar et al., 2008), where this host is considered the main carrier of
wildlife tuberculosis and a key factor in cattle tuberculosis eradication (Naranjo et al., 2008). In the
region of South Baka, three endemic foci of tuberculosis were recorded located in municipalities
of abalj, Novi Sad and Titel. The percentage of infected animals in individual herds ranged
between 11.10% and 59.18% (Pui et al., 2007; Pui et al., 2009; Pui et al., 2013). So far,
relevant data on the presence of tuberculosis in wild boars in this region are not available and the
research is ongoing. The occurrence of tuberculosis in cattle was recorded in the village of Kovilj
(the territory of Novi Sad municipality), which suggests potential contacts between wild and
domestic animals and thus presence of tuberculosis in wild game.
Eradication programmes in domestic animals rely on annual diagnostic examination of cattle using
the method of intradermal tuberculinization reaction, computed records and animal tracking, testing
positive herds and those who were in close contact with them at short intervals, and mandatory
slaughter of positive animals (Pui et al., 2008; Pui et al., 2009a,b,c). When speaking of wild
animals, the surveillance is practically impossible, so meat inspection is the only potential current
source of information and measure for control of tuberculosis.
Trichinella spp
Trichinellosis is endemic in almost all European countries, affecting also the regions of Srem and
river valeys of Danube, Drina and Kolubara in Serbia (Petrovi et al.,2012a). The analysis of
recorded trichinellosis epidemics in Vojvodina in the period 2001-2011 identified domestic pig as
the main reservoire of Trichinella. The infection is commonly acquired by consuming raw or
undercooked meat infected with living Trichinella larvae. Documented cases of human infections
after consuming wild boar meat were reported in Serbia (Uroevi et al., 2013). In Europe, wild
animals are considered the main reservoir of Trichinella, which makes the eradication of the
infection impossible in spite of its pretty low prevalence in wild game (Rafter et al., 2005).
According to Petrovi et al. (2012 a, b, c), high incidence of trichinellosis was established in the
territory of Vojvodina among several animal species such as jackals (7.89%), foxes (4.76%) and
wild boars (0.53%). In countries in which trichinellosis of domestic animals has been fully
eradicated, such as Danemark, the prevalence of sylvatic trichinellosis is extremely low (0.001%)
(Enemark et al., 2000). Moreover, an average infection rate in carnivores in Vojvodina (3
larvae/10g) is significantly higher than that recorded in Danemark (1 larva/10g). In some cases,
extremely high infection rates has been established in wild boars in Vojvodina region, ranging even
up to 1100 larvae/g (Petrovic et al., 2013a, b). High incidence of sylvatic trichinellosis in some
108
geographic regions poses substantial risk of infection spreading to domestic pigs grazed in sylvatic
habitats. The potential transmission routes of Trichinella spp. in pigs include canibalism, ingestion
of synanthropic and sylvatic animals as well as of the faeces of pigs that have been infected some 12 days earlier (Petrovi et al., 2014).
According to Petrovic et al. (2014), life cycle of T. spiralis in Vojvodina region includes circulation
from domestic pigs to wild boars and vice versa, which is assotiated with specific behaviour of this
animal species. Wild boars are very tolerant to the presence of humans, often commingling with
domestic pigs on common pastures and have access to laystall and food waste. Improper disposal of
pig carcasses and offals in the field, is the greatest risk factor for trichinellosis maintenance and
spread within pig population.
The diaphragms of all killed wild boars must be examined by artificial digestion method, for
estimating the presence of Trihinela spp larvae. This is the most effective measure for the control of
meat safety when speaking of this pathogen. However, it should be emphasized that appropriate
disposal of meat originating from infected animals represents an important step in preventing
further spreading of trichinellosis.
Salmonella spp.
Salmonella has long been recognised as an important zoonotic pathogen of economic significance
in animals and humans. Human salmonellosis is usually characterised by the acute onset of fever,
abdominal pain, nausea and sometimes vomiting. Symptoms are often mild and most infections are
self-limiting, lasting a few days. The common reservoir of Salmonella is the intestinal tract of a
wide range of domestic and wild animals, which may result in a variety of foodstuffs of both animal
and plant origin becoming contaminated with faecal organisms either directly or indirectly (EFSA,
2013).
Finding of Salmonella spp in wild boars has traditionally been associated with S. Typhimurium;
however, in the past few decades, the spectrum of serotypes isolated from carcasses, tonsils, faeces
and lymph nodes is much more diverse. Great differences in the prevalence of Salmonella spp. in
game were reported between individual species (e.g., the rates are higher in wild boars than in
ruminants) as well as between particular regions (e.g., higher prevalence rates were recorded in
southern countries of the EU) (Table 1). According to data reported by EU MSs in the framework
of the Zoonoses Directive (2003/99/EC) in 20042011, 1.1 % of deer, 11.1 % of reindeer, 18.3 % of
wild boar, 1.8 % of ostrich and 2 % of rabbit faecal samples were positive for this organism.
Salmonella was therefore shortlisted for risk ranking (EFSA, 2013)
Investigation of wild game pathogens in our country were mainly aimed at wild birds and other
enteropathogens (Stojanov et al., 2012; Velhner et al., 2012). The prevalence of salmonellas on wild
boar carcasses is relatively low, i.e. below 10% (unpublished data). Wild boars are more frequently
the carriers of Salmonella spp. than wild ruminants. Thus, an inadequate evisceration and/or bad
shot (e.g. shooting wound in abdominal region) increases the risk of meat contamination with
Salmonella spp. (Wisniewski, 2001).
Table 1. Prevalence of Salmonella spp. in wild boars in some European countries (Paulsen et al., 2012)
Animal species and sample
Country
Number of samples
Number of positive
samples
Italy
2365
441 (18.7%)
Portugal
Switzerland
77
73
17 (22.1%)
4 (5.5%)
109
There are few practical options for eradication of Salmonella and other zoonotic diseases in
wildlife, with the possible exception of vaccination or culling in geographically isolated areas.
Regulating animal density (to avoid crowding and overabundance), can contribute to disease
control; also, when game is eviscerated on the spot, the offal should be removed from wildlife
(Gortazar et al., 2006). However, there are no records indicating that such measures would have
successfully eradicated Salmonella in the wild.
In actual scientiffic literature there are no published recommendations (at least to our knowledge)
on Salmonella spp., control measures in live wild boars. Therefore it is important to control hygiene
during hunting, evisceration, bleeding and cleaning of carcasses, cooling and transportation,
coupled with sampling of processed carcasses for Salmonella spp. presence.
Toxoplasma gondii
T. gondii infection is common in animals and humans. T. gondii is an obligate intracellular
protozoan parasite. Nearly all warm-blooded animals can act as intermediate hosts, and almost all
animals may be carriers of tissue cysts of this parasite. However, the parasite matures only in
domestic and wild cats, which are the definitive hosts (EFSA, 2013). In pregnant women, the
parasite can cause congenital infections resulting in abortion, stillbirth, mortality and hydrocephalus
in newborns. The parasite can also cause severe disease in immune compromised individuals such
as organ graft recipients and individuals with AIDS or cancer (EFSA, 2013). In immune-competent
individuals, 8090 % of cases of T. gondii infection are asymptomatic and the majority of the
remainder result in only mild, self-limiting symptoms.
Common infection routes for wild boars include ingestion of oocysts from the environment,
ingestion of infected rodents and birds or cannibalism (Tenter et al., 2000). An interesting
observation was reported by Dubey et al (1992) suggesting significantly higher seroprevalence of
Toxoplasma among pigs raised outdoor than in those reared in conventional settings. The natural
production system is conducive for exposure of the pigs to various known risk factors for
Toxoplasma infestations such as cats (the definitive host) and other species that can be harbouring
cysts in their musculature as compared to the indoor conventional production system. In addition,
the outdoor environment with open access to soil, vegetation, and moisture allows viable
environments for Toxoplasma oocysts. The similar trend of higher seroprevalence of Toxoplasma
and Trichinella in outdoor-reared swine was reported in the Netherlands (van der Giessen et al.,
2007). The frequency distribution of Toxoplasma seroprevalence reported in Dubey et al (1992)
study ranged from 0.38% in intensive production to 5.62% in outdoor-reared system.
T. gondii is common in hunted wild boars in EU, where the seroprevalence has been reported to
vary between 8% and 38% (Lutz, 1997; Gauss et al., 2005; Antolova et al., 2007). The
seroprevalence in farmed wild boar has been reported to be 33 % (EFSA, 2007). Given the high
incidence in wild boar, this organism is significant hazard for wild boar meat safety.
Toxoplasmosis in animal commonly takes an asymptomatic course, which makes the diagnostics in
living animals impossible. To detect T. gondii infection in livestock, serologic assays can be
applied. With the exception of cattle, the presence of antibodies and tissue cysts is assumed to
correlate well. Meat or tissue samples can be tested by bioassay or PCR. T. gondii oocysts cannot be
differentiated from Hammondia or Neospora oocysts morphologically, thus molecular techniques
need to be applied. If infected meat is consumed without prior freezing or proper heating (core
temperature over 67 C) T. gondii can be transmitted. Salting, fermenting, drying, and smoking also
reduce tissue cyst viability, but the exact conditions needed to inactivate T. gondii are less wellestablished (Opsteegh et al., 2013).
110
Alaria alata
Alaria alata is a trematode parasite, and the transmission of this parasite occurs when humans eat
undercooked game or frog meat infected with the mesocercarial stage of this parasite. The
epidemiology of Alaria infection is not well-understood (Moehl et al., 2009a). The reported cases of
human larval alariosis are most likely due to mesocercariae from Alaria species other than A.
americana, but primates can be infested by A. americana (Moehl et al., 2009b). A study in
Germany (Riehn et al., 2012) found a high prevalence of A. alata in wild boar (11.5%). Although
specific methods for targeted detection of A. alata are available, its diagnosis is feasible during the
official Trichinella inspection in the competent veterinary inspection offices. Recent studies
conducted in the eastern parts of Austria indicated an overall prevalence of A. alata mesocercariae
in wild boar of 2%, when lean muscle (M. masseter) tissue was tested (Sailer et al., 2012) or 6.7%,
when a muscle fat tissue mixed sample was tested (Paulsen et al., 2012).
Jaki et al. (2002) and Grosse and Wste (2006) pointed out that the parasite represents a potential
source of infection for both humans and animals, and that consumption of wild boar meat can be an
important factor in the epidemiology of this zoonosis (Moehl et al., 2009b). However, to date, there
has been no report on human alariosis cases due to consumption of wild boar meat and thus Aaria
alata was ranked as hazard with low priority.
Chemical hazards
EFSA (2013) ranked chemical residues and contaminants on the basis of bioaccumulation,
toxicological profile and likelihood of occurrence, and they took into account the findings from the
NRCPs for the period 20052010. The ranking results were as following:
- No substances were classified in the high potential concern category for game.
- Within the category of medium potential concern for farmed game is cadmium.
- All other substances listed in Council Directive 96/23/EC was ranked as being of low or
negligible potential concern
- Potentially higher exposure of consumers to these substances from game meat takes place
only incidentally, as a result of mistakes or non-compliance with known and regulated
procedures.
The analysis of the results of the microelements and heavy metals in wild boar meat in Serbia (non
published data), has shown that no samples exceeded legal limits, but our results suggest that
pollution of the biosphere with chemical contaminants should be systematically monitored to
identify potential increasing contamination tendencies.
Conclusion
The absence of characteristic clinical picture is common to all aforementioned hazards, thus a
thorough post mortem examination for the presence of tuberculosis and artificial digestion to
confirm the presence of Trichinella but also Alarai alata is of outmost importance. However, some
hazards are not detectable by these procedures (Salmonella, Toxoplasma, chemical hazards) and
designing and implementation of appropriate hazard control programs is necessary.
The presence of alimentary pathogens and contamination of boar meat with chemical hazards in
Serbia has not yet been fully elucidated. While relevant data on Trichinella spp are available and
the mechanisms of the maintenance of its life cycle in our region are well known, the data on other
hazards are still unclear. A number of ongoing research-scientific projects in our country address
the prevalence of selected hazards among wildlife population with an aim of obtaining
111
Acknowledgement
This work was supported by the Ministry of Science and Technological Development of the
Republic of Serbia, grants TR 31084.
References
1. Antolova D., Reiterova K., Dubinsky P.:Seroprevalence of Toxoplasma gondii in wild boars (Sus scrofa)
in the Slovak Republic. Annals of Agricultural and Environmental Medicine, 14, 7173, 2007
2. Ashford D., Whitney E., Raghunathan P., Cosivi O.: Epidemiology of selected mycobacteria that infect
humans and other animals. Rev Sci Tech. 20,1,325-337, 2001
3. CAC Codex alimentarius CAC/RCP58-2005. Code of hygienic practice for meat
4. Council Directive 96/23/EC
5. Dubey J., Gamble H., Rodrigues A., Thulliez Ph.: Prevalence of antibodies
to Toxoplasma gondii and Trichinella spiralis in 509 pigs from 31 farms in Oahu, Hawaii. Veterinary
Parasitology, 43,12, 57-63, 1992
6. EFSA: Scientific Opinion of the Panel on Biological Hazards on a request from EFSA on Surveillance
and monitoring of Toxoplasma in humans, foods and animals. The EFSA Journal 583,164, 2007
7. EFSA: Scientific Opinion on the public health hazards to be covered by inspection of meat from farmed
game. The EFSA Journal 11,6,3264,2013
8. Enemark H., Bjorn H., Henriksen S., Nielsen B:. Screening for infection of Trichinella in red fox
(Vulpes vulpes) in Denmark Vet Parasitology 88, 3-4, 229-37,2000
9. Gauss C., Dubey J., Vidal D., Cabezon O., Ruiz-Fons F., Vicente J., Marco I., Lavin S., Gortazar C.,
Almeria S.: Prevalence of Toxoplasma gondii antibodies in red deer (Cervus elaphus) and other wild
ruminants from Spain. Veterinary Parasitology, 136, 193200, 2006
10. Gortazar C., Acevedo P., Ruiz-Fons F., Vicente J.: Disease risks and overabundance of game species
European Journal of Wildlife Research 52,8187,2006
11. Gortazar C., Torres J., Vicente J., Acevedo P., Reglero M., de la Fuente J., Negro J., Aznar-Martin J.:
Bovine tuberculosis in Doana Biosphere Reserve: the role of wild ungulates as disease reservoirs in the
last Iberian lynx strongholds. PLoS One,23,3,7:e2776. 2008 . doi: 10.1371/journal.pone.0002776.
12. Gortzar C., Delahay R., McDonald R.:The status of tuberculosis in European wild mammals. Mammal
Review, 42, 193206, 2012
13. Grosse K.,Wuste T.:Mesocercaria from Alaria alatadiscoveries at examination for trichinosis.
Fleischwirtschaft, 86, 106108, 2006
14. Jaksic S., Uhitil S.,Vucemilo M.:Mesocercariae of fluke Alaria alata determined in wild boar meat.
Zeitschrift Fur Jagdwissenschaft, 48, 203207, 2002
15. Lutz W.: Serological evidence of antibodies against Toxoplasma and Leptospira in wild boar. Zeitschrift
Fr Jagdwissenschaft, 43, 283287, 1997
16. Moehl K., Grosse K., Hamedy A., Wueste T., Kabelitz T., Luecker E.: Alaria alatainvestigations on
detection, prevalence and biology of a re-emerging parasite. International Journal of Medical
Microbiology, 299, 103103, 2009a.
17. Moehl K., Grosse K., Hamedy A., Wueste T., Kabelitz P.,Luecker E.: Biology of Alaria spp. and human
exposition risk to Alaria mesocercariaea review. Parasitology Research, 105, 115Naranjo V,
112
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
Gortzar C, Vicente J and de la Fuente J, 2008. Evidence of the role of European wild boar as a reservoir
of Mycobacterium tuberculosis complex. Veterinary Microbiology, 127, 19, 2009b.
Opsteegh M., Teunis P., Zuchner L., Koets A., Langelaar M.,van der Giessen J.: Low predictive value of
seroprevalence of Toxoplasma gondii in cattle for detection of parasite DNA. International Journal of
Parasitology, 41, 343354, 2010
Paz M., Hofle U., Vicente J., Ruiz-Fons F., Vidal D., Barral M., Garrido J., Funte J, Gortazar C.: Lesions
associated with Mycobacterium tuberculosis complex infection in the European wild boar. Tuberculosis
87, 4, 360-367,2007
Paulsen P., Smulders, F., Hilbert, F.: Salmonella in meat from hunted game: A Central European
perspective. Food Research International, 45, 609616, 2012a
Paulsen P., Ehebruster J., Irschik I., Luecker E., Riehn K., Winkelmayer R.,Smulders F:Findings of
Alaria alata mesocercariae in wild boars (Sus scrofa) in eastern Austria. European Journal of Wildlife
Research, 58, 991995, 2012b
Petrovi J., Pui I., Api J., Milanov D., Grgi ., orevi V., Matekalo-Sverak V. Silvatina
trihineloza - uloga divljih ivotinja u ciklusu irenja trihineloze u Srbiji. Veterinarski glasnik 66,3-4,175183,2012a
Petrovi J., Grgi ., ivkov-Balo M.: Molecular diagnostics of trichinella species: new data on
trichinella life cycle in Vojvodina region.Proceedings, Conference Meat and Meat Products Perspectives of Sustainable Production, Belgrade, 10th-12th June, 153-158, 2013a
Petrovi J., Doen R., Grgi ., Stojanov I., Milanov D.Zbornik radova u 11.Simpozijuma sa
meunarodnim ueem 'Zdravstvena zatita, selekcija i reprodukcija svinja'.98-98, 2013b
Petrovi J., Grgic Z., Pusic I., Urosevic M.: Sylvatic trichinosis in the Vojvodina region (Serbia). Trends
in game meat hygiene From forest to fork. Wageningen Academic Publishers, AE Wageningen, The
Netherlands, 175-181, 2014
Pui I., urii B., Bugarski D., Prodanov J., Santra V.: Epizootioloke karakteristike tuberkuloze
goveda u koviljskom ritu. IX epizootioloki dani sa meunarodnim ueem, Poarevac 28-31.03.2007
Zbornik radova i kratkih sadraja,135-137, 2007a.
Pui I., urii B., Savi-Jeveni S., Prodanov J., Bugarski D., Grgi ., Milievi V.: Vrednovanje i
primena mycobacterium bovis gama interferon testa u dijagnostici tuberkuloze goveda. X epizootioloki
dani sa meunarodnim ueem, Tara 2-5. 04 2008. Zbornik radova i kratkih sadraja, 207-208,2008
Pui I., urii B., Milievi V., Grgi ., Prodanov J., Bugarski D.: Metode dijagnostike tuberkuloze
na ivim govedima. 8. kongres veterinara Srbije, Beograd, sa meunarodnim ueem, 15-19.09.2009.
Zbornik kratkih sadraja, Veterinarska medicina, ivot i zdravlje, 101-102, 2009a
Pui I., Laloevi D., Bugarski D., Prodanov J., Grgi ., Uroevi M., Lupulovi D.: Epizootioloke
karakteristike tuberkuloze goveda u Junobakom okrugu. Arhiv veterinarske medicine, ISSN 18209955, 55-63, 2009b
Pui I., Milievi V., Savi S., Prodanov J., Grgi ., Bugarski D., Stojanov I.: A preliminary trial to
evaluate the gamma-interferon assay for the detection of tuberculosis in cattle under local conditions in
Serbia. Lucrari stiintifice, ISSN 1221-5295, 125-130, 2009c .
Pui I., Prodanov-Radulovi J., Ratajac R., Stojanov I., Uroevi M., Mari D.: The use of different
diagnostic techniques in cattle tuberculosis eradication. II International Symposium and XVIII Scientific
Conference of Agronomists of Republic of Srpskam March 26-29, 2013, 372-373, 2013 .
Rafter P., Marucci G., Brangan P., Pozzio E. 2005. Rediscovery of Trhichinella spiralis in red foxes
(Vulpes vulpes) in Ireland after thirty years of oblivion. J. Infect., 50, 61-5,2005
Ramanzin M, Amici A, Casoli C et al. Meat from wild ungulates: ensuring quality and hygiene of an
increasing resource. Italian Journal of Animal Science 2010; 9:e61doi:10.4081/ijas.2010.e61
Regulations (EC) 853/2004 i 854/2004
Rippa, D., Maselli, V., Di Donato, S., Salvioli, L.,Liguori, A.,Ligrone, R., Fulgione, D.: Efekti razliitog
lovnog gazdovanja na genetsku strukturu populacije divlje svinje u junoj Italiji. Meunarodni
simpozijum o lovstvu, Savremeni aspekti odrivog gazdovanja populacijama divljai Zemun-Beograd,
Srbija, 22. 24. jun, 2012. UDK:351.823.1:65.012.32
113
114
Invited lecture
THE DETERMINATION OF THE QUALITY IN CEREAL SILAGES SUPPLEMENTED
WITH PUMPKIN AND CARROT
Milica Zivkov-Balos1, Sandra Jaki1, Milovan Jovicin1
1
Abstract
The aim of this work was to evaluate the nutritional composition of silages based on the cereals
supplemented with carrot as well as pumpkin. For the ensilage, the following combinations of raw
materials were used: whole corn plant and carrot, oat grits and carrot and corn grits and pumpkin.
Determination of moisture, fat, crude fiber, ash, calcium and phosphorus in the samples was
performed by standard methods, while the protein was analyzed by measuring total nitrogen by total
combustion (according to Dumas). Content of mineral matters was measured applying the atomic
absorption spectrometry. The results obtained from this research reveal that cereals silages
supplemented with pumpkin and carrot can be considered a good source of nutrients.
Key words: silages, cereals, pumpkin, carrot, dairy cows
Introduction
Plant species that are suitable for silage have a higher dry matter yield in the field and higher
digestibility, low buffer capacity and a higher amount of water-soluble carbohydrates. Whole plant
maize silage is used worldwide in the rations for cattle. However, -carotene content in maize
silage, which is a popular main feed for dairy cows, is very low. The majority of feeds for dairy
cows contain low levels of -carotene (Nozire et al. 2006). The contents of -carotene in grass
vary depending on the plant species and growth stage. The highest levels of -carotene in pasture
grass, maize, alfalfa, etc. are found in young plants and their content decreases with plant ageing.
Plant carotenoids are transferred to the products of animal origin with the different absorption rates.
Thus, egg yolk demonstrates high absorption rate, whereas carotenoids transfer is somewhat less
pronounced in ruminants and affects the colour of milk and dairy products and body fat as well.
Consumers mostly assess the initial quality of animal products according to its colour, though their
preferences regarding the colour and thus the acceptability of milk and dairy products differ
between the countries and even between the regions in one country. Yellow colour of milk and
dairy products is often associated with grass-feeding systems, which are considered natural in
most countries. Thus, the carotenoids content in milk can be considered an indicator of pasturebased farming (Nozire et al., 2006).
The only natural source of vitamin A for ruminants is that occurring by -carotene cleavage and
its absorption by enterocytes and, to some lesser extent, as the product of liver metabolism. To that
end, adequate -carotene content in the colostrum is a prerequisite for providing adequate levels of
vitamin A (-carotene). Furthermore, its absorption by the enterocytes is of vital importance for calf
development (Kaelawmun et al., 2011). Peripartal period in dairy cows is highly stressful period
associated with intensive physiological changes and metabolic adaptation during pregnancy period
and lactation. The energy requirements increase because of accelerated foetal growth and milk
production. This period is characterized by increased immunosuppression and thus higher
susceptibility to disease. Metabolic changes are associated with rapid foetal growth, parturition and
115
inducing of lactation, which results in increased generation of free radicals. When the production of
free radicals exceeds the antioxidant defence mechanisms of the body, the cow is in oxidative stress
(Kaelawmun et al., 2011). Oxidative stress is an important factor contributing to disease
susceptibility. -carotene as an antioxidant can affect the functionality of hosts immune system
through its positive effects on membrane fluidity (Chew and Park, (2004); Tjoelker et al., (1988,
1990)). Chawla and Kaur (2004) reported that -carotene supplementation to cows in drying off
period is required to improve the antioxidative plasma status and overall health status post partum,
to improve the milk production and quality, and to reduce the incidence of mammary infections.
Kawashima et al. (2010) reported that -carotene supply improved embryo production and quality
in super ovulated cows. Among the role of retinol in ruminants, as in other mammals, its influence
on reproduction has been extensively studied. Retinol deficiency may reduce reproductive
efficiency in dairy cows, especially through impaired ovarian function and increased incidence of
abortion (Hurley and Done, 1989). Retinol is also involved in various functions, such as vision,
growth and male fertility. In addition, the conversion rate of -carotene to vitamin A in granulose
cells has been enhanced by follicular growth, and intrafollicular concentrations of vitamin A
correlated positively with those of estradiol and follicle diameter (Schweigert et al., 1987).
Some crops, which are used as feed alternative for domestic animals, are rich sources of this
vitamin precursor. In our region, carrot and pumpkin can be considered alternative cultures and
good sources of vitamin A and -carotene for cattle. The use of agricultural residues and surplus
products as well as alternative crops is often a useful way of overcoming the shortage of animal
feedstuffs and has been intensively addressed by some recent researches and projects worldwide.
Agricultural surplus, low purchase price of agricultural products and inability of selling the products
on the market result in the disposal and loss of substantial amounts of agricultural products.
Carrot is good source of carotene, but it conteins also xanthophyll, though in some lesser amounts.
At the food market, the carrots of poor quality (some 22% of total production) are returned to the
producers mainly because of undersize, deformity, breakage or root diseases/infection. The rejected
crops that are returned to the supplier are considered goods of poor economic value and are used
rather as animal feed than the source of carotenoids. Potential way of using the health-nutritional
components of rejected crops and thus increasing their economic value is their application in
organic egg production (Hammershj et al., 2010). Carrots have become a common animal feed in
egg production in Danemark. In the U.S., carrot root has been used in cattle breeding as the winter
feed for dairy cows, in the production of yellow-colour butter and cream (Watson, 1994). Some
novel researches indicated that carrot supplementation to the diet of dairy cows increases the
content of vitamin A and lactic acids in milk (Nalecz-Tarwacka et al., 2003).
Beside for human consumption, pumpkin (especially some particular varieties) is used as animal
feed. Flashy and cellulose portions of pumpkin are one of the most important edible agricultural
residues (Razzaghzadeh et al., 2007). In the U.S., pumpkin varieties are grown as decorative plants
as well as for human nutrition. Pumpkins with spots or blemish as well as those broken or damaged
during harvesting are discarded as inacceptable for the market. Moreover, after October 31
(Halloween), the demand for decorative pumpkins decreases, thus substantial amount of the crops is
left in the fields. Some farmers use pumpkin fields for grazing (in combination with maize-stalk),
but in general, very little information is available on the nutritive value of pumpkin in cattle
nutrition. Some researches pointed out that pumpkin is good source of energy with adequate protein
content for the cattle (Jenkins, 2010).
It is to be emphasized that including of these alternative crops into the diet for dairy cows could
contribute to the increase of organic milk production in line with the basic principles of organic
production. Organic milk production is based on organic principles and objectives including
naturalness and recycling of nutrients. According to current regulations, the feed used in organic
milk production must be 100% organic-grown (EC, 1999). However, the integrity of organic
116
production could be further enhanced if frequent use of vitamin supplementation with artificial fatsoluble vitamins is substituted by vitamins from natural sources (Mogensen et al., 2012).
Preservation of alternative crops
Carrot and pumpkin are highly moist materials. Although these materials have nutritive value, they
are difficult to incorporate into a commercial feeding program because of preservation problems.
This means that these need to be treated for storage if they are to be made available as a feed
resource during lean season. Ensiling can be considered as a method for making use of wet raw
materials more effectively. Prior to silage making, drying and chopping are also required, which
makes the method somewhat expensive and cumbersome for farmers.
Silage making involves harvesting crops by mechanical harvester, usually with considerable
reduction of the size of particles, which accelerates the release of plant cell contents. The harvested
materials are placed in a silo, which is sealed to produce anaerobic conditions. The silo is opened
after several weeks or months and the silage is removed for use as feed. Preservation of ensiled
materials is achieved by the conversion of plant water-soluble carbohydrates glucose, fructose,
fructans and sucrose to organic acids, principally lactic acid. There is also a variable degree of
degradation of proteins to amino acids and other nitrogenous compounds (Wilkinson, 1999).
The advantages of ensiling alternative crops and root crops include (Moran, 2005):
Another aspect of using carrot and pumpkin in cattle nutrition that is to be emphasized is the fact
that using agricultural surplus products for animal feed is a specific recycling process, since such
surplus, when accumulated, can cause environment pollution and increased costs of waste disposal.
The basic aim of these researches was finding new options for balanced livestock diet avoiding the
competition with human nutrition, and thus changing the perception of economic value of food.
Using alternative crops as animal feed can provide competitive alternatives to traditional feed
sources and potentially reduce the expenses and impact on the environment. At the same time,
agricultural surplus products should be used with an aim of increasing the self-sufficiency and
stability of food supply. Such raw materials can be used not only as the source of nutrients for
ruminants but also as the substitute for commercial and imported feeds, which leads to further
savings in energy and transportation. Moreover, potential harmful environmental effects of waste
incineration, i.e., landfills for plant material surplus are greatly reduced.
The aforementioned strongly suggests the soundness and necessity of our research that was aimed at
alternative crops and agricultural surplus products from our region, which could be used as feed for
dairy cows and an alternative to synthetic vitamin A and -carotene in organic milk production.
Materials and Methods
Material:
For ensilaging, the following combinations of raw materials were used:
117
Dry matter
Organic matter
Crude Protein
Crude fat
Crude fiber
Crude ash
(DM)
(OM)
(CP)
(EE)
(CF)
(CA)
1
27.58 4.50
95.29 4.44
9.32 0.36
1.20 0.23 23.86 1.73 4.71 0.06
2
53.02 5.59
96.72 5.12
13.45 0.59
0.79 0.30 10.49 1.02 3.28 0.65
3
55.13 1.79
89.70 3.60
8.11 0.28
0.54 0.02 8.98 0.13 10.30 1.82
Sample No: 1. whole corn plant and carrot; 2. oat grits and carrot; 3. corn grits and pumpkin; Results are
presented as meansSD.
118
The CP content was 2.29-2.84% on fresh matter basis (average 9.32% in DM) in silage of whole
maize plant and carrot, 7.13-7.52% (average 13.45% in DM) in silage of carrot and oat grits and
4.19-4.75% (average 8.11% in DM) in silage of maize grits and pumpkin (Table 1). Our results of
silage CP were in between the results of other authors. Demirel et al. (2011) noted that silages of 12
maize hybrids have CP content from 4.07-6.91% in DM. Kamalak et al. (2002) findings revealed
the content of CP from 8.5 to 9.6% for control and transgenic maize varieties. The effect of stage of
maturity on the ensiling properties of whole crop maize was studied under laboratory conditions.
The CP content decreased from 80 to 58 g/kg DM (Filya, 2004). Vranic et al. (2008) reported that
the CP content in samples of maize silage for dairy cows nutrition, was 61.6 g CP / kg DM. Similar
findings (68.72 g/kg DM) were reported by orevi et al. (2009). Carrots have 85-90% moisture
content and about 10% crude protein in dry matter (Rust and Buskirk, 2008). Carrot silage has 27.1
% of DM and 13.8% of CP (Laflamme, 1992). Content of proteins in pumpkins (carving and pie
pumpkins) is 14.3-14.4% in DM (Jenkins, 2010) and 16% (Davis et al., 2012).
The CF content in silages changed from 4.82 to 8.45% on fresh matter basis (8.98-23.86% in DM).
The highest content of CF has been established in vitaminized silage of whole maize plant and
carrot, and the lowest in vitaminized silage of maize grits and pumpkin. Our results are in
compliance with the results of other authors. Demirel et al. (2011) established CF content in maize
silages ranging between 17.96 and 27.28% DM. orevi et al. (2009) reported that the content of
CF in DM of whole plant maize silage is 17.65%, whereas Galila et al. (2012) reported the content
of CF in maize stalks, after the process of fermentation (that lasted 28 day), ranging between 24.54
and 27.20%. Carrot root contains 8.1-12.1% crude fibre in DM (Nonaka et al., 1994). The carrot
roots and carrot heads contain 9.1% and 18.1% of CF, respectively (Davis et al., 2012). Fresh
pumpkin (Cucurbita sp.) contains averagely 13.2% CF in DM (Enishi et al., 2004).
Ether extract (EE) ranged between 0.54% and 1.20% DM. Our silage results were lower than the
results of other authors. The maize silages EE content changed from 2.68% to 4.40% in DM
(Demirel et al., 2011). Djordjevi et al. (2009) reported that EE content in dry matter of maize
silages is 8.76%. EE content in carrot is on average 1.0% (0.2-1.9%) in DM (Nonaka et al., 1994).
Fresh pumpkin contains about 2.8% of crude fat in DM (Enishi et al., 2004).
The CA content in silages changed from 3.28 to 10.30 % in DM. Highest ash content was measured
in the silage of whole maize plant and pumpkin as a consequence of higher proportion of maize
stalks in the silage. Fresh pumpkin contains about 2.8% of crude fat in DM (Enishi et al., 2004). CA
in whole plant maize silages changed from 4.64 to 7.94% in DM (Demirel et al., 2011). According
to the report of Djordjevi et al. (2009), CA content in dry matter of maize silages is 5.04%. Filya
(2004) reported CA contents in maize silages in different stages of fermentation ranging 4.0213.57% in DM. The average CA content in carrot is 7.4% (3.1-10.4%) in DM (Nonaka et al., 1994).
Enishi et al. (2004) reported that fresh pumpkin contains about 7.9% CA in DM.
Calcium (Ca) and phosphorus (P) content in investigated silages is displayed in Table 2. The
chemical analysis revealed abundant amounts of these essential macro elements for animal nutrition
on DM basis ranging between 900-4300 mg/kg (Ca) and 1600-2200 mg/kg (P). The highest content
of Ca was measured in vitaminized silage made of whole maize plant and carrot. Calcium content
in whole maize plant is 800 mg Ca/kg DM (Galila et al., 2012). The average calcium and
phosphorus contents in fresh carrot roots are 3800 mg/kg and 2900 mg/kg DM, respectively
(Nonaka et al., 1994). Idi et al. (2005) reported Ca and P contents in dry matter of carrot of 0.36%
and 0.26%, respectively. The pumpkin Ca and P contents are averagely 3900 mg/kg and 2600
mg/kg in DM, respectively (Enishi et al., 2004). Hashemi and Razzaghzadeh (2007) reported Ca
and P contents in dry matter of silages from Cucurbit residues of 0.94% and 0.09%, respectively.
The DM mineral content of our silages was within the range of average values reported by other
authors. The variability in the contents of mineral elements in plants results from a number of
119
factors, such as plant species, soil properties and application of agro technical measures (ivkovBalo et al., 1999). Macro- and microelements analyses of soils, feed (alfalfa and maize) and food
(wheat) indicated a high variability in the contents of these elements between some locations in
Vojvodina Province (ivkov-Balo et al., 2000, 2011).
Table2. Mineral content of vitaminized silages (on dry matter basis)
Mineral,
unit of measure
Calcium, %
0.36-0.43
0.09-0.13
0.13-0.16
Phosphorus, %
0.18-0.22
0.21-0.26
0.14-0.18
Manganese, mg/kg
47.1-61.3
2.1-10.3
7.6-8.9
Zinc, mg/kg
22.8-24.3
18.7-20.4
15.4-19.8
Coper, mg/kg
30.8-31.2
7.2-7.9
4.5-21.6
Iron, mg/kg
126.9-147.6
70.5-95.1
99.8-111.2
Magnesium, mg/kg
2175-3912
754.-802
805-898
Natrium, mg/kg
798-1131
660-753
3283-17187
Type of vitaminized silage: 1. whole corn plant and carrot; 2. oat grits and carrot; 3. corn grits and pumpkin;
Results are presented as interval of variation
The highest manganese (Mn) levels were measured in the samples of maize silage (whole plant) and
carrot, being averagely 54.2 mg/kg of DM. This is significantly higher value as compared to that
reported by other authors. Thus, Demirel et al. (2011) reported Mn contents in samples of diverse
maize hybrids silage ranging from 4.09 to 6.16 mg/kg of DM. Blackwood (2007) stated that silage
made of whole plant maize contained 34.0 mg/kg Mn in DM. The content of Mn in carrot ranges
between 34.4 mg/kg DM in the root and 198 mg/kg in leaves (Intawongse and Dean, 2006). The
results of their investigation showed that uptake of some microelements by plants corresponded to
the increasing level of soil contamination, and that soil-to-plant transfer factor values decreased
from Mn>>Zn>Cd>Cu>Pb. Higher manganese contents in our samples are most probably due to
the high soil Mn levels. The highest zinc (Zn) levels were determined also in silages based on whole
maize plant and carrot. Our results on zinc levels correspond with the results of other authors
(Demirel et al., 2011; Intawongse and Dean, 2006). Iron contents in the examined samples of
vitaminized silages were within the range of available literature data. Vitaminized silages,
particularly those based on pumpkin pulp and maize grout, are very rich in sodium and magnesium.
The most important attribute of these silages is their richness in vitamins and -carotene. The
average content of this provitamin in maize and carrot based silages was about 386.60 mg/kg.
According to the data from the literature, the level of -carotene in maize ranges from 24 to 35
mg/kg, whereas average -carotene contents in green grass, dry forages, silages and hay are 196,
159, 81 and 36 mg/kg, respectively (Noziere et al., 2006).
Total 8 sera of cows from two production groups, i.e., cows in late pregnancy and recently calved,
were tested before and during feeding vitaminized silage made of maize (whole plant) and carrot
(Table 3.).
120
Elevated contents of -carotene were measured in the blood of all cows fed vitaminized silage
based on maize and carrot. Such high levels of -carotene in vitaminized silage, that is, blood sera
of the cows, contributed to improved production results and significantly reduced administration of
veterinary drugs.
Table 3. The content of -carotene in blood serum before and during feeding vitaminized silage
Characteristic
Reference value
Sample No.
1.
2.
3.
4.
n=4
SD=
SD=
Sample No.
1.
2.
3.
4.
n=4
Content of -carotene
winter 2.79-9.30; summer 9.30-27.90
The values in samples before feeding
vitaminized silage
7.22
8.23
7.59
7.98
7.76 0.44
The values in samples during feeding
vitaminized silage
36.83
28.64
42.59
36.07
36.03 7.01
Conclusions
Vitaminized silages based on grains, carrot and pumpkin that were used in the present experiment
were assessed to be of good quality. With regard to their nutritional composition, the investigated
vitaminized silages are potential resource to be used in bovine diets. Vitaminized silages based on
grains, carrot and pumpkin ensure good results in cattle reproduction and better milk yield. The
entire technological process is designed to provide highest level of preserving the quality and
nutritive properties of feed. The selected alternative crops are widely grown in the territory of
Serbia and do not require any substantial economic investments, which guarantees a sustainable
production of safe organic food of animal origin and satisfactory production outcomes without
significantly affecting the farming technology.
Acknowledgments
The research was financially supported by the Ministry of Education, Science and Technological
Development of the Republic of Serbia (Project No TR31071)
References
1.
2.
3.
Blackwood, I.: Mineral content of common ruminant stockfeeds, crops and pastures. Primefact 522,
September Livestock Officer, Extensive Industries Development, Paterson, 2007.
Chawla R., Kaur H.: Plasma antioxidant vitamin status of periparturient cows supplemented with tocopherol and -carotene. Anim. Feed Sci. Tech., 114, 279-285, 2004.
Chew B.P., Park J.S.: Carotenoid action on the immune response. J. Nutr., 134, 257-261.
121
Demirel R., Akdemir F., Saruhan V., Sentrk Demirel D., Akinci C., Aydan F.: The determination of
qualities in different whole-plant silages among hybrid maize cultivars. African Journal of Agricultural
Research, 624, 5469-5474, 2011.
5. Davis C., Wiggins L., Hersom M.: Utilization of Cull Vegetables as Feedstuffs for Cattle.
http://edis.ifas.ufl.edu/pdffiles/AN/AN28000.pdf
6. Djordjevi N., Grubi G., Levi J., Sredanovi S., Stojanovi B., Boikovi A.: The quality of silages
from lucerne, whole maize plant and maize cobs prepared with various additives. Proceedings of XIII
International Symposium Feed Technology Symposium FEDD-TO-FOOD/1st Workshop FP/REGPOT3, Novi Sad, Serbia, 2009, 146-152.
7. EC: Regulation No 1804/1999 from European Commission, supplementing regulation No 2092/91,
1999.
8. Enishi O., Yoshioka T., Nakashima K.., Saeki M., Kawashima T.: Analysis of in situ ruminal digestive
characteristics and nutritive value of pumpkin and carrot juice residue for ruminant feeds. Grassland
Sci., 50, 4, 360-365, 2004.
9. Filya I.: Nutritive value and aerobic stability of whole crop maize silage harvested at four stages of
maturity. Animal Feed Science and Technology, 116, 141150, 2004.
10. Galila A.M.A. Darwish, Bakr A.A., Abdallah M.M.F.: Nutritional value upgrading of maize stalk by
using Pleurotus ostreatus and Saccharomyces cerevisiae in solid state fermentation. Annals of
Agricultural Science, 57 (1) 47-51, 2012.
11. Hammershj M., Kidmose U., Steenfeldt S.: Deposition of carotenoids in egg yolk by short-term
supplement of coloured carrot (Daucus carota) varieties as forage material for egg-laying hens. J Sci
Food Agric, 90: 11631171, 2010.
12. Hashemi R., Razzaghzadeh S.: Investigation on the Possibility of Ensiling Cucurbit (Cucurbita pepo)
Residues and Determination of Best Silage Formula. Journal of Animal and Veterinary Advances, 6
(12), 1450-1452, 2007.
13. Horrocks R.D., Vallentine J.F.: Harvested Forages. Academic Press, San Diego, 426, 1999.
14. Hurley W.L., Doane R.M.: Recent developments in the roles of vitamins and minerals in reproduction.
J.Dairy Sci. 72, 784804, 1989.
15. Idi A., Permin A., Christensen J.P., Steenfeldt S., Engberg R.M., Fink M.: Effect of carrots and maize
silage on colinization of hens by Ascaridia galli and Salmonella enterica servoar Enteritidis.
Helminthologia, 42 (3) 121-131, 2005.
16. Intawongse M., Dean R. J : Uptake of heavy metals by vegetable plants grown on contaminated soil and
their bioavailability in the human gastrointenstinal tract. Food Additives and Contaminats, 23 (1), 3648, 2006.
17. Jenkins H. K.: Feed Value of Alternative Crops for Beef Cattle. NebGuide, Index: Beef Feeding and
Nutrition, G2036, University of Nebraska-Lincoln Extension, Institute of agriculture and Natural
Resources, 2010.
18. Kaewlamun W., Okouyi M., Humblot P., Remy D., Techakumphu M., C. Duvaux-Ponter C., Ponter
A.A.: The influence of a supplement of -carotene given during the dry period to dairy cows on
colostrums quality, and -carotene status, metabolites and hormones in newborn calves. Animal Food
Science and Technology, 165, 31-37, 2011.
19. Kaewlamun W., Okouyi M., Humblot P., Remy D., Techakumphu M., C. Duvaux-Ponter C., Ponter
A.A.: Effects of a dietary supplement of -carotene given during the dry period on milk production
and.circulating hormones and metabolites in dairy cows. Revue Md. Vt., 163, 5, 235-241, 2012.
20. Kamalak A., Grbz, Y., Finiaayson, H.J. (2002). Comparison of in vitro DM degradation of four maize
silagesusing the Menke Gas Production method. Turk. J. Vet. Anim.Sci., 26, 1003-1008, 2002.
21. Kawashima C., Nagashima S., Sawada K., Schweigert F.J., Miyamoto A., Kida K.: Effect of -carotene
supply during close-up dry period on the onset of first postpartum luteal activity in dairy cows.
Reprod.dom. Anim., 45, 282-287, 2010.
22. Laflamme L. F.: Carrot/grass silage as cattle feed. Can. J. Anim. Sci, 72,441-443, 1992.
122
123
Invited lecture
MYCOTOXICOLOGICAL ASSESSMENT OF FEED IN SERBIA IN 2014 IN THE LIGHT
OF NEW LEGISLATION
Ksenija Nei1*, Sandra Jaki2, Milica ivkov-Balo2, Bojana Pruni2
1
2
Abstract
Under favorable environmental conditions, when temperature and moisture are suitable, fungi
proliferate and may produce secondary metabolites well known as mycotoxins. They commonly
enter the food chain through contaminated food and feed crops, mainly cereals, which get infested
prior to and during harvest, or during (improper) storage. But neither all molds are toxigenic, nor all
secondary metabolites are toxic. Therefore, although more than 300 mycotoxins have been isolated
and chemically characterized, worldwide research has focused on those forms causing significant
injuries to humans and animals. There is a small number of toxins that are of practical relevance, as
well as small number that has been officially regulated. European Union and Serbian regulations
treat only several mycotoxins by giving maximal permitted limits in feed and food. Regarding feed,
recently revised directive was published in Serbia in March 2014.
The aim of this paper was to present the mycotoxicological assessment of feed in Serbia in 2014 in
the light of this newly established regulation. Here shown results indicate that mycotoxins are
present more than they used to be, so more attention has to be paid to this problem, especially
keeping on mind their global impact on food safety, with possible serious effects on animal and
human health. So there is strong need for preventive measures, as well as regular and
comprehensive monitoring of feed as important step for struggle and control of these natural
contaminants.
Keywords: feed safety, monitoring, mycotoxins, regulations
Introduction
Mycotoxins have globally significant human and animal health, economic and international trade
implications (Bryden, 2012). The supply of meat, milk and eggs, the human food of animal origin,
can be adversely affected by mycotoxins. This is followed by the impact on animal health and
production (Shier et al, 2005).
Fungi are ubiquitous and all feedstuffs can be contaminated with mycotoxins. Formation of
mycotoxins is not restricted to any component of the animal feed supply chain, but the level of
contamination varies with location and reects different agronomic practices and climatic
conditions, which dictate the fungi that are present in a farming system (Bryden, 2009).
The fungal species most often encountered with intoxications belong primarily to genera
Aspergillus, Fusarium and Penicillium. These moulds produce many different toxic compounds but
not all isolates of the same species produce toxins (Cole et al, 2003; Brase et al, 2009). The major
toxins produced by these three genera include: aatoxins, ochratoxins, trichothecenes, fumonisins
and zearalenone.
Fungi are a normal part of the microora of standing crops and stored feeds, but the production of
mycotoxins depends upon the fungi present, agronomic practices, the composition of the
commodity and the conditions of harvesting, handling and storage (Bryden, 2009). The amount of
124
toxin produced will depend on physical factors (moisture, relative humidity, temperature and
mechanical damage), chemical factors (carbon dioxide, oxygen, composition of substrate, pesticide
and fungicides), and biological factors (plant variety, stress, insects, spore load).
The accumulation of mycotoxins, both before and after harvest, largely reflects climatic conditions.
Fusarium toxins are produced in cereal grains during high moisture conditions around harvest
(Nesic et al, 2014), whereas pre-harvest aatoxin contamination of crops is associated with high
temperatures, insect damage and prolonged drought conditions. Moreover, because Aspergillus can
tolerate lower water activity than Fusarium, it is more likely to contaminate commodities both preand post-harvest, whereas Fusarium is more likely to be found as a contaminant pre-harvest
(Bryden, 2009). These examples demonstrate that although it may be convenient to describe fungi
as either pre- and post-harvest organisms, the actual colonisation and proliferation of fungi is not
clear cut but depends on the environmental and ecological circumstances and the resulting toxins
will differ accordingly.
Stored grain is not static as well. It is in a dynamic state and may become infested with fungi and
insects. These interrelationships are affected by climatic factors such as temperature and humidity,
by geographical location, by the type of storage container and by grain handling and transport.
Moisture depends mostly on water content at harvest, the amount of drying, aerating, and turning of
the grain before or during storage as well as the respiration of insects and microorganisms in the
stored grain. If provided grain is dry when placed in storage, moisture content can only rise from
leaks or condensation. Grain may go into storage at a uniform temperature but over a period the
grain mass will cool at a different rate in the centre than at the periphery. As a result of temperature
differentials moisture migrates through the storage bin, resulting in condensation and the provision
of ideal conditions for mould growth or the development of hot spots in localised areas. Microbial
and insect growth in stored grain also results in moisture condensation and the potential
development of hot spots. The minimum critical levels for the growth of fungi are 70150 g/kg
moisture (depending on commodity) and 8085% relative humidity. Temperatures at which toxin
production can take place vary from 0 C to 35 C, depending on fungal species. Most mycotoxins
are very stable chemically and once formed in a feedstuff will continue to contaminate that
commodity and feeds manufactured from it (Bryden, 2012).
However, the major problem associated with mycotoxin contamination of the animal feed supply
chain is not acute disease episodes but reduced animal productivity. Low level toxin ingestion may
cause an array of metabolic disturbances which may or may not be accompanied by pathological
change (Haschek et al, 2002). One of the rst indications of a chronic mycotoxicosis is growth
depression, which may result from reduced feed intake, impaired nutrient utilisation, changes in
feed quality or toxicity per se. Many studies have demonstrated that mycotoxin ingestion reduced
feed conversion efficiency and may reflect impaired nutrient utilisation. The perturbations of
metabolism that occur following mycotoxin ingestion may affect reproductive efficiency of both
males and females (Nesic et al, 2008) and in the pregnant animal, mycotoxins may disturb
embryonic and foetal development. Mycotoxins are immunomodulators, mostly
immunosuppressive and it has been shown they increase the susceptibility of animals to infectious
disease (CAST, 2003).
It is important to know the fate of mycotoxins after ingestion, as contamination of animal products
with mycotoxins or their metabolic products has signicant public health implications. In this
regard, transfer of aatoxin into milk and ochratoxin A into meat have been the issues of most
concern. Available evidence suggests that tissue accumulation of aatoxin or its metabolites is very
low and that residues are excreted in a few days. Animals are effective toxin eliminators with milk,
the animal product most likely to contain aatoxin residues. The hydroxylated metabolite of
aatoxins B1, aatoxins M1 is excreted into milk from 1 to 6% of dietary intake (Fink-Gremmels,
2008).
125
Ochratoxin A has been detected in blood, kidneys, liver and muscle tissue from slaughtered pigs in
several European countries. There are significant differences among pig and poultry tissue
deposition studies and this is presumably due to differences in absorption and metabolism of the
toxin. It has been shown that the half-life of ochratoxin A in pigs and chickens is 180140 h and
approximately 4 h, respectively (Petterrson, 2004).
Residues of other mycotoxins including zearalenone, trichothecenes and fumonisins are not
considered to be of public health importance as only very low levels of the toxins have been found
in the tissues of animals that had been fed very high levels of the toxins in experimental situations
(Petterrson, 2004). However, caution should be exercised when extrapolating or predicting tissue
residues as there is presently insufficient data on which to anticipate the outcome of any field
toxicosis. There are some reports of synergistic effects of different mycotoxins which suggest that
contamination of e.g. dairy rations with other mycotoxins, in particular ochratoxin, may decrease
the excretion of aatoxin B1 by dairy cattle (Bryden, 2012).
Keeping on mind worldwide impact of these natural contaminants on feed and food safety, with
possible serious effects on animal and human health, the aim of this paper was to present the
mycotoxicological assessment of feed in Serbia in 2014 in the light of actual legislation and to
highlight the need for greater attention focused on the prevention.
Results
Results of mycotoxicological examination of feed samples during the year 2014 showed low
presence of ochratoxin A (Table 1), as well as T-2/HT-2 toxin (Table 2).
While 25.4 % of 138 analysed samples were slightly positive, detected concentrations of ochratoxin
A were far below maximum permitted levels given in Serbian directive (Sl.glasnik RS, 27/2014),
which is more strict compared with the previous one (Sl.glasnik RS, 4/2010). Most of the values
were below the detection limits of the used ELISA protocols. The highest concentration of
ochratoxin was detected in the mixture for poultry and it was 0.0275 mg/kg.
Regarding T-2/HT-2 detection no comment could be given in respect of new regulation (Sl.glasnik
RS, 27/2014), as no limits are proposed here. But directive from 2010 (Sl.glasnik RS, 4/2010), that
is not valid since March 2014, prescribed levels of 1.0 mg/kg for adult pigs and poultry and 0.5
126
mg/kg for young animals. Both were high above determined concentrations. Maximal content of
0.143 mg/kg among 169 samples was discovered in feed for pigs.
With regard to aflatoxin crisis in 2013, special attention was paid to the presence of this group of
toxins. Therefore, the largest number of samples were examined, a total of 668. Overall results
(Table 3) indicated that aflatoxin was still there in 59.1 % of performed analysis with 5.1 % of
samples that exceeded limits permitted by now actual legislation (Sl.glasnik RS, 27/2014). The
largest content was quantified in the corn sample (0.0322 mg/kg) which was above regulated limit
of 0.03 mg/kg, but which would be tolerable according to previous permitted limit of 0.05 mg/kg
(Sl.glasnik RS, 4/2010). Generally, by the adoption of new Directive more stringent criteria for
allowable levels of aflatoxin were introduced, thereby specifying limits for B1 from group of
aflatoxins. During the whole year, decreasing trend of recorded concentrations of aflatoxin B1 was
noted, with very few positives at the end of the year.
Table 1. Ochratoxin A in feed samples
Type of feed
Number of
samples
Positives
[%]
Poultry
Pigs
Cattle
Corn
Silage
Sunflower meal
Wheat
OVERALL
27
62
4
39
3
1
2
138
29.6
30.7
0
20.5
0
0
0
25.4
Range of
concentrations
[mg/kg]
0.0037 0.0275
0.003 0.0182
< 0.002
0.0052 0.0153
< 0.002
< 0.002
< 0.002
0.003 0.0275
Mean value
[mg/kg]
0.0084
0.0096
< 0.002
0.0082
< 0.002
< 0.002
< 0.002
0.0087
Above
permitted
limits [%]
0
0
0
0
0
0
0
0
Maximum
permitted
level [mg/kg]
0.2
0.1
0.25
0.25
0.25
0.25
-
Number of
samples
Positives
[%]
Poultry
Pigs
Cattle
Corn
Wheat
OVERALL
38
77
5
48
1
169
39.5
26.0
20.0
18.8
0
26.6
Range of
concentrations
[mg/kg]
0.029 0.095
0.026 0.143
0.060
0.039 0.098
< 0.025
0.026 0.143
Mean value
[mg/kg]
0.0514
0.0546
0.060
0.0681
< 0.025
0.0585
Above
permitted
limits [%]
-
Maximum
permitted
level [mg/kg]
-
But, examining feed throughout 2014, while the situation with aflatoxin B1 turned down, the results
related to Fusarium toxins, zearalenone and DON, were changing and becoming more complex.
Over time more positive samples were found.
Results of zearalenone analysis are presented in Table 4. Among 165 samples in 51.5 % of them
certain concentrations were detected. The highest level of 2.389 mg/kg was found in corn, but there
were 4.8 % of samples with contamination above permitted level and all of them were for feeding
pigs.
Deoxynivalenol (Table 5.) was found in the highest percentage of analysed samples (64 %) and
11.4 % of them were highly contaminated, more than it was allowed by regulation (Sl. glasnik RS,
27/2014). As the most sensitive species, pigs were strongly affected and the largest mean value was
determined in feed for those animals (1.159 mg/kg), as well as the biggest number of inadequate
samples (27.3 %). Maximal detected concentration was found in the corn sample (12.242 mg/kg)
and 76 % of them were found positive, while all samples of wheat were also contaminated.
127
Number of
samples
Positives
[%]
Range of
concentrations
[mg/kg]
Mean value
[mg/kg]
Above
permitted
limits [%]
Poultry
189
73.0
0.0011 0.030
0.0037
7.9
Pigs
190
58.4
0.0011 0.024
0.0060
6.8
Cattle
103
59.2
0.0010 0.0082 0.0034
1.9
Lambs
23
30.4
0.0011 0.0072 0.0046
8.7
Premix and
39
71.8
0.0011 0.013
0.0038
0
additional mix
Corn
100
37.0
0.0010 0.0322 0.0065
2
Silage
14
71.4
0.0011 0.0013 0.0040
0
Sunflower
8
15.0
0.0020 0.0016 0.0063
0
meal
Wheat
2
50.0
0.0050
0.0050
0
OVERALL
668
59.1
0.0010 0.0322 0.0048
5.1
*Double permitted level: for young animals (lower level) and adult animals (higher level)
Maximum
permitted
level
[mg/kg]
0.005-0.02*
0.005-0.02*
0.005-0.02*
0.005
0.01
0.03
0.03
0.03
0.03
-
Number of
samples
Positives
[%]
Range of
concentrations
[mg/kg]
Mean value
[mg/kg]
Above
permitted
limits [%]
Poultry
14
28.6
0.046 0.249
0.145
Pigs
77
48.1
0.031 0.574
0.168
10.4
Cattle
9
77.8
0.067 0.593
0.258
0
Corn
52
53.9
0.063 2.389
0.309
0
Silage
8
100.0
0.062 1.542
0.494
0
Sunflower
2
0
< 0.025
< 0.025
0
meal
Wheat
3
33.3
0.083
0.083
0
OVERALL
165
51.5
0.031 2.389
0.243
4.8
*Double permitted level: for young animals (lower level) and adult animals (higher level)
Maximum
permitted
level
[mg/kg]
0.2-0.5*
1
6
6
4
4
-
Number of
samples
Positives
[%]
Range of
concentrations
[mg/kg]
Mean value
[mg/kg]
Above
permitted
limits [%]
Poultry
32
53.1
0.079 1.770
0.931
0
Pigs
66
63.6
0.079 5.852
1.159
27.3
Cattle
5
40.0
0.290 1.47
0.88
0
Corn
50
76.0
0.091 12.242
1.792
2
Silage
12
66.7
0.170 10.377
3.980
8.3
Sunflower
5
0
< 0.074
< 0.074
0
meal
Wheat
5
100.0
0.370 3.612
1.9
0
OVERALL
175
64.0
0.079 12.242
1.774
11.4
*Double permitted level: for young animals (lower level) and adult animals (higher level)
128
Maximum
permitted
level
[mg/kg]
5
0.9
2-5*
12
12
8
8
-
Discussion
Taking into consideration all these collected data, one fact cannot be neglected: mycotoxins are
more present than they used to be. In Serbia during previous years rare or strictly experimental
reports were given regarding this topic, which stayed captured in professional circles until the
attention of broad public was drawn to the case of aflatoxin in 2013, solely because of its presence
in milk (Kos et al, 2014). Also, in terms of aflatoxin presence in feed, situation was quite different
and very unlike years ago (Jakic-Dimic et al, 2010; Jakic-Dimic and Nesic, 2011). Most of the
analyses presented by Nesic and Pavlovic in early 2013, showed in 75 % of them significant
contamination, while as many as 35 % exceeded the maximum permitted levels, so did not
correspond to the Serbian regulation (Sl.glasnik RS, 4/2010). The highest percentage of
contaminated samples (100%) and also the maximal concentration (0.263 mg/kg) was detected in
feed for piglets, while 70 % of dairy mixtures were positive and 47.5 % over regulated level.
Extremely hot and dry conditions followed by drought were noted during maize growing season
2012 (Republic Hydrometeorological Service of Serbia, 2012), so aflatoxins occurrence in 68.5% of
samples harvested in 2012 could be contributed to weather conditions favourable for mould growth
and mycotoxins production (Kos et al, 2013). Comparing the results shown in Table 3 it can be
noted that the percentage of positive samples decreased in 2014, as well as detected aflatoxin
concentrations (the largest content was 0.0322 mg/kg quantified in the corn sample). Although
greater number of examinations done, only 5.1 % were above limits permitted by new legislation
(Sl.glasnik RS, 27/2014), which prescribed more strict criteria for aflatoxin. Approaching the end of
the year downward trend for this toxin had been increasingly apparent.
As aflatoxin crisis began to subside, the public interest in the problem of mycotoxins declined, but
not the problem itself. It has only modified in accordance with the new conditions of climate and
environment with lot of rain and moisture (Republic Hydrometeorological Service of Serbia, 2014).
Therefore, testing of maize and wheat during 2014, showed a large percentage of positives on
presence of new group, Fusarium mycotoxins: zearalenone and deoxynivalenol. Although these
moulds and their secondary metabolites are typical for our region, however, the frequency of their
presence and level of contamination exceeded previous data (Nesic and Pavlovic, 2013). Residues
of those mycotoxins are not considered to be of public health importance as only very low levels of
the toxins have been found in the tissues of animals that had been fed very high levels of the toxins
in experimental situations (Petterrson, 2004). But, from animal health and production point of view
their presence should not be neglected. The economic consequences can be very serious, especially
in pigs as the most sensitive species. Common clinical signs of zearalenonetoxicoses are vaginal
and vulvar swelling, enlargement of mammary glands and testicular atrophy, as well as other
reproductive effects, such as decreased fertility, increased number of resorptions and reduced litter
size (EFSA 2011; Nesic et al, 2008). Recent studies have demonstrated the potential for ZEA to
stimulate growth of human breast cancer cells (Yu et al, 2005). Intoxication with deoxynivalenol
(vomitoxin) is manifested by a decrease in food intake or its refusal, vomiting and digestive
disorders with subsequent losses of weight gain (Nesic et al, 2014). The gastrointestinal system is
the target organ of this toxin. In practice, the co-occurrence of DON and ZEA, or even additional
mycotoxins in contaminated cereals exacerbates the management of affected animals (Dll and
Dnicke, 2011).
Due to synergistic interactions co-contaminated samples might elicit adverse effects even the
concentrations of the individual mycotoxins do not surpass legal guidance values. However, in their
present state regulations do not address co-contamination and associated risks. For example, there is
data that a 5% growth depression is to be expected in pigs fed naturally deoxynivalenol (DON)contaminated diets containing 0.6 mg kg1 DON, whereas 1.8 mg kg1 DON is required to obtain
a similar effect if pure toxin is used. Serbian Directive as well as the European Unions guidance for
DON in complete feed for pigs is 0.9 mg/kg (Streit et al, 2013).
129
Based on the discussion above it is also important to emphasize the process of detection of
mycotoxins. Mycotoxins are a major analytical challenge because of the range of chemical
compounds they represent, and the array of feed matrices in which they are found. Analysis is
essential for determining the extent of mycotoxin contamination, for risk analysis, for confirming
the diagnosis of a mycotoxicosis and for monitoring mycotoxin mitigation strategies. Quantifying
these compounds requires sophisticated laboratory equipment and trained people (Krska et al, 2008;
Rahmani et al, 2009). The development of immunological methods for mycotoxin detection,
especially enzyme-linked immunosorbent assays (ELISA), although screening test, was a major
step toward developing rapid, repeatable and sensitive assays. But there are other influences that
can disturb the validity of the results. Sampling is the greatest source of error when quantifying
mycotoxin contamination. It is difficult to obtain feed samples representative of what may have
caused a mycotoxicosis incident or to represent large grain consignments. These difficulties arise
because of the uneven distribution of toxin within a commodity, in which mycotoxins occur (CAST,
2003; Whitaker, 2003, 2006). Also, it has recently become apparent that there is a connection
between masked, hidden, bound and/or conjugated mycotoxins in feedstuffs and the potential
for animals to perform poorly. Mycotoxin conjugates may be formed as a result of plant metabolism
(Berthiller et al, 2007), but are not detected by using conventional analytical procedures. These
conjugates will be hydrolyzed following ingestion, thereby increasing exposure to the precursor
toxin.
As the latest laboratory results showed permanent presence of some mycotoxins and the cooccurance of few of them, it is important to establish better prevention (Nesic et al, 2013), as well
as the predictive models in regard to meteorological forecasts. However, special attention has to be
paid to the control system and regular monitoring of cereals, feed and food has to be organized.
Since managing impact of these contaminants is still great practical challenge, only timely and
adequate reaction is the right solution. There are a number of approaches that can be taken to
minimize mycotoxin contamination in the food chain: prevention of fungal growth and therefore
mycotoxin formation, strategies to reduce or eliminate mycotoxins from contaminated feedstuffs or
diverting contaminated products to low risk uses. A field to table combating program against
mycotoxins should involve Good Agricultural Practice, Good Manufacturing Practice, Good
Storage Practice and applying the seven HACCP (Hazard Analysis Critical Control Points)
principles within the framework of the quality systems, as well as Good Laboratory Practice and the
methods for mycotoxin detection which must meet the highest standards.
Acknowledgments
This paper is published as part of the projects of the Ministry of Education, Science and
Technological Development of Republic of Serbia No. III46009 and 031071.
References
1.
2.
3.
4.
Berthiller F., Sulyok M., Krska R., Schuhmacher R.: Chromatographic methods for the simultaneous
determination of mycotoxins and their conjugates in cereals. Int. J. Food Microbiol., 119, 3337, 2007
Brase S., Encinas A., Keck J., Nising C.F.: Chemistry and biology of mycotoxins and related fungal
metabolites. Chem. Rev., 109, 39034399, 2009
Bryden W.L.: Mycotoxin contamination of the feed supply chain: Implications for animal productivity
and feed security. Animal Feed Science and Technology, 173, 134 158, 2012
Bryden W.L.: Mycotoxins and mycotoxicoses: significance, occurrence and mitigation in the food
chain. In: Ballantyne B, Marrs T, Syversen T (Eds.), General and Applied Toxicology. Third ed. John
Wiley & Sons Ltd, Chichester, UK, 2009, 35293553.
130
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
CAST: Mycotoxins risk in plant, animal and human systems, Task Force Report, No. 139. Council for
Agricultural Science and Technology, Ames, Iowa, 2003, 1-191.
Cole R.J., Scheweikert M.A., Jarvis B.B.: Handbook of Secondary Fungal Metabolites, Vols. IIII.
Academic Press, CA, USA, 2003.
Dll S., Dnicke S.: The Fusarium toxins deoxynivalenol (DON) and zearalenone (ZON) in animal
feeding. Preventive Veterinary Medicine, 102, 132 145, 2011
EFSA: Scientific Opinion on the risks for public health related to the presence of zearalenone in food.
EFSA Journal, 9 (6), 2197, 2011
Fink-Gremmels J.: Mycotoxins in cattle feeds and carry-over to dairy milk: a review. Food Addit.
Contam., 25, 172180, 2008
Haschek W.M., Voss K.A., Beasley V.R.: Selected mycotoxins affecting animal and human health. In:
Haschek, W.M., Rousseaux, E.C.G., Wallig, M.A. (Eds.), Handbook of Toxicological Pathology, vol. 1,
second ed. Academic Press, New York, 2002, 645699.
Jakic-Dimic D., Nesic K., Savic B., Keckes J., Pisinov B.: Presence of fungi in poultry feed and effects
of contaminants on health status. Proceedings of the XIV International Symposium Feed Technology,
Novi Sad, Serbia, 248-253, 2010
Jakic-Dimic D., Nesic K.: Mycotoxins in feed for poultry. Proceedings of the 4th International Congress
on Food and Nutrition and MycoRed 2nd Mediterranean Workshop on Mycotoxins and Toxigenic
Fungi, October 12-14, 2011, Istanbul, Turkey, 2011, 229.
Kos J., Levi J., uragi O., Koki B., Miladinovi I.: Occurrence and estimation of aatoxin M1
exposure in milk in Serbia, Food Control, 38, 41-46, 2014
Kos J., Mastilovi J., Jani Hajnal E., ari B.: Natural occurrence of aflatoxins in maize harvested in
Serbia during 20092012, Food control, 34, 31-34, 2013
Krska R., Schubert-Ulrich P., Molinelli A., Sulyok M., McDonald S., Crews C.: Mycotoxin analysis: an
update. Food Addit. Contam. 25, 152163, 2008
Nesic K., Ivanovic S., Nesic V.: Fusarial Toxins - Secondary Metabolites of Fusarium Fungi. Rev.
Environ. Contam. T., 228, 101-120, 2014
Nesic K., Jaki S., Kapetanov M.: Prevention, control and detection of Fusarial toxins. Matica srpska
J. Natural sciences, 124, 91-99, 2013
Nesic K., Pavlovi N.: Current mycotoxicological profile of Serbian feed. Proceedings of the
International 57th Meat Industry Conference, June 10-12, 2013, Belgrade, Serbia, 2013, 320-323.
Nesic K., Resanovic R., Nesic V., Sinovec Z.: Efficacy of mineral and organic adsorbent in alleviating
harmful effects of zearalenone on pigs performance and health. Acta Veterinaria 58, 2-3, 211-219, 2008
Petterrson H.: Controlling mycotoxins in animal feeds. In: Magan, N., Olsen, M. (Eds.), Mycotoxins in
Food. Woodhead Publishing, Cambridge, 2004, 262304.
Rahmani A., Jinap S., Soleimany F.: Qualitative and quantitative analysis of mycotoxins. Compr. Rev.
Food Sci. Food, 202-251, 2009
Republic Hydrometeorological Service of Serbia. Agrometeoroloski uslovi u proizvodnoj 2011/2012
godini na teritoriji Republike Srbije, 2012.
Republic Hydrometeorological Service of Serbia. Agrometeoroloski uslovi u proizvodnoj 2013/2014
godini na teritoriji Republike Srbije, 2014.
Shier W.T., Abbas H.K., Wearer M.A., Horn B.W.: The case for monitoring Aspergillus avus
aatoxigenicity for food safety assessment in developing countries. In: Abbas, H.K. (Ed.), Aatoxin and
Food Safety. CRC Press, Boca Raton, 2005, 291311.
Slubeni glasnik Republike Srbije, Pravilnik o izmeni pravilnika o kvalitetu hrane za ivotinje 27, 2014
Slubeni glasnik Republike Srbije, Pravilnik o kvalitetu hrane za ivotinje 4, 2010
Streit E., Naehrer K., Rodrigues I., Schatzmayr G.: Mycotoxin occurrence in feed and feed raw
materials worldwide: Long-term analysis with special focus on Europe and Asia. J. Sci. Food Agric. 93,
28922899, 2013.
Whitaker T.B.: Detecting mycotoxins in agricultural commodities. Mol. Biotech. 23, 6171, 2003
131
132
Abstract
The objective of this study was to determine the fatty acid (FA) profile, oxidative stability of lipids,
measured by the thiobarbituric acid (TBA) and physicochemical properties of raw and heatprocessed meat of chickens fed with a different n-6/n-3 PUFAs ratio (14.38, 12.91, 13.40 and
12.85, respectively), resulting from the different dietary ingredient (particularly soybean meal and
sunflower oil). Samples of breast and thigh muscles of broilers equal to 48 from two farms (Farm
I and Farm II) were taken during 2012. The chickens were fed ad libitum on commercial diets for
growing broilers which contained different feed ingredients. Generally, all parameters measured
were influenced by the interaction of growth performances, the quality characteristics of the
chicken meat, and treatment group (farms and diets) by at most 5%. The farm treatments modify
significantly growth performance and feed intake of the broilers between farms. The
physicochemical properties, including cooking loss, color, pH, lipids and thiobarbituric acid (TBA)
in raw and heat-processed breast and drumstick meat samples, differed significantly. Content of
total iron (Fe) did not differ significantly between meat samples. Comparing FAs composition in
diet with drumstick and breast muscle, the diet was comprised mainly of polyunsaturated FA
(PUFA) then monounsaturated FA (MUFA) and saturated FA (SFA) (100:47:27%) versus
drumstick and breast muscle, where the predominant FAs was MUFA, in comparison to SFA and
PUFA (100:78:55%), although the proportion of FAs with four or more double bonds was
metabolized specific. It may be concluded that, higher n-6/n-3 PUFAs ratio in the diets improved
the FAs ratio in the meat samples, however, the higher n-6/n-3 PUFAs ratio in meat adversely
affected the oxidative stability as manifested by the significantly higher TBA concentrations in
heat-processed breast and drumstick meat (4.69 0.93 to 5.52 1.44 and 5.87 1.27 to 8.63
0.88 MAL/kg, respectively), compared with those of the group where are low n-6/n-3 PUFAs ratio
in meat samples (2.49 1.08 to 5.46 0.19 and 3.06 0.99 to 4.53 0.10 MAL/kg, respectively).
Therefore, our results suggest that poultry meat quality is a complex and multivariate property,
which is affected by multiple interacting factors.
Keywords: chicken meat, physicochemical properties and oxidative stability.
Introduction
Effect of diet on human health is a major problem not only in developing countries but also in
highly industrialized countries, where consumers are becoming more demanding in relation to food
products. Chicken meat is the fastest growing component of global meat demand. In Serbia the
consumption of chicken meat is higher compared to other meats, as it is preferred over other meat
for its health appeal because of its nutritional value, but also its taste and appearance
(Bogosavljevic-Boskovic et al., 2010). Compared to other meats, chicken lipids are characterised
by relatively high levels of unsaturated fatty acids, especially polyunsaturated fatty acids (PUFA),
which are considered as a positive and healthy aspect by consumers (Bonoli et al., 2007).
However, commercial chicken meat is known to be deficient in n-3 FA and rich in n-6 FA. From
133
the human health point of view, it is important to have low saturated fat and adequate amount of
PUFA preferably less n-6 FA, balancing n-3 FA. The modern human diet is deficient in n-3 FAs,
which has been linked to the increase in several degenerative diseases such as cardiovascular
disease, diabetes, arthritis, cancer and mental illness (Nichols et al., 2010). Therefore it is important
to enrich chicken meat with n-3 FA and lower the saturated and n-6 FA content. Decreasing the n6/n-3 FA ratio in chickens is important in order to make chicken meat a functional food (Rondelli et
al., 2004). Of all the meat constituents, the lipid fraction has the highest susceptibility to
modification, in contrast to protein with aminoacidic composition determined by the genetic code.
As a result, feeding strategies have been adopted to alter lipid composition of broilers meat (Kouba
and Mourot, 2011). However, the increasing amount of PUFA content in poultry diets could
increase the degree of broilers fat unsaturation and probably the rate of tissue lipid peroxidation,
which reflects the so-called thiobarbituric acid reactive substance (TBA) value of broilers tissue
(Cherian et al., 1996). Lipid oxidation is responsible for the production of undesirable compounds
(from both a toxic and sensory point of view) which is of significant importance in consumer
purchase decisions for fresh meat (Risvik, 1994), and in general causes shelf-life quality
deterioration in meat (Bou et al., 2009). Therefore, the present study was conducted to determine
the fatty acid (FA) profile, oxidative stability of lipids, measured by the thiobarbituric acid (TBA)
and physicochemical properties of raw and heat-processed meat of chickens fed with a different n6/n-3 PUFAs ratio and a possible interaction between these factors.
lost during cooking. Total lipid was determined in raw and roasted breast and thigh meat with
skin. Total lipid content was determined by extraction of fat by petroleum ether and Soxhlet
extractor after acid hydrolysis of the samples (SRPS ISO, 1992). Total lipids were extracted from
the diet, thigh and breast muscle samples and further converted to fatty acid methyl esters (FAMEs)
(0.25 M trimethylsulfonium hydroxide - TMSH in methanol as the methylating agent). FAMEs
were determined by capillary gas chromatography on GC Shimadzu 2010 (Kyoto, Japan) equipped
with flame ionization detector and capillary HP-88 column (100 m 0.25 mm 0.20m, J&W
Scientific, USA). Thiobarbituric acid (TBA) was determined according to the method proposed by
Tarladgis et al. (1964) and Holland (1971). TBA content was expressed as mg of malondialdehyde
per kg of meat (mg MAL/kg). Determinations of Fe in meat samples were performed by flame
atomic absorption spectrophotometry (Analyst 300, Perkin Elmer, USA) following the methods
described by Jorhem (2000).
Statistical analysis
Data from the experiment was analysed by descriptive statistics (mean, standard deviation, and
range). ANOVA with Tukey's test was performed, in order to determine statistical differences
among examined parameters between farms (P < 0.05).
Results
Growth performance of the broilers
The Growth performances of broilers fed various dietary and composition of the commercial
broiler diets which were used for feeding chicks, are shown in Tables 1 and 2. Average live
weight, daily gain, carcass, breast, and drumstick weights were different among the groups of
broilers. At the same age, the highest average daily body gains (57 g), average daily feed intake
(103.9 g) and carcass (1764.87 227.83 g), breast (647.95 78.70 g), and drumstick weights
(536.40 88.41 g) were in chickens from Farm I in the autumn. Despite the different diet
compositions, nutritive values were similar during the investigation (Table 2). In regard to fatty
acids content, n-6/n-3 PUFAs ratio were different (14.38, 12.91, 13.40 and 12.85, respectively),
resulting from the different dietary ingredient, particularly soybean meal and sunflower oil.
Physicochemical properties, FAs rations and TBA values in broiler meat
Physicochemical properties, FAs rations and oxidative status of raw broiler meat are shown in
Table 3 and Figs 1 and 2. The physicochemical properties, including cooking loss, color, pH, lipids
and thiobarbituric acid (TBA) in raw and heat-processed breast and drumstick meat samples,
differed significantly between treatment group. Content of total Fe did not differ significantly
between samples. Comparing FAs composition in diet with drumstick and breast muscle, the diet
was comprised mainly of PUFA then MUFA or SFA (100:47:27 %) versus drumstick and breast
muscle, where the predominant FAs was MUFA, in comparison to SFA and PUFA (100:66-77:5670 %), except in the treatment group were is sunflower oil added in diets in 4.45 % (100:71-96:3751 %). Although the proportion of FAs with four or more double bonds was metabolized specific,
the n-6/n-3 PUFAs ratio in breast and drumstick muscle samples was higher in broilers fed with
higher level of the sunflower oil and the soybean meal (29.01:1 and 20.84:1 respectively). These
results indicated that n-6/n-3 PUFAs ratio in broiler meat large in magnitude, was significantly
different (P<0.001). The average TBA values in drumstick and breast muscle (0.04 and 0.02 mg
MAL/kg, respectively) in treatment group Ib was significantly (P<0.001) lower than those from the
other treatment group. The average TBA values in drumstick and breast muscle in other group
varied between 0.067 to 0.09 MAL/kg, both in breast and drumstick muscle.
135
Parameter
(range)
I (n = 12)
38
57
103.9
1.82
1279.45174.02
(1021.7- 1681.2)
452.5 80.17
(339 - 628)
389.89 51.19
(316.8 - 494)
II (n = 12)
38
39
84.33
2.16
1223.3 116.38
(1055 - 1486.4)
427.70 53.44
(337.1 - 547.2)
392.9 39.20
(354 - 472.7)
Ib (n = 12)
39
57
100.51
1.76
1764.87 227.83
(1498.8 - 2226.7)
647.95 78.70
(510 - 775.1)
536.40 88.41
(443.2 - 703)
IIb (n = 12)
38
52
106.1
2.04
1400.70 130.01
(1186 - 1712.7)
470.62 61.15
(393.4 - 614.1)
476.78 48.20
(398.6 - 572.4)
Starter (0 - 15 d)
Ia
55.2
IIa
55.12
Ib
50.06
IIb
49.45
Grover (16 - 32 d)
Farm
a
a
I
II
Ib
IIb
56.03
56.03 39.08
49.6
Finisher (33 - 38 d)
Ia
61.1
IIa
55.8
Ib
55.8
IIb
52.75
SbM
34.8
34.8
18
30.9
30.9
25.4
29.8
(46% CP)
SbM
15
33.60
31.60
29.4
23.5
24.5
(44% CP)
Wg
3.0
3.0
6.0
6.0
6.0
6.0
20.0
10.0
6.0
6.0
10
10
SfM
3.0
(33% CP)
Yeasts
1.5
CG
2.0
2.0
2.0
SfO
1.65
1.65
2.5
2.62
2.4
2.4
4.42
3.45
3.05
3.45 3.45
4.45
L-Lysine
0.27
0.27
0.29
0.36
0.02
0.02
0.08
0.11
0.16
0.05 0.24
0.11
DL-Meth.
0.28
0.28
0.30
0.28
0.15
0.15
0.17
0.15
0.15
0.11 0.14
0.15
Treonine
0.12
0.12
0.13
0.14
0.03
0.03
0.05
0.07
0.06
Ch. 60%
0.13
0.13
0.13
0.14
0.10
0.10
0.10
0.10
0.10
0.10 0.10
0.10
VMP 0.5%
0.60
0.60
0.60
0.60
0.60
0.60
0.50
0.50
0.50
0.50 0.50
0.50
Chemical composition (%)
Crude protein 22.32 22.82 22.46 22.25
19.24
20.39 20.1
20.62 18.71 18.83 19.12 19.82
Water
11.07 10.23 11.50 13.19
10.69
10.73 11.40 12.79 10.30 11.46 11.11 11.57
Crude fibre
1.15 1.68
1.57
1.88
1.73
1.50
1.66
1.75
1.34
1.55
1.63
2.68
Fat
4.75 4.48
4.56
4.60
4.69
4.30
4.92
4.90
6.32
5.95
6.10
6.20
Ash
5.48 5.80
5.63
5.61
5.32
6.04
5.52
5.21
4.62
4.88
4.98
5.44
Ca
0.82 0.95
0.86
0.88
0.74
1.03
0.86
0.81
0.81
0.74
0.78
0.81
Available P
0.71 0.70
0.68
0.65
1.73
0.69
1.05
0.73
0.58
0.70
0.64
0.63
Sums of fatty acids
SFA
15.3 16.05 16.0 16.62
15.7
16.83 16.83 16.95
15.6
16.06
15.8
15.8
MUFA
27.6 26.83 28.09 29.85
27.9
27.79 28.40 29.53
27.2
25.95
27.0 27.88
PUFA
57.1 57.12 55.92 53.53
56.4
55.4 55.77 55.53
57.2
58.01
57.2 56.38
n-3
3.49 3.65
3.58
3.61
3.53
4.14
3.67
3.36
3.72
4.17
3.98
4.07
n-6
53.6 53.47 52.33 49.92
52.87
51.25 51.45 50.17 53.48
53.84
53.21 52.31
n-6/n-3
15.3 14.65 14.61 13.83
14.98
12.38 14.10 14.93 14.38
12.91
13.40 12.85
PUFA/SFA
3.73 3.56
3.49
3.22
3.60
3.29
3.38
3.27
3.66
3.61
3.62
3.58
MUFA/
1.65 1.67
1.75
1.79
1.77
1.65
1.72
1.72
1.74
1.61
1.71
1.77
SFA
ME (MJ/kg)
12.65 12.65 12.65 12.65
13.00 13.00 13.00 13.00 13.45 13.45
13.45 13.45
I, II - farms, a - summer, b - autumn/winter, SbM - soybean meal, Wg - wheat grain, SfM - sunflower meal, CG - corn
gluten, SfO - sunflower oil, DL MethDL - methionine, Ch - choline, VMP - vitamin + mineral premix, SFA - saturated
FA, MUFA - monounsaturated FA , PUFA - polyunsaturated FA
136
Table 3. Chemical composition and physicochemical properties of raw and heat-processed breast
and drumstick meat
Treatment group
Parametar
Breast
Ia
Ib
IIa
IIb
32.60 2.10 **
(29.96-36.10)
57.20 1.87 ***
L*
(54.66-60.05)
2.83 1.67 *
a*
(1.10-7.48)
4.71 1.95 **
b*
(2.44-7.63)
5.71 0.29 ***
pH 24
(5.21-6.10)
7.88 1.41
Fe total (mg/kg)
(6.03-10.34)
9.63 0.64 ***
raw
Lipids
(8.18-10.81)
(%)
heat14.73 0.55 ***
processed
(14.00-15.50)
TBA (mg MAL/kg)
0.07 0.02 **
raw
(0.05-0.12)
* P < 0.05; ** P < 0.01; *** p 0.001
29.69 3.48 *
(23.73-36.25)
52.93 2.58 ***
(49.01-56.36)
2.02 0.57
(1.18-3.39)
5.91 1.22 ***
(4.36-8.20)
6.45 0.25 ***
(6.02-6.77)
8.42 1.46
(6.08-11.18)
9.85 1.98 ***
(8.12-15.29)
13.37 0.95 ***
(12.00-15.00)
0.04 0.014 ***
(0.004-0.06)
33.34 4.58 **
(24.78-41.34)
58.82 2.21 ***
(54.91-62.33)
1.26 0.79 ***
(0.25-3.11)
2.86 1.10 ***
(1.10-4.60)
6.44 0.17 ***
(6.15-6.74)
7.45 0.98
(6.07-9.24)
5.20 0.45 ***
(4.33-5.70)
10.54 0.22***
(10.00-11.00)
0.087 0.064 *
(0.03-0.24)
29.60 2.37
(25.06-33.36)
58.10 3.22 ***
(49.54-61.84)
3.10 1.07 ***
(1.30-4.65)
7.67 2.77 ***
(1.47-11.55)
6.51 0.09 ***
(6.38-6.68)
8.12 0.69
(7.00-9.10)
8.16 2.26 ***
(5.27-11.26)
11.07 2.04 ***
(8.11-14.11)
0.09 0.01 ***
(0.07-0.12)
raw
heatprocessed
TBA (mg MAL/kg)
raw
Drumstick
Cooking loss (%)
The concentrations of total lipid and TBA values in heat-processed broiler meat are shown in
Table 3 and Figure 3. Heat-processed broiler meat (Table 3) belonging to chickens from Farm II
contained lower quantities of total lipids in breast (3.57 to 3.72%) and drumstick (10.54 to 11.07
%) than samples from Farm I in breast (6.08 to 6.25 %) and drumstick (13.37 to 14.73%). These
differences were significant (P < 0.001). TBA values as a measure of lipid oxidation in heatprocessed breast and drumstick chicken meat are shown in Figure 3. A higher (P 0.001) TBA
values was found in the muscle from the Farm II. The average TBA values in samples of heatprocessed drumstick muscle of chickens from Farm II ranged from 5.87 1.28 (mg MAL/kg) in
summer to 8.63 0.88 (mg MAL/kg) in autumn, compared to those from the Farm Ib, where the
average TBA values in samples of heat-processed breast muscle was 2.49 1.08 (mg MAL/kg)
and 3.06 0.99 (mg MAL/kg) in drumstick muscle. These differences (p < 0.001) could be
137
attributed to initial higher level of TBA values in samples from farm II, as well as high n-6/n-3
PUFAs ratio in breast and drumstick muscle.
100%
PUFA
90%
MUFA
80%
SFA
70%
60%
50%
40%
30%
20%
10%
0%
B (Ia)
D (Ia)
B (Ib)
D (Ib)
B (IIa)
D (IIa)
B (IIb)
D (IIb)
Fig. 1. The fatty acid (FAs) rations (% of total fatty acids) in raw breast (B) and raw drumstick (D) meat
from farms I and II during summer (a) and autumn (b) fed dissimilar diets
40
12
35
(mg MAL/kg)
n-6/n-3
30
25
20
12
10
10
15
10
B (I a)
D (I a)
B (I b)
D (I b)
B (II a)
D (II a)
B (II b)
D (II b)
B (Ia)
D (Ia)
B (Ib)
D (Ib)
B (IIa)
D (IIa)
B (IIb)
D (IIb)
Fig. 2.(A) n-6/n-3 PUFA ratio in raw breast (B) and raw drumstick (D) meat from farms I and II during
summer (a) and autumn (b) fed dissimilar diets (B) Malondialdehyde (mg MAL/kg) content in heatprocessed breast (B) and drumstick (D) meat with skin from farms I and II during summer (a) and autumn
(b)
Discussion
In the present study, we analyzed the effect of diets with a different n-6/n-3 PUFAs ratio resulting
from the different dietary ingredient (particularly soybean meal and sunflower oil), on the fatty acid
(FA) profile, physicochemical properties and oxidative status of raw and heat-processed breast and
drumstick meat. The results of the study indicate that all parameters measured were influenced by
the interaction of growth performances, the quality characteristics of the chicken meat, and
treatment group (farms and diets). Because of inclusion of grain, corn, plant seeds or oils, which
138
are rich in C18:2, poultry meat of different kinds generally has as high n-6/n-3 ratio as pork and
higher than beef and lamb, whereas the P/S ratio is closer to 1.0 (Li et al., 1998). These results are
in contrast to those observed in our study where P/S ratio was below of 1.0 (0.39 to 0.97 in breast
and 0.76 to 1.04 in drumstick). However, P/S ratio is better in samples originating from farm I then
from farm II. A lower dietary n-6/n-3 PUFA ratio provides health benefits to consumers. In typical
Western diets, the n-6/n-3 PUFA ratio is high, ranging between 10:1 and 30:1 (Hibbeln et al.,
2006), while it should remain in the 1:11:4 range (Lands, 2005). The ideal dietary n-6/n-3 PUFA
ratio, recommended by an international panel of lipids experts, is approximately 2:1 (Simopoulos et
al., 1999). In the present experiment, the ideal n-6/n-3 PUFA ratio was not achieved and was far
from recommended, ranged from 14.1:1 to 29.01:1 in breast meat, versus 18.08:1 to 20.84:1 in
drumstick meat. High n-6/n-3 PUFA ratio corresponded to low P/S ratio in samples originating
grom farm II.
Concerning results in the present studies, this result suggests that dietary lipid source or n-6/n-3
PUFA ratio did not influence its color characterized in scale L*,a*, and b* (data not presented). For
example, Bianchi et al., (2009) reported that dietary use of vegetable oils produced darker and a
higher yellowness of breast meat than animal fats. In regarding to diferences between FAs
composition in diet with thigh and breast muscle, the results in this study supported the hypothesis
that chicks can better assimilate FAs from fat sources that are rich in UFA than from fats that are
rich in SFA (Smits et al., 2000). Friedman and Nylund (1980), reported that the absorption of long
chain SFA is limited by their incorporation rate into micelles. Saturated FA are less rapidly
incorporated into micelles than polyunsaturated FA because of their non- polarity, which makes
them rely on an adequate presence of bile salts for efficient emulsification (Polin et al. 1980,
Dnicke, 2001).
The TBA test is a sensitive and useful method for monitoring lipid oxidation in many systems and
under a wide variety of conditions. The increase in the TBA content in heat-processed breast and
drumstick meat noted in the present study, was accompanied by a higher proportion n-6/n -3 PUFA
ratio in the total FA pool. Several studies have reported, an increase in n-6/n -3 PUFA ratio in meat
was followed by an increase in the concentrations of lipid oxidation products (measured as TBA
content) or cholesterol oxidation products, both in raw meat (Zanini et al., 2006: Cortinas et al.,
2004) and heat-processed meat (Eder et. al., 2005). Also, the results (Fig. 2B) revealed that the
initial MAL levels in meat, which strongly depend on fat content, composition, and fatty acid
composition, determine the absolute MAL levels after cooking. Similar results have been reported
by Vasavada et al. (2006).
It is important to point out the role that haemoglobin can perform in the beginning of
lipoperoxidative process. In the case of meat, it has been found that the haeme group (contains iron,
Fe) present in some proteins would have an important catalytic effect in the oxidative
decomposition of PUFA. In addition, Kranen et al. (1999) suggested that poultry leg and breast
contain significant concentrations of haemoglobin, 0.67 mg/g and 0.24 mg/g, respectively and in
consequence, when the animals are slaughtered, the biochemical processes that turn the muscle into
meat allow haemoproteins to control the lipoperoxidative processes that definitively accelerate the
deterioration of the meat (Alayash et al., 2001). Concerning the differences in the MAL levels in
meat between farms and season it is important to emphasise that this differences can be attributed to
the differences in the type of ingredient added to feeds, particularly corn, soybean meal and
sunflower oil, the main source of dietary fat.
In fact, it was noted that production parameters for broilers from the farms were very different. The
performance of the birds was not within the expected range of the breed standard (Aviagen, 2007),
and so the study did not reflect commercial performance. These data show much worse production
parameters for broilers at Farm II compared with Farm I, probably due to the problems induced by
microbiological factors (high mortality rate 28.37%, data not presented), which consequently
139
might alter the chemical composition, and physicochemical properties of the meat. In addition, to
explain some discrepancy in obtained results with other authors, linked to possible microbiological
factor which could induce worst production results, cells involved in the inflammatory response are
typically rich in the n-6 fatty acid. PUFA are important constituents of the phospholipids of the
membranes of inflammatory cells. Typically these contain a relatively high proportion of the n-6
PUFA (Calder, 2012).
Conclusion
This study contributes an update to the literature data about fatty acid (FA) profile, oxidative
stability of lipids, measured by the thiobarbituric acid (TBA) in the meat cuts obtained from
chickens from the conventional commercial rearing system. From the results of the present study, it
can be concluded that, higher n-6/n-3 PUFAs ratio in the diets improved the FAs ratio in the meat
samples. However, the higher n-6/n-3 PUFAs ratio in meat adversely affected the oxidative stability
as manifested by the significantly higher TBA concentrations in heat-processed breast and
drumstick meat. Results from the current study can be used as a feeding strategy in order to improve
poultry production. Therefore, further studies should be encouraged to evaluate the nutritive value
of chicken meat produced through new and alternative rearing systems, the utilisation of animal
feed fortified in some nutrients, and better slaughtering practices, which currently also contribute to
the variability of the nutrient composition of meat.
Acknowledgements
This study was supported by the projects no. TR 31008, funded by the Ministry of Education,
Science and Technological Development of the Republic of Serbia.
References
1. Alayash A.I., Patel R.P. and Cashon R.E.: Redox reactions of hemoglobin and myoglobin: Biological
and toxicological implications. Antioxidants & Redox Signalling, 3, 313-327, 2001
2. Aviagen.:
Ross
308
Broiler
Performance
Objectives
June
2007.
http://aviagen.com/ss/assets/Tech_Center/Ross_Broiler/Ross_308_Broiler_Performance_Objectives.pdf
. 2007
3. Bianchi M., Ferioli F., Petracci M., Caboni M.F., Cavani C.: The influence of dietary lipid source on
quality characteristics of raw and processed chicken meat. European Food Research and Technology,
229, 23392348, 2009
4. Bogosavljevic-Boskovic S., Mitrovic S., Djokovic R., Doskovic V., Djermanovic V.: Chemical
composition of chicken meat produced in extensive indoor and free range rearing systems.
African Journal of Biotechnology, 53, 90699075, 2010
5. Bonoli M., Caboni M.F., Rodriguez-Estrada M.T., Lercker G.: Effect of feeding fat sources on the
quality and composition of lipids of precooked ready-to-eat fried chicken patties. Food Chemistry, 101,
13271337, 2007
6. Bou R., Codony R., Tres A., Decker E.A., Guardiola F.: Dietary strategies to improve nutritional value,
oxidative stability, and sensory properties of poultry products. Critical Reviews in Food
Science and Nutritio, 49, 800822, 2009
7. Calder C. Philip.: Fatty acids Long-chain fatty acids and inflammation. The 5th International
Immunonutrition Workshop was held at Puerto Vallarta, Mexico on 68 April 2011. Proceedings of the
Nutrition Society, 71 , 284289, 2012
8. Cherian G., Wolfe F. W., Sim J. S.: Dietary oils and added tocopherols: effects on egg or tissue
tocopherols, fatty acids, and oxidative stability. Poultry Science, 75, 423431, 1996
140
Cortinas L., Villaverde C., Galobart J., Baucells M. D.et al., Fatty acid content in chicken thigh and
breast as affected by dietary polyunsaturated level. Poultry Science, 83, 11551164, 2004
10. Dnicke S.: Interaction between cereal identity and fat quality and content in response to feed enzymes
in broilers. In: Bedford, M.R., Partridge, G.G. (Eds.), Enzymes in Farm Animal Nutrition. CABI Pub,
Wallingford, UK, 2001, pp. 199236.
11. Eder K., Gru"thal G., Kluge H., Hirche, F. et al.,Concentration of cholesterol oxidation products in
raw,heated processed and frozen meat of broiler chickens fed diets differing in the type of fat and
vitamin E concentration. British Journal of Nutrition, 93, 633643, 2005
12. Hibbeln J. R., Nieminen L. R. G., Blasbalg T. L., Riggs J. A., Lands W. E. M.: Healthy intakes of n-3
and n-6 fatty acids: Estimations considering worldwide diversity. American Journal of Clinical
Nutrition, 83, 14831493, 2006
13. Holland C. D.: Determination of malonaldehyde as an index of randicity of nut meats. Journal of
AOAC, 54, 5, 10241026, 1971
14. Nichols P.D., Petrie J., Singh S.: Long-chain omega-3 oils-an update on sustainable sources. Nutrients
2, 572585, 2010
15. Jorhem L: Determination of metals in foods by atomic absorption spectrometry after dry ashing: NMKL
collaborative study. Journal of AOAC International, 83, 1204-1211, 2000
16. Kouba M., Mourot J.: A review of nutritional effects on fat composition of animal products with special
emphasis on n-3 polyunsaturated fatty acids. Biochimie, 93, 1317, 2011
17. Kranen R.W., Van Kuppevelt T.H., Goedhart H.A., Veerkamp, C.H., Lambooy, E. and Veekamp H.:
Hemoglobin and myoglobin content in muscles of broiler chickens. Poultry Science, 78, 467-476, 1999
18. Lands W. E. M.: Dietary fat and health: The evidence and the politics of prevention: Careful use of
dietary fats can improve life and prevent disease. Annals of the New York Academy of Sciences, 1055,
179192, 2005
19. Li D. A. Ng., Mann N. J., and Sinclair A. J.: Contribution of meat fat to dietary arachidonic acid, Lipids,
33, 437440, 1998
20. Polin D., Wing T., Ki P., Pell K.E.: The effect of bile acids and lipase on absorption of tallow in young
chicks. Poultry Science, 59, 27382743, 1980
21. Risvik E., Sensory properties and preferences. Meat Science, 36, 6777, 1994
22. Rondelli S.G., Martinez O., and Garcia P.T.: Effects of different dietary lipids on the fatty acid
composition of broiler abdominal fat. Brazilian Journal of Poultry Science 6, 171-175, 2004
23. Simopoulos A. P., Leaf A., Salem N., Jr.: Workshop on the essentiality of an recommended dietary
intakes for omega-6 and omega-3 fatty acids. Journal of the American College of Nutrition, 18, 487
489, 1999
24. Smits C.H.M., Moughan P.J., Beynen A.C.: The inhibitory effect of a highly viscous
carboxymethylcellulose on dietary fat digestibility in the growing chicken is dependent on the type of
fat. Journal of Animal Physiology and Animal Nutrition, 83, 231238, 2000
25. SRPS ISO 1443/1992. Meso i proizvodi od mesaOdreivanje sadraja ukupne masti.
26. Tarladgis B. C., Pearson A. M, Dugan L.R.: Chemistry of the 2-thiobarbituric acid test for
determination of oxidative rancidity in foods. II Formation of the TBA malonaldehyde complex without
acid heat treatment. Journal of the Science of Food and Agriculture, 15, 9, 602607, 1964
27. Vasavada M.N., and Cornforth D.P.: Evaluation of Antioxidant Effects of Raisin Paste in Cooked
Ground Beef, Pork, and Chicken. Journal of Food Science, 71, 4, 242246, 2006
28. Zanini S. F., Colnago G. L., Pessotti B. M. S., Bastos M. R. et al., Oxidative stability and total lipids on
thing and breast meat of broiler fed diets with two fat sources and supplemented with conjugated
linoleic acid. LWT - Food Science and Technology, 39, 717723, 2006
141
Abstract
Recently, the production of smoked common carp meat has suffered some changes in the production
process that include changing production conditions, as well as adapting recipes and quality to
industrial production conditions. The product obtained in this way has not all those sensory
characteristics of the products which consumers are given by craft production. The aim of this work
was to prove quality, safety and the lower PAHs content of a product obtained in ecological safe
production of smoked common carp meat.
The sensory, chemical and microbiological analyses of the ecologically produced smoked common
carp meat which were done at the Scientific veterinary institute "Novi Sad" confirm quality and
safety of the product and prove that the application of gravel filter gets smoked product without the
presence of carcinogenic polycyclic aromatic hydrocarbons (PAH).
Keywords: ecological, smoking, common carp, gravel filter, safety
Introduction
Production of smoked meat is common in Serbia and the region, which makes smoked products
very popular and consumed quite often. In this region, smoked fish is mostly eaten during the
Christmas fastening period. The consumption of smoked fish in our country is lower compared to
other countries in the EU, but it shows the tendency for the significant growth. The taste of smoked
carp meat resembles the taste of other traditional smoked products and therefore affects the increase
of the fish consumption in our market.
The main technological problem when it comes to the fish meat is that it goes bad very quickly
(FAO, 1995; Adelaja et al, 2013; Rzepka et al, 2013; Cirkovic et al, 2015). This characteristic is
mainly due to the lack of activity of the milk acid, that is, the pH value being close to the neutral
value and high activity of water (aw) being higher than 0,95 (Milijasevic et al, 2010).
In order to make the fish meat more durable (better preserved) as the product, we have to take
knowing and professional care of the fish from the moment they are caught until the moment they
are sold to the consumer. Processing of the fish meat creates adverse conditions for survival of
microorganisms, the main cause of fish meat going bad, and they act in a bacteriostatic,
bactericidical and the combined way (Cirkovic et al, 2002). The fish processing enables selling it on
a much bigger market, that is, it makes it more available for the consumers. The fish processing
industry is not well developed in our country because for many years the amount of fish was just
not enough and also because of the consumers' habits. This led to selling all the fish raw (Cirkovic
et al, 2002; Cirkovi et al, 2015). The main purpose of the smoking process is to preserve the
product. This is partially done by drying it out and partially through the transfer of antimicrobiological compositions, such are the phenols in smoke. Smoked fish is considered to be a
ready to- eat meal (Ready-To-Eat, RTE), and lately, its consumption has increased significantly in
many European countries (Gallart-Jornet et al, 2007). Approximately 15% of the fish for human
consumption is available in either cold or hot variant (Stolyhwo and Sikorski, 2005). In contrast to
142
the times when the smoked fish meat was considered to be an item of luxury, today this is a
common product, available to the great number of people. Within this type of the fish products, the
smoked carp, silver carp and trout meat is available in our country (Pavlicevic et al, 2013).
Recently, the production of smoked common carp meat has suffered some changes in the
production process that include changing production conditions, as well as adapting recipes and
quality to industrial production conditions. The product obtained in this way has not all those
sensory characteristics of the products which consumers are given by craft production. The standard
quality of the hot smoked fish meat is not easily sustainable. It depends on the number of factors
related to the fish farming, fishing, transport, raw material, stunning, slaughtering, cutting off the
head and gills, descaling, exentration, washing, halving, brining, washing under pressure and
draining, drying, hot smoking, cooling, packaging and storing.
The acceptance of smoked fish in developed countries is based primarily on the sensory
characteristics (Yanar et al, 2006), while group of authors Akintola et al. (2013) confirmed the
nutritional qualities and adequacies.
It is known that the smoke, consisting of hundreds of components, also contains at least 100
polycyclic aromatic hydrocarbons (Polycyclic Aromatic Hydrocarbons, PAH) and their alkylated
derivatives. Some of them are proven to have carcinogenic characteristics (Stolyhwo and Sikorski,
2005). According to the latest classification of the carcinogenic PAH compounds, benzo[a]pyrene
(BaP) is a definite carcinogenic (group 1), dibenz[a,h]anthracene is probably carcinogenic (group
2A), but naphthalene, benzo[a]anthracene, chrysene, benzo[b]fluoranthene, benzo[k]fluoranthene,
benzo[j]fluoranthene and indenol[1,2,3-c,d]pyrene are classified as possible human carcinogens
(group 2B) (International Agency for Research on Cancer, 2012). Wood smoke has also been
classified as definite carcinogenic (group 1) (International Agency for Research on Cancer, 2012;
Essumang et al, 2014).
PAH compounds reach their maximum levels during burning of materials, wood or cigarettes at
500-700 C (Wenzl et al, 2006). This carcinogenic effect needs to be minimized by technological
procedures in the production of the smoked carp meat. These procedures imply construction of craft
smokehouses and chambers that serve the same purpose, choosing the materials with limited fat
content, choosing the most adequate type of wood, the height of the kiln in relation to the fish,
temperature of pyrolysis, the duration of drying and smoking, the temperature in the central part of
the fish and finally, using the different types of filters (Yurchenko and Mlder, 2005; Anggraini and
Yuniningsih, 2013).
Material and Methods
The carp fish was farmed on the fish farm Eka in Lukino Selo. The feed with 30% protein was
used for farming. The fish meat contained 6% fat. The fishing was done in autumn period, and the
fish was stored at the temperature of 4 C before it was processed.
Brining was done with a dry method with 2 % NaCl for 12 hours at room temperature. After that we
did washing under pressure and draining, then drying in the smoke generator with the gravel filter
for 1 h at 55 C, followed by hot smoking using beech sawdust until the temperature in the centre
of the product, which was continuously monitored, reached 65 C. This value was kept for 1h.
After that we continued with cooling down to the temperature of 10 C or less within 3 hours after
smoking, and then down to the temperature of 3 C or less within 12 hours. The analyses of the
smoked carp meat were done at the Scientific Veterinary Institute "Novi Sad". 20 samples of the
smoked carp meat were tested in total. The quality of the product was tested with the sensory,
chemical and microbiological methods.
Chemical analyses included determining of the PAH levels. The identification of PAHs was done
with an analytical method gas chromatographymass spectrometry (GC-MS) (Agilent
143
7890B/5977A MSD), based on comparison of the retention times of the peaks and target ions with
those obtained from standard mixture of PAHs (standards supplied by instrument manufacturer).
Quantification was based on external calibration curves prepared from the standard solution of each
of the PAHs. The coefficients of determination (r2) for the PAH standard calibration plots were
pyrene (0.99975), benzo[b]fluoranthene (0.99945), benzo[k]fluoranthene (0.99950), acenaphthylene
(0.99982), indenol[1,2,3-c,d]pyrene (0.99999), benzo[a]anthracene (0.99926), acenaphthylene
(0.99928) and flourene (0.99963).
Microbiological analyses were done according to the current Regulation (Regulation on General
and Special Conditions of Hygiene of Food at any Stage of Production, Processing and Transport,
the Official Gazette SRJ 72/2010) by determining/detecting Listeria monocytogenes (SRPS EN
ISO 11290-1/2010) in the final product.
Sensory characteristics of the final product, the smoked carp meat, were determined in a
quantitative-descriptive test (SRPS EN ISO 6658/2002), at the interval scale ranging from 1 to 5.
Five sensory evaluators, who had passed the sensory evaluation training in detecting and
recognizing smells (SRPS ISO 5496/2002) and whose senses had previously been tested using the
test for determining the sense of taste (SRPS ISO 3972/2002), were giving marks in sensory
characteristics.
Results
The total PAHs concentration in ecological smoked common carp meat was 279.60 g/kg. Maximal
concentrations of PAHs detected in the final product are: fluoranthen (63.93g/kg), naphtalene
(61.18 g/kg), acenaphthylene (60.97 g/kg), fluorene (50.58 g/kg), anthracene (21.56 g/kg),
acenaphtene (8.13 g/kg), fluoranthene (7.66g/kg ), pyrene (3.33 g/kg). The most important
thing is that PAHs from the groups 1, 2A i 2B (International Agency for Research on Cancer, 2012)
were not detected in the samples.
The reference method for determining the presence of Listeria monocytogenes (SRPS EN ISO
11290-1/2010) did not reveal any of its presence in all the samples. The results of the sensory
characteristics of the smoked carp meat are shown in Figure 1. The obtained results of chemical,
microbiological and sensory tests confirm the quality and safety of the smoked carp meat processed
in this ecological way.
Figure 1. The results of the sensory marks of the ecologically smoked carp meat
Sensory
characteristics
Appearance
Colour
Smell
Colour at the
intersection
Texture
Taste
Sd
CV%
4,51
4,67
4,83
4,67
0,60
0,52
0,49
0,66
13,30
11,13
10,14
14,13
4,83
4,76
0,86
0,42
17,81
8,82
144
In order to determine PAH compounds in food, various methods are used. They are:
fluorometricand spectrofotometric, high performance liquid chromatography, gas chromatography
mass spectrometry (GC-MS) or gas chromatography with flame ionization detector (Yurchenko and
Mlder, 2005). Gas chromatography is widely used to determine PAH compounds in food (Simko,
2002).
Non-processed fish can have small or undetectable amounts of different PAHs absorbed from the
environment, most commonly from the contaminated water because fish rapidly metabolizes PAHs
(Stolyhwo and Sikorski, 2005; Yurchenko and Mlder, 2005).
The levels of PAH in smoked fishery products from modern smoking kilns with external smoke
generation are higher than the levels in smoked fishery products from traditional smoking kilns
(Karl and Leinemann, 1996).
Temperature of smoke plays an important part in the amount of carciogenic PAHs that are created
during pyrolysis. The amount increases linearly with the smoking temperature within the interval of
400- 1000C (Simko, 2002). Direct exposure to smoke leads to a product with higher
concentrations of PAHs, whereas non-direct exposure to smoke leads to a product with lower
concentrations of PAHs (Simko, 2002; Duedahl-Olesen et al, 2010). Many studies have been
investigating the influence of different combustion woods and smoking duration on smoked food
PAH content and confirmed that soft resinous woods and longer smoking durations resulted in food
with higher PAH content (Stumpe-Viksna et al, 2008; Duedahl-Olesen et al, 2010; Forsberg et al,
2012)
The sum of PAH in smoked fish products in Denmark ranged from 22 g/kg in smoked mackerel
prepared in an electric oven to 1387 g/kg in herring smoked by direct smoking (Duedahl-Olesen et
al, 2006).
Traditional sauna smoked products are marketed as special delicacies, but during an official control
programme of BaP levels in Swedish smoked meat and fish, six samples of smoked fish which were
produced by traditional sauna smoking, had high BaP levels ranging from 8,4 to 14,4 g/kg.
Samples of meat and fish smoked by indirect technique all had BaP levels below limit of
quantification. Regional initiatives of Sweden support further development of the traditional sauna
smoking process and improvement of the quality of the smoked products (Wretling et al, 2010).
Forsberg et al. (2012) reported that traditional smoking of fish is still practiced, and is still a
significant component of the CTUIRs cultural and spiritual identity in the USA, but smoking
processes can introduce potentially harmful combustion by-products into the smoked fillets. That
was confirmed by their study in which the carcinogenic and non-carcinogenic PAHs in traditionally
smoked salmon were 40430 times higher than those measured in commercial products.
Investigation of potential carcinogenic PAH in two different smoked fish in Turkey showed a
significant correlation between the fish fat and the total PAHs level. Also, the content of PAH in
smoked fish depends on the concentration of these compounds in the wood smoke, smoking
temperature and smoking time. The concentration of total PAHs varied between 23.83- 79.74 g/kg
(Basak et al, 2010).
The results of Essumang and the group of authors (2014) have shown the statistically significant
difference in PAH levels between smoking with no charcoal as a filter and smoking with charcoal
as a filter.
Yusuf et al. (2015) investigated the effect of fish smoking methods on dietary exposure to PAHs
and potential risks to human health. They proved that traditional method of smoking had 7
genotoxic PAHs.
Data reported in the literature on PAHs in smoked fish are highly variable and that can be attributed
to the differences in the procedures used for smoking. Some of variables are: the type and
145
Acknowledgments
This paper is a result of the research within the project TR 31011 The influence of the quality of
the food components for cyprinid fish species on the quality of meat, losses and the profitability of
production, financed by the Ministry of Science and Technological Development, Republic of
Serbia.
References
1.
Akintola S.L., Brown A., Abdullahi B., Osowo O.D., Bello B.O.: Effects of Hot Smoking and Sun
Drying Processes on Nutritional Composition of Giant Tiger Shrimp, Pol. J. Food and Nutr. Sci., 63, 4,
227-237, 2013
2. Anggraini S.P.A., Yuniningsih S.: Liquid Smoke Purification Process for Benzo (A) Pyrene Levels
Lowering on Food Safety, J.Agric.Food.Tech., 3, 12, 1-4, 2013
3. ATSDR: Case Studies on Enviromental Medicine: Toxicity of Polycyclic Aromatic Hydrocarbons
(PAHs), WB 1519, 2012
4. Basak S., Sengor G.F., Karakoc F.T.: The Detection of Potential Carcinogenic PAH Using HPLC
Procedure in Two Different Smoked Fish, Case Study: Istanbul/Turkey, Turkish Journal of Fisheries
and Aquatic Sciences 10, 351-355, 2010
5. Cirkovic M., Jovanovic B., Maletin S.: Ribarstvo, Poljoprivredni fakultet, Novi Sad, 2002
6. Cirkovic M., Ljubojevic D., Novakov N., Djordjevic V.: Gajenje i kvalitet mesa aranskih riba,
monografija,Nauni institut za veterinarstvo Novi Sad, Novi Sad, 2015
7. Duedahl-Olesen L., Christensen J.H., Hojgard A., Granby K., Timm-Heinrich M.: Influence of smoking
parameters on the concentration of polycyclic aromatic hydrocarbons (PAHs) in Danish smoked fish.
Food additives & contaminants, 27, 12941305, 2010
8. Duedahl-Olesen L., White S., Binderup M.L.: Polycyclic aromatic hydrocarbons (PAH) in Danish
smoked fish and meat products. Polycyclic Aromatic Hydrocarbons 26, 163184, 2006
9. Essumang D.K, Dodoo D.K., Adjei J.K.: Effective reduction of PAH contamination in smoke cured fish
products using charcoal filters in a modified traditional kiln, Food Control, 35, 1, 85-93, 2014
10. Essumang D.K, Dodoo D.K., Adjei J.K.: Polycyclic aromatic hydrocarbon (PAH) contamination in
smoke-cured fish products, Journal of Food Composition and Analysis, 27, 2, 128-138, 2012
11. FAO: Quality and quality changes in fresh fish, FAO fisheries technical paper- 348 food and
Agriculture organization of the United Nations, 1995
146
147
Abstract
Numerous studies have confirmed the correlation between the prevalence of chronic disease and
human nutrition. In these studies, special emphasis is placed on the use of fats in human nutrition,
especially n-3 and n-6 fatty acids and their relation. The importance of conjugated linoleic acid
(CLA) for human health is also highlighted. Furthermore, the content and a ratio of fatty acids in
pig meat may be affected by choice of feeds for pigs. The aim of our research was to investigate the
impact of commercial preparations linseed, or of commercial preparations of CLA supplementation
in diets for pigs on fatty acid composition of pig meat. Fatty acid composition of feed for pigs and
pig meat was determined by gas chromatography.The use of linseed or CLA in the diet of pigs
significantly influenced the content of saturated, monounsaturated and polyunsaturated fatty acids
in pig meat. The meat of pigs fed with these supplements had significantly better ratio of n-6/n-3
fatty acids, compared to the meat of pigs fed without the addition of linseed preparation, or CLA.
The meat of pigs fed with the addition of CLA preparations revealed the presence of both isomers
of this preparation. The presence of these isomers has not been proven in the meat of pigs fed
without the addition of CLA.Adding linseed preparation, or preparation of CLA in food for pigs
improves the nutritional value of pigs meat.
Keywords: pigs nutrition, linseed, fatty acids, meat quality
Introduction
Numerous medical findings show that a significant role in the development of cardiovascular and
other chronic diseases in humans has a relationship between the two groups of polyunsaturated fatty
acids in the diet: n-6 acids, whose main representative is linoleic acid (C18: 2 n-6) and n-3 fatty
acids, whose main representative is alpha linolenic acid (C18:3 n-3).
Unsaturated fatty acids have mutually differences in chain length, number and position of double
bonds in molecules. The abbreviation "n-6" (or n-6) indicates that the first double bond in the
molecule of fatty acid is at the sixth carbon atom, as for "-3 '(or n-3) indicates that the first double
bond in the molecule of fatty acid is at the third carbon atom, counting from the methyl group. In
the natural resources most often reported unsaturated fatty acids belong to the n-6, n-3 and n-9
series.
The human body cannot synthesize essential fatty acids, but retains the ability to translate basic
essential fatty acid ingested with food (linoleic and -linolenic) in the so-called long-chain
polyunsaturated fatty acids with specific roles in the body. In these biotransformation are involved
enzymes desaturase and elongase and throughout their activities, as well as the amount of substrate,
depends the intensity and efficiency of these reactions (obaji, 2002).
148
Numerous studies confirm that increased intake of n-3 fatty acids can affect on decreasing the risk
of heart disease and vascular disorders, but also alleviating symptoms and improving the clinical
picture in some autoimmune and inflammatory disorders.
Interest in the role of polyunsaturated fatty acids has been launched by investigations in 70 th of the
last century, which have revealed a very low occurrence of vascular disease in the population of
Greenland Eskimos, despite their diet rich in fat and based on marine mammals and fish whose food
chain is based on algae and plankton rich in n-3 polyunsaturated fatty acids. Similar observations
were later confirmed by epidemiological studies in other populations with a similar diet, for
example, in coastal areas of Japan (Karolyi, 2007).
The ability of producing n-3 enriched meat products of pigs is very interesting for many producers
and consumers, as noted above. In monogastric animals such as pigs, fatty acids are absorbed from
the gastrointestinal tract with small changes. In fact, the fatty acid profile of tissue directly reflects
the profile of fatty acids in animal nutrition. In ruminants, however, the fatty acids from food in the
digestive tract are changed, under the influence of the process of microbial fermentation and
biohydrogenation, prior to absorption from the gastrointestinal tract (Baltic et al., 2011b; Markovic
et al., 2011b).
In modern human nutrition the ratio of n-6/n-3 polyunsaturated fatty acids is relatively wide (1015:1), so that today in human diet efforts is made in order to enrich food with n-3 fatty acids, so that
this relationship could be approximate to optimal (4:1).
In the pig nutrition soybean, sunflower and other oilseeds that contain fatty acids of n-3 series and
fatty acids of n-6 series are used (Baltic et al., 2011; Markovic et al., 2011).
Linseed contains about 35 to 45% oil compared to the mass of dry material (Karleskind, 1996).
More than 70% of this oil contains polyunsaturated fatty acids, primarily alpha-linolenic acid
(ALA), an essential -3 fatty acids and linoleic acid (LA), essential n-6 fatty acids.
It should be noted that linseed meal contains the fatty acid profile that is similar, if not identical, as
linseed, considering that the total oil content of the meal is variable depending on the method used
for extraction of oil, which affects the energy value of this nutrient.
The CLAs are a mixture of positional and geometric isomers of linoleic acid (9c,12c C18:2), which
were first identified in rumen fluid as an intermediate in the biohydrogenation process (Bartlett and
Chapman, 1961). In synthetic CLA preparations the 9c,11t and 10t,12c isomers are predominant
(often in a 1:1 ratio). It appears that the 9c,11t isomer has positive effects on some types of cancer
by inhibiting tumorogenesis, while 10t,12c isomer could be responsible for changes in whole-body
fat deposition (Pariza et al., 2001).
In addition, dietary CLA seems to be highly deposited in body tissues of monogastric animals and
as a result, in pork and meat products (Corino et al., 2005; Jiang et al., 2010).
The aim of this study was that in two experiments on pigs choice of ingredients, meal examination
to influence the fatty acid composition and meat quality of pigs.
group (E-I) had a grain sunflower, second experimental group (E-II) preparation of linseed
(Vitalan, Vitalac, France) in the recommended inclusion rate of 2.5% in the mixture, and the third
experimental group (E-III) full-fat soybean meal included in the diet (Table 1). The fatty acid
composition of feed and meat content of n-3 and n-6 fatty acids, as well as their relationship with
feed and meat were investigated.
In the Experiment 2 the aim of the research was to investigate if the addition of CLA in the diet of
fattening pigs, affects the fatty acid composition of meat. Sixty crossbreed pigs (Yorkshire
Landrace), with an initial body weight of 60 kg were used in this study. The pigs were divided
into two groups (Control-C and Experimental-E) of 30 pigs in each and fed with a standard mixture
(NRC, 1998), from 60 to 110 kg (fattening period of 60 days). The diet between groups differed
only in the fact that the experimental group had commercially prepared conjugated linoleic acid
60% CLA (Lutalin, BASF, Germany), added in the feed, at the recommended rate of 2.0% of the
mixture. The mixtures were balanced and completely satisfied the needs of the animals in this
production stage. The nutrient composition of the diets is detailed in Table 1.
Table 1. Raw material of the final feed for pigs fattening (%)
Feed
Corn, grain
Wheat, grain
Barley, grain
Full-fat soybean meal
Soybean meal
Sunflower, grain
Wheat bran
Vitalan
Lutalin
Dicalcium phosphate
Chalk
Salt
Vitamin mineral premix
E-I
Experiment 1
E-II
E-III
46.7
15.0
11.5
7.5
16.2
-
50.80
14.0
13.0
16.50
2.5
51.0
14.0
14.60
1.0
16.20
-
0.50
1.20
0.40
1
100
0.60
1.20
0.40
1
100
0.60
1.20
0.40
1
100
Experiment 2
C
E
48
28
16
5
3
100
46
28
16
5
2
3
100
The total lipids, for fatty acid determination, were extracted from pig muscle tissue with
hexane/isopropanol mixture by accelerated solvent extraction (ASE 200, Dionex, Germany). After
the evaporation of solvent to dryness under the stream of nitrogen, total lipids were converted to
fatty acid methyl esters (FAME) by trimethylsulfonium hydroxide. FAMEs were determined by
Shimadzu 2010 gas chromatograph equipped with flame ionization detector (FID) and cianopropyl
HP-88 capillary column (100m 0.25 mm 0.20m) (Trbovi et al., 2011).
Meat samples (M. longissimus dorsi) from each pig in all groups for analysis of fatty acid
composition analysis were taken at the end of the both experiments, after slaughtering, processing
and chilling of the carcasses.
Results
In these studies, we have investigated the quantities and proportions of fatty acids in pork meat
when fed diets with variable fatty acid content. In the examined total fatty acid content of pig feed,
(Table 2) it was noticed that there was a statistically significant (p<0.01) difference between groups
(Experiment 1). The complete feed mixture of E-II group, which contained the preparation of
150
extruded linseed, had a significantly lower content of SFA and significantly higher PUFA content
(p<0.01), compared to the other two groups.
Since the fatty acid content was significantly different, that resulted in different ratios of n-6/n-3. In
the Experiment 1, the most beneficial ratio of n-6/n-3 was observed in E-II group (5.57) (a group
that was fed linseed preparation), compared to E-I group (52.65) and E-III group (11.00) (p <0.01)
(Table 2).
Table 2. The fatty acid composition of feed (%), and the ratio n-6/n-3
FA
SFA
MUFA
PUFA
n-6
n-3
n-6/n-3
c9t11CLA
t10c12CLA
c9t11CLA+
t10c12CLA
E-I ( X SD)
20.60B 0.46
35.29A,B0.56
43.54AB0.76
42.73AC0.76
0.81AC 0.1
52.65AC1.10
-
Experiment 1
E-II ( X SD)
18.38AB0.60
25.46B0.26
55.99A0.70
47.46AB0.60
8.53AB0.22
5.57AB0.14
-
E-III ( X SD)
20.17A0.32
25.51A0.32
54.33B0.48
49.79BC0.41
4.54BC0.22
11.00BC0.54
-
Experiment 2
C ( X SD)
E ( X SD)
22.21A0.40 17.93A0.27
38.31A0.20 25.71A0.24
39.48A0.60 56.36A0.32
37.98A0.55 53.94A0.18
1.47A0.07
2.38A0.22
25.78a1.11 22.80a2.21
ND
2.570.02
ND
2.550.01
ND
5.120.03
Legend: A, B, C the same letter indicates significant difference of p<0.01; a the same letter indicates significant difference
of p<0.05
In the Experiment 2, significant differences between the contents of fatty acid in the feed of control
and experimental groups were observed. SFA and MUFA in the feed of the control group were
significantly higher (p<0.01) than in feed of the experimental group. The content of n-3 and n-6
fatty acids, was significantly higher (p<0.01) in the feed of the experimental group. Similarly the
most beneficial ratio of n-6/n-3 was observed in the feed of the experimental group (p<0.05) (Table
2). CLA isomers c9t11CLA and t10c12CLA were detected in the feed supplemented with CLA
(experimental group) and were below the detection limit in the control group (Table 2).
The average content of SFA and MUFA in the meat (Experiment 1) was higher in the group of pigs
fed with linseed preparation (E-II), but on the other hand the average content of PUFA in this group
was lower as well as the n-6/ n-3 ratio compared to the other two groups of pigs (p<0.01) (Table 3).
In the Experiment 1, meat from the group which was fed with linseed preparation, E-II group, had
the highest percentage of SFA (37.910.75%), which was significantly higher (p<0.01) compared to
the E-I group, while between E-II and E-III groups no significance was observed (Table 3).
Table 3. Fatty acid composition in meat (%), and ratio
Experiment 1
FA
SFA
MUFA
PUFA
n-6
n-3
n-6/n-3
c9t11CLA
t10c12CLA
c9t11CLA+
t10c12CLA
Legend: A the same
p<0.05
Experiment 2
E-I ( X SD)
36.98A0.25
39.59AC0.12
23.17AC0.28
22.53AC0.28
0.69AC0.01
32.40AC0.51
-
E-II ( X SD)
37.91A0.75
43.71AB0.28
17.99AB0.44
16.98AB0.56
1.23AB0.03
13.67AB0.08
-
E-III ( X SD)
37.540.05
41.42BC0.05
20.87BC0.08
19.76BC0.07
1.12BC0.02
17.84BC0.55
-
C ( X SD)
43.33A1.38
46.72A1.88
9.95a0.60
9.510.57
0.320.04
29.72a3.60
ND
ND
E ( X SD)
53.48A1.07
37.53A0.28
8.99a0.92
8.560.90
0.360.03
24.58a2.97
2.370.01
1.190.01
ND
3.560.71
letter indicates significant difference of p<0.01; a the same letter indicates significant difference of
151
Meat from E-II group (Experiment 1) of pigs contained 43.710.28% of MUFA, which was
significantly higher (p<0.01) and 17.990.44% of PUFA, which was significantly lower (p<0.01)
compared to E-I and E-III group. The meat of pigs that were fed with soy (E-III group) was
41.420.05% of MUFA and 20.870.08% of PUFA, which was significantly higher (p<0.01)
compared to the E-I group that was fed with sunflower grain, as a source of fatty acids (Table 3).
It was found that the average content of saturated fatty acids in the meat of the experimental group
of pigs (53.481.07%) was significantly higher (p<0.01) than the average content of saturated fatty
acids in the meat of pigs of the control group (43.33 1.38%). The average content of
monounsaturated or polyunsaturated fatty acids (37.530.28%, 8.990.92%, respectively) in the
experimental group pig meat was significantly lower (p<0.01, p<0.05, respectively) than the
average content of monounsaturated or polyunsaturated fatty acids in the meat of pigs of the control
group (46.721.88%, 9.95 0.60, respectively). There was no statistically significant difference
between the average content of n-3 and n-6 fatty acids in meat sample (0.360.03%, 8.560.90%,
respectively) and a control group of pigs (0.320.04%, 9.510.57%, respectively).
The average ratio of n-6/n-3 fatty acids in meat pigs experimental group (24.582.97) were
significantly lower (p<0.05) than the same ratio in the meat of the control group pigs (29.72 3.60)
as shown in Table 3.
The average content of conjugated linoleic acid c9t11, t10c12 and total CLA content in the meat of
pigs of the experimental group was 2.370.01%, 1.190.01% and 3.560.71% (respectively). In the
meat of the control group of pigs the CLA was not detected (Table 3).
Discussion
A negative attitude towards the consumption of meat has many different causes. One of the most
common is the health concern. Today, virtually everyone knows that there is a connection between
diet and health. Scientific discoveries and better informed consumers have contributed to the
understanding of these connections. Among the risk factors of numerous chronic noncommunicable diseases (cardiovascular and cerebral diseases, hypertension, malignant neoplasms,
diabetes, obesity, nephrolithiasis, bile duct diseases, osteoporosis, dental caries), which are
numerous (more than 200), nutrition is of the great importance.
The fatty acid profile of the meat directly reflects the fatty acid profile in feed (Eastwood, 2008).
Since linseed has a desirable fatty acid composition, many producers are interested to include
linseed in swine finisher in order to improve the fatty acid composition of meat.
In this study (Experiment 1) results indicate that by changing sources of fat and fatty acid
composition of feeds, the fatty acid composition of meat can be affected. The average content of
saturated (SFA), monounsaturated (MUFA) and polyunsaturated (PUFA) fatty acids, as well as the
average contents of n-6 and n-3 fatty acids in the feed, between groups, were statistically
significantly different.
It has been found that the average content of saturated fatty acids in pork meat of pigs fed with the
addition of linseed was significantly higher compared to the SFA content of the meat from pigs fed
with the addition of sunflower. The average content of polyunsaturated fatty acids in pork from pigs
fed with the addition of linseed was significantly lower compared to average content of these acids
in pork from pigs in the other two groups (p <0.01) (Todorovic, 2014).
The average content of n-6 fatty acids in meat was significantly lower, and content of n-3 fatty acids
significantly higher in pork meat of pigs fed with the addition of linseed (p<0.01). Pork from pigs
fed with additions of linseed had a statistically significantly better ratio of n-6/n-3 fatty acids.
152
Apart from the optimal quantity of essential fatty acids in nutrition, their ration is also very
important. The ratio of n-3/n-6 fatty acids is optimal if it is in a range 1:4 to 1:5. It is recommended
that polyunsaturated fatty acids present 10 to 20% of total daily intake of lipids. Fatty acids n-3
have a protective effect on the cardiovascular system and the decrease of frequency of deaths
caused by cardiovascular diseases. These acids decrease triglycerides in blood, and blood pressure,
regulate the activity of protein kinase C that have a role in angiogenesis and slow down the growth
of tumor metastases. An important source of n-3 fatty acids is the fish meat of northern sea fish
(mackerel, herring, sardines, salmon) (Losso, 2002; Pariza, 1997).
One of the first studies about the effects of linseed on meat lipid profile was performed by Cunnane
et al. (1990). In this experiment, from the age of two till the tenth week of age feed was
supplemented with 5% of linseed. Piglets had significantly higher levels of ALA in the liver,
kidney, heart, skin, subcutaneous adipose and muscle tissue.
Later, other researches performed trials in order to determine the optimal level and the length of
supplementation of linseed in feed, in order to ensure that the enrichment of n-3 fatty acids does not
negatively affects meat quality. Romans et al. (1995a) studied the influence of different
concentrations of linseed in feed (5, 10 and 15%) 25 days before the slaughter. These authors
concluded that linseed should not be used in the feed of finisher pigs at the level higher than 15% in
order to maintain the meat sensory properties. In the other study, Romans et al. (1995b) studied the
different length of linseed use in feed (15% linseed) 7, 14, 21 and 28 days before the slaughter. The
ALA content of back fat adipose tissue significantly linearly increased with the increase in the
length of feed supplementation with linseed. A large number of experiments were performed in
final pig fattening stage (Raj et al., 2010; Matthews et al., 2000; Vclavkova and Bekova, 2007;
Enser et al., 2000 and Thacker et al. 2004).
Okanovi et al. (2010) investigated the impact of feed enriched with linseed on the content of n-3
fatty acids in pork, from pigs with an average weight of 110 kg. Feed containing linseed resulted in
higher concentrations of n-3 fatty acids (> 7 mg/100 g), which decreased ratio of n-6 and n-3 fatty
acids in meat (<3) making it better for human health.
The CLA concentration in muscle tissue may be further enhanced when CLA supplementation is
combined with additional dietary fat (Gatlin et al., 2002). Adding CLA in the mixture for pigs
(Experiment 2) has significantly influenced the fatty acid composition of the mixture. It was found
that the experimental group of pigs had significantly increased the content of polyunsaturated fatty
acids (PUFA), while the amount of saturated and monounsaturated fatty acids was reduced in the
same group. Adding a CLA mixture to the feed of experimental groups of pigs increased content of
n-6 fatty acids, as well as the void content of n-3 fatty acids. The swine feed by adding CLA to
change the attitude of n-6/n-3 fatty acids, which is caused by the content of these acids in mixtures.
Results of n-6/ n-3 fatty acid ratio in the diets of the control and experimental groups of pigs are
shown in Table 2. The average content of isomers c9t11CLA and t10c12CLA in feed for the pigs of
the experimental group were nearly identical, which is understandable, given the fact that the
Lutalin preparation, according to the producer statement contains 50% and 50% c9t11CLA
t10c12CLA (Table 2).
As a part of these investigations have been two isomers of CLA, c9t11CLA and t10c12CLA, as a
supplement mixture for pigs. Both of these acids were found in the meat of pigs, provided that the
content c9t11CLA was almost twice the content t10c12CLA (Table 3).
It is notable that it is not the same degree of adoption and incorporation of both isomers of
conjugated linoleic acid were observed in the feed. Isomer c9t11 is more suitable for installation in
intramuscular fat depots (Panti, 2014).
A number of the current research is directed at manipulating the fatty acid content of meat animals
in order to increase n-3 and CLA content (Enser et al., 1998). The cereal-based diet commonly
153
offered to poultry and pig supplies mainly n-6 PUFA and a small amount of n-3 PUFA. This is
reflected in the fatty acid composition of the animal product. Dietary modification of poultry meat,
eggs or pork meat in order to increase the content of n-3 PUFA requires a supply of n-3 PUFA from
the diet (Nieto and Ros, 2012). Many studies in order to manipulate the fatty acid composition of
the meat using whole oilseeds have been conducted.
Several reports indicate that CLA supplementation increases the amount of saturated fatty acids
(C14:0, C16:0, and C18:0) and decreases the amount of MUFA fraction (mainly C18:1) in pig the
tissues by down-regulating the D9-desaturase activity (Eggert et al., 2001; Gatlin et al., 2002; Joo et
al., 2002; Lauridsen et al., 2005; Smith et al., 2002; Thiel-Cooper et al., 2001).
Conclusion
A diet enriched with extruded linseed had a beneficial impact on the content of n-3, n-6 acids and
the ratio of n-6/n-3, which is important for the health of consumers. Chemical analysis of the fatty
acid composition of complete mixtures found that the feed which was included preparation of
linseed had significantly lower SFA content, and content is significantly higher PUFA mixture of
full fat soybean meal. Also, the ratio of n-6/n-3 fatty acids in feeds linseed group was lower (5.567)
in comparison to a composition for a full fat soybean meal group (11.00) (p<0.01). By adding a
mixture of linseed to the mixture for finishing pigs the meat with favorable fatty acid composition
and favorable ratio of n-6/n-3 fatty acids compared to pigs which had no linseed in the diet was
obtained.
The inclusion of high dose of dietary CLA in pigs of conventional genotype (Yorkshire
Landrace) increased the CLA content in pig meat. Also, the addition of CLA in the diet of pigs
increases the content of the SFA and reduces the content of MUFA and PUFA in the pig meat.
The results from this study show that the pig products can be modified to in order to provide a
significant increase the functional lipids, which can have a positive influence on the human health.
Acknowledgment
The study was conducted within the project "The selected biological threat to the safety/quality of
food of animal origin and control measures from the farm to the consumer", TR 031034 financed by
the Ministry of Education, Science and technological development of the Republic of Serbia.
References
1.
2.
3.
4.
5.
6.
Balti .M., Markovi Radmila, orevi Vesna: Nutrition and meat quality. Tehnologija mesa, 52, 1,
154-159, 2011b
Balti .M., Markovi Radmila, Dokmanovi Marija, efer D., Karabasil N., Todorovi Milica: Ishrana
i kvalitet mesa svinja. Zbornik radova 9.Simpozijuma-Zdravstvena zatita selekcija i reprodukcija
svinja. Veterinarski Institut Poarevac, Srebrno jezero, 2011,139-146
Bartlet, J.C. and D.G. Chapman: Detection of hydrogenated fats in butter fat by measurement of cistrans conjugated unsaturation. J. Agric. Food Chem. 9: 1961, 50-53
Corino Carlo, Alessia Di Giancamillo, Raffaella Rossi, Cinzia Domeneghini, , Dietary Conjugated
Linoleic Acid Affects Morphofunctional and Chemical Aspects of Subcutaneous Adipose Tissue in
Heavy Pigs, J. Nutr., 135, 6, 1444-1450, 2005
Cunnane S.C., Stitt P.A., Ganguli S., Armstrong J.K.: Raised omega-3 fatty acid levels in pigs fed flax.
Can. J. Anim. Sci.,70, 251-254, 1990
Eastwood Laura: The nutritional value of flax seed meal for swine. PhD Thesis. Departmant of Animal
and Poultry Science. University of Saskatchewan. Canada. 2008
154
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
Enser M., K.G. Hallett, B. Hewett, G.A.J.Fursey, J.D. Wood,. and G. Harrington: Fatty acid content and
composition of UK beef and lamb muscle in relation to production system and implications for human
nutrition. Meat Science, 49:329341, 1998
Enser M., Richardson R.I., Wood J.D., Gill B.P., Sheard P.R.: Feeding linseed to increase the n-3 PUFA
of pork: fatty acid composition of muscle, adipose tissue, liver and sausages. Meat Sci., 55: 201-212,
2000
Eggert J.M., M.A. Belury, A. Kempa-Steczko, S.E. Mills and A.P. Schinckel: Effects of conjugated
linoleic acid on the belly firmness and fatty acid composition of genetically lean pigs. Journal of Animal
Science. 79:28662872, 2001
Gatlin LA, See MT, Larick DK, Lin X, Odle J.: Conjugated linoleic acid combination with
supplemental dietary fat alters pork fat quality. J Anim Sci., 132:310512, 2002
Jiang Z.Y., Yang L., Jiang S.Q., Lin Y C., Zhong W.J., & Zheng C. T.: Conjugated linoleic acid
differentially regulates fat deposition in backfat and longissimus muscle of finishing pigs. J Anim Sci,
88, 1694-1705, 2010 http://dx.doi.org/10.2527/jas.2008-1551
Joo S.T., J.I Lee, Y L. Ha and G.B. Park: Effects of dietary conjugated linoleic acid on fatty acid
composition, lipid oxidation, color, and water-holding capacity of pork loin. Journal of Animal Science,
80:108112, 2002
Karleskind A.: Oils and Fats Manual, Vol.1, Intercept Ltd, Andover, Hampshire, UK, 1996
Karolyi D.: Polinezasiene masne kiseline u ishrani ljudi. Meso, IX,.3, 151 158, 2007
Lauridsen C., H.Mu and P. Henckel: Influence of dietary conjugated linoleic acid (CLA) and age at
slaughtering on performance, slaughter- and meat quality, lipoproteins, and tissue deposition of CLA in
barrows. Meat Science, 69:393399, 2005
Losso N.J, Preventing degenarative diseases by anti-angiogenic funtional foods. Food Technology, 56,
6: 78-87, 2002
Markovi Radmila, Todorovi Milica, efer D., Karabasil N., Radulovi S., Drljai A., Balti .M.:
Znaaj izbora hraniva za masnokiselinski sastav mesa. Zbornik referata i kratkih sadraja 22.
Savetovanja veterinara Srbije, Zlatibor, 95-111, 2011b
Markovi Radmila, Balti .M., Marija Dokmanovi, Radulovi S., Jelena uri, Milica Todorovi,
Drljai A.: Ishrana i kvalitet mesa svinja- pogled u budunost. Veterinarski urnal Republike Srpske,
XI, 1, 30-36, 2011
Matthews K.R., Homer D.B., Thies F., Calder P.C.: Effect of whole linseed (Linum usitatissimum) in
the diet of finishing pigs on growth performance and on the quality and fatty acid composition of
various tissues. Br. J. Nutr., 83: 637-643, 2000
Nieto, G. and G. Ros: Modification of Fatty Acid Composition in Meat Through Diet: Effect on Lipid
Peroxidation and Relationship to Nutritional Quality A Review. Chapter 12, 2012
http://dx.doi.org/10.5772/51114
NRC: Nutritional requirements of swine. 10th Ed. NRC., Washington, DC, 1998
Okanovi ., Ili N., Ivanov Duica, Pali D., Drobnjakovi R., Vukevi ., Ikoni P.: Influence of
linseed enriched diet on omega-3 fatty acids content in pork. Krmiva, 52, 189-194, 2010
Panti Sran: Uticaj konjugovane linolne kiseline na proizvodne rezultate, kvalitet mesa i proizvoda od
mesa svinja u tovu, Doktorska disertacija, Fakultet veterinarske medicine Univerziteta u Beogradu,
2014
Pariza M.W.:Conjugated linoleic acid, a newly recognized nutrient. Chemistry and Industry, 16: 464469, 1997
Pariza M.W., Park Y., Cook M.E.: The biologically active isomers of conjugatedlinoleic acid. Progress
in Lipid Research, 40, 283298, 2001
Raj Stanislawa, Polawska Ewa, Skiba Grzegorz, Weremko Dagmara, Fandrejewski H., Skomial J.: The
influence of dietary source of fatty acids on chemical composition of the body and utilization of linoleic
and linolenic acids by pigs. Animal Science Papers and Reports, 28, 4, 355-362, 2010
155
156
Abstract
Maintaining bird health, regarding diseases or agents acting on the gastrointestinal tract, is crucial in
broiler production, since this is the entry route of nutrients for bird development. Also, it is well
known that broiler production is impossible without antibiotics, which are used as growth promoters
and in order to suppress overgrowth of pathogenic microflora in the gastrointestinal tract. Taking
into account this, we investigated the growth promoting and beneficial effects of three
phytoadditives (Ocimum basilicum, Thymus vulgaris and Pimpinella anisum) on growth
performances (body weight, total feed intake, feed conversion ratio and carcass yield),
concentrations of glucose, total proteins, albumin, total bilirubin, triglycerides and activity of
creatine kinase enzyme, in broiler chicks at 56 days of age. On the day of hatching 150 broiler
chicks, were divided into five equally groups (n=30). The control group (1st group) of broilers
received a basal diet (BD) without any feed additive. The second, third and fourth groups of chicks
were fed BD enriched with 1% of Ocimum basilicum pulverised herba, 0.5% of Ocimum basilicum
and 0.5% of Thymus vulgaris pulverised herba and 0.5% of Thymus vulgaris herba and 2% of
Pimpinella anisum pulverised fructus, respectively. The fifth group was fed with BD mixed with
Salinomycin (60 ppm). The results indicated that feeding the diets enriched with selected herbal
supplement failed to affect the growth performance of chickens at 56 days of age. In addition, this
supplementation had no influence on glucose metabolism, but we observed beneficial effects on
some parameters of protein metabolism. The concentration of total proteins was significantly higher
in chicks fed with phytoadditives; 41.711.08 vs 35.881.04 g/L; p<0.01. Albumin concentration
was also significantly higher in experimental groups (28.291.32 vs 19.730.51 g/L; p<0.001).
Creatine kinase activity and total bilirubin concentration were significantly reduced in broilers fed
with phytoadditives; p<0.05. Ocimim basilicum in combination with Thymus vulgaris decreased the
concentration of tryglicerides (0.890.02 vs 1.230.05 mmol/L; p<0.001), but this was not the case
with other phytoadditives.
It could be concluded that supplementation of the diet with phytoadditives has a potential to
improve health status in broilers. Further examinations are needed in order to elucidate the exact
mechanism of action.
Key words: phytonutrients, growth performance, blood chemistry, broiler chickens
Introduction
Expansion of the poultry industry holds the greatest promise for bridging the animal protein gap in
the world. This is mainly due to the short generation interval of poultry, particularly of broilers.
However, the rising cost of poultry feed, problems of drugs residues, microbial resistance and
diseases have become major problems militating against the industry (Puvaa et al., 2013).
Maintaining bird health, regarding diseases or agents acting on the gastrointestinal tract, is crucial in
157
broiler production, since this is the entry route of nutrients for bird development. Also, it is well
known that broiler production is impossible without antibiotics and coccidiostats, which are used as
growth promoters and in order to suppress overgrowth of pathogenic organisms in the
gastrointestinal tract.
The prophylactic use of antibiotics in poultry nutrition in order to cause improvements in growth,
feed consumption, feed utilization and decreased mortality from clinical diseases is well
documented. But, the growing concern over the transmission and the proliferation of resistant
bacteria via the food chain has led to a ban of the feed use of antibiotic growth promoters in
livestock within the European Union since 2006 (Brenes and Roura, 2010). As a result, new
commercial additives derived from plants including aromatic plant extracts and their purified
constituents have been examined as a part of alternative feed strategies for the future. Such products
have several advantages over commonly used commercial antibiotics since they are residue free and
they are also, generally recognized as safe and commonly used items in the food industry (Lv et al.,
2011). These botanicals have received increased attention as possible growth performance
enhancers for animals in the last decade. Also, natural methods are likely to play an increasing
role in the control of the disease since they are well accepted by consumers. Plant products are
residue-free, and function by mechanisms other than those of chemotherapeutics, involving new
therapeutic molecules to which resistance has not yet developed (Orengo et al., 2011).
Plants and their extracts have been used for many centuries as treatments for ailment of many
pathological conditions, yet only in the past 20-30 years have scientists seriously begun to
determine whether plant-derived traditional remedies are effective, and, if so, their mode of action.
Less than 10% of approximately 250000 of the worlds flowering plant species have been
investigated scientifically for their pharmacological properties but almost 25% of active medical
compounds currently prescribed in the USA and UK were isolated from higher plants. Plants are an
important source for drug discovery particularly for parasites because of the long association
between the coexistence of parasites, humans and herbal remedies (Anthony et al., 2005). Recently,
a number of plants and their extracts have been used in poultry nutrition. Their functional
substances (such as flavonoids, polyphenols and terpenoids) are mainly secondary metabolites
synthesized by plants to deter herbivorous predators, repel competitors and attract pollinators
(Petrovi et al., 2011).
Taking into account this, we investigated the growth promoting and beneficial effects of three
phytoadditives (Ocimum basilicum, Thymus vulgaris and Pimpinella anisum) grown and harvested
in Serbia, on growth performances, concentration of glucose, total proteins, albumin, total bilirubin,
triglycerides and activity of creatine kinase enzyme, in broiler chicks at 56 days of age.
regimen (24 h of light per day) was kept throughout the fattening period. Relative humidity in the
room was maintained at 70%.
All birds were fed ad libitum with the commercial standard diets for broilers (Veterinarski ZavodZemun, Serbia): Starter from day 1 to 14; Grower from day 15 to 35 and Finisher from day
36 to 56. The control group (1st group) of broilers received a basal diet (BD) without any feed
additive. The second, third and fourth groups of chicks were fed BD enriched with 1% of Ocimum
basilicum pulverised herba, 0.5% of Ocimum basilicum and 0.5% of Thymus vulgaris pulverised
herba and 0.5% of Thymus vulgaris herba and 2% of Pimpinella anisum pulverised fructus,
respectively. The fifth group was fed with BD mixed with Salinomycin (60 ppm). The broilers had
free access to feed and water.
All experiments were performed according to our institutional guidelines for animal research and
principles of the European Convention for the Protection of Vertebrate Animals Used for
Experimental and Other (Official Daily N. L 358/1358/6, 18, December 1986).
Sample collection
None of broiler chickens in any group died during the trial. The body weight of broilers, feed
conversion ratio and carcass yield were among the growth parameters studied and recorded on the
day 56 of life. On day 56 of age all broilers were slaughtered by decapitation. Blood was taken
without anticoagulants presence, enabling the separation of blood serum. Sera were obtained after
a spontaneous blood coagulation attained by centrifugation lasting 10 min at 3000 rpm. Thus
obtained blood sera were frozen at -20 oC until further analysis.
Biochemical assaying
The kinetic method was used to determine creatine kinase (CK) enzyme activity, while triglycerides
concentration was determined after enzymatic hydrolysis with lipases and quinoneimine as
indicator. The biuret method was used to determine total protein concentration, while bromocresol
green was used to determine albumin concentration. Total bilirubin (the sum of conjugated and
unconjugated bilirubin) was determined in the reaction with diazonium ion of sulphanilic acid. All
of the above mentioned biochemical parameters were determined using commercial kits (Bayer
Diagnostics, Germany). Spectrophotometric measurements were performed with Cecil CE
2021UV/VIS spectrophotometer. Blood glucose concentration was determined by using PrecisionXtra plus test strips.
Statistical analysis
Statistical significance of differences of all examined parameters were determined by means of the
ANOVA, followed by the Tukey test. Data were expressed as means standard error. Significance
level was set at p < 0.05. Statistical analysis was performed using the Graph Pad Prism 5.0
Software, CA, USA.
Results
The effect of diet supplementation with 1% of Ocimum basilicum, 0.5% of Ocimum basilicum and
0.5% of Thymus vulgaris and 0.5% of Thymus vulgaris herba and 2% of Pimpinella anisum, in
experimental groups, as well as in control groups (C1 fed with BD; and C2 fed BD plus
Salinomycin) on the body weight, total feed intake, feed conversion ratio and carcass yield are
shown in Table 1.
159
Our results showed no statistically significant differences (p > 0.05) in the growth performance
indices (such as body weight, total feed intake, feed conversion ratio and carcass yield), between
groups of chicken.
Table 1. The effects of diet supplementation with 1% of Ocimum basilicum (I group), 0.5% of Ocimum
basilicum and 0.5% of Thymus vulgaris (II group) and 0.5% of Thymus vulgaris herba and 2% of Pimpinella
anisum (III group); Control groups (C1 fed with BD and C2 BD plus Salinomycin) on growth
performance of broilers at the age of 56 days
C1
I group
II group
III group
C2
260264.99
265470.48
257375.04
237555.25
269491.49
8405
7214
6985
7365
8210
2.15
1.99
1.87
1.89
2.05
Carcass yield
1605
1794
1768
1601
1715
Body weight
Concentrations of total proteins (Fig. 1) were statistically significant higher in groups of chickens
supplemented with phytoadditives; the higher concentrations were recorded in I (41.020.76 g/L; p
< 0.01) and III groups (41.711.08 g/L; p < 0.001) compared to C2 group (35.261.06 g/L).
The albumin concentrations (Fig. 2) were also statistically significant higher in broilers fed with
phytoadditives. Also, in this case the higher albumin concentrations were determined in I
(28.291.32 g/L; p < 0.001) and III groups (26.500.89 g/L; p < 0.001) compared to C1
(19.730.51 g/L) and C2 (19.310.53 g/L) groups. But it is also worth to mention that we
determined higher values of albumin in I group (fed BD plus 0.5% basil) compared to II group
(24.390.85 g/L; p < 0.05).
50
**
+
***
++
40
30
20
10
gr
ou
p
III
ro
up
II
g
Ig
ro
up
Fig. 1. The effects of diet supplementation with 1% of Ocimum basilicum (I group), 0.5% of Ocimum basilicum and
0.5% of Thymus vulgaris (II group) and 0.5% of Thymus vulgaris herba and 2% of Pimpinella anisum (III group); C1
control group fed with BD; C2 control group fed with BD plus Salinomycin) on concentration of total proteins in
broilers at the age of 56 days; + p<0.05; ++ p<0.01 vs. C1 control group; ** p<0.01; *** p<0.001 vs. C2 control group
Creatine kinase activity (Fig. 3) is another biomarker which can be used for evaluation, not only of
functional status of hepatocytes, but also for skeletal muscle integrity. In this experimental design
we determined the lowest activity in group of broilers fed BD with 0.5% of Ocimum basilicum and
0.5% of Thymus vulgaris (403.430.55 U/L; p < 0.01) and broilers fed BD with 0.5% of Thymus
vulgaris herba and 2% of Pimpinella anisum (470.141.06 U/L; p < 0.05), compared to C2 group
(695.874.5 U/L). There were no differences between C1 group (BD only) and I group of broilers
(BD plus basil), p > 0.05.
160
40
#
***
+++
Albumin g/L
30
***
+++
**
++
20
10
III
gr
ou
p
ro
up
II
g
Ig
ro
up
Fig. 2. The effects of diet supplementation with 1% of Ocimum basilicum (I group), 0.5% of Ocimum basilicum and
0.5% of Thymus vulgaris (II group) and 0.5% of Thymus vulgaris herba and 2% of Pimpinella anisum (III group); C1
control group fed with BD; C2 control group fed with BD plus Salinomycin) on albumin concentration in broilers at
the age of 56 days; ++ p<0.01; +++ p<0.001 vs. C1 control group; ** p<0.01; *** p<0.001 vs. C2 control group; # p<0.05 I
group vs. II group
1000
800
600
**
400
200
III
gr
ou
p
ro
up
II
g
Ig
ro
up
Fig. 3. The effects of diet supplementation with 1% of Ocimum basilicum (I group), 0.5% of Ocimum basilicum and
0.5% of Thymus vulgaris (II group) and 0.5% of Thymus vulgaris herba and 2% of Pimpinella anisum (III group); C1
control group fed with BD; C2 control group fed with BD plus Salinomycin) on creatine kinase activity in broilers at
the age of 56 days; * p<0.05; ** p<0.01 vs. C2 control group
15
10
**
+
gr
ou
p
III
ro
up
II
g
Ig
ro
up
Fig. 4. The effects of diet supplementation with 1% of Ocimum basilicum (I group), 0.5% of Ocimum basilicum and
0.5% of Thymus vulgaris (II group) and 0.5% of Thymus vulgaris herba and 2% of Pimpinella anisum (III group); C1
control group fed with BD; C2 control group fed with BD plus Salinomycin) on concentration of total bilirubin in
broilers at the age of 56 days; * p<0.05; ** p<0.01 vs. C2 control group
161
Concentrations of total bilirubin (Fig. 4) were the lowest in III group of broilers (8.110.16 mol/L;
p < 0.01) and in II group (8.270.31 mol/L; p < 0.05) compared to C2 group. It is of interest to
note that we did not find statistically significant difference between C1 (BD only) and C2 groups
(BD plus Salinomycin); p > 0.05.
Triglycerides concentration (Fig. 5) was the lowest in II group of broilers fed with addition of 0.5%
of Ocimum basilicum and 0.5% of Thymus vulgaris (0.890.02 mmol/L; p < 0.001), compared to C1
(1.230.05 mmol/L) and C2 (1.140.03 mmol/L). The same statistical differences (p < 0.001) were
noticed between I (1.200.02 mmol/L) and II group (1.250.06 mmol/L) of broilers.
We did not find any significant differences (p > 0.05) between broiler groups regarding
concentration of glucose (Fig. 6)
Triglycerides mmol/L
1.5
###
***
+++
1.0
0.5
III
gr
ou
p
ro
up
II
g
Ig
ro
up
0.0
Fig. 5. The effects of diet supplementation with 1% of Ocimum basilicum (I group), 0.5% of Ocimum basilicum and
0.5% of Thymus vulgaris (II group) and 0.5% of Thymus vulgaris herba and 2% of Pimpinella anisum (III group); C1
control group fed with BD; C2 control group fed with BD plus Salinomycin) on concentration of triglycerides in
broilers at the age of 56 days; +++ p<0.001 vs. C1 control group; *** p<0.01 vs. C2 control group; ### p<0.001 I group vs.
II group
Glucose mmol/L
15
10
gr
ou
p
III
up
ro
II
g
Ig
ro
up
Fig. 6. The effects of diet supplementation with 1% of Ocimum basilicum (I group), 0.5% of Ocimum basilicum and
0.5% of Thymus vulgaris (II group) and 0.5% of Thymus vulgaris herba and 2% of Pimpinella anisum (III group); C1
control group fed with BD; C2 control group fed with BD plus Salinomycin) on concentration of glucose in broilers at
the age of 56 days
(Markovi et al., 2009). Furthermore, now days consumers request poultry products that are free
from residual chemotherapeutics. The use of natural products as an alternative to drugs may be the
best solution to this consumer demand (Harper and Makatouni, 2002).
The herbal products are complex mixtures of ingredients, where the relative concentrations of each
phytomolecule may vary considerably (Orengo et al., 2012). Instead of testing each and every one,
our study focuses on three plants used alone or in combination. The aim of this research was to find
what plant and effective doses of herbal additives could have a beneficial impact on the growth
performance and health status of broilers.
Plants and their extracts (called essential oils) possess antibacterial, antifungal and antiviral
properties and have been screened worldwide as potential sources of novel antimicrobial
compounds, alternatives to treat infectious diseases and agents promoting food preservation
(Solorzano-Santos and Miranda-Novales, 2011). Weight gain is one of the most sensitive and
informative measure of efficacy of certain additives (Conway et al., 1999). From productive point
of view, it is of interest to mention that our results showed that phytoadditives can improve growth
performance in broilers, although there were no statistically significant differences between control
and experimental groups (Table 1). But, it is obvious from results showed in Table 1, that broilers
received BD with 0.5% of Ocimum basilicum and 0.5% of Thymus vulgaris had a better feed
conversion ratio and carcass yield compared to other groups of broilers. Our trial was performed
under highly hygienic conditions, which could have alleviated the animals response.
Environmental conditions, such as density and stress status of the animals, are important for
detecting performance responses to plants used as feed additives (Catala-Gregori et al., 2008).
According to Ertas et al. (2005), the combination of some plants extracts could present better effect
on the growth performance in poultry in comparison with their individual supplementation.
Synergism among some herbal constituents was highlighted in the in vitro studies performed by
Montes-Belmont and Carvajal (1998). Moreover, Burt (2004) reported that an antagonistic effect
has been expected as well. We presumed that potential synergistic effects between basil and thyme
could result in beneficial effect on both the growth performance of broilers and their
hepatoprotective effects.
Although total protein concentrations were also affected by phytoadditives in BD (Fig. 1), the most
remarkable are results in albumin concentrations (Fig. 2). Our results showed that 1% of basil had
the best stimulatory effect on hepatocytes to synthesized albumin, since the liver is the only site for
its synthesis. It is possible that eugenol and carvacrol, two major ingredients of basil (Lv et al.,
2011), are responsible for such liver response. Total proteins, also were much higher in herbal
supplemented broilers; the most higher values were recorded in group supplemented with mixture
of 0.5% basil and 0.5% of thyme (Fig. 1). If one takes into account that globulins are the second
protein fraction, very important as a part of defensive systems of an organism (and that they are
elevated in this case), the contribution of this herbal combination should not be neglected in
stimulation of broilers immune system.
Dietary supplementation of our plants combination to chickens for 8 weeks did not cause a
significantly lower blood plasma glucose concentration, and in this respect our results are
contradictory. Namely, a number of spices and herbs have a long history of traditional use in
treating elevated blood sugar levels. For example Jarvill-Taylor et al. (2001) reported that cinnamon
stimulated glucose uptake, glycogen synthesis, and activated glycogen synthase in 3T3-L1
adipocytes. Later studies of Bakirel et al. (2008) showed that ethanolic extracts of rosemary leaves
lowered blood glucose in normoglycemic and glucose-hyperglycemic rabbits.
In the present experiment, there was a significant decrease in total bilirubin concentration in birds
fed diets supplemented with 0.5% basil and 0.5% thyme (II group) and 0.5% basil and 2% anis (III
group). A decrease in total bilirubin level in the blood sera in the current study could be explained
by stimulation of uridine diphosphate glucuronyltransferase enzyme (UDP-glucuronyltransferase),
163
or by protective effects of essential oils presents in our combination of plants on wall of liver cells
(Figs. 3 and 4). There are several reports concerning an inhibition or activation of hepatic UDP
glucuronyltransferase by certain plant constituents. Siraki et al. (2005) found out that borneol
inhibited glucuronidation of non steroidal antiinflammatory drugs in isolated rat hepatocytes. This
could be also applied to activity of creatine kinase activity. Namely, we found significantly decrease
of its activity in the blood sera of broilers fed with combinations of basil and thyme (II group) and
basil and anis (III group). Undoubtedly, these findings coupled with total bilirubin concentration,
suggest that wall of liver cells was strengthened in some way (Bakkali et al., 2008).
Little is known about the effects of herbs on lipid metabolism of broilers. The effect of some
functional herb substances (cyclic terpenes) on serum cholesterol and total lipids in poultry were
reported by Faxova et al. (2009). On the other hand, no changes in serum cholesterol and plasma
lipids because of dietary supplementation of herb extracts (some monoterpens and essential oils) to
broilers were observed. Najafi and Torki (2010) found that total cholesterol, triglycerides and highdensity lipoproteins in the blood of broilers did not respond to the dietary supplementation of clove
extract. Our results are in line with these findings, except for the combination of 0.5% basil and
0.5% thyme (Fig. 5), where this combination of phytoadditives significantly decreased the
concentration of triglycerides in the blood of broilers.
It could be concluded that supplementation of the diet with phytoadditives has a potential to
improve health status in broilers. Further examinations are needed in order to elucidate the exact
mechanism of action.
Acknowledgment
This work was granted by Ministry of education, science and technological development, Republic
of Serbia; Grant No III 46009.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
Anthony JP., Fyfe L., Smith H.: Plant active components a resource for antiparasitic agents? Trends in
Parasitology, 21, 10, 2005
Bakirel T., Bakirel U., Kels O.U., Ulgen S.G., Yaroibi H.: In vitro assessment of antidiabetic and
antioxidant activities of rosemary (Rosmarinus officinalis) in alloxan-diabetic rabbits. Journal of
Ethnopharmacology, 116, 64-73, 2008
Bakkali F., Averbeck S., Averbeck D., Idaomar M.: Biological effects of essential oils - A review. Food
and Chemical Toxicology, 46, 446-475, 2008
Brenes A., Roura E.: Essential oils in poultry nutrition: Main effects and modes of action. Animal Feed
Science and Technology, 158, 1-14, 2010
Burt S.: Essential oils: their antibacterial properties and potential application in foods a review.
International Journal of Food Microbiology, 94, 223-253, 2004
Catala-Gregori P., Mallet S., Travel A., Orengo J., Lessire M.: Efficiency of a prebiotic and a plant
extract alone or in combination on broiler performance and intestinal physiology. Canadian Journal of
Animal Science, 88, 623-629, 2008
Conway D.P., Dayton A.D., McKenzie M.E.: Comparative testing of anticoccidials in broiler chickens:
the role of coccidial lesion scores. Poultry Science, 78, 529-535, 1999
Ertas O.N., Guler T., Ciftci M., Dalkilic B., Sinsek U.G.: The effect of an essential oil mix derived from
oregano, clove and anis on broiler performance. International Journal of Poultry Science, 4, 879-884,
2005
Faixova Z., Piesova E., Makova Z., Takacova J., Cobanova K., Leng L., Faix S.: Effects of borneol on
blood chemistry changes in chickens. Acta veterinaria (Beograd), 59, 177-184, 2009
164
165
Abstract
Marked climate changes led to frequent droughts and high temperatures that favor the growth of
molds, occurrence of plant diseases and pests and consequently, the toxin production. Having in
mind characteristic climatic conditions in Serbia in 2011/12 and 2013/14 production years, our
research was aimed at investigating their influence on contamination of animal feed and potential
consequent poisoning of milk by specific mycotoxins. The available results on crops contamination
for each year were correlated with the climatic conditions characteristic for the relevant year.
Extremely warm and dry 2011/12 production year (according to the report of Republic
Hydrometeorological Service of Serbia) was characterized also by high aflatoxin levels in maize.
Out of 67 examined maize samples, 61.2% were contaminated with aflatoxins, whereas 24% of
examined 75 milk samples contained aflatoxin M1 at concentrations above 0.5 g/kg. Contrary to
that, extremely humid climate conditions in 2013/14 production year resulted in particularly high
concentration of Fusarium toxins. Thus, 100% of 21 examined maize samples were contaminated
with deoxynivalenol and fumonisins, and 90% with zearalenone. Consequently, high percentage of
16 examined samples of complete feed mixtures for pigs were declared unsafe, that is, contaminated
with deoxynivalenol (75%) and zearalenone (44%). Comparison of the data on climatic conditions
with the levels and incidence of samples contaminated with aflatoxins and Fusarium toxins
revealed negative effects of climatic deviations (precipitation rate and temperature) in the territory
of Serbia on mycotoxicological safety of maize, and consequently animal feed and milk.
Keywords: mycotoxins, climate, feed, milk
Introduction
Mycotoxins are toxic compounds produced by filamentous fungi, which often contaminate cereal
food and feeds. Mycotoxins may possess carcinogenic, cytotoxic, immunosuppressive, neurotoxic,
estrogenic or teratogenic activity (Nei et al., 2014). The mycotoxins of greatest concern in Serbia
usually were Fusarium toxins such deoxynivalenol (DON, Jaji et al., 2008) and zearalenone (Jaji
et al., 2013), but also ochratoxin A as Aspergillus toxin (Jaki et al., 2011). In warm and humid
subtropical and tropical conditions, maize ears are ideal conditions for colonization and dominance
of Aspergillus flavus/parasiticus species, resulting in the formation of aflatoxins (Sanchis and
Magan, 2004). Until now, aflatoxins were not identified as common contaminant of cereals in the
territory of Serbia (Jaki et al., 2011; Kos et al., 2013). Moreover, high concentrations of
fumonisins were not recorded either (Jaki et al., 2012), thus, they were not addressed in legal
regulations pertaining to animal feed (Official Gazette RS, 2014). Mycotoxins cause individual
toxic effects to human and animal health; however, cumulative effect of low mycotoxin
166
concentration and potential synergistic effects of low levels of multiple mycotoxins are issues that
are receiving growing attention (Stojanov et al., 2013).
Production of mycotoxins on crops depends on climatic factors such as temperature and relative
humidity, thus, changing climate has a direct impact on mycotoxin production (Paterson and Lima,
2011). Accurate information is therefore needed on the impact of and relationship between key
factors related to climate conditions (water availability and temperature), and which are marginal
and which are optimum for germination, growth and toxin production (Sanchis and Magan, 2004).
Table 1 shows the optimal temperatures and water activity (aw) for mycotoxins production and
growth in vitro for some important plant pathogenic fungi.
Table 1. Optimal temperature (C) and water activity (aw) for mycotoxin production and growth on
different substrates (Sanchis and Magan, 2004).
Fungus species
Aspergillus flavus
Aflatoxins
33
(0.99 aw)
Mycotoxins production
Ochratoxin
Zearalenone DON
1530
(0.93 aw)
Fusarium
verticillioides,
F. proliferatum
25
(>0.98 aw)
F. graminearum
A. ochraceus
Penicillium
verrucosum
Fumonisins
2530
(0.98 aw)
25
(0.900.95 aw)
30
(0.99 aw)
Growth
35
(0.95 aw)
30
(0.90 aw)
2022
(0.98-0.995 aw)
30
(0.960.98 aw)
25
(0.95 aw)
Conditions adverse to the plant (drought stress, temperature stress, stress induced by pest attack,
poor nutrient status, etc.) encourages the fungal partner to develop more than under conditions
favourable to the plant with the expectation of greater production of mycotoxins. On the other side,
factors influenced by climate such as insect and other pest attack, soil condition and nutrient status
and agro-industrial methodology are potential and indirect triggers of fungal colonization and
mycotoxins production (Tirado et al., 2010). Temperature and rainfall are the climatic factors that
are most likely to be affected widely by future global change, and alterations in these are expected
to have a wide range of impacts on plants and on mycotoxins concentrations in plants (Miraglia et
al., 2009).
Maize can support different mycotoxin-producing molds, such as F. graminearum, F.
verticillioides, and A. flavus, and the dominant species is determined by meteorological conditions.
F. verticillioides, a producer of the fumonisin toxins, is the most common species on maize in
Southern Europe. Fumonisins have been associated with dry weather during grain fill and late
season rains. Therefore, the production of the toxins will be favored by the foreseen climate change.
While drought years may take most of crop value in the case of aflatoxin problems, mild
temperature and rain during maize plant growth is conducive to plant infection by F. graminearum
and DON levels (Miraglia at al., 2009). Therefore, changes in global temperature would directly
affect their growth and mycotoxins production capacity.
According to Paterson and Lima (2010) the biggest risk with respect to mycotoxins from climate
change will be found in developed countries with temperate climates (e.g. parts of Europe and the
United States of America, etc.) and the anticipated climate changes will present numerous
challenges for those involved in mycotoxins research and crop production in the near future.
167
A high priority over the next decade is the collation of accurate contamination and weather data,
together with the development of models to forecast the effects of climate change on mycotoxins,
with a view to providing the necessary foresight for strategic adaptation to climate change (Miraglia
et al., 2009; Paterson and Lima, 2010). Modelling studies provide increasingly realistic scenarios
for the influence of changes in the magnitude and variability of precipitation, temperature, etc. on
mycotoxins contamination.
Having in mind characteristic climatic changes that resulted in specific extreme conditions in Serbia
in 2011/12 and 2013/14 production years, our research was aimed at investigating their influence on
contamination of maize, feed and potential consequent poisoning of milk by specific mycotoxins.
1.75
2.11
156
37.36
168
41/67
61.2
As obvious from Table 2, 61.2% of samples revealed aflatoxin levels above DL. Out of 67
examined samples, 14 (21%) were unacceptable for animal feed, i.e., the level of total aflatoxins
exceeded 50 g/kg, which was maximum permitted level in animal feed according to the relevant
Regulation in Serbia of that time (Official Gazette RS, 2010). Namely, pursuant to new Regulation
(Official Gazette RS, 2014), maximum permitted content of aflatoxin B1 in animal feed is 30 g/kg,
thus in that case 22.4% of examined samples would have been declared unacceptable. Researches
on aflatoxin in maize (harvest 2012) in Serbia of other authors revealed similar results: 56%
positive samples out of which 5.4% with concentration above 50 g/kg and with a maximum
concentration reaching even 145.8 g/kg (krinjar et al., 2013); 68.5% positive samples with 29.5%
revealing toxin content >50 g/kg (Kos et al., 2013).
Maize contamination with high levels of aflatoxins has lead to consequent milk contamination with
M1, a metabolic product of aflatoxin B1. The results of the examination of milk samples are
displayed in Table 3. Eighteen (24%) examined samples contained more than 0.5 g/kg aflatoxin
M1, thus not complying with the legislative regulations in Serbia of that time (Official Gazette RS,
2013). When analyzing the obtained results in relation to EU regulations (EC, 2010), 73.3% of the
samples would have been declared unacceptable for human consumption because of aflatoxin
concentration above 0.05 g/kg
Table 3. Contents of aflatoxin M1 in milk samples in Serbia in 2013.
No. of samples
Toxin
Aflatoxin M1
DL*
(g/kg)
Positive/
total no. of
samples
Positive
samples
(%)
0.050.50
(g/kg)
0.500.80
(g/kg)
> 0.80
(g/kg)
0.05
55/75
73.3
37
10
* Because of high toxin concentration and max permitted level of 0.5 g/kg, the samples were diluted, thus
determination range encompassed concentrations from 0.05 to 0.80 g/kg
2.12
433.4
3.28
Complete swine mixtures
DON
Zearalenone
Fumonisins
(mg/kg)
(g/kg)
(mg/kg)
16
16
16
16
16
16
12
7
0
5.82
0.47
574
144
2.15
0.901
2.82
337.6
1.42
Complete poultry mixtures
DON
Zearalenone
Fumonisins
(mg/kg)
(g/kg)
(mg/kg)
7
Not
7
legislated
6
7
0
0
3.17
0.311
4.24
0.837
1.82
1.83
According to the results presented in Table 4, high incidence of samples positive to Fusarium toxins
was recorded in maize samples. DON and fumonisin contamination was confirmed in 100% of
examined maize samples, whereas 90.5% of samples were contaminated with zearalenone.
Although the concentrations of the examined mycotoxins in maize did not exceed the maximum
permitted levels (8 mg/kg for DON, 4000 g/kg for zearalenone and 60 mg/kg for fumonisins
(Official Gazette RS, 2014; EC, 2006)), maize contamination with these mycotoxins consequently
resulted in large number of contaminated samples of complete pig mixtures (100% samples
contaminated with all three toxins) and complete poultry mixtures (DON and fumonisin
contamination of 85.7% and 100% samples, respectively). As complete feed mixtures contain large
proportion of maize, high percentage of pig mixtures were declared inappropriate according to the
Regulation because of increased contents of DON (75.0%) and zearalenone (43.7%). Fumonisin
concentration in examined samples did not exceed the maximum permitted values according to EU
170
regulations (EC, 2006); however, their presence should not be neglected because of their potential
cumulative and synergistic toxic effects with DON and zearalenone.
According to the report of RHMZS, weather conditions in the territory of Serbia in 2014 revealed
several extreme deviations as compared to the annual range of average values for this climatic
region. By mid May, the territory of Serbia was characterized by abundant rainfall, which has never
been recorded so far. The summer 2014, (June-August) was characterized by moderately warm and
extremely rainy and humid season. During the vegetative period (April-September) 2014, the
average rainfall recorded in Serbia was 700 mm, which is the highest rate of rainfall during
vegetation period recorded in the last 45 years. In the major part of the country, the precipitation
rate was 2-3 times higher as compared to the multi-year annual average. Such extremely humid and
rainy weather brought about a number of plant diseases such as blight and decaying fungi as well as
intensive activity of the European corn borer (Ostrinia nubilalis). Frequent rains and increased air
humidity contributed to significantly slower ripening of maize, thus resulting in delayed harvesting.
Even though this rainy year contributed to record maize yields, increased grain moisture content as
well as grain damage caused by mouldy corn agents such as Fusarium and Penicillium was
recorded (RHMZS, 2014).
The presented results indicated that humid climatic conditions in 2014 significantly contributed to
the development of Fusarium moulds and consequent mycotoxin production in maize.
Conclusion
Based on the analysis of the content of examined mycotoxins and agrometeorological factors we
can conclude that temperate climate is the determining factor for mycotoxicological safety of
cereals in the region of Serbia. The deviation from annual average precipitation and temperature
values, that is, precipitation surplus or droughts as well as prolonged periods with extremely high
temperatures, impose the necessity of applying all available agro technical measures to prevent
development of fungi, maize diseases and insects and thus reduce the risk of mycotoxin
contamination. The obtained data on the level of mycotoxins and correlation of their contents are
useful instrument for developing a model to improve prediction of risks for mycotoxin
contamination in Serbia.
Acknowledgments
The work was financially supported by the Ministry of Education, Science and Technological
Development of the Republic of Serbia (Project No 172042).
References
1.
2.
3.
4.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Jaki S., Pruni B., Milanov D., Jaji I., Bjelica L., Abramovi B.: Fumonisins and co-occurring
mycotoxins in north Serbian corn, Proceedings for Natural Sciences, Matica Srpska Novi Sad, 120,
4959, 2011
Jaki S., Abramovi B., Jaji I., ivkov-Balo M., Mihaljev ., Despotovi V., oji D.: Co-occurrence
of Fumonisins and Deoxynivalenol in Wheat and Maize Harvested in Serbia. Bulletin of Environmental
Contamination and Toxicology, 89, 3, 615-619, 2012
Kos J., Mastilovi J., Jani Hajnal E., Sari B.: Natural occurrence of aflatoxins in maize harvested in
Serbia during 20092012. Food Control, 34, 1, 3134, 2013
Miraglia M., Marvin H. J. P., Kleter G. A., Battilani P., Brera C., Coni E., Cubadda F., L. Croci, De
Santis B., Dekkers S., Filippi L., Hutjes R.W.A., Noordam M.Y., Pisante M., Piva G., Prandini A., Toti
L., van den Born G.J., Vespermann A.: Climate change and food safety: An emerging issue with special
focus on Europe. Food and Chemical Toxicology, 47, 5, 1009-1021, 2009
Nei K., Ivanovi S., Nei V.: Fusarial Toxins: Secondary Metabolites of Fusarium Fungi. Reviews of
Environmental Contamination and Toxicology, 228, 101-120, 2014
Official Gazette RS, No. 4 : Pravilnik o kvalitetu hrane za ivotinje, l. 99 i 101, 2010
Official Gazette RS, No. 20: Pravilnik o maksimalno dozvoljenim koliinama ostataka sredstava za
zatitu bilja u hrani i hrani za ivotinje i o hrani i hrani za ivotinje za koju se utvruju maksimalno
dozvoljene koliine ostataka sredstava za zatitu bilja, 2013
Official Gazette RS, No. 27: Pravilnik o izmeni pravilnika o kvalitetu hrane za ivotinje, 2014
Paterson R.R.M., Lima N.: How will climate change affect mycotoxins in food? Food Research
International, 43, 7, 1902-1914, 2010
Paterson R.R.M., Lima N.: Further mycotoxin effects from climate change. Food Research International,
44, 9, 2555-2566, 2011
R-biopharm,
Mycotoxins,
http://www.r-biopharm.com/products/food-feed-analysis/mycotoxins,
Pristupljeno 05.04.2015.
RHMZS (Republiki hidrometeoroloki zavod Srbije): Agrometeoroloki uslovi u proizvodnim
2011/2012; 2013/2014. godinama na teritoriji Republike Srbije.
http://www.hidmet.gov.rs/ciril/meteorologija/agrometeorologija.php, Pristupljeno 05.04.2015.
Sanchis V., Magan N.: Environmental conditions affecting mycotoxins. In, Mycotoxins in food:
Detection and control, Eds. N. Magan and M. Olsen, Boca Raton, FL: CRC Press, 2004, 174-189.
Stojanov I.M., Kapetanov M.C., Potkonjak D.V., ivkov-Balo M.M., Jaki S.M., Radulovi Prodanov
J.Z.: Correlation between the limit values of laboratory and clinical mycotoxicosis. Journal for Natural
Sciences, Matica Srpska Novi Sad, 124, 325-332, 2013
krinjar M., Jockovi ., Matijevi Z., Koci-Tanackov S.: Aflatoksini u itaricama i proizvodima na
bazi itarica - pojava, uticaj na ljudsko zdravlje, zakonska regulative. Zbornik referata 47. Savetovanje
agronoma Srbije, 39.02.2013, Zlatibor, Srbija, 2013, 27-32.
Tirado M.C., Clarke R., Jaykus L.A., McQuatters-Gollop A., Frank J.M.: Climate change and food safety:
A review. Food Research International, 43, 7, 1745-1765, 2010
172
Abstract
Peaceful uses of nuclear energy (nuclear weapons testing, nuclear reactor accidents, industrial and
medical use of radioactive compounds) and application of phosphate mineral fertilizers in
agricultural production lead to substantial environmental contamination. Land contaminated with
radionuclides represents the first link in the food chain and hence the radioactive contamination of
crop and livestock production. To determine the soil levels of natural radionuclides the samples
were collected from 11 localities in the territory of Vojvodina. The measurements were performed
applying inductively coupled plasma with mass spectrometry. The values for concentration of
radionuclide activity measured in the examined samples do not significantly diverge from standard
values for agricultural soils.
Key words: natural radionuclides, soil, ICP-MS
Introduction
Natural radioactivity implicates presence of radioactive elements that have been present in nature
since the formation of Earth and the very beginning of formation of its entire living world
(biosphere). Abundant researches revealed substantial differences in the levels of natural
radionuclides between particular localities at Earths surface, and their amounts vary according to
the locality (Mitrovi et al., 1996). The largest source of radiation activity of the soil is a natural
radionuclide potassium-40 (Delalija, 2006). Some other natural radionuclides, which have always
been present on Earth, include also uranium-235, uranium-238, thorium-232, radium-226 and
radon-222 (Levant, 1996). The exposure to low-level radiation originating from these natural
elements has been always affecting all living beings on Earth, and it is considered background
radiation or natural phon.
The basic component of the biosphere is lithosphere (Earths crust), which represents the first link
of the ecology chain: soil-vegetation-animals-man. The soil plays a crucial role in the process of
radionuclide distribution and transfer, thus, knowing of radioactive contamination of the soil is of
great importance for radiation safety issues in biotechnology (Petrovi et al., 1994). Radioactive
contamination of the soil is either natural (formed without mans activity) or human produced
(nuclear testing, reactor accidents, radioactive waste) (Dobri et al., 2006).
The technologically enhanced naturally occurring radioactivity is attributed to uranium, which is
brought to the environment through diverse technological procedures and agro technical measures
(Rajkovi, 2001). Technological development resulted in substantial increase of natural soil
radioactivity, predominantly through intensive application of agro-technical measures based on the
use of artificial phosphate fertilizers that contain substantial amounts of natural uranium. Moreover,
mining of ore containing heavy metals (zinc, copper, led) from deep layers of lithosphere and
processing thereof, as well as the thermal power stations producing huge amounts of solid waste
(ash, cinder) that contain natural radionuclides such as uranium, thorium and their prodigy (Kisi et
al., 2013) increase the levels of soil radioactivity. Uncontrolled application of phosphate fertilizers
173
implicates substantial potential for undermining of ecological balance as they represent the most
powerful source of 238U and 232Th content in the soil, and hence in plants and other links within the
food chain. In a superphosphate, uranium is deposited as highly water-soluble uranyl sulphate UO2(SO4) and urano-sulphate - U(SO4) (Mitrovi et al., 2011). Contrary to other radioisotopes,
radioactive decay of 238U and 232Th results in formation of the series of unstable nuclei, 226Ra and
222
Rn being the most dangerous members of uranium chain. 226Ra is a long half-life -emitter,
manifesting affinity for accumulating in bones, while gaseous 222Rn is responsible for internal
irradiation of lung tissues. Emissions of those radionuclides into the environment represent potential
significant risk factors for the exposure of local inhabitants to ionizing radiation, as well as for
increased levels of natural radiation in particular regions.
Involvement of particular radionuclides into biological cycle is associated with plants ability to
absorb radioactive elements from the soil via their root systems. The amount of radioactive material
from the soil absorbed by plants is directly proportional to the pollution emission density at
particular territory (Simi M., 2001). The transfer of radionuclides from the soil into the plants is
substantially dependant on the soil type, that is, its physico-chemical properties that significantly
affect the resorption rate of radioactive material. The most important physico-chemical properties
include chemical composition (concentration of minerals and content of organic matter), structure
(mechanical composition), pH, moisture content and crop density.
The activity levels of uranium-235 and uranium-238 in soil samples were determined according to
total uranium concentration using mass activity values 0.570 Bq/mg U for 235U and 11.10 Bq/mg U
for 238U (Eisenbud, 1973). Potassium content was determined using the method of emission
spectrophotometry on Spectr AA10, manufactured by Varian, at wavelength 766.5 nm and using
cesium as the ionization-suppressor. The soil levels of potassium-40 activity were calculated from
total potassium, using the mass activity value for potassium being 31.561 Bq/g K (Eisenbud, 1973).
Results
The soil in Vojvodina region undergoes radioactive contamination from diverse sources. Above all,
emissions from nuclear plant reactors in neighboring regions cause contamination of the air and
water in a wide area. Intensive application of phosphate fertilizers with high uranium content
potentially causes gradual increase in the activity level of uranium chain in the soil. Moreover,
potential contamination of the soil in Vojvodina with depleted uranium caused by NATO bombing
in 1999 is widely accepted public opinion. All aforementioned factors strongly suggest the
importance of comprehensive assessment of the soil radioactivity status in Vojvodina (Bikit et al.,
2010). Table 1 displays the results on potassium and uranium concentrations, as well as the activity
levels of natural radionuclides 40K, 235U and 238U.
Table 1. Contents of potassium and uranium and concentration of potassium-40, uranium-235 and
uranium-238 activity in soil samples
No.
Locality
1.
Ba
2.
Zmajevo
3.
Despotovo
4.
Temerin
5.
enej
6.
Lovenac
7.
urug
8.
Kisa
9.
Baki Brestovac
10.
Baki Jarak
11.
Rumenka
Average value SD
K content
[g/kg]
16.37 0.54
15.08 0.24
10.91 0.06
15.92 0.30
11.40 0.29
12.84 0.17
17.72 0.58
21.88 0.35
17.57 0.33
22.03 0.42
23.49 0.45
16.84 4.28
40
K activity
[Bq/kg]
516.6 17.0
476.1 17.6
344.3 12.1
502.4 19.6
359.8 19.4
405.4 15.3
559.3 18.6
690.6 11.0
554.5 10.5
695.3 13.2
741.4 14.1
531.4 134.9
U content
[mg/kg]
4.76 0.24
3.55 0.18
3.36 0.17
2.65 0.13
3.12 0.16
3.89 0.19
3.06 0.15
2.87 0.14
2.80 0.14
2.76 0.14
3.24 0.16
3.28 0.62
235
U activity
[Bq/kg]
2.71 0.14
2.02 0.10
1.91 0.10
1.51 0.08
1.78 0.09
2.22 0.11
1.74 0.09
1.63 0.08
1.60 0.08
1.57 0.08
1.85 0.09
1.87 0.35
238
U activity
[Bq/kg]
52.84 2.64
39.40 1.97
37.30 1.86
29.42 1.47
34.63 1.73
43.18 2.16
33.97 1.70
31.86 1.59
31.08 1.55
30.64 1.53
35.96 1.80
36.39 6.83
175
Uranium contents in soil samples were uniform, ranging within an interval 2.65-4.76 mg/kg with an
average value for all localities being 3.28 mg/kg (Table 1). Based on these values, the following
activity concentrations for uranium were calculated: 235U = 1.51-2.71 Bq/kg, average value 1.87
0.35 Bq/kg and 238U = 29.42-52.84 Bq/kg, average value 36.39 6.83 Bq/kg. Similar results on
uranium concentration in the soil and the activity concentration for radioactive uranium-238 were
reported by other authors (Skipperud et al., 2011).
The importance of natural radionuclides as potential pollutants in agricultural and livestock
production is addressed in the latest addendum to the Ordinance on the limits of radionuclides in
drinking water, food, animal feed, drugs, general use items, building materials and other goods that
are placed on the market (Official Gazette of RS, No. 97/13). This addendum introduced the new
article, 11a, establishing limits for the contents of natural radionuclides (238U, 226Ra, 40K) in mineral
and phosphate fertilizers as potential sources of radioactive contamination of soil.
We also may conclude that ICP-MS (inductively coupled plasma mass spectrometry) proved very
sensitive method for quantitative determination of uranium concentration in soil samples (Sahoo et
al., 2011). It is therefore an attractive alternative for monitoring uranium because can detect the
normal environmentally caused concentrations (Schramel et al., 1997).
Systematic monitoring of radioactivity level of agricultural soil is of paramount importance in
Vojvodina, as the region with extremely high potential for production of safe food. Soil
contamination with wet or dry atmospheric precipitation and materials characterized by
technologically increased level of natural radioactivity can represent a permanent reservoir of
radionuclides that significantly contribute to the overall radiation exposure and total population
radiation dose.
Acknowledgments
The work was financially supported by the Ministry of Education, Science and Technological
Development of the Republic of Serbia, project No TR 31084.
References
1.
2.
3.
4.
5.
6.
7.
8.
Bikit I., Todorovi N., Mra D., Forkapi S., Jovanevi N., Nikolov J., Hansman J.: Merenje
radioaktivnosti zemljita na teritoriji AP Vojvodine. Univerzitet u Novom Sadu, Prirodno-matematiki
fakultet, Departman za fiziku, Novi Sad, 2010
Bikit I., Slivka J., Veskovi M., onki Lj., Krmar M., Mihaljev .: Contamination of Soil and Food
with Radionuclides from Chernobyl. Proceedings of the International Symposium on Post-Chernobyl
Environmental Radioactivity Studies in East European Countries, Kazimierz -1990, Maria CurieSklodowska University, Lublin, Poland, 1990, 34-37
upi ., Mihaljev ., Kljaji R., ivkov-Balo M., Ivanev A.: Total beta activity, potassium-40 and
residual beta activity in alfalfa samples in Vojvodina region. Proceedings of XI international feed
technology simposium-Quality Assurance, Vrnjaka Banja, 2005, 245-248
Dobri S., urovi B.:Nuklearni akcidenti u svetu od 1950 do 2005. Godine. Vojnosanitetski pregled,
63, 5, 465-469, 2006
Delalija M.: Ionizirajue zraenje u biosferi. Sveuilite u Splitu, Kemijsko-tehnoloki fakultet, Split,
2006
Eisenbud M.: Environmental Radioactivity. Academic Press, New York, 1973
International Atomic Energy Agency-IAEA: Measurement of Radionuclides in Food and the
Environment. Vienna, 1989
Kisi D., Mileti S., Radonji V., Radanovi S., Filipovi J.:Prirodna radioaktivnost uglja i leteeg
pepela u termoelektrani Nikola Tesla B. Hemijska Industrija, 67, 5, 729-738, 2013
176
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
Levant I.: Izloenost prirodnom zraenju na Zemlji. Posebno izdanje Agencije za posebni otpad-APO,
Zagreb, 1996
Mihaljev ., upi ., ivkov-Balo M., Jaki S.: Total beta activity, Potassium-40 activity and
residual beta activity in different Tea Samples. Proceedings of XV International Eco-Conference,
Environmental Protection of Urban and Suburban settlements II, Novi Sad, 2011, 281-287
Mitrovi B., Vitorovi G., Stojanovi M., Vitorovi D.: Radiaktivnost fosfatnih mineralnih proizvoda.
Veterinarski Glasnik 65, 1-2, 123-140, 2011
Mitrovi R., Kljaji R., Petrovi B.: Sistem radijacione kontrole u biotehnologiji. Nauni institut za
veterinarstvo Novi Sad, Novi Sad, 1996
Petrovi B., Mitrovi R.: Radijaciona zatita u biotehnologiji. DP Institut za mlekarstvo, Beograd, 1994
Rajkovi M.: Osiromaeni uranijum Uranijum, radioaktivnost i zakonska regulative. Hemijska
Industrija, 55, 4, 167-182, 2001
Sahoo S.K., Hosoda M., Kamagata S., Sorimachi A., Ishikawa T., Tokonami S., Uchida S.: Thorium,
Uranium and rare Elements Concentration in Weathered Japanese Soil Samples. Progress in Nuclear
Science and Technology, 1, 416-419, 2011
Schramel P., Wendler I., Roth Werner E.: Method for the Determination of Thorium and Uranium in
Urin by ICP-MS. Mikrochimica Acta, 126, 263-266, 1997
Simi M., Kovaevi J., Radoevi B., Jovi V.: Prirodni kontaminanti ivotne sredine. Tehnologija
mesa, 42, 1-2, 45-57, 2001
Skipperud L., Popi J., Roos P., Salminen S., Nygren U., Sigmarsson O., Palsson S.E.: Methods-MS,
final report. Nordic nuclear safety research, nks-243, 30-32, 2011
Sl. glasnik RS, br 97/2013. Pravilnik o dopuni Pravilnika o granicama sadraja radionuklida u vodi za
pie, ivotnim namirnicama, stonoj hrani, lekovima, predmetima opte upotrebe, graevinskom
materijalu i drugoj robi koja se stavlja u promet
Veri A., etojevi D., Mijatovi D., Tramoljika Lj.:Uticaj radioaktivnog zraenja na ljudski
organizam. Book of Abstracts, 1st International Conference Ecological Safety in post-modern
environment, Banja Luka, Bosna I Hercegovina, 2009.
ivkovi B., Nejgebauer V., Tanasijevi ., Miljkovi N., Stojkovi L., Drezgi P.: Soils of Vojvodina.
Institute for agricultural research, Novi Sad, 1972
177
Abstract
Physicochemical analysis of honey plays an important role in determining the overall characteristic
of honey and final assessment of its quality. This study was aimed at investigating the
physicochemical properties of local honeys collected from different flora from Vojvodina. The
physicochemical parameters such as moisture content, titratable acidity, HMF determination and
ash content were analyzed. The physicochemical characteristics of 35 out of 40 honey samples
(87.5%) analyzed in this study completely correspond with the national Regulation No. 45/2003 and
Codex Alimentarius, indicating adequate processing, good maturity and freshness. Five samples
(12.5%) did not meet standards established in the Regulation No. 45/2003 and Codex standards. In
40 samples analyzed, the HMF content was elevated in one sample (2.5%) exceeding the limit of 40
mg/kg, and 29 samples (72.5%) revealed values lower than 10 mg/kg, which is typical for fresh
unheated honeys, according to the current quality criteria. The moisture content exceeded the
maximum level permitted by the Regulation in only one of 40 analyzed honey samples (2.5%).
Moreover, in only three samples (7.5%), ash content exceeded the maximum level permitted by the
Regulation. The titratable acidity of all samples was lower than the limit of 40 mmol of acid per
1000 g of sample. Research findings pointed out that the physicochemical properties of local honey
from Vojvodina were in accordance with the Codex standard and the products meet significant
quality criteria for a high-quality honey.
Key words: honey, quality, moisture content, titratable acidity, HMF content, ash content
Introduction
Honey is a sweet liquid produced by honeybees using nectar from flowers through a process of
regurgitation and evaporation. The possible health benefits of consuming honey have been
documented in early Greek, Roman, Vedic, and Islamic texts and the healing qualities of honey
were referred to by philosophers and scientists all the way back to ancient times, such as Aristotle
(384 - 322 BC) and Aristoxenus (320 BC). Modern science is finding that many of the historical
claims that honey can be used in medicine may indeed be true. In the Bible (Old Testament), King
Solomon said, "My son, eat thou honey, for it is good", and there are a number of reasons why it
may be good ( Nordqvist, 2014).
Honey also possesses antiseptic and antibacterial properties. In modern science, we have managed
to find useful applications of honey in chronic wound management. However, it should be noted
that many of honey's health claims still require further rigorous scientific studies to confirm them
(Nordqvist, 2014).
According to the Regulation ("Official Gazette of SCG", No. 45/2003), honey is defined as sweet,
dense, crystallized, viscous product produced by honeybees from the nectar of honey plant flowers
or from secretions of living parts (conifer or hardwood species), which the bees collect, transform
by combining with specific substances of their own, and deposit in honeycombs to mature. In
178
Codex standard (2001), honey is defined as natural sweet substance produced by honey bees from
the nectar of plants or from secretions of living parts of plants or excretions of plant sucking insects
on the living parts of plants, which the bees collect, transform by combining with specific
substances of their own, deposit, dehydrate, store, and leave in the honey comb to ripen and
mature. Chemical composition of honey implicates highly complex mixture of more than 200
different substances (Ferreira et al., 2009). Some of these substances are produced by honeybees,
and some originate from honey plants, whereas some are produced during the maturation process in
the honeycomb (Krell, 1996).
Serbia has a very long tradition of beekeeping. Its favourable climate, good geographical condition
and a variety of botanical species provide great potential for the development of apiculture
(Maukanovi-Joci, 2008).
Serbian honey could potentially be very interesting for the EU market, so it is very important to
verify its compliance with the quality specifications of the European Union (European Economic
Community, 2002).
Moisture content is one of the most important compositions to be considered as a quality parameter
of honey. The maximum moisture content was found to be 34.00 mmol of acid/1000 g in linden
samples, whereas 2.2 mmol of acid/1000 g moisture content was observed in multiflower variety.
Table 1. Results of determining moisture content, HMF, ash content and total acidity in diverse
honey samples
TYPE OF
HONEY
No. of
samples
Meadow
Moisture content
(%)
Acidity
(mmol of acid/1000 g)
Ash content
(%)
HMF content
(mg/kg)
Range
Average
SD
Range
Average
SD
Range
Average
SD
Range
Average
SD
12
14.6 18.6
17.33 1.13
13.75 26
20.34 3.79
0.07 2.96
0.48 0.81
3.84 34.75
10.81 8.20
Acacia
10
14.2 18.4
16.2 1.42
9.5 18.75
13.17 3.07
0.0 0.41
0.09 0.13
6.78 43.78
15.87 12.64
Linden
15 18.6
16.67 1.36
10.5 34.0
15.9 7.44
0.04 1.27
0.38 0.40
4.69 16.13
8.40 3.54
Multi
flower
15.821.4
17.661.93
2.2 27.7
18.98 9.10
0.07 -0.36
0.22 0.10
5.69 10.7
7.48 1.75
Sunflower
16 16.8
16.33 0.42
10 15.00
12.42 2.50
0.02 0.275
0.11 0.15
5.23 7.45
6.47 1.13
Average values obtained in our research (Table 1.) are in agreement with the findings of Cantarelli
et al. (2008), who reported that the moisture content in honey was in the range of 14 to 18%;
however, it depends upon the season and geographic condition. Furthermore, these results are also
in agreement with those of Nuru (2002) and Downey et al. (2005), who reported that the range of
moisture content of pure honey is 16.10 to 23.36%. Fredes and Montenegro (2006) reported that
honey with lower moisture content would have a longer shelf life. The maximum ash content
(2.96%) was found in one sample of meadow honey, another sample of meadow honey revealed ash
contents of 0.86%, which exceeds the maximum permitted level of 0.50%. Total ash contents
measured in other honey samples were in accordance with the limits prescribed by relevant
Regulation. , These findings are in agreement with those of Ihtisham-ul-haq (1997), who analyzed
different varieties of honey and determined the ash content range of 0.008 to 0.49% in honey
samples. These results are also in agreement with those of White (1975a), who worked on different
varieties of honey and obtained ash content in the range of 0.020 to 1.028%. The variation may be
due to many factors such as soil conditions, atmospheric conditions and physiology of each plant.
The composition of organic acids in honey has not yet been adequately investigated; however, some
evidence (Rogulja et al., 2009) suggest that acacia, chestnut and meadow honeys are characterized
by particularly low contents of organic acids, whilst darker honeys in general appear to be higher in
acidity.
The research of Prica et al. (2014.) also demonstrated low acidity of acacia honey as compared with
other examined honey types. The results obtained for meadow honey do not correspond with the
aforementioned evidence, yet the acidity was within the proper range. Our results correspond with
these reports. HMF represents the freshness of honey and depends on adequate beehives and harvest
practice. The majority of honey samples had HMF contents in line with the maximum permitted
levels prescribed by the Regulation ("Official Gazette of SCG", No. 45/2003); maximum HMF
content in honey put in the market is fixed to 40 mg/kg. According to the obtained results, HMF in
honey content exceeded maximum permitted value in only one sample of acacia honey.
180
Conclusion
The physicochemical characteristics of 35 out of 40 honey samples (87.5%) analyzed in this study
completely correspond with the national Regulation No. 45/2003 and Codex Alimentarius,
indicating adequate processing, good maturity and freshness. Five samples (12.5%) did not meet
characteristics established in the Regulation No. 45/2003 and Codex standards. In 40 samples
analyzed, the HMF content was elevated in one sample (2.5%) exceeding the limit of 40 mg/kg, and
29 samples (72.5%) revealed values lower than 10 mg/kg, which is typical of fresh unheated
honeys, according to the current quality criteria.
The moisture content exceeded the maximum level permitted by the Regulation in only one of 40
analyzed honey samples (2.5%). Moreover, in only three samples (7.5%), ash content exceeded the
maximum level permitted by the Regulation. The titratable acidity of all samples was lower than the
limit of 40 mmol of acid per 1000 g of sample.
Research findings pointed out that the physicochemical properties of local honey from Vojvodina
were in accordance with the Codex standard and it meets significant quality criteria for a highquality honey.
Acknowledgments
This work is supported by a grant from the Ministry of Education, Science and Technological
Development, Republic of Serbia, Project number TR 31084
References
1. Cantarelli M.A., Pellerano R.G., Marchevsky E.J., Camia J.M.: Quality of honey from Argentina: Studi
of chemical composition and trace elements. The Journal of the Argentine Chemical Society, 96, 1/2, 3341, 2008
2. Codex Alimentarius Commission: Revised Codex Standard for Honey, Codex STAN 12-1981, 2001.
3. Downey G., Hussey K., Jelly J.D., Walshe T.F., Martn P.G.: Preliminary contribution to the
characterization of artisanal honey produced on the island of Ireland by palynological and
physicochemical data. Food Chemistry, 91: 347-354. 2005
4. European Economic Community: EEC Council Directive of 20 December 2001 relating to honey.
Official Journal of the European Communities, 110, 47-50, 2002
5. Ferreira I.C.F.R., Aires E., Barreira J.C.M., Estevinho L.M.: Antioxidant activity of Portuguese honey
samples: Different contributions of the entire honey and phenolic extract. Food Chemistry, 114, 14381443, 2009
6. Fredes C., Montenegro G.: Heavy metal and other trace elements contents in honey bee in Chile. Cien.
Inv. Agric., 33, 50-58, 2006
7. Ihtisham-ul-haq: Effect of floral type, geographical locations and honey bee species on the water activity
and other physico-chemical parameters of honey. M.Sc. Thesis. Deptt. Food Sci. Technol., Faculty of
Nutrition Sciences, NWFP Agricultural University, Peshawer, Pakistan, 1997
8. Krell R.: Value-added products from beekeeping, FAO Agricultural Services Bulletin No. 124, Food and
Agriculture
Organization
of
the
United
Nations
Rome
1996,
Dostupno
na
www.fao.org/docrep/w0076e/w0076e00.htm. Pristupljeno 12.11.2014.
9. Maukanovi-Joci M.: The biology of melliferous plants with an atlas of Serbian apiflora. Faculty of
Agriculture (on Serbian), Beograd, Serbia, 2008
10. Nordqvist J., Reviewed by Megan Ware, RDN, LD, registered dietitian and nutritionist, What are the
health benefits of honey?; 26.09.2014. Dostupno na:
http://www.medicalnewstoday.com/articles/264667.php
181
182
Abstract
Experiment was conducted to investigate the effect of hot red pepper in broiler nutrition on
productive performances and blood lipid profile. For biological research three treatments with the
total of 450 broilers were formed, within four replicates. Control treatment (CON) of chickens were
fed with mixture based on corn flour and soybean meal of standard composition and quality, while
the experimental treatments were fed with the same mixture only with addition of two levels of hot
red pepper 0.5 (HRP-0.5) and 1.0 g/100g (HRP-1.0). Addition of hot red pepper in the amount of
0.5 g/100g has led to the highest final body weight of chickens (2460.6 g), followed by the addition
of 1.0 g/100g (2442.4 g) with significant differences (p<0.05) compared to a control treatment
(2075.8 g). The lowest amounts of triglycerides, total cholesterol, low density lipoprotein (LDL)
and non-high density lipoprotein (non HDL) was recorded in broilers in treatments with hot red
pepper with statistically significant (p<0.05) differences compared to a control treatment. The
highest share of high density lipoprotein (HDL) with statistical significance (p<0.05) was
determined also in hot red pepper treatments. Based on the obtained results, it can be concluded that
the addition of hot red pepper in broiler chicken nutrition has positive effects on production
performances and in improvement of chicken blood lipid profile.
Key words: Hot red pepper, cholesterol, nutrition, chickens, food
Introduction
Beside of an important role of hot red pepper in daily human nutrition for enhancement of taste,
aroma and colour of food, this spice have also been efficiently used in animal nutrition for
improvement of animal health and production of healthier meat and eggs. With the ban of
antibiotics use in animal nutrition due to the emergence of microbe resistance, alternative growth
promoters must be found (Steiner, 2009). Removal of antibiotics as growth promoters has led to
animal performance problems, increase of feed conversion ratio, and a rise in the incidence of
certain animal diseases (Wierup, 2001). The alternatives to antibiotics as growth stimulators are
numerous (Steiner, 2009; Puvaa et al., 2013). Hot red pepper (Capsicum annuum L.) plays an
important role in decreasing the deposition of cholesterol and fat in the body, contributes to
decreased levels of triglycerides and supports the vascular system in the body. Efficient hot red
pepper compounds consist of capsaicin, capsicin and capsanthin. Hencken, (1991) explained that
hot red pepper is rich in vitamin C, which have a considerable impact in improving production
through contributes the reduction of heat stress (Yoshioka et al., 2001). A recent studies involved in
chicken performance have shown that blends of active compounds for hot red pepper have
chemopreventive and chemotherapeutic effects. In research of Al-Kassie et al. (2012) addition of
hot red pepper had significant effect on the heterophil/lymphocytes (H/L) ratio, which reflects the
183
role of hot red pepper, especially its active compound capisicine, which is involved in stress
hormones, and which supports the immune system of birds and enhances its resistance against
disease through decreasing (H/L) ratio.
The aim of this study was to investigate the effect of hot red pepper in broiler nutrition on blood
lipid profile and productive performances.
Bioactive compounds
Capsanthin, g/kg
Capsaicin, g/kg
a
3.31
0.96b
0.58
0.04
Treatments with different letter indexes in the same row are statistically significantly different (p<0.05)
Animal trials
Biological tests were carried out under production conditions at the experimental farm "Pustara" in
property of the Faculty of Agriculture from Novi Sad. At the beginning of the experiment, a total of
450 one-day old Hubbard broilers were distributed into three dietary treatments with four replicates
each. Every dietary treatment included 150 chickens, which were divided in four pens with 37-38
chicken per each pen. Chickens were reared on floor holding system with the chopped straw as litter
material. Chickens were provided with the light regime of 23h of day per entire experimental period
of 42 days with incandescent light source. For nutrition of chicks three mixtures were used, starter,
grower and finisher through pan feeders. For the first 14 days, during the preparatory period, chicks
were fed with starter mixtures. Following the preparation period, chicks were fed with grower
mixtures for the next 21 days, and then for the last 7 days of fattening period with finisher mixtures
according the experimental design given in Table 2 and dietary chemical composition of used
starter, grower and finisher mixtures which is given in Table 3.
During the experiment chicks were fed and watered ad libitum. Chickens were watered throught the
nipple water system. Microclimate conditions were regularly monitored. Body weight was
monitored at an individual level during the entire experimental period every seven days, while the
feed consumption and feed conversion ratio were monitored at the pen level also every seven days.
184
Starter
89.4
10.5
21.1
3.9
3.5
5.0
0.8
0.6
12.5
Diet mixtures
Grower
89.3
10.7
20.7
3.9
3.5
4.8
0.9
0.6
12.8
Finisher
89.4
10.5
17.3
4.7
3.6
5.6
1.1
0.5
13.3
Blood lipids
At the end of 6th week, twelve birds were randomly chosen from each treatment and bled via wing
vein puncture to obtain blood samples. Serum samples from blood were separated by centrifugation
(4000 rpm for 5 min at 20C). Commercially available kits (Randox Laboratories Limited - United
KIngdom) were used to analyse the serum for triglycerides, total cholesterol, HDL and LDL on an
biochemical autoanalyzer Cobas Mira Plus (Roche Diagnostics). Values were expressed as mg/dl.
Statistical analyses
Statistical analyses were conducted within statistical software program Statistica 12 for Windows,
to determine if variables differed between treatments. Significant effects were further explored
using analysis of variance (ANOVA) with repeated measurements, least square means (LSM) and
standard errors of least square means (SELSM), as well as Fisher's LSD post-hoc multiple range test
with Bonferroni corrections to ascertain differences among treatment means. A significance level of
p<0.05 was used.
0.26 g of dry mater. Taking into account that the capsaicin is alkaloid responsible for the hot taste of
pepper, this result was expected because the hot red pepper is recognizable its pungent quality.
Similar result was obtained by Dang et al. (2014) in their study of three-liquid-phase extraction and
separation of capsanthin and capsaicin from Capsicum annum L. The highest content of capsaicin
was found in the placenta, as well as dihydrocapsaicin, 10.48 and 6.43 g/kg, respectively, while the
highest ratio of 3.71 estimated from the quantity of capsaicin and dihydrocapsaicin was calculated
in the pericarp. The determined pungency level in placenta of 272 211 SHU was almost five times
and two times higher than the pungency level in the seed and pericarp, respectively (Simonovska et
al., 2014).
Productive performance of broilers
Based on the obtained results it can be concluded that the addition of hot red pepper in the diet of
broiler chickens led to a statistically significant (p<0.05) differences in body weight (Table 4).
Chickens have finished the preparatory period with uniform body weight with no statistical
significant differences (p>0.05). At the end of the second fattening period, addition of hot red
pepper exerted the stimulating effect and led to statistically significant differences (p<0.05) in body
weight in relation to the control treatment. After the completion of the experimental period, the
highest achieved body weight of chicken was in treatment HRP-0.5 (2460.6 g) which was followed
by treatment HRP-1.0 (2442.4 g) with statistically significant differences (p<0.05) compared to
control treatment.
Table 4. Body weight of chickens in experiment, g
Experimental
treatments
CON
LSM
HRP-0.5
LSM
HRP-1.0
LSM
Pooled SELSM
1 day
42.8a
42.5a
42a
0.47
7 days
162.7a
162.5a
161.6a
1.6
Age of chickens
14 days
21 days
28 days
388.6a
785.6a
1162.4a
a
a
385.3
770.5
1193.6a
a
a
385.1
762.4
1183.6a
3.87
8.38
11.84
35 days
1643.8b
1815.1a
1812.1a
12.2
42 days
2075.8b
2460.6a
2442.4a
24.33
Treatments with different letter indexes in the same column are statistically significantly different (p<0.05)
Our study has shown that the addition of hot red pepper has positive effect on production results of
chickens, which is also in agreement with previous findings of Alaa (2010), Al-Kassie et al. (2012)
and Puvaa et al. (2014c) with the use of hot red pepper in broiler chicken nutrition. Research of AlKassie et al. (2011) revealed that the inclusion of hot red pepper at levels of 0.5%, 0.75% and 1% in
the diets of broiler chicken of hybrid line Ross 308 improved body weight gain and feed conversion
ratio. Investigation of Thiamhirunsopit et al. (2014) with the different forms of hot red peppers
showed better growth performance results of chickens on experimental hot red pepper treatments in
comparison to control treatments.
Lipid profile in broiler chickens
Addition of hot red pepper as feed additives to broiler chicken nutrition in this experiment led to
high improvement of lipid profile of chickens. From the results given in Table 5 it can be noticed
that the highest amounts of triglycerides (65.9 mg/dl), total cholesterol (97.2 mg/dl) and LDL (36.7
mg/dl) were in control treatment with statistically significant (p<0.05) differences in comparison to
treatments with the dietary addition of hot red pepper.
This effect can be explained by the possible inhibition of the Acetyl CoA syntheses enzyme that is
necessary for the biosynthesis of fatty acids. Afzal et al. (1985) reported that polyunsaturated fatty
acids prevent atherosclerosis through the formation of cholesterol esters. Both levels of hot red
pepper in our study decreased LDL levels compared to the levels in chickens of the control
186
treatment. This effect can be explained by the possible mechanism of antioxidant and antiperoxide
lowering action on LDL or the decrease in hepatic production of very low density lipoprotein
(VLDL) which serves as the precursor of LDL in the blood circulation (Kim et al., 2009).
Table 5. Biochemical blood parameters and lipid profile, mg/dl
Experimental
treatments
CON
LSM
HRP-0.5
LSM
HRP-1.0
LSM
Pooled SELSM
Triglycerides
a
65.9
16.7b
17.7b
0.8
Total
cholesterol
97.2a
52.4b
54.3b
0.9
HDL
LDL
19.2
35.5a
35.7a
1.16
36.7
9.4b
10.3b
1.01
non HDL
a
78.0
16.9b
18.6b
1.03
HDL/LDL
0.5b
3.8a
3.6a
2.33
Treatments with different letter indexes in the same column are statistically significantly different (p<0.05)
Addition of hot red pepper to the broiler diet in different amounts from 0.25 to 1% had influence on
decreased concentration of blood cholesterol, and other blood biochemical parameters (Alaa, 2010;
Al-Kassie et al., 2012). Furthermore, addition of spice herbs and medicinal plants can facilitate
activity of enzymes which are involved in the conversion of cholesterol to bilious acids and
subsequently will result in lower cholesterol concentration in the carcass. Similar results with the
lowering effects of total cholesterol in red and white meat and skin of chickens fed with dietary
garlic powder was obtained by Stanaev et al. (2012). Spice herbs in human nutrition had a very
large influence in health promotion and lowering concentration of blood cholesterol and lipid
oxidation (Ahuja and Ball, 2006). Beside the hot red pepper, garlic (Puvaa et al., 2014a) and black
pepper (Puvaa et al., 2014b) had a high impact on alteration of blood lipid profile of chickens.
Capsinoids present in red peppers causes pungent, hot tasting sensations when consumed as a part
of the diet in addition to sensory properties of chicken meat that may be affects human health,
because capsinoids includes antimicrobial activities against disease caused by bacteria. Meat
obtained by chickens fed with hot red pepper poses better lipid profile and can be successfully used
in daily human nutrition as a dietetic food.
Conclusions
Based on the obtained results, it can be concluded that the addition of hot red pepper in broiler
chicken nutrition has positive effect on production performances. Addition of hot red pepper in the
amount of 0.5 g/100g has led to the highest final body weights of chickens. Also it can be
concluded that significant lowering of plasma cholesterol, triglycerides, LDL and increase of HDL
by this spice herb supplementation in broiler diet could indicates effective in regulation of lipid
metabolism in a favourable manner for prevention of atherosclerosis or coronary heart diseases in
humans who use this kind of chicken products in their daily nutrition.
Acknowledgments
This paper is a part of the project III 46012 which is financed by Ministry for Science and
Technological development of the Republic of Serbia. Also the realization of one part of this
experiment was supported by the Perutnina Ptuj Topiko a.d., Petefi brigade 2, 24300 Baka
Topola, Serbia.
References
1.
Afzal M., Hassan R.A.H., El-Kazini A.A., Fattah R.M.A.: Allium sativum in the control of
atherosclerosis. Agricultural and Biological Chemistry, 49, 1187-1188, 1985.
187
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Ahuja K.D., Ball M.J.: Effects of daily ingestion of chilli on serum lipoprotein oxidation in adult men
and women. British Journal of Nutrition, 96, 239-42, 2006.
Alaa A.A.: The effect of the Capsicum annuum in the diet of broilers on the isolation and shedding rate
of Salmonella paratyphoid. Kufa Journal for Veterinary Medical Sciences, 1, 28-38, 2010.
Al-Kassie G.A.M., Al-Nasrawi M.A.M., Ajeena S.J.: The effects of using hot red pepper as a diet
supplement on some performance traits in broiler. Pakistan Journal of Nutrition, 10, 842-845, 2011.
Al-Kassie G.A.M., Butris G.Y., Ajeena S.J.: The potency of feed supplemented mixture of hot red
pepper and black pepper on the performance and some hematological blood traits in broiler diet.
International Journal of Advanced Biological Research, 2, 53-57, 2012.
Dang Y.Y., Zhang H., Xiu Z.L.: Three-liquid-phase extraction and separation of capsanthin and
capsaicin from Capsicum annum L. Czech Journal of Food Science, 32, 109114, 2014.
Hencken H.: Cooling the burn from hot peppers. Journal of the American Medical Association, 266,
2766-2770, 1991.
Kim Y.J., Jin S.K., Yang H.S.: Effect of dietary garlic bulb and husk on the physicochemical proper-ties
of chicken meat. Poultry Science, 88, 398-405, 2009.
Puvaa N., Kostadinovi Lj., Ljubojevi D., Luka D., Popovi S.: Influence of black pepper (Piper
nigrum L.) on productive performances and blood lipid profile of broiler chickens. Annals of Biological
Research, 5: 29-33, 2014b.
Puvaa N., Kostadinovi Lj., Ljubojevi D., Luka D., Popovi S., Dokmanov B., Stanaev V.S.:
Effects of dietary garlic addition on productive performance and blood lipid profile of broiler chickens.
Biotechnology in Animal Husbandry, 30, 669-677, 2014a.
Puvaa N., Ljubojevi D., Luka D., Kostadinovi Lj., Stanaev V., Popovi S., ivkov Balo M.,
Nikolova N. (2014c): Digestibility of fat in broiler chickens influenced by dietary addition of spice
herbs. Macedonian Journal of Animal Science, 4, 6167, 2014c.
Puvaa N., Stanaev V., Glamoi D., Levi J., Peri L., Stanaev V., Mili D.: Beneficial effects of
phytoadditives in broiler nutrition. World's Poultry Science Journal, 69, 27-34, 2013.
Simonovska J., Rafajlovska V., Kavrakovski Z., Srbinoska M.: Nutritional and bioactive compounds in
hot fruits of Capsicum annuum L. from Macedonia. Macedonian Journal of Chemistry and Chemical
Engineering, 33, 97104, 2014.
SRPS EN ISO 7540.: Ground paprika (Capsicum annuum L.). Requirements for ground paprika, 2012.
Stanaev V., Glamoi D., Miloevi N., Peri L., Puvaa N., Stanaev V., Mili D., Plava N.:
Influence of garlic (Allium sativum L.) and copper as phytoadditives in the feed on the content of
cholesterol in the tissues of the chickens. Journal of Medicinal Plants Research, 6, 2816-2819, 2012.
Steiner T.: Phytogenics in animal nutrition Natural concepts to optimise gut health and performance.
Nottingham University Press: 1-169, 2009.
Thiamhirunsopit K., Phisalaphong C., Boonkird S., Kijparkorn S.: Effect of chili meal (Capsicum
frutescens LINN.) on growth performance, stress index, lipid peroxidation and ileal nutrient digestibility
in broilers reared under high stocking density condition. Animal Feed Science and Technology, 192, 90100, 2014.
Vraar Lj.: Manual for quality control of fresh and processed fruits, vegetables and mushrooms and
non-alcoholic beverages (In Serbian). Faculty of Technology, Novi Sad, 2001.
Wierup M.: The Swedish experience of the 1986 ban of antimicrobial growth promoters, with special
reference to animal health, disease prevention, productivity, and usage of antimicrobials. Microbial
Drug Resistance, 7, 183190, 2001.
Yoshioka M., Doucet E., Drapeau V., Dionne I., Tremblay A. (2001): Combined effects of red pepper
and caffeine consumption on energy balance in subjects given free access to foods. British Journal of
Nutrition, 85, 203-211, 2001.
188
________________________________________________________________________
Session 3
189
Plenary lecture:
MOSQUITO-BORNE FLAVIVIRUSES IN EUROPE: CURRENT PERSPECTIVES
Juan Carlos Saiz
Departamento de Biotecnologa, Instituto Nacional de Investigacin y Tecnologa Agraria y
Alimentaria (INIA). Carretera de la Corua Km 7.5, 28040, Madrid (Spain)
Corresponding author: jcsaiz@inia.es
Abstract
Flaviviruses (Flaviviridae family) constitute a genus of viruses that contains more than 50 different
species, many of which are important human and animal pathogens. Flavivirus genome is
constituted by a single-stranded RNA molecule of positive polarity ( 11,000 nt) that encodes a
polyprotein in a single open reading frame. Flaviviruses are maintained in nature in an infectious
cycle between wild animals, which act as their natural host, and insects (mosquitoes and ticks) that
act as their vectors. These vectors can transmit the virus to other animals or to humans, causing
zoonoses. Flaviviruses can infect the host nervous system, thus inducing severe neurological
diseases that can lead to death. Global climate warming together with changes in land use are
helping to change the distribution patterns of flaviviruses. Nowadays, 3 mosquito-borne flaviviruses
have been detected in Europe: West Nile virus (WNV), Usutu virus (USUV) and Bagaza virus
(BAGV), being WNV the most clinically relevant. WNV lineage 1 has been circulating in Europe
since 1960s, but from the 1990s the number, frequency and severity of the outbreaks increased
greatly. Earlier in this century, lineage 2 strains entered the continent, being already responsible for
hundreds of human cases and dozens of deaths. Lineage 2 strains are currently circulating in central
and south-eastern Europe, including Serbia. Usutu virus (USUV), was reported for the first time in
Austria in 2001 and quickly spread across Europe, causing a considerable number of bird deaths
and neurological disorders in a few immunocompromised patients, and it is now considered a
European resident pathogen. BAGV was reported for the first time in Europe when caused a deadly
outbreak among partridges and pheasants in Spain in 2010. Here, different aspects of mosquitoborne flaviviruses pathogenesis and clinical consequences, distribution, epidemiology, diagnosis,
and prophylaxis (vaccine and antivirals) will be discussed.
Keywords: Flavivirus, mosquitoes, Europe, West Nile virus, Usutu virus, Bagaza virus
Introduction
Flaviviruses (Flaviviridae family) constitute a genus of viruses that contains more than 50 different
species, many of which are important human and animal pathogens, such as Dengue virus (DENV),
West Nile virus (WNV), Japanese encephalitis virus (JEV), Yellow fever virus (YFV), Usutu virus
(USUV), or Tick-borne encephalitis virus (TBEV), among others (Weaver and Reisen, 2010). Most
flaviviruses are maintained in nature in an infectious cycle that includes transmission between wild
animals, which act as their natural host, and insects (mosquitoes and ticks) that act as their vectors,
being thus arboviruses (arthropod-borne viruses). These vectors can transmit the virus to other
animals or to humans, causing zoonoses. A characteristic shared by a wide variety of flaviviruses is
that they can infect cells from the host nervous system, thus inducing severe neurological diseases,
which often include encephalitis (Sips et al., 2012). Global climate warming together with changes
in land use are helping to change the distribution patterns of some flaviviruses, so that, they are
190
currently being detected in new geographical zones, where they cause infectious outbreaks that
affect both human and animals (Gould and Higgs, 2009).
Ecology
Flaviviruses are grouped according to their vectors, mosquitoes, ticks, or those for which the vector
is still unknown. Those transmitted by mosquitoes are subdivided into 2 clades depending on the
vector genus (Culex or Aedes) (Beck et al., 2013). Culex-clade viruses usually have birds as natural
reservoirs, are neurotropic, and may cause encephalitis. Aedes-clade viruses have primates as main
reservoir and are not used to be neurotropic, but frequently cause hemorrhagic diseases. Tick-borne
flaviviruses are also grouped into 2 clades, those that circulate among seabirds and those that
produce encephalitis and which main natural reservoir are rodents, being the most clinically
relevant the TBEV (Beck et al., 2013).
Within a mosquito genus, different species show diverse competence for transmission of the
different flaviviruses (Martn-Acebes and Saiz, 2012). For instances, more than 11 species have
been described as WNV competent vectors in U.S., being the most efficient ones those of the Culex
species, although other species (such as Aedes or Ochlerotatus) may also play a role on viral
transmission as bridging vectors that can transmit the virus to mammals. In Europe, the virus has
been isolated from more than 40 different species, being again those of the Culex species the main
vectors. Several other species have been also described as competent vectors in other geographical
areas.
Climate (temperature, humidity, rainfall rate, etc.) and landscape conditions (altitude, latitude, water
sources, forestation, etc.) directly affect arthropod populations, density and stability, thus playing a
pivotal role in arboviral dissemination and evolution (Gould and Higgs, 2009; Beck et al., 2013;
Weaver and Barret, 2004). Climate change affects the geographical and seasonal distribution of
arthropod vectors, a fact that has many consequences. Expansion of mosquito species to more
extreme latitudes and elevations allows them to reach new host populations to feed on, and to share
new ecological niches with other vector species. Heavy rainfall and warm temperatures benefit the
increase of mosquitoes populations, and has been positively correlated with arbovirus transmission
(Martn-Acebes and Saiz, 2012; Weaver and Barret, 2004). Likewise, overabundance of birds that
share urban and rural areas with ubiquitous fastidious mosquitoes that feed on birds and mammals
plays an important role in flavivirus transmission. In fact, in two of the major urban WNV
191
outbreaks reported in Europe, which took place in Bucharest (Romania), and Volgograd and
Volzhskiy (Russia), the regions were heavily infested by potential mosquito vectors. Thus, arboviral
epidemics are probably more related to the concomitant profusion of hosts and vector populations in
the same area, generally wastelands and mashes where migratory birds are abundant, than to other
factors (Brault, 2009).
An important factor in arboviral evolution is socio-economic development since it has led to
increased and faster travelling, urbanization, deforestation, irrigation, and migratory activities
leading to overpopulation. For instance, and because JEV outbreaks were mainly restricted to Japan
before the second world war, the conflict seems to have favoured virus spread (Gould and Higgs,
2009). Hence, new human and animal behaviours and climate changes are facilitating contact
between vectors and hosts that, together with viral genetic mechanisms, may lead to the emergence
or re-emergence of new arbovirus with expanded tropism and host-range and, thus, represents an
important threat for human and animal health.
192
equids, and it has been recently associated with a few cases of neurological disorders in
immunocompromised patients in Italy and Croatia (Beck et al., 2013).
Diagnosis
Flavivirus laboratory diagnosis relays on isolation of virus, detection of viral antigens or RNA in
blood or tissues, or detection of virus-specific IgM antibody that should be further confirmed by
detection of IgG antibody in the same or a subsequent sample.
Virus isolation in susceptible cell culture is the gold standard for virus detection, but it is usually
hampered by the typical short duration and low levels of viremia and by the need of BSL-3
facilities. In this regard, several methods for detection of viral RNA have been applied for
Flavivirus surveillance and diagnosis, mainly reverse transcription (RT) polymerase chain reaction
(PCR) assays and quantitative real-time RT-PCR (Martn-Acebes and Saiz, 2012; Dauphin and
Zientara, 2007).
Cross-reactivity between Flavivirus antigens is the greatest drawback for proper serological
diagnosis and epidemiological studies and, thus, sera have to be tested against different related
viruses and results have to be subsequently confirmed by different assays, namely hemagglutination
inhibition (HI), immunoflourescence (IF) or plaque reduction neutralization test (PRNT),
considered as the gold-standard (Martn-Acebes and Saiz, 2012; Dauphin and Zientara, 2007). A 4193
fold increase in PRNT titers between 2 sequential serum samples collected 2-3 weeks apart usually
confirms an acute Flavivirus infection, and viral neutralizing titers 4-fold higher than titers to other
related-flavivirus is usually taken as a probe of the specificity of the infection. Different ELISA
formats, both commercial and in-house, are currently applied for serological testing using
inactivated whole virus as antigen; however, its production implies risks for laboratory personnel
and needs highly sophisticated biosafety level 3 (BSL-3) containment facilities to grow the virus,
and then, several ELISAs have been developed using recombinant viral proteins expressed in a
variety of systems (bacteria, mammalian cells, insect cells, and larvae) (Martn-Acebes and Saiz,
2012; Dauphin and Zientara, 2007).
Prophylaxis
Until now, no WNV or USUV vaccine or specific therapy has been approved for humans, and
clinical treatment is only supportive; however, promising approaches are being developed (MartnAcebes and Saiz, 2012; Dauphin and Zientara, 2007). In this regard, and even though there are
effective, licensed WNV vaccines for horses, no approved vaccines exist for human use, although
some have undergone clinical trial. These candidates are based on the use of either live attenuated
or chemically inactivated virus, or recombinant viral proteins (or fragments of them) synthesized in
diverse systems (from bacteria to insect cells and larvae) (Dauphin and Zientara, 2007).
The search for antiviral compounds active against Flavivirus infection includes the identification of
those targeting distinct aspects of the viral replication cycle (Martn-Acebes and Saiz, 2012;
Dauphin and Zientara, 2007). The candidate may be targeted against the viral particle itself,
impairing its entry and/or infection, or it may block multiplication of the virus within infected cells.
This search has leaded to the identification of multiple promising compounds interfering with these
processes, including the repositioning of drugs approved for other purposes that have also shown
antiviral activities against Flavivirus (Martn-Acebes and Saiz, 2012; Dauphin and Zientara, 2007).
Recently a new approach in antiviral search has focused on cellular factors (proteins and lipids)
implicated in the viral life cycle, which may constitute potential targets for antiviral activity. In any
case, progress in Flavivirus therapies should pass through a combination of drug strategies that
targets viral replication, boosts protective immune responses, minimizes neuronal injury, and limits
the development of resistant variants. However, long way remains to be completed before these
novel compounds could to be administered to humans or animals, as they should be first tested for
antiviral activity in animal models and adverse effects should be ruled out.
Conclusions
Although our knowledge about Flavivirus infections has greatly increased during recent years, some
aspects of WNV activity still need to be further addressed: the ways WNV colonizes new ecological
niches and the role that climate and anthropogenic factors play; the differences in WNV disease
manifestations between different regions of the world; the better understanding of WNV immunity,
pathogenicity, and the molecular basis of virulence; the development of national and international
surveillance programs to monitor WNV spread and to take appropriate measures to control it; the
search for more efficient, rapid, and specific diagnostic assays; and the search for cost-effective
human vaccines and antiviral targets for therapeutic usage.
Acknowledgments
Supported by grants RTA-2011-0036 and E_RTA2013-00013-C04-2014 (INIA), and PLATESAP2013/ABI-2906 (Comunidad Autnoma de Madrid).
194
References
1.
Amicizia D et al. (2013). Epidemiology of tick-borne encephalitis (TBE) in Europe and its prevention
by available vaccines. Human Vacc & Immunotherp 9(5):1163-1171. Doi:10.4161/hv.23802.
2. Beck C, et al. (2013). Flavivrus in Europe: complex circulation patterns and their consequences for the
diagnosis and control of West Nile disease. Int J Environ Res Public Health 10:6049-6083.
Doi:10.3390/ijerph10116049.
3. Brault AC (2009). Changing patterns of West Nile virus transmission: altered vector competence and
host susceptibility. Vet Res 40:43. Doi:10.1051/vetres/2009026.
4. Dauphin G, Zientara S. (2007). West Nile virus: recent trends in diagnosis and vaccine development.
Vaccine 25:5563-5576. Doi: 10.1016/j.vaccine.2006.12.005.
5. Gould EA and Higgs S (2009). Impact of climate change and other factors on emerging arboviruses
diseases. Trans R Soc Trop Med Hyg 103(2):109-121. Doi:10.1016/j.trstmh.2008.07.025.
6. Lani R, et al. (2014). Tick-borne viruses: a review from the perspective of therapeutic approaches. Ticks
Tick Borne Diseases 5(5):457-465. Doi:10.1016/j.ttbdis.2014.04.001.
7. Martn-Acebes MA and Saiz JC (2012). West Nile virus: a re-emerging pathogen revisited. World
Journal of Virology 1(2):51-70. Doi:10.5501/wjv.v1.i2.51.
8. Sips. G.J, et al. (2012). Neuroinvasive flavivirus infections. Rev Med Virol 22(2):69-87.
Doi:10.1002/rmv.712.
9. Weaver SC and Barret ADT (2004). Transmission cycles, host range, evolution and emergence of
arboviral diseases. Nature Rev Microbiol 2:789-801. Doi:10.1038/nrmcrol1006.
10. Weaver SC and Reisen WK (2010). Present and future arboviral threats. Antiviral Research 85(2):328.
Doi:0.1016/j.antiviral.2009.10.008.
195
Invited lecture
AN OVERVIEW OF THE RECENT STUDIES ON TICK BORNE PATHOGENS IN
SERBIA
Sara Savi1, Branka Vidi1, Aleksandar Potkonjak2, eljko onka3
1 Scientific Veterinary Institute Novi Sad
2 Department of veterinary medicine, Faculty of agriculture, University of Novi Sad,
2 Zito Dunav Agroveterina DOO, Voganj
* Corresponding author: sara@niv.ns.ac.rs
Abstract
Tick borne diseases are one of the key issues within a One Health concept. A triangle between
humans, animals and ticks has been a challenge for researchers for some time now. In Serbia,
research on ticks as vectors, tick borne pathogens and tick borne diseases has started approximately
a decade ago. The first studies were on the presence of Borrelia burgdorferi sensu lato starins in
ticks, followed by research on Babesia spp. During the last few years a lot of work has been done,
not only in Serbia, but in the whole region on the topic of the presence of Anaplasma
phagocytophilum, Coxiella burnetii and Francisella tularensis in ticks.
Tick species found in different regions of Serbia so far are the following: Ixodes ricinus,
Dermacentor marginatus, Dermacentor reticulatus, Rhipicephalus sanguineus, Hemaphysalis
punctata, Haemaphysalis concinna
For B.burgdorferi s.l. more genospecies were found in ticks during the last few years: B. afzelii,
B,burgdorferi s.s, B. lusitaniae, B. garinii and B. valaisiana. Monitoring of the prevalenece of
B.burgdorferi s.l. in ticks is constant, but it differs among different regions in Serbia (Vojvodina,
Belgrade region and middle Serbia). The prevalence for B.burgdorferi in ticks varies from 23% to
42.5%.
Babesia spp is found to be present in ticks with two different methods, in different tick species with
different prevalence varies from 10.61% to 46.40% in different regions. In another study,
Anaplasma phagocitophylum has recently been found in 13.9% ticks in Serbia. Coxiella burnetii
was found in less than 7% in ticks in different regions of Serbia. The prevalence for Francisella
tularensis microorganisms has also been found as 3.8% in ticks.
All of the monitored pathogens are causative agents for more or less dangerous zoonozes, which
can be found in the region of Serbia and almost all of them have already been reported in humans.
Key words: tick borne pathogens, zoonozes, borreliosis, anaplasmosis, ricketiosis, babesiosis
Introduction
Arthropods as vectors of pathogens are causing vector-borne diseases, an important threat to public
health. The pathogen carried by the arthropod vector is transferred during blood feeding, the closest
interaction between the arthropod vector and the vertebrate host. Whether or not the transferred
pathogen is actually causing a disease, depends on a complex interaction of many factors, most
important the pathogen, the host and the hosts immune system (Mencke, 2013).
A research on vector borne infections and pathogens has started two decades ago. Vector borne
pathogens are often known as emerging pathogens. Emerging pathogens include infectious agents
that were previously un recognized and have been identified and associated with a new disease or
an illness with a previously unknown aetiology; organisms that have been described in other regions
196
and imported into areas where they were previously unknown, or agents that were constantly
present in the affected area at a low level or in a different host and due to some change have become
more widely spread in the population under concern (Harrus and Baneth, 2005). Important tickborne zoonoses such as Lyme disease, human granulocytic anaplasmosis (HGA) caused by A.
phagocytophilum, human monocytic ehrlichiosis (HME) caused by Ehrlichia chaffeensis, and
human babesiosis caused by B. microti were all described in the US during the second half of the
20th century and later in other countries and continents. Candidates Neoehrlichia mikurensis is an
intracellular bacterium member of the Anaplasmataceae family which causes severe disease with
fever and septicaemia in humans. It is an example of an emerging tick borne infection that has
been known only for a decade and appears to be dispersed in multiple regions. It has been identified
throughout Europe, in patients in Sweden, Switzerland, Germany, Czech Republic, China (Foldvari,
2014). Similarly to other tick borne infections agents, it is likely to have been circulating among
wildlife animals and ticks long before it emerged as a recognised clinical cause of human disease.
Tick borne diseases are one of the key issues within a One Health concept. A triangle between
humans, animals and ticks within the environmental conditions, has been a challenge for
researchers for some time now.
Figure 1 Overlaping of tick borne infections among different species (Baneth, 2014)
Ticks as vectors
Approximately 900 species of ticks have been described to date, of which more than 700 belong to
the Ixodidae (hard ticks); approximately 200 belong to the Argasidae (soft ticks). The lifestyle of
ticks which includes uptake of blood from hosts, secretion of saliva into the host tissues, movement
between different hosts and production of eggs from which a new generation of ticks develops,
inevitably makes them suitable to host other organisms. A wide variety of pathogens is transmitted
from ticks to vertebrates including viruses, bacteria such as rickettsiae and spirochetes, fungi,
protozoa and helminths, of which most have a life cycle which requires passage through the
vertebrate host (Dantas-Torres et al., 2012).
Several factors contribute to the change in geographic ranges of tick borne infections. Ticks cannot
fly or move long distances by themselves and, therefore, their transfer from one location to another
depends mostly on movement of hosts including birds which can fly long distances (Mathers et al.,
2011 and Hasle, 2013), migrating wild animal species such as jackals, animals introduced into new
areas by humans such as farm animals imported into areas where they were not present before,
197
rodents travelling accidently with ships or trucks, or imported pet animals. Climate change may also
facilitate migration of vertebrate tick hosts, allowing dispersal of ticks and pathogens into new
territories (Estrada-Pea et al., 2012). Transmission of tick borne infections can also occur by
contaminated blood transfusions and needles. Babesia of different species have been shown to be
transmitted by blood transfusion in both humans and dogs (Stegeman et al., 2003). Such artificial
transmission may result in spread of tick borne infections to new areas, if competent tick vectors
and reservoir hosts are found in those areas. Although the majority of tick borne infections are
transmitted via the tick saliva during the course of the blood meal, there are some pathogens of
veterinary importance which are transmitted naturally by other mechanisms. For example,
Hepatozoon spp. is protozoa that belongs to the Apicomplexa and infect vertebrates by oral
ingestion of an arthropod host containing infective sporozoites. Hepatozoon spp. infect dogs that
orally uptake and ingest ticks harbouring mature sporozoites.
Ixodes ticks are abundant throughout Europe, but I.ricinus nortward shift has been noted, all the
way up to Norway and Sweden (Jaenson and Lindgren, 2011). I. ricinus has also been recorded at
1200-1300m above sea level in Check Republic and Austria (Daniel et al., 2003; Stuenzner et al.,
2006).
Factors that influence the distribution of I. ricinus in Europe have been identified as the following:
(1) factors directly related to climatic change (affecting the tick, host or habitat), (2) factors related
to changes in the distribution of tick hosts (which may be directly or indirectly a consequence of
human interventions) and (3) other ecological changes. Considering the large size of the global
human population, the high density of humans in some areas, and the surface size of the adult
human body, humans would be expected to be one of the most common blood sources for
ticks. Certainly most tick borne infections circulate between wildlife animals and ticks, and may
affect humans or domestic animals, but do not rely on infecting people for their persistence. For
example, Lyme disease circulates mostly among rodents, and humans or domestic dogs are just
incidental hosts that could suffer from clinical disease but do not play an important role in the
enzootic transmission and epidemiology of this infection (Radolf et al., 2012). Despite the global
abundance of humans and their presence in a variety of climates and ecological conditions, they are
not major reservoirs for tick borne infections. Tick borne infections of humans, farm animals and
companion animals such as dogs and cats, may overlap, and some agents such as B.
burgdorferi and Anaplasma phagocytophilum are able to infect hosts belonging to more than one of
these categories, however all of these zoonotic agents are associated with wildlife reservoirs
Tick borreliosis
One of the most prevalent vector borne disease in humans in Europe is borreliosis. In Europe
several Borrelia species have been described, which are considered to cause human borreliosis with
clinical symptoms. These species are referred to collectively as Borrelia burgdorferi sensu lato, and
B.afzelii, B.garinii and B.valesiana. It is proposed to use term borreliosis or tick borreliosis for
Borrelia infection in Europe with B.burgdorferi s.l. instead of Lyme borreliosis which is used in
North America.
The risk of tick bite during outdoor activities for humans and dogs was studied in hunters and
compared to humans without association to hunting. The study indicated a higher prevalence of
borreliosis in owners of hunting dogs (15%) compared to non hunters (9%), but in more than 90%
of hunters, there was no evidence of clinical symptoms. There is an association between
occupations such as forestry workers, military personnel, rangers and borreliosis (Nohlmans et al.,
1991).
Information on the role of dogs in tick borreliosis, as infected patient or as a sentinel for tick
borreliosis in Europe is rather limited. The data for seroprevalence of borreliosis in dogs in Europe
198
vary from only several percentages in Czech Republic, Poland and Romania, to 50% in Slovakia
(Pelchalova et al., 2006; Scotarczak and Wodecka, 2003; Kiss et al., 2011; Stefancikova et al.,
1998)
Tick-borne rickettsiales
Rickettsiales transmitted by ticks in Europe and causing clinical signs in dogs are Anaplasma
phagocytophilum and Anaplasma platys. There is also Erlichia canis, belonging to the
Anaplasmataceae family. Anaplasma phagocytophilum has been found all over Europe in the
following countries: Austria, Belgium, Czech Republic, Finland, France, Germany, Hungary, Italy,
Luxembourg, Netherlands, Norway, Poland, Russia, Slovakia, Slovenia, Spain, Sweden,
Switzerland and United Kingdom (Jahfari et al., 2014)
Rickettsia conorii is the most important tick borne rickettiosis with public health impact in Europe.
It is the pathogen of Mediterranean spotted fever. The main vector for Rikettsia conorii is
Rhipicephalus sanguineus, but also Ixodes ricinus and Dermacentor spp have been described
(Benianti et al., 2002). Dogs have been identified as reservoirs of Rickettsia conorii (Levin et al.,
2012)
In Serbia, research on ticks as vectors, tick borne pathogens and tick borne diseases has started
approximately a decade ago. The first studies were on the presence of Borrelia burgdorferi sensu
lato strains in ticks, followed by research on Babesia spp. During the last few years a lot of work
has been done, not only in Serbia, but in the whole region on the topic of the presence of
Anaplsma phagocytophilum, Coxiella burnetii and Francisella tularensis in ticks.
Tick species found in different regions of Serbia so far are the following: Ixodes ricinus,
Dermacentor marginatus, Dermacentor reticulatus, Rhipicephalus sanguineus, Hemaphysalis
punctata, Haemaphysalis concinna (Tomanovi, 2013).
For B.burgdorferi s.l. more genospecies were found in ticks during the last few years: B. afzelii,
B,burgdorferi s.s, B. lusitaniae, B. garinii and B. valaisiana (Tomanovi et al., 2014; Potkonjak et
al., 2014. Monitoring of the prevalenece of B.burgdorferi s.l. in ticks is constant, but it differs
among different regions in Serbia (Vojvodina, Belgrade region and middle Serbia). The prevalence
for B.burgdorferi in ticks varies from 23% to 42.5% in different regions (Milutinovi et al., 2008;
Savi et al., 2010). Babesia spp is found to be present in ticks with two different methods, in
different tick species. It was found in Dermacentor reticulatus (21.57%) and Haemophysalis
concinna (8.57%) with one group of authors, by molecular detection in ticks collected from the field
(Mihaljica et al., 2012). The other group of authors searched for Babesia by microscopic analysis of
the midgut content of ticks in R. sanguineus, D. marginatus and D. reticulatus ticks, collected from
dogs with clinical sighs of babesiosis. The prevalence in ticks in the second study was quite higher
46.40% (Pavlovi et al., 2002). Both studies were done in the same region. In another study,
Anaplasma phagocitophylum has recently been found in 13.9% ticks in Serbia, including strains
with proven pathogenicity for humans (Tomanovi et al., 2010; Potkonjak et al., 2013). Coxiella
burnetii was found in less than 7% in ticks in different regions of Serbia (Tomanovi et al., 2013).
The prevalence for Francisella tularensis microorganisms has also been found as 3.8% in ticks
(Milutinoviet al., 2008).
All of the monitored pathogens are causative agents for more or less dangerous zoonozes, which
can be found in the region of Serbia and some of them have already been reported in humans (Savi
et al., 2012).
Table 1 Zoonotic tick borne diseases and hosts found in Serbia
Disease
Borreliosis
Bartonellosis
Ehrlichiosis
Rickettsiosis
Anaplasmosis
Tularaemia
Coxiellosis
Tick-borne encephalitis
Louping ill
*unpublished data, research still going on
Vector
Tick
Flea, Tick
Tick
Tick, Flea
Tick
Tick
Tick
Tick
Tick
Detection in Serbia
Ticks, dogs, humans
Cats
*
Ticks
Ticks, dogs
Ticks
Ticks, sheep, humans
*
No
Conclusion
Vector-borne diseases are important infectious disease of human and veterinary medicine across
Europe. From all the published data recently, it is concluded that further research is needed and
field studies on vector borne diseases in Serbia. The epidemiology of ticks, the dynamics of ticks
spreading into new habitats due to climate changes and land use is not enough known.
200
Veterinary medicine in general, needs to be included in any action of European bodies regarding
tick borreliosis and also this disease is an important canine vector borne disease. Infections with
Rickettsiales, like Anaplasma phagocytophilum or Rickettsia conorii are emerging and re-emerging
vector borne diseases in Europe.
Vector borne diseases shared between humans and dogs, point clearly towards the necessity for a
joint effort under the One health concept in all aspects, from epidemiology, clinic, diagnostic,
therapy and prevention. From a veterinary medicinal perspective the importance of a One health
concept was recently addressed by the World Small Animal Veterinary Association (WSAVA) by
initiating the One Health Committee ( Day, 2010). It is the aim of this committee to position small
animal veterinary medicine as an integral part of the One health concept in terms of zoonotic and
vector-borne diseases (Day, 2011).
The question at the moment is weather is the global prevalence of tick borne infections increasing
or are improvements in the ability to detect infection using sensitive and specific new techniques,
and an increased awareness, responsible for more detection of disease? It is most likely that both an increase in the spread of tick borne infections and an improved capability of detection are the
answer for the global rise in reporting of tick borne infections. Human tick borne infections cannot
be described without studying and understanding their relationship to animal hosts and reservoirs.
Unlike some of the major human vector-borne diseases associated with flying insect vectors, where
infection could be independent of association with animals, tick borne infections are zoonoses and
control efforts must consider this when programs are developed to limit or eradicate them.
Integration of veterinary and human reporting systems, surveillance in wildlife and tick populations,
and combined teams of experts from several scientific disciplines such as entomology,
epidemiology, medicine, public health and veterinary medicine are needed for the formulation of
regulations and guidelines for the prevention of tick borne infections (Baneth, 2014).
Acknowledgments
This work was supported by the grant TR31084 of the Ministry of Education, Science and
Technological Development of the Republic of Serbia.
References:
1.
2.
3.
4.
5.
6.
7.
Baneth G, Tick-borne infections of animals and humans: a common ground, Int J Parasitol. 2014
Aug;44(9):591-6. doi: 10.1016/j.ijpara.2014.03.011. Epub 2014 May 15, 2014
Beninati T., N. Lo, H. Noda, F. Esposito, A. Rizzoli, G. Favia, C. Genchi, First detection of spotted
fever group rickettsiae in Ixodes ricinus from Italy Emerg. Infect. Dis., 8 (9), pp. 983986, 2002.
Daniel M., V. Danielova, B. Kriz, A. Jirsa, J. Nozicka, Shift of the tick Ixodes ricinus and tick-borne
encephalitis to higher altitudes in Central Europe, Eur. J. Clin. Microbiol. Infect. Dis., 22, pp. 327328,
2003.
Dantas-Torres F., B.B. Chomel, D. Otranto, Ticks and tick-borne diseases: a One Health perspective
Trends Parasitol., 28, pp. 437446, 2012.
Day M.J. One health: the importance of companion animal vector-borne diseases Parasit. Vectors, 4, p.
49, 2011.
Day M.J. One health: the small companion animal dimension Vet. Rec., 167, pp. 847849, 2010.
Dumont P, Fourie JJ, Soll M, Beugnet F, Repellency, prevention of attachment and acaricidal efficacy
of a new combination of fipronil and permethrin against the main vector of canine babesiosis in Europe,
Dermacentor reticulatus ticks, Parasit Vectors. 2015 Jan 27;8:50. doi: 10.1186/s13071-015-0682-z.,
2015.
201
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
202
203
Invited lecture
WNV IN SERBIA: UPDATE OF CURRENT KNOWLEDGE
Tama Petrovi1, Duan Petri2, Diana Lupulovi1, Ivana Hrnjakovic Cvetkovic3, Vesna
Milosevic3, Sava Lazi1, Juan Carlos Saiz 4
1. Scientific Veterinary Institute Novi Sad, Novi Sad, Serbia
2. Laboratory for medical and veterinary entomology, Faculty of Agriculture, University of Novi Sad, Novi Sad,
Serbia
3. Institute of Public Health of Vojvodina, Medical Faculty, University of Novi Sad, Novi Sad, Serbia
4. Department of Biotechnology, Instituto Nacional de Investigacin y Tecnologa Agraria y Alimentaria (INIA),
Madrid, Spain
Corresponding author: tomy@niv.ns.ac.rs
Abstract
West Nile virus (WNV) is a neurovirulent mosquito-borne Flavivirus with zoonotic potential.
Recently, the number, frequency and severity of outbreaks of infections caused by WNV, with
neurological consequences for birds, humans and horses have increased dramatically throughout
central and south Europe, including Serbia, constituting a serious veterinary and public health
problem.
The emergency of WNV infections in Serbia is described through the current epidemiology
situation based on recent data on the presence, prevalence and incidence of WNV infection among
virus natural hosts and vectors; sentinel (horses) and other animal species, and in human population.
The short overview of the WNV serology studies conducted on horse blood samples collected in
different occasions during the last six years, and the results of the serology studies conducted
among other animal species like pigs, wild boars, and roe deer in Serbia are presented and
discussed. The results of the first studies on WNV presence in mosquito vectors, and in wild birds
as virus natural hosts in Serbia are presented and analyzed. Also, the data on the WNV serology
studies conducted in human population in Serbia in the last few years, and the existing data of
WNV outbreaks in 2012, 2013 and 2014 are included.
In addition, the national program for WNV monitoring launched by the veterinary service in Serbia
in April 2014 is presented. The program was funded by the Veterinary Directorate, and it was
implemented on the field by veterinary service in collaboration with entomologists and
ornithologists. The main objective of the monitoring program was early detection of WNV presence
in nature, and consequently timely alerting of human health services and local governments in order
to control the mosquito population and to inform the local communities. The monitoring program
was based on the direct and indirect monitoring of WNV presence in nature. Indirect monitoring of
virus presence was performed by serological testing of WNV seronegative - sentinel horses and
backyard chickens hatched during 2014, and direct monitoring was done by molecular testing of
WNV presence in pooled mosquitos samples and in wild birds. Number of tested samples is
defined at the level of each district of the Republic of Serbia in relation to the risks of WNV
infection.
Keywords: West Nile virus, antibody and virus detection, domestic and wild animals, human
population, mosquitoes, surveillance program, Serbia
Introduction
West Nile virus (WNV) is a neurovirulent mosquito-borne Flavivirus with zoonotic potential,
which is maintained in nature in an enzootic transmission cycle between avian hosts and
204
ornithophilic mosquito vectors. The virus occasionally infects other vertebrates, including humans
and horses, in which it may cause sporadic disease outbreaks that may result fatal. West Nile virus
(WNV) was first isolated from a febrile woman in the West Nile district of Uganda in 1937
(Smithburn et al., 1940) and today is considered as the most widespread flavivirus in the world,
endemic in Africa, Asia, Europe, Middle East, Australia and Americas (Trevejo and Eidson, 2008;
Calistri et al., 2010; Weissenbck et al., 2010; Papa et al., 2011).
WNV infections have been described in a wide variety of vertebrates (Komar et al., 2003). The
virus is maintained in an enzootic cycle between ornithophilic mosquitoes, mainly of the Culex
genus (Hayes et al., 2005; Ziegler et al., 2012), but also Aedes and Ochlerotatus genus, and certain
wild bird species (Savini et al., 2012; Ziegler et al., 2012). WNV was found in more than 150
species of wild and domestic birds (van der Meulen et al., 2005). Wild birds are important to public
health because birds migrating across national and intercontinental borders and becoming a longrange virus vectors (Linke et al., 2007). Following infection, many bird species produce levels of
viraemia that are sufficient for transmitting the virus to mosquitoes (Komar et al., 2003). Human
and mammals, especially horses, are occasional, dead end hosts and play limited roles in the natural
cycle because viraemia is generally too low to infect mosquitoes (Dauphin et al., 2004; Valiakos et
al., 2011), however severe neuroinvasive disease and occasionally with fatal outcomes can occur.
In Europe, until the 1990s WNV had caused sporadic outbreaks with rare reports of encephalitis
but its epidemiological behaviour changed when it re-emerged in Romania, Russia and the
Mediterranean basin causing dozens of humans and horses deaths (Castillo-Olivares and Wood,
2004; Blitvich, 2008; Calistri et al., 2010). Also, only recently the strains of WNV lineage 2 were
identified in Europe: in 2004 and 2005 in goshawks and birds of prey in Hungary, in 2007 in
Volgograd, Russia, and in 2008 and 2009 in goshawks and a falcon in Austria (Bakonyi et al., 2006;
Erdlyi et al., 2007; Platonov et al., 2008; Wodak et al., 2011). Since 2008, WNV has been heavily
spreading throughout central and southeastern Europe, constituting a serious veterinary and public
health problem for Europe (Barbi et al., 2012; Ziegler et al., 2012).
The history of West Nile fever in Serbia is largely unknown. Due to absence of routine diagnose
praxis and limited resources in hospitals of Serbia the human cases of meningoencephalitis of
unknown origin, that should be submitted to laboratory testing for WNV presence, had been
neglected up until 2012. In addition, with the exception for research purpose, the regular, program
based WNV surveillance in sentinel chickens, horses or mosquitoes did not exist before 2013. Only
scarce historical data exists about the presence of WNV in human population and indicate
seroprevalence of WNV in republics of former Yugoslavia of 1-3% in Croatia, 1% in Bosnia and
Herzegovina and Kosovo, 1% in Montenegro and 1-8% in Serbia (Vesenjak-Hirjan et al., 1991).
In August 2012, an outbreak of WNV infection in humans, was reported for the first time ever in
Serbia (EpiSouth Weekly Epi Bulletin - N232, - N240; ECDC, 2012; Obrenovi et al., 2013;
Popovi et al., 2013), being the first time that WNV infections in the country have been associated
with clinical symptoms. As of November 30, 2012, a total of 71 West Nile fever cases were
reported, among which 42 were clinically and laboratory confirmed, and in 9 cases resulted fatal
(lethality of 12.7%). All the cases were detected in central and northern part of the country, 72% of
them in the Beograd district (ECDC, 2012; Obrenovic et al., 2013; Popovic et al., 2013). This
epidemic continued, and became even more severe during 2013. As of November 2nd, 2013, a total
of 303 West Nile fever cases were reported, among which 202 were clinically and laboratory
confirmed, and 103 were classified as probable cases. Infection in 35 cases resulted fatal (lethality
of 11.6%). Almost all of the cases were also detected in central and northern part of the country
(Institute of Public Health of Serbia, 2014).
The epidemic also continued during 2014. The outbreak characteristic was similar as those from
2012. In total 76 clinical cases were reported and 9 cases resulted fatal. Almost all the cases were
detected in central and northern part of the country, and 65 out of 76 (86%) of them in four counties
(Belgrade, South Banat, South Backa and Srem county) (ECDC, 2014). In Europe during 2014 in
total 163 human cases were reported, so 47% of cases were from Serbia. It can be concluded that
WNV infection in Serbia become endemic and can be assumed that it will be public health problem
in the coming years also.
tested negative in 2010, thus confirming an intensive WNV circulation in 2012 on the territory of
Serbia. Very recent WNV infection theory is also supported by findings that among young, up to 3
years old animals, almost 57% tested positive on anti-WNV antibodies (Petrovi et al., 2014).
Similarly, 96 horses from 5 tested stables during 2012 were tested again during 2013 with the same
methodology. High prevalence of 46.88% (ranged between stables from 23.53-75.0%) with new
cases of seroconversion were detected also indicating an intensive WNV circulation in 2013
(unpublished data). The very recent data suggests that more than 50% of horses from Northern and
central part of Serbia, the areas around the rivers Danube, Sava and Tisza, are seropositive
(unpublished data).
on these hot spots revealing WNV RNA in three out of 50 pools of Cx. pipiens pipiens, the first
finding of WNV in mosquitoes in Serbia (Petri et al., 2012). During this experiment, a total of
56757 mosquitoes (841 pools of 50 individual insects) originating from 66 localities in 29
settlements in Vojvodina were examined. The presence of WNV genome was established in only
three pooled-samples of mosquitoes collected during 2010 in the territory of Detelinara (part of the
city of Novi Sad). The isolate was typed as lineage 2 WNV (Petri et al., 2012). During the year
2012 WNV outbreak in Serbia, mosquitoes were collected at 62 sites in 31 municipalities in Serbia.
West Nile virus RNA was detected in 9.55% of 314 mosquito pools (11113 specimens) from 9
municipalities in Cx. pipiens pipiens, Aedimorphus vexans and Culiseta annulata (Petri et al., in
press). In addition, presence of WNV genome was confirmed in 28 (9.2%) out of 306 mosquito
pools collected and tested from 20 localities in Vojvodina Province of Serbia during 2013
(unpublished data). The very recent testing of WNV presence in mosquito vectors (Cx. pipiens
pipiens) was done during the first WNV surveillance program during 2014 in Serbia. The Cx.
pipiens pipiens mosquitoes were collected from the whole territory of Serbia and out of 995 tested
mousquito pools WNV were found present in 22 (2.21%) samples (unpublished data). These data
point on slightly less intensive WNV circulation during 2014 in Serbia, but still the virus circulation
in vectors is endemically present for the least four last years.
208
The active and passive surveillance encompassed all municipalities in the Republic of Serbia. The
selection and distribution of sampling localities in each county-region is defined by epizootiological
services of Scientific and Specialized Veterinary Institutes according to the assessment of the risk of
exposure to WNV (according to the human cases in the last 2 years, and previous studies performed
in horses). The whole Program was described in details by Petrovi et al. (2014a). The basic
methodology of WNV surveillance program in Serbia in 2014 is described in the Table 1.
Table 1. WNV surveillance program (sampling /testing) in Serbia in 2014 (Petrovi et al., 2014a)
High-risk regions/Counties
Lower-risk regions/Counties
1. Testing of sentinel animals (domestic poultry and horses) aimed at early detection of WNV
circulation
Surveillance of
sentinel poultry on
rural households
poultry hatched in
current year
(backyard poultry)
Surveillance of
sentinel horses
Virus surveillance
in wild birds
Virus surveillance
in vectors mosquitoes
(Culex pipiens)
health in Serbia, there is a need for further studies and continuous monitoring and surveillance of
WNV infection and virus epidemiology in Serbia in the coming years.
Acknowledgments
This work is conducted within the project TR31084 funded by the Serbian Ministry of Education,
Science and Technological development
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
Bakonyi, T., Ivanics, E., Erdelyi, K., Ursu, K., Ferenczi, E., Weissenbock H. and N. Nowotny: Lineage
1 and 2 strains of encephalitic West Nile virus, central Europe. Emerg Infect Dis. 12(4), 618-623, 2006.
Barbi, Lj., Liste, E., Kati, S., Stevanovi, V., Madi, J., Stareina, V., Labrovi, A., Di Gennaro, A.
and G. Savini: Spreading of West Nile virus infection in Croatia. Veterinary Microbiology 159, No 3-4,
504508, 2012.
Blitvich, B.J.: Transmission dynamics and changing epidemiology of West Nile virus. Anim. Health
Res. Rev. 9(1), 71-86, 2008.
Bordjoski M, Gligic A, Boskovic R.: Arbovirusne infekcije u SR Srbiji. Vojnosanit Pregl, 29(4):173175, 1972.
urii B, Vasi A, Rogoarski D, Vojinovi D, Elezovi Radovanovi M, Mani M, Mari J, Proki N,
Ili , Novotny N, Gligi A.: Seroepizootiological-epidemiological investigation and mapping of West
Nile infection in the Republic of Serbia. Acta Veterinaria (Beograd), Vol. 63, No. 5-6, 569-579, 2013.
DOI: 10.2298/AVB 1306569D
Calistri, P., Giovannini, A., Hubalek, Z., Ionescu, A., Monaco, F., Savini, G., Lelli R.: Epidemiology of
West Nile in Europe and the Mediterranean basin. The Open Virol. J. 4, 29-37, 2010.
Castillo-Olivares, J. and J. Wood: West Nile infection in horses. Vet. Res. 35, 467-483, 2004.
Dauphin, G., Zientara, S., Zeller, H. and B. Murgue (2004). West Nile: worldwide current situation in
animals and humans. Comp Immunol Microbiol Infect Dis. 27 No5, 343-355.
ECDC (European Centre for Disease Prevention and Control). Reported cases of West Nile fever for the
EU and neighbouring countries. Situations update 30. November 2012. [Accessed 16 Dec 2012].
Available
from:
http://ecdc.europa.eu/en/healthtopics/west_nile_fever/West-Nile-fevermaps/Pages/index.aspx
ECDC (European Centre for Disease Prevention and Control). Reported cases of West Nile fever for the
EU and neighbouring countries. Situations update 20. November 2014. Available from:
http://ecdc.europa.eu/en/healthtopics/west_nile_fever/West-Nile-fever-maps/pages/index.aspx
.
[Accessed 10 March 2015].
EpiSouth Weekly Epi Bulletin - N232, 22nd August 28th August 2012 (e-WEB) available at:
http://www.episouthnetwork.org/sites/default/files/bulletin_file/eweb_232_30_08_12.pdf
EpiSouth Weekly Epi Bulletin - N240, 17 October 23 October 2012 (e-WEB) available at:
http://www.episouthnetwork.org/content/episouth-weekly-epi-bulletin-e-web
Erdlyi, K., Ursu, K., Ferenczi, E., Szeeredi, L., Ratz, F., Skare, J., Bakonyi T.: Clinical and
pathological features of linage 2 West Nile virus: Infections in birds of prey in Hungary. Vector Borne
Zoonotic Dis. 7, No 2, 181-188, 2007
Escribano-Romero E, Lupulovi D, Merino T, Blzquez A-B, Lazi G, Lazi S, Saiz JC, Petrovi T.
West Nile virus serosurveillance in wild and domestic mammals from Serbia. Veterinary Microbiology
176, 365369, 2015.
Hayes, E., Komar, N., Nasci, R., Montgomery, S., OLeary, D., Campbell G.: Epidemiology and
transmission dynamics of West Nile virus disease. Emerg Infect Dis. 11, No 8, 1167-1173, 2005.
Institut za javno zdravlje Srbije. Infrmci tuln pidmil situcii grznic
Zpdng Nil n tritrii Rpubli Srbi u 2014. gdini - 25.07.2014. (www.batut.org.rs;
http://www.batut.org.rs/index.php?content=940 )
210
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
Bunning M.: Experimental infection of North American birds with the New York 1999 Strain of West
Nile virus. Emerg Infect Dis. 9, No 3, 311-322, 2003.
Linke, S., Niedrig, M., Kaiser, A., Ellerbrok, H., Muller, K., Muller, T., Conraths, F.J., Muhle, R.U.,
Schmidt, D., Koppen, U., Bairlein, F., Berthold, P., Pauli G.: Serologic evidence of West Nile virus
infections in wild birds captured in Germany. Am. J. Trop. Med. Hyg. 77, 358364, 2007.
Lupulovi D, Martn-Acebes M, Lazi S, Alonso-Padilla J, Blquez A-B, Escribano-Romero E, Petrovi
T, Saiz JC. First Serological Evidence of West Nile Virus Activity in Horses in Serbia. Vector-Borne
and Zoonotic Diseases, Vol. 11, No9, 1303-05, 2011.
Medi S, van den Hoven R, Petrovi T, Lupulovi D, Nowotny N.: Serological evidence of West Nile
virus infection in the horse population of northern Serbia. J Infect Dev Ctries, 8(7):914-918, 2014.
Obrenovi Jelena, Grgi Bojana, Lonarevi Goranka, Dimitrijevi Dragana, Ili-Vlatkovi Verica,
Simi Danijela, Kanazit Milena, Seke Kristina, Milinkovi Milunka, Mutavdi Tanja. Izvetaj o
zaraznim bolestima u 2012.godini na teritoriji Republike Srbije. Institut za javno zdravlje Srbije dr
Jovan
Jovanovi
Batut,
2013,
ISSN2217-9607.
http://www.batut.org.rs/download/izvestaji/Godisnji%20izvestaj%20o%20zaraznim%20bolstima%202
012.pdf
Papa, A., Bakonyi, T., Xanthopoulou, K., Vazquez, A., Tenorio, A., Nowotny N.: Genetic
characterization of West Nile virus lineage 2, Greece, 2010. Emerg. Infect. Dis. 17, 920922, 2011.
Popovi N, Miloevi B, Uroevi A, Poluga J, Lavadinovi L, Nedelijkovi J, Jevtovi D, Dulovi O.
Outbreak of West Nile virus infection among humans in Serbia, August to October 2012 . Euro Surveill.
2013;18(43):pii=20613
Petri D, Hrnjakovi Cvjetkovi I, Radovanov J, Cvjetkovi D, Jerant Pati V, Miloevi V, Kovaevi
G, Zgomba M, Ignjatovi upina A, Konjevi A, Marinkovi, D, Paz Snchez-Seco M.: West nile virus
surveillance in humans and mosquitoes and detection of cell fusing agent virus in Vojvodina province
(Serbia). HealthMED, Vol. 6, No 2, 462-468, 2012.
Petri D., Zgomba M., Ignjatovi upina A., Bellini R., Hrnjakovi Cvjetkovi I., Miloevi V., Jerant
Pati V., Lazi S., Petrovi T. West Nile virus presence in mosquitoes in Serbia during 2012. In press
Petrovi T, Blazquez A, Lupulovi D, Lazi G, Escribano-Romero E, Fabijan D, Kapetanov M, Lazi S,
Saiz JC.: Monitoring West Nile virus (WNV) infection in wild birds in Serbia during 2012: first
isolation and characterisation of WNV strains from Serbia. Eurosurveillance, Vol 18, 44, 1-8, 2013.
Petrovi T, Lazi S, Lupulovi D, Lazi G, Bugarski D, Vidanovi D, Stefan-Miki S, Miloevi V,
Hrnjakovi-Cvetkovi I, Petri D.: Serological study on WNV presence in horses in Vojvodina after the
human outbreak in Serbia in 2012. Arch Biol Sci Belgrade, 66 (2), 473-481, 2014.
Petrovi T., ekler M., Petri D., Lazi S., Lupulovi D., Lazi G., Debeljak Z., Bugarski D., Plavi B.:
West Nile virus surveillance program in Serbia. Arhiv veterinarske medicine, 7, 2, p29-45, 2014a.
Platonov, A.E., Fedorova, M.V., Karan, L.S., Shopenskaya, T.A., Platonova, O.V. and V.I. Zhuravlev
(2008). Epidemiology of West Nile infection in Volgograd, Russia, in relation to climate change and
mosquito (Diptera: Culicidae) bionomics. Parasitol Res. 103, Suppl 1, 45-53
Savini, G., Capelli, G., Monaco, F., Polci, A., Russo, F., Di Gennaro, A., Marini, V., Teodori, L.,
Montarsi, F., Pinoni, C., Pisciella, M., Terregino, C., Marangon, S., Capua I., Lelli R.: Evidence of West
Nile virus lineage 2 circulation in Northern Italy. Vet Microbiol. 158 No 3-4, 267-273, 2012.
Smithburn, K.C., Hughes, T.P., Burke, A.W., Paul J.H.: A neurotropic virus isolated from the blood of
a native of Uganda. Am J Trop Med Hyg 20, 471-492, 1940.
Trevejo, R.T., and M. Eidson: Zoonosis update: West Nile virus. J. Am. Vet. Med. Assoc. 232, 1302
1309, 2008.
Valiakos, G., Touloudi, A., Iacovakis, C., Athanasiou, L., Birtsas, P., Spyrou, V., Billinis C.: Molecular
detection and phylogenetic analysis of West Nile virus lineage 2 in sedentary wild birds (Eurasian
magpie), Greece, 2010. Euro Surveill. 16(18):pii=19862, 2011. [Accessed 30 May 2013]. Available
online: http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19862
van der Meulen, K.M., Pensaert, M.B., Nauwynck H.J.: West Nile virus in the vertebrate world. Arch.
Virol. 150, 637657, 2005.
211
Journal of Hygiene, Epidemiology, Microbiology and Immunology (Prague) 35, 129-40, 1991.
36. Weissenbck, H., Hublek, Z. Bakonyi, T., Nowotny N.: Zoonotic mosquito-borne flaviviruses:
worldwide presence of agents with proven pathogenicity and potential candidates of future emerging
diseases. Vet. Microbiol. 140, 271280, 2010.
37. Wodak, E., Richter, S., Bag, Z., Revilla-Fernndez, S., Weissenbck, H., Nowotny, N., Winter P.:
Detection and molecular analysis of West Nile virus infections in birds of prey in the eastern part of
Austria in 2008 and 2009. Vet Microbiol. 149, No 3-4, 358-366, 2011
38. Ziegler, U., Seidowski, D., Angenvoort, J., Eiden, M., Mller, K., Nowotny, N., Groschup M.H.:
Monitoring of West Nile Virus Infections in Germany. Zoonoses and Public Health, Vol. 59, 95-101,
2012
212
Abstract
Bluetongue is an infectious arthropod-borne viral disease primarily of domestic and wild ruminants.
Infection with bluetongue virus (BTV) is common in a broad band across the world. Since the
1990s, BTV has extended considerably north of the 40th and even the 50th parallel in some parts of
the world (eg, Europe).
The etiological agent of the disease is Orbivirus, family Reoviridae. There are at least 24 serotypes
worldwide. Although not all serotypes exist in any one geographic area, virus has high capacity to
quickly spread across the area.
During the late summer and early fall 2014, emerging of the disease was observed in the eastern and
southeastern part of Serbia. It was confirmed as BTV Serotype 4. The first cases in sheep in
Branicevo district were recorded in September. The sheeps have had fever, lameness and
depression. Edema of lips, nose, face, submandibular area and eyelids were seen in most of the
cases. Edema of the head was followed by plentiful salivation. On the tongue and gums there could
be seen erosions and in one sheep it was found edematous tongue with mild cyanosis (blue tongue).
The first autopsy findings of dead sheeps did not clearly indicate blue thongue disease: several
erosions on the tongue and gums with plenty of saliva, slightly swollen subcutaneous tissue in the
chest region. The most pronounced lesions were in the thoracic cavity: hyperemia and pulmonary
edema, massive subpleural hemorrhages. The lesions of the proximal part of the pulmonary artery
were slightly pronounced (hardly visible changes).
Subsequent autopsy cases were revealed pathognomonic lesions on the proximal part of the
pulmonary artery (ring bleeding under the adventitia of the pulmonary artery), edema and
hemorrhages of the papillary muscle of the left heart ventricle. These gross lesions are nearly
certain sign of the disease. The severity of lesions depends on the virulence of the virus, the period
of time of it presents on some area and the immune status of the host. Laboratory confirmation is
essential for final diagnose.
Key words: Orbivirus, sheep, gross lesions.
Introduction
Bluetongue (BT) or ovine catarrhal fever is an arthropod-borne viral disease of domestic and wild
ruminants, particularly sheep. It is characterised by inflammation, haemorrhage, excoriations,
erosion and cyanosis of the mucous membranes of the oronasal cavity, coronitis, laminitis, oedema
of the head and neck, and torticollis. The name of the disease derives from cyanosis of the tongue.
Bluetongue is most prevalent in tropical and subtropical climate area. It was first described in South
Africa (in the late eighteenth century) in Merino sheep (Verwoerd and Erasmus, 2004). During the
twentieth century, the disease have been reported in Cyprus, Israel, USA, Portugal, Spain, Pakistan,
India, Middle East, China, Malaysia, Indonesia, Australia and in now days in Southeast Europe.
The etiological agent of the disease is a virus which is composed of a segmented, double-stranded
RNA enclosed in a double-layered capsid. It was classified in genus Orbivirus, family Reoviridae.
There are at least 24 serotypes worldwide. In blood and tissue specimens it is very stable at 20 C, 4
C and -70 C, but not at -20 C. The virus is unstable below pH 6,5 (Owen, 1964).
213
Bluetongue virus (BTV) first multiplies in the regional lymph nodes after virus inoculation by the
bite of a midge before spreading to the rest of the body. Viral replication occurs primarily in
endothelial cells and pericytes of capillaries and small blood vessels. Pathological changes in these
cells leads to hyperplasia of the endothelium and consequently vascular occlusion, stasis and
exudation, which eventually gives rise to hypoxia, oedema and haemorrhage as well as to secondary
lesions in the overlying epithelium (Verwoerd and Erasmus, 2004). The most sever lesions occur in
areas where the temperature is lower than that of circulating blood (Verwoerd and Erasmus, 2004).
There is also evidence for a highly selective involvement of endothelial cells in certain blood
vessels, such as the pulmonary artery and those where the most severe lesions are found. The
mechanism of these lesions is not understood.
The aim of this paper was not to elucidate the new facts about BT, but to remind and emphasizes
the importance of gross lesions in the diagnosis of this disease.
Material and Methods
Photos used in this paper were taken during necropsies of sheep, in Veterinary institute
Poarevac, in September 2014. In all cases BTV was confirmed in full blood samples by ReverseTranscription Polymerase Chain Reaction (RT-PCR).
Results
During the late summer and early fall 2014, emerging of BT was observed in the eastern and southeastern part of Serbia. It was confirmed BTV, serotype 4. The first cases in sheep in Branicevo
district were recorded in September. The sheep have had fever, lameness and depression. Oedema
of lips, nose, face, submandibular area and eyelids were seen in most of the cases. Oedema of the
head was followed by plentiful salivation. On the tongue and gums there could be seen erosions and
in one sheep it was found oedematous tongue with mild cyanosis (blue tongue).
The first autopsy findings of dead sheep did not clearly indicate Blue tongue disease: several
erosions on the tongue and gums with plenty of saliva (Fig. 1, 2 and 3), slightly swollen
subcutaneous tissue and few ecchymoses of the intermuscular connective tissues in the chest region
(Fig. 4 and 5). The most pronounced lesions were in the thoracic cavity: hyperaemia and pulmonary
oedema, massive subpleural haemorrhages. The lesions of the proximal part of the pulmonary artery
were slightly pronounced (hardly visible haemorrhages) (Fig. 6, 7, 8 and 9).
214
215
216
Subsequent autopsy cases were revealed more pronounced and characteristic lesions: erosions on
dental pad covered with diphtheritic deposits Fig.10; oedema of subcutaneous tissue in the
submandibular area Fig. 11; gelatinous oedema of connective tissue in the surroundings of of the
esophagus Fig. 12; hydrothorax - Fig. 13; sprayed subepicardial bleeding which cover a large area
of the heart - Fig. 14; pronounced ring bleeding in the tunica media of proximal part of pulmonary
artery - Fig. 15; edema and hemorrhages of the papillary muscle of the left heart ventricle - Fig. 16;
subcapsular petechial hemorrhages of the spleen Fig. 17.
Discussion
Previously described gross lesions correspond largely with the clinical signs (Moulton, 1961).
Ecchymoses and larger haemorrhages in the tunica media of the pulmonary artery near its base are
characteristic of BT (Fig. 8, 9 and 15). These lesions are sometimes described as being
pathognomonic for BT, but they have also been seen on rare occasions in other infections such as
217
Rift Valley fever, heart-water and pulpy kidney disease in sheep. These haemorrhages may be
difficult do see and it may be necessary to stretch the pulmonary artery and to hold it against the
light (Fig. 9). Sometimes epicardial and endocardial haemorrhages as well as focal necrosis of the
papillary muscle can be seen in the left ventricle (Fig. 16). Bleedings in the wall of the base of the
pulmonary artery and lesions of the papillary muscle of the left ventricle are highly characteristic
for BT and they are usually obvious in severe clinical infections but as shown in Figures 8 and 9,
they may be barely visible in mild or convalescent cases (Lear and Callan, 2014).
Lymph nodes are commonly swollen and oedematous and at the spleen can be seen subcapsular
haemorrhages (Fig. 17).
Oral lesions which have been seen in the initial stage of the disease consist of slightly expressed
hyperemia, erosions and haemorrhages of the mucous membrane (Fig. 1, 2 and 3). The mucous
membrane was covered with a large amount of saliva. Destruction of epithelial cells lead to
excoriation and erosions (especially in areas of most friction: inside of the lips, dental pad, cheeks
and tongue, particularly adjacent to molars). Secondary bacterial infecton is often responsible for
the diphteric necrosis of the erosions (Martens et al., 1989), which have been observed in latter
clinical cases and necropsies (Fig. 10).
Hyperaemia, petechiation and erosions of the mucosa of the forestomachs, particularly of the
papillae, rumenal pillars, reticular folds and oesophageal groove also can be seen in gastrointestinal
tract (Erasmus, 1990).
The most severe pathology changes occur in the lungs. Severe hyperaemia and oedema of the lungs
accompanied by copious amounts of froth in bronchi and trachea, as well as hydrothorax, occur
especially in acute fatal cases (Fig. 6). Aspiration pneumonia may occasionally be found (Luedke et
al., 1964).
The muscle lesions comprise ecchymoses (Fig. 5) and gelatinous oedema of the intermuscular
connective tissue, particularly in the neck and the dorsal thoracic region.
Each of described lesions for himself are not sufficient for diagnosis of BT, but all together in
correlation with clinical signs and epizootic anamnesis are certain milestone in the right direction.
First cases of the disease should be differentiated from early signs of hepatogenous photosensitivity
caused by a variety of plant and mycotoxin poisonings (Kellerman et al., 1988), vesicular diseases
such as foot-and-mouth disease and contagious ecthyma. In sheep that die after typical oral lesions
of BT have regressed, it may be difficult to differentiate BT from disease such as heartwater and
pulpy kidney disease (Verwoerd and Erasmus, 2004).
A presumptive diagnosis of BT can be made from previously described lesions in affected sheep,
especially in those areas where the disease is endemic. In nonendemic areas and in other ruminant
species laboratory conformation by either virus isolation, conformation of the virus genome or
serology is necessary. Laboratory conformation is also necessary to identify the serotype involved
in order to establish specific control measures.
References:
1. Erasmus B.J.: Bluetongue. In: Virus infections of Ruminants, Vol. 3, ed. Dinter Z and Morein B.,
Amsterdam: Elsevier Science Publishers, 1990.
2. Kellerman T.S., Coetzer J.A.W. and Naud T.W.: Plant Poisonings and Mycotoxicoses of Livestocks in
Soutern Africa. Cape Town, Oxford University Press Soutern Africa, 1988.
3. Lear A.S. and Callan R.J.: Overview of Bluetongue. In: The Merck Veterinary Manual, ed. Aiello S.E.
and Moses M.A., Merck Sharp & Dohme Corp., a subsidiary of Merck & Co., Inc., Whitehouse Station,
N.J., U.S.A., 2014,
http://www.merckmanuals.com/vet/generalized_conditions/bluetongue/overview_of_bluetongue.html
218
219
Abstract
All hard ticks species are obligatory parasites, often host nonspecific, and therefore capable of
parasitizing a numerous species of vertebrates. Their relatively slow feeding process on the hosts,
the absence of digestive enzymes and relatively adaptable life cycles enable acquisition,
maintenance and transmission of a variety of the pathogens and thus cause severe diseases in
humans and animals. The aim of the study is to determine the hard tick species diversity and the
dominance of the certain life stages on the hosts and on the vegetation cover at the hunting resorts
of Vojvodina. Two methods were used for tick sampling: from the vegetation and from the body of
the hunted roe deer (Capreolus capreolus Linnaeus, 1758) and wild boars (Sus scrofa Linnaeus,
1758). The study was conducted from 2011 to 2014 at 20 hunting resorts in Vojvodina, all
agroecosystems with wide belts of deciduous forests and sporadic shrub vegetation. Eight tick
species from four genera were identified on the hosts: Ixodes ricinus Linnaeus 1758,
Haemaphysalis concinna Koch 1844, H. punctata Canestrini & Fanzago 1878, H. sulcata
Canestrini & Fanzago 1878, Dermacentor marginatus Sulzer 1776, D. reticulatus Fabricius 1794,
Rhipicephalus bursa Canestrini & Fanzago 1878 and R. sanguineus Latreille 1806, but only five
species from three genera on the vegetation: I. ricinus, H. concinna, H. punctata, D. marginatus and
D. reticulatus. Depending on the season, locality and the sampling methods, the dominance of the
certain life stages was significantly different. The adult stages of all tick species were found on the
hosts, nymphae of I. ricinus, H. concinna and H. punctata and larvae only of I. ricinus and H.
punctata. However, on the vegetation cover, adults were found for five tick species, but nymphal
and larval stages only of I. ricinus and H. concinna. Due to its wide home ranges, seasonal
migrations and population fluctuations most of the vertebrate species found at hunting resorts
represent an "epidemiological bridge" among hosts, parasites and pathogens, responsible for the
maintenance of the high tick density populations in certain habitats and therefore seasonal, spatial,
transstadial and transovarial transmission of important pathogens for human and animal health.
Key words: ticks, Ixodidae, diversity, life stages, hunting resorts, Vojvodina
Introduction
All hard ticks species are obligatory parasites, often host nonspecific, and therefore capable of
parasitizing a numerous species of vertebrates. Their relatively slow feeding process on the hosts,
the absence of digestive enzymes and relatively adaptable life cycles enable acquisition,
maintenance and transmission of a variety of the pathogens and thus cause severe diseases in
humans and animals (Sonenshine, 1991). High tick infestation could cause the death of the host due
to blood loss (Balashov, 1968; loc. cit. Evans, 1992), but more important is the role of ticks as
vectors of numerous pathogens, viruses, bacteria and protozoa, transmitted to the host during the
feeding phase. During the last two decades, cases of zoonoses transmitted by ticks, such as Lyme
borreliosis, Tick-borne encephalitis, anaplasmosis, babesiosis and others, are on the rise, and
220
represent the leading health problem in many parts of Europe and North America (Paulauskas,
2009). Additionally, the further increase of tick-borne disease incidences could be expected as a
result of global climate change, as well as the expansion of vectors and pathogens in the new areas.
Due to their vector role, ticks are the subjects of many studies. To understand the complex
interactions among ticks, their hosts and pathogens, and to determine the potential risk of the
contact between humans and animals with infected ticks, a good knowledge of all biotic and abiotic
factors that affect the population of these arthropods is needed. Furthermore, continuous and
systematic monitoring of species abundance, seasonal and spatial dynamics of ticks and their hosts
is crucial.
Acarological studies in our country are mainly focused on urban and suburban habitats, although a
few numbers of studies were conducted at the natural habitats of ticks, such as hunting and natural
resorts (Jurii et al., 2011, Jurii et al., 2012). The rural habitats have low anthropogenic
influence, so floristic and faunistic communities are rich and diverse and provide favourable
conditions for maintaining the tick populations. The main host for the adult stages of Ixodes ricinus
in Central Europe is roe deer (Capreolus capreolus Linnaeus, 1758) (Pintur et al., 2012), followed
by the wild boar (Sus scrofa Linnaeus, 1758). Several studies have confirmed the high infestation of
roe deer and wild boars in Europe (Fuente et al., 2004; Ruiz-Fons et al., 2006; Kiffner et al., 2010;
Vor et al., 2010; Pintur et al., 2012; Carpi et al., 2008), stating that its abundance can affect the
population dynamics of I. ricinus ticks. Although the role of roe deer and wild boars in maintaining
the agents of some diseases in natural habitats (such as Lyme borreliosis and Tick-borne
encephalitis) is still unclear, there are numerous evidences of a positive correlation between the
number of roe deer and ticks (Carpi et al., 2008), which confirms the importance of understanding
the complex mechanisms of transmission of these potentially serious diseases. The role of wild boar
as a reservoir of Anaplasma phagocytophilum is confirmed by Michalik et al. (2009). Due to its
wide home ranges, seasonal migrations and population fluctuations most of the vertebrate species
found at hunting resorts represent an "epidemiological bridge" among hosts, parasites and
pathogens, responsible for the maintenance of the high tick density populations in certain habitats
and therefore seasonal, spatial, transstadial and transovarial transmission of important pathogens for
human and animal health.
In order to obtain the most accurate data on tick species diversity and density in practice, it is
necessary to use different methods of tick sampling. Due to different host seeking strategies, the
estimated relative abundance of tick populations is in most cases the direct result of the applied
sampling methods and as such do not represent a real tick species diversity at a certain locality. To
avoid the bias and to obtain the actual state of tick species diversity and their spatial dispersion, two
different methods of tick sampling were applied in this study. The aim of the study is to determine
the hard tick species diversity and the dominance of the certain life stages found on the hosts and on
the vegetation cover at the hunting resorts of Vojvodina.
collection of ticks from the carcasses of roe deer and wild boars was performed immediately after
the hunt. Each carcass was systematically and thoroughly inspected using palpatory technique by
three observers using latex gloves. All tick specimens were collected using acarological tweezers
and placed into plastic tubes (5 ml) with a small cotton ball soaked in water to maintain the
humidity and closed with perforated plastic stopper for sufficient ventilation. The collected
specimens were properly labeled and transported to the laboratory and maintained in induced
diapause at 5C till examination and identification. Tick species were identified up to species level
according to identification keys: Nosek & Sixl (1972), Estrada-Pea et al. (2004) and Walker et al.
(2007).
Localities
The study was performed at 20 localities on the territory of Autonomous Province of Vojvodina, 15
in Baka: Ada (13.277 ha, N4546`522`` E2009`230``), Apatin (28.812 ha, N4541`593``
E1855`340``), Ba (30.149 ha, N4520`447`` E1913`108``), Baka Palanka (52.204 ha,
N4514`198`` E1920`239``), Bako Gradite (6.548 ha, N4533`336` E2005`512``), Bako
Petrovo Selo (11.304 ha, N4541`144`` E2005`283``), Beej (30.147 ha, N4536`536``
E2004`419``), Futog (14.413 ha, N4514`005`` E1941`093``), Kanjia (39.856 ha, N4603`271``
E2004`422``), Mol (9.429 ha, N 4544`103`` E2009`462``), Nadalj (3.646 ha, N4532`005``
E1954`542``), Senta (25.500 ha, N4558`399`` E2005`316``), Srbobran (19.441 ha, N4533`331`
E1946`052``), Titel (26.070 ha, N4512`338`` E2019`075``), Turija (5.343 ha, N4532`509``
E1951`239``); four in Banat: oka (23.139 ha, N4557`301`` E2005`469``), Novi Beej (60.745
ha, N4535`509`` E2007`219``), Panevo (69.565 ha, N4451`530`` E2037`453``), Novi
Kneevac (30.539 ha, N4601`456`` E2004`598``); and one in Srem: Ruma (50.560 ha,
N4501`570`` E1949`189`` (area according to Antoni & Beukovi, 2007). All studied localities
were described as agroecosystems with wide belts of mixed deciduous forests and sporadic shrub
and bush vegetation.
Statistical analyses
The obtained values were tested using software Statistica 12 (StatSoft, licensed to University of
Novi Sad, Faculty of Agriculture). In order to statistically analyze the data, distribution fitting tests
(2 and Kolmogorov-Smirnov tests), one-way ANOVA (tested by Fishers LSD test for significance
level of p<0.05 as statistically significant and p<0.01 as highly statistically significant) were
applied.
Results
The qualitative and quantitative studies of tick species and life stages collected from vegetation and
from the carcasses of the hosts have shown the differences in relative abundance of identified tick
genera and species (Tab 1.).
Table 1. Differences in abundance of identified tick species, life stages and localities depending on sampling
method
Ticks collected
from the
vegetation
Ticks collected
from the hosts
Total
number
Number
of tick
species
The mean of
collected
ticks
Minimum
collected
ticks
Maximum
collected
ticks
Variance
Standard
deviation
Standard
error
20035
50.0875
569
8641.057
92.957
4.648
7267
11.3547
256
1084.236
32.928
1.302
222
l
273
245
321
I. ricinus
n
152 217
73
145 154
89
169 269
85
715
633
844
D. marginatus
n
0
0
48 27
0
0
55 23
0
0
59 25
75
78
84
D. reticulatus
n
0
0 11
8 19
0
0
0
0
0
0
0
0
0
0
H. punctata
n
11 32 10
13 35 11
15 21
8
53
59
44
H. concinna
Total
n
0
0
2
1
3
865
0
0
1
0
1
771
0
0
2
0
2
974
Ada
0
4.32
Apatin
0
3.85
Ba
0
4.86
Baka
256 189 198
96
739
0
0
72 26
98
0
0
0
0
0
0 12 34
9
55
0
1
0
0
1
893
4.46
Palanka
Bako
259 175 178
59
671
0
0
56 35
91
0
0
0
0
0
0 12 29
8
49
0
0
3
1
4
815
4.07
Gradite
Bako
Petrovo
358 211 159
63
791
0
0
65 24
89
0
0 12
9 21
0 11 26
7
44
0
0
1
0
1
946
4.72
selo
Beej
211 148 265
84
708
0
0
69 29
98
0
0 18
7 25
0 12 32
9
53
0
2
1
0
3
887
4.43
Futog
345 201 245 102
893
0
0
78 38 116
0
0 12
5 17
0 11 31
8
50
0
0
5
1
6 1082
5.40
Kanjia
326
36 240
68
670
0
0
71 21
92
0
0 21 11 32
0 18 30 12
60
0
0
0
0
0
854
4.26
Mol
211 184 211
75
681
0
0
84 33 117
0
0 13
5 18
0 13 25
2
40
0
1
2
1
4
860
4.29
Nadalj
198 196 256
79
729
0
0
92 22 114
0
0 10
6 16
0 19 27 24
70
0
0
1
0
1
930
4.64
Senta
371 258 242
96
967
0
0
69 28
97
0
0
0
0
0
0 19 24 21
64
0
0
0
0
0 1128
5.63
Srbobran
386 234 214
96
930
0
0
67 31
98
0
0 14
5 19
0 18 29
8
55
0
2
3
2
7 1109
5.54
Titel
345 265 198
93
901
0
0
99 34 133
0
0
5
3
8
0 21 34
9
64
0
0
4
2
6 1112
5.55
Turija
245 233 206
85
769
0
0
48 39
87
0
0
6
1
7
0 19 36 15
70
0
0
5
2
7
940
4.69
Ruma
425 245 254
86 1010
0
0
87 29 116
0
0
2
0
2
0 15 29 16
60
0
1
1
0
2 1190
5.94
oka
398 257 214
82
951
0
0
84 26 110
0
0
8
1
9
0 21 24 28
73
0
2
5
2
9 1152
5.75
Novi Beej 387 311 236
76 1010
0
0
76 34 110
0
0 14
8 22
0 20 21 22
63
0
1
7
4 12 1217
6.07
Panevo
569 254 197
58 1078
0
0
88 26 114
0
0 19
7 26
0 11 30 21
62
0
0
5
2
7 1287
6.42
Novi
387 224 226
99
936
0
0
59 25
84
0
0
0
0
0
0
0
0
0
0
0
2
1
0
3 1023
5.11
Kneevac
Total
6516 4087 4379 1644 16626
0
0 1426 575 2001
0
0 165 76 241
0 291 549 248 1088
0 12 49 18 79 20035 100.00
%
32.52 20.40 21.86 8.21 82.98 0.00 0.00 7.12 2.87 9.99 0.00 0.00 0.82 0.38 1.20 0.00 1.45 2.74 1.24 5.43 0.00 0.06 0.24 0.09 0.39 100.00
Obtained data had normal distribution, and ANOVA did not emphasize any statistical significances
regarding the different localities as independent variables on the number of collected ticks as a
dependent variable (pl=0.99999 for p0.05). However, ANOVA proved high statistical significance
between the total number of collected ticks and their species and life stages (psp=0.00000 and
pst=0.00475 for p<0.01) (Graph 1. and 2.). The Fisher's LSD test demonstrated high statistical
differences (for p<0.01) between the number of collected I. ricinus and all other species and D.
marginatus comparing to D. reticulatus and H. concinna. Furthermore, the number of sampled
males had high statistical differences (for p<0.01) comparing to collected larvae and females.
Ticks collected from the hosts
The total number 7267 specimens of ticks were sampled from the roe deer (64 carcasses) and wild
boars (29 carcasses) (Table 3.). Eight tick species from four genera were identified: I. ricinus
(69.00%), D. marginatus (13.76%), D. reticulates (4.06%), H. punctata (2.11%), H. concinna
(1.22%), as well as Haemaphysalis sulcata Canestrini & Fanzago 1878 (2.53%), Rhipicephalus
sanguineus Latreille 1806 (6.47%) and R. bursa Canestrini & Fanzago 1878 (0.85%). The most
abundant were the females of I. ricinus (49.33%). The larval stages of all identified species, as well
223
as the nymphs of D. marginatus, D. reticulatus, H. punctata, H. sulcata and R. bursa have not been
found on the hosts. The highest number of sampled ticks was at hunting resort Novi Kneevac
(6.12%) and the lowest at locality Mol (3.59%).
I. ricinus
l
D. marginatus
D. reticulatus
H. punctata
H. concinna
H. sulcata
R. sanguineus
R. bursa
Total
Ada
22
125
58
205
24
18
42
11
11
277
3.81
Apatin
24
129
54
207
28
16
44
10
20
287
3.95
Ba
Baka
Palanka
Bako
Gradite
Bako
Petrovo
selo
19
256
62
337
35
24
59
15
11
23
434
5.97
25
247
51
323
36
21
57
11
16
21
421
5.79
23
211
25
259
29
18
47
19
24
11
19
349
4.80
35
241
32
308
41
31
72
10
13
16
26
429
5.90
Beej
26
158
57
241
27
15
42
10
18
10
12
11
28
345
4.75
Futog
58
132
48
238
39
15
54
19
23
11
25
347
4.78
Kanjia
24
154
34
212
34
14
48
24
18
42
10
15
332
4.57
Mol
26
126
25
177
29
13
42
13
15
261
3.59
Nadalj
35
191
11
237
31
36
14
22
11
307
4.22
Senta
45
174
24
243
40
18
58
15
20
13
17
353
4.86
Srbobran
47
152
37
236
25
13
38
15
11
17
11
33
343
4.72
Titel
39
147
36
222
29
34
10
18
15
10
32
309
4.25
Turija
50
205
41
296
36
17
53
11
15
11
16
22
405
5.57
Ruma
25
185
21
231
41
16
57
16
14
22
12
16
22
14
15
38
406
5.59
oka
26
164
26
216
48
54
17
26
24
33
15
29
359
4.94
Novi Beej
38
184
34
256
50
25
75
12
16
21
11
32
10
11
29
10
427
5.88
Panevo
Novi
Kneevac
34
182
45
261
23
11
34
13
17
26
15
19
18
37
18
35
10
431
5.93
31
222
56
309
36
18
54
14
22
11
17
21
13
445
6.12
777 5014
0 199
96 295
0 100
53 153
10
57
22
89
0 124
89 470
39
23
62
Total
%
0 652 3585
60 184
0 202 179
7267 100.00
0.00 8.97 49.33 10.69 69.00 0.00 0.00 9.37 4.39 13.76 0.00 0.00 2.74 1.32 4.06 0.00 0.00 1.38 0.73 2.11 0.00 0.14 0.78 0.30 1.22 0.00 0.00 1.71 0.83 2.53 0.00 2.78 2.46 1.22 6.47 0.00 0.00 0.54 0.32 0.85 100.00
Tested values had normal distribution, and there were no significant differences among collected
ticks concerning different localities (pl=1.00000 for p<0.05). Nevertheless, ANOVA emphasized
high statistical associations between the number of collected ticks and species and life stages
(psp=0.00000 and pst=0.00000 for p<0.01) (Graph 3. and 4.). The Fisher's LSD test proved high
statistical differences (for p<0.01) between the number of collected I. ricinus ticks and all other
species, as well as D. marginatus with H. concinna and R. bursa. The statistical significances (for
p<0.05) were obtained for comparing the numbers of D. marginatus with D. reticulatus, H.
punctata and H. sulcata. No statistical significances were found in the number of D. marginatus and
R. sanguineus. Moreover, the high statistical differences (for p<0.01) were found in the number of
sampled larvae comparing to females and males, and females compared to nymphs and males.
224
90
45
80
40
70
35
60
30
50
Number of ticks
Number of ticks
40
30
20
25
20
15
10
10
5
0
0
-10
I. ricinus
D. reticulatus
H. concinna
R. sanguineus
D. marginatus
H. punctata
H. sulcata
R. bursa
Mean
-5
Larvae
Species
Mean
Nymphs
Females
Males
Stage
The nymphs and adults of H. punctata were obtained from the vegetation, but only adults were
found on the host. This species is confirmed at 19 localities as a host-seeking tick, and only at 7 as
parasiting on the hosts. More frequent, but less abundant was H. concinna, which nymphal stages
and adults were found both on the vegetation and the hosts. H. concinna was identified at all
prospected localities when sampled the vegetation and at 14 localities when sampled from the hosts.
These two species have preferences to open, warm and mild humid areas, with overlapping niches
with I. ricinus, and according to Nosek (1971, loc. cit. Mihalca et al. 2012), these species prefer
pastures, forest margins and forest-steppes. H. sulcata was the most abundant species of
Haemaphysalis genus, found as adults only on the hosts. Its presence is confirmed at 9 localities.
Similarly to findings of Mihalca et al. (2012), this species prefers warm and humid areas in
Vojvodina.
The species of genus Rhipicephalus were found only on the hosts. The nymphs and adults of R.
sanguineus were obtained from all studied localities. However, only adults of R. bursa were
collected at 13 localities. Although R. sanguineus is an endophilic, monotropic and three-host tick
species, it is also able to survive and maintain its population in the outdoor environments (DantasTorres, 2010) and therefore parasite on cattle or wild ungulates (Estrada-Pea et al., 2004). R.
bursa, on the other hand is a typical representative of tick fauna commonly found on ungulates,
with preferences to areas well covered with bush and steppe vegetation (Fuente et al., 2004).
Statistical differences obtained from studying the appearance of species on the vegetation and on
the hosts are mainly caused by ticks preferences to suitable habitats and hosts, their adaptability and
different host seeking strategies. Furthermore, the absence of D. marginatus and D. reticulatus
larval stages on the vegetation cover could be explained by their induced endophilic behaviour, as
they are found in the vicinity or in the lairs of rodent and insectivore species. In addition, the larval
stages of all collected tick species from the hosts are absent too, as they parasite only on rodents and
other small mammals, reptiles and birds, although Vor et al. (2010) have reported their presence on
the heads of the roe deer in Germany.
The most abundant tick stages obtained from the vegetation were larvae and females. Statistical
significance calculated for the male could be explained by their low abundance and specific sex
ratio characteristics typical for the ambush host-seeking behaviour confirmed by Hornok (2009).
However, statistical differences obtained for females comparing to nymphs and males from the
hosts proves the fact that females are obligated to take the blood meal in order to oviposit.
The presence and abundance of certain tick species at studied localities have not emphasized any
statistical significance in both types of sampling. The total number of collected ticks was evenly
distributed. The number of ticks collected from the vegetation varied from 4.07% at Bako Gradite
to 6.42% at Panevo and from the hosts from 3.59% at Mol to 6.12% at Novi Kneevac.
In order to obtain the most accurate data on tick species diversity and density in practice, to avoid
the bias and to obtain the actual tick population densities and their spatial dispersion it is necessary
to use different methods of tick sampling and to include a wider range of tick hosts such as other
ungulate species, carnivores, rodents, reptiles, birds, bats. Due to consistent population densities,
wide home ranges and seasonal migrations, most of the vertebrate species found at hunting resorts
are responsible for the maintenance of the high tick density populations in certain habitats and
therefore seasonal, spatial, transstadial and transovarial transmission of pathogens important for
human and animal health.
Acknowledgments
The presented work is part of the research done in the project TR31084 granted by the Serbian
Ministry of Education and Science and project No: 114-451-1293/2014-03 granted by the
Provincial secretary for science and technological development of AP Vojvodina
226
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
Antoni D., Beukovi M.: Lovaka organizacija Vojvodine: 1922-2007. Monografija Lovakog Saveza
Vojvodine, Novi Sad, 2007
Barandika J.F., Hurtado A., Garca-Sanmartin J., Juste R.A., Anda P., Garca-Prez A.L.: Prevalence of
Tick-Borne Zoonotic Bacteria in Questing Adult Ticks from Northern Spain. Vector-Borne and
Zoonotic Diseases, 8, 6, 829-835, 2008
Carpi G., Cagnacci F., Neteler M., Rizzoli A.: Tick infestation on roe deer in relation to geographic and
remotely sensed climatic variables in a tick-borne encephalitis endemic area. Epidemiol. Infect., 136,
14161424, 2008
Crooks E., Randolph S.E.: Walking by Ixodes ricinus ticks: intrinsic factors determine the attraction of
moisture or host odour. The Journal of Experimental Biology, 209, 2138-2142, 2006
Dantas-Torres F.: Biology and ecology of the brown dog tick, Rhipicephalus sanguineus. Parasites &
Vectors, 3, 26, 1-11, 2010
Donz G., Mcmahon C., Guerin M.: Rumen metabolites serve ticks to exploit large mammals. The
Journal of Experimental Biology, 207, 4283-4289, 2004
Estrada-Pea A., Bouattour A., Camicas J., Walker A.: Ticks of domestic animals in the Mediterranean
Region. A guide to identification of species. University of Zagaroza, Spain., 2004
Evans G.: Principles of Acarology. Cambridge Univesity press, Cambridge, 1992
Fuente de la J., Naranjo V., Ruiz-Fons F., Vicente J., Estrada-Pea A., Almazn C., Kocan K.M.,
Martin P.M., Gortzar C.: Prevalence of tick-borne pathogens in ixodid ticks (Acari: Ixodidae) collected
from European wild boar (Sus scrofa) and Iberian red deer (Cervus elaphus hispanicus) in central Spain.
Eur J Wildl Res, 50, 187-196, 2004
Hornok S.: Allochronic seasonal peak activities of Dermacentor and Haemaphysalis spp. under
continental climate in Hungary. Veterinary Parasitology, 163, 366-369, 2009
Jurii A:, Petrovi A., Rajkovi D., Niin S.: The application of lambda-cyhalothrin in tick control. Exp
Appl Acarol, 52, 201-109, 2010
Jurii A., Petrovi A., Rajkovi D., Beukovi M.: Attachment site and abundance estimation of ixodid
ticks (Acari: Ixodidae) on male roe deer (Capreolus capreolus Linnaeus 1758). Proceedings of 22nd
International symposium Food safety production,June19-25,Trebinje, Bosnia and Herzegovina, 2011,
146-148
Jurii A., Petrovi A., Rajkovi D., Beukovi M.: Monitoring of tick species (Acari: Ixodidae) in
Vojvodina hunting resorts. Proceedings of International symposium on hunting Modern aspects of
sustainable management of game population,June22-24, Zemun-Belgrade, Serbia, 2012, 122-125
Kiffner C., Ldige C., Alings M., Vor T., Rhe F.: Abundance estimation of Ixodes ticks (Acari:
Ixodidae) on roe deer (Capreolus capreolus). Exp. Appl. Acarol, 52, 7384, 2010
Maupin G.O., Fish D., Zoltowsky J., Campos E.G., Piesman J.: Landscape ecology of Lyme disease in a
residential area of Westchestcr County. Am. J. Epiderniol, 133, 1105-1113, 1991
Michalik J., Staczak J., Cieniuch S., Racewicz M., Sikora B., Dabert M. (2009): Surveillance of wild
boar (Sus scrofa) and feeding Ixodes ricinus ticks for Anaplasma phagocytophilum and Borrelia
burgdorferi s.l. using molecular methods. Book of Apstracts, 10th International Jena Symposium on
Tick-borne Diseases (IJSTD),March 19-21, Weimar, Germany, 2009, 178
Mihalca A.D., Gherman C.M., Magda C., Dumitrache M.O., Gyrke A., Sndor A.D., Doma C.,
Oltean M., Mircean V., Mrcuan D.I., D'Amico G., Pduraru A.O., Cozma V.: Ixodes ricinus is the
dominant questing tick in forest habitats in Romania: the results from a countrywide dragging
campaign. Exp Appl Acarol, 58, 175-182, 2012
Nosek J., Sixl W.: Central European Ticks (Ixodoidea) Key for determination. In collaboration with
Kvicala P. & Waltinger H. Mitt. Abt. Zool. Landesmus. Joanneum Jg. 1H2S, Graz, 1972
Pintur K., Beck R., Babi I., Popovi N., Florijani T., Krapinec K., Bokovi I.: Krpeljivost srnee
divljai na podruju Gorskog Kotora. Book of Abstracts, 47th Croatian and 7th International
Symposium on Agriculture, February 13-17, Opatija, Croatia, 2012, 619623
227
228
Abstract
The most important flaviviruses are mosquito-borne viruses responsible for severe encephalitis in
humans: Japan encephalitis virus (JEV), Saint Louis encephalitis virus, West Nile virus (WNV) and
Dengue viruses (DV-1 through 4). The most important mammalian tick-borne flavivirus is tickborne encephalitis virus (TBEV). Nowadays, in early illness phase, diagnosis is based on detection
of viral RNA by PCR/real time PCR. In the late phase of infection serologic diagnosis is a method
of choice to establish the diagnosis of flavivirus infection. Significant problems in serological
diagnosis are cross-reactions between members of Flavivirus genus due to antigenic similarity. The
aim of the study was to demonstrate the extent to which the use of multiple serological testing is
able to contribute solving the cross-reaction issues between some members of genus Flavivirus.
Eighteen ELISA IgG-positive sera on WNV were tested on Dengue virus by ELISA as well as on 8
flaviviruses (TBEV, WNV, JEV, YFV, DV 1-4) by indirect immunofluorescent test (IIFT)
Flavivirus Profile 2 (Euroimmun, Germany).
All of 18 ELISA IgG- positive sera on WNV were simultaneously ELISA IgG- positive on Dengue
virus. Considering the fact that WNV circulates in Serbia among mosquitoes, birds, horses and
humans unlike Denga virus, it was assumed that there were cross-reactions and sera from 18
patients were tested on eight flaviviruses by IIFT. In 12 sera specific IgG antibodies to WNV were
confirmed by determination of antibody titres. Among those 12 sera, 5 sera were only positive to
WNV by IIFT (but not to other flaviviruses), whereas the testing of the other 7 sera showed the
presence of both the antibodies against WNV and antibodies against Dengue viruses 1-4 (although
the latter in lower titers). Six (33.3%) patients need to be additionally tested for setting the final
diagnose. Cross-reaction issues between WNV and Dengue virus can be solved in some cases by
IIFT.
Keywords: flaviviruses, cross-reaction, serological diagnosis
Introduction
Flavivirus genus consists of more than 70 viruses. More than thirty of them are pathogens
significant for human medicine. Flaviviruses are 40 - 60 nm in diameter and have a single-stranded,
positive-sense RNA of 11 kb. There is glycoprotein E inserted in the viral lipid envelope (Jawetz,
Melnick & Adelberg's, 2013). The antigenic determinants of glicoprotein E are responsible for
production of neutralisation antibodies in the host. On the basis of antigenic characteristics
flaviviruses can be divided into eight antigenic groups. The most important antigenic group is the
complex of Japan encephalitis (JE) whose members are mosquito - borne viruses that can cause
229
severe cases of encephalitis in humans: Japan encephalitis virus (JEV), Saint Louis encephalitis
virus (SLEV), West Nile virus (WNV), Murray Valley virus and the complex of Denga viruses
whose members are DV-1 through 4.
Four denga viruses are widely distributed in the tropics (between 35 north and 35 south latitude)
where principal vector Aedes aegypti is present. WNV is the only mosquito borne flavivirus which
activity in humans and animals is detected in Serbia (Petrovi et al., 2014; Petric et al ., 2012). The
vast majority of WNV infections in humans are asymptomatic. Approximately 20% of infected
humans suffer from WNV fever and less than 1% develops neuroinvasive disease resulting in
encephalitis and meningitis. Myocarditis, pancreatitis and fulminant hepatitis have been described
in some symptomatic persons infected with WNV (Petersen and Marfin, 2002). Human clinical
cases associated with WNV infections have been reported from many countries in Africa, southern
Europe, south-western and south-central Asia and Australia (Hublek and Holouzka, 1999). Cases
of yellow fever virus (YFV) infection have been recorded in subtropical areas of Africa and South
America (Jerant Pati, 2007). Since 2000, circulation of YFV has been increased significantly in
Africa. Epidemics of YFW infection occurred in unimmunized population of Africa in 20th century;
morbidity rate was very high, ranging from 51 - 89% (WER, 2005). The most remarkable clinical
feature is haemorrhagic syndrome. Neurological disorders, meningitis, kidney and liver failure may
also occur.
Among mammalian tick-borne flaviviruses, the most important is tick-borne encephalitis virus
(TBEV). TBEV infections are endemic in large parts of Europe (Southern Germany, Austria,
Switzerland, Czech Republic, Slovakia, Hungary, Slovenia, Baltic countries, Poland, parts of
Scandinavia, European Russia (Heinz et al., 2013). Neighbouring countries like Bosnia, Croatia,
Bulgaria, and Romania are at high risk due to high prevalence of the virus in ticks (WHO, 2011.).
Japanese encephalitis is zoonosis widely distributed in Asia caused by Japanese encephalitis virus
(JEV). Most JEV infections are asymptomatic, but in some cases the virus can cause systemic
febrile illness with the central nervous system involvement and possible fatal outcome.
Surprisingly, Ravanini reported detection of JEV RNA in mosquitoes collected in northern Italy.
Further investigations are needed for confirmation of spreading JEV in Europe (Ravanini et al.,
2012).
Nowadays, in early illness phase, diagnosis is based on detection of viral RNA by PCR or real time
PCR or serologic tests. However, serologic tests appear to be the method of choice for establishing
the diagnosis in the late phase of virus infection. Significant problems in serological diagnosis are
cross reactions between members of Flavivirus genus because of antigenic similarity. Viral isolation
from blood or cerebrospinal fluid is usually unsuccessful even in the early stage of infection
because of low viral loud in humans.
The aim of the study was to examine the value of multiple serological testing in solving the crossreaction issues between flaviviruses.
Results were considered as positive if ratio was equal to or greater than 1.1, intermediate if ratio
was between 0.8 and 1.1 and negative if ratio was less than 0.8. All samples were tested in the
Institute of Public Health of Vojvodina and all were positive on WNV IgG antibodies.
Eighteen ELISA WNV IgG-positive sera were tested by commercially available ELISA IgG for
denga (Euroimmun, Germany) and IIFT Flavivirus Mosaic 1 (Euroimmun, Germany) against
TBEV, WNV, JEV, YFV, DV 1-4. For IIFT, serum samples were diluted 1:10 and applied on the
slides coated with TBEV, WNV, JEV, YFV, DV 1-4 antigens. The results were read under a
fluorescent microscope (Olympus BH2), objective 40X.
Results
All of 18 ELISA WNV IgG-positive sera were simultaneously ELISA IgG- positive on Dengue
virus (table 1). Considering the fact that WNV circulates in Serbia among mosquitoes, birds, horses
and humans unlike Dengue virus, it was assumed that there were cross-reactions.
Table 1.Results of ELISA IgG on Denga virus in IgG WNV positive serum samples
Serum
samples
116
159
8
14
91
31
11132
5291
11582
11553
11542
5409
11796
688
626
667
11528
11561
Origin of
samples
ND
ND
MBD
MBD
MBD
MBD
SBD
SBD
SBD
SBD
SBD
SBD
SBD
SBD
SBD
SBD
SBD
SBD
History of
WNV
infection
recent
past
past
past
past
past
past
past
recent
past
past
past
past
past
past
past
recent
recent
ELISA
WNV
IgG
4,46 IgM +
5,56
2,98
5,73
IgG+
1,96
3,25
2,60
5,13 IgM+
5,97
5,04
3,79
4,60
1,28
5,83
5,85
I1,53 IgM+
4,69 IgM+
ELISA
Denga
IgG
1.28
3.28
1,16
3,43
3,17
2,89
0,88
1.70
2,29
4,52
3,23
4,62
3,18
1,94
2,97
2,16
3,15
3,35
Legend: ND - Nisava district, MBD - Middle Banat District, SBD - South Backa District
Between WNV and Denga virus by ELISA IgG test independent whether it is recent or past WNV
infection. Serum sample No 116, 11582, 11528 and 11561 were positive on WNV IgM antibodies
that indicated recent infections. In the other serum samples past WNV infection were detected.
Cross reactivity of the WNV positive sera observed in ELISA against DV was 100%.
All 18 sera positive against WNV were tested on eight flaviviruses by IIFT. In 6 (33.3%) sera
specific WNV IgG antibodies were confirmed and there were no cross-reactivity with other
flaviviruses. In 12 serum samples cross reactivity was observed (table 2). The highest crossreactivity was observed with DV, in 11/18 (61.11%)
231
Cross-reactivity was observed for all denga virus serotypes (table 3). The highest cross-reactivity
(33.33%) was observed with DV4. Among those 12 sera, where cross-reactivity was observed in,
11 sera showed the presence of both the antibodies against WNV and antibodies against Dengue
viruses 1-4 (although the latter in lower titers).
Table 3. Cross-reactivity between denga virus (1-4) by IgG IIFT in serum samples positive on
WNV by ELISA IgG
Flavivirus
DV1
DV2
DV3
DV4
5/18 (27,77)
5/18 (27,77)
3/18 (16,67)
6/18 (33,33)
232
Applying IIFT in our study, WNV, JEV, YFV and TBEV antigens gave lower rate of crossreactions than DV antigens by the same test. DV4 antigen gave the highest rate of cross-reactivity.
Acknowledgments
The presented work is part of the research done in the project TR31084 and TR43007 granted by
the Serbian Ministry of Science and Technological Development and 114-451-2142/2011-01 (20112014) by Provincial Secretariat for Science and Technological Development.
References
1.
Heinz F., Stiasny K., Holzmann H., Grgic-Vitek M., Kriz B., Essl A., and Kundi M.: Vaccination and
tick-borne encephalitis, Central Europe. Emerg Infect Dis,19,1,69-76,2013.
2. Hublek Z., Holouzka J.: West Nile fever a re-emerging mosquito-borne viral disease in Europe.
Emerg Infect Dis , 5, 5, 643-650, 1999
3. Jawetz, Melnick & Adelberg's.: Medical Microbiology.26th Edition. New York, McGraw Hill Lange,
2013
4. Jerant Pati V. Medicinska virusologija..Novi Sad, Ortomedics, 2007.
5. Koraka P., Zeller H., Niedrig M., Osterhaus A., Groen J. Reactivity of serum samples from patients with
a flavivirus infection measured by immunofluorescence assay and ELISA.Microbes and Infection,
4,1209-1215,2002
6. Makino Y., Tadano M., Saito M., Maneekarn N. , Sittisombut N.,Sirisanthana V., et al. Studies on
serological cross-reaction in sequential flavivirus ections, Microbiol. Immunol, 38, 951955, 1994.
7. Petersen LR., Marfin AA. West Nile virus: A primer for clinician. Ann Inter Med, 137, 3, 173 179,
2002
8. Petric D., Hrnjakovic Cvjetkovic I., Radovanov J., Cvjetkovic D., Jerant Patic V., Milosevic V., et
all.West Nile virus surveillance in humans and mosquitoes and detection of cell fusing agent virus in
Vojvodina province (Serbia). HealthMed 6, 2, 462-468, 2012;
9. Petrovi T., Lupulovi D., Petri D., Vasi A., Hrnjakovi Cvjetkovi I., Miloevi V. i ost. Groznica
zapadnog Nila - znaajna vektorska virusna infekcija u Srbiji:aktuelna situacija. Veterinarski glasnik,
69,1-2, 2015 (prihvaeno za tampu)
10. Ravanini P., Huhtamo E., Ilaria V., Crobu MG., Nicosia AM., Servino L., et all. Japanese encephalitis
virus RNA detected in Culex pipiens mosquitoes in Italy. Euro Surveill,17,28,2012,:pii=20221
Available on line: http://www.eurosurveillance.org/ViewArticle.
11. WHO.Vaccines against tick-borne encephalitis:WHO position paper.Wkly WHOEpidemiol Rec, 86, 24,
241-56, 2011.
12. WER...The yellow fever situation in Africa and South America in 2004. Weekly epidemiological
record. 80, 29, 249-256, 2005 Available on line:http://www.who.int/wer
233
Univesity St. Kliment Ohridski - Faculty of Veterinary Medicine, 7000 Bitola, R. Macedonia
2
Pet Land Veterinary Hospital, 7500 Prilep, R. Macedonia
*Corresponding author/ e-mail: zlatko_raja@yahoo.com
Abstract
Vector borne infection with Ehrlichia canis is a systemic disorder that manifests with fever,
bleeding tendencies, with thrombocytopenia and platelet dysfunction and non-regenerative anaemia.
The disease is transmitted through the saliva of brown tick, Rhipicephalus sanguineus, which is
widespread in the world. The etiologic agent of canine monocytic ehrlichiosis (CME) is rickettsia
Ehrlichia canis (E. canis). It is a small gram negative coccoide bacteria that parasitizes in
circulating monocytes as a group of organisms called morulae. The clinical manifestation of the
disease is known as ehrlichiosis in dogs (CME). This disease is known in the world, also under the
following names dogs rickettsioses, canine hemorrhagic fever, canine typhoid, tropical
pancytopenia.
Diagnostic and treatment of canine ehrlichiosis is described in a male dog, of Labrador breed, about
2.5 years old. Clinical symptoms in this dog were depression, reduced limb function after long
inactivity, disbalance in the movement of the rear limbs, nervous symptoms, loss of weight.
After performing the complete blood count, blood examination showed reduced number of
granulocytes (41.7 - %), increased number of lymphocytes (49.6 + %) and monocytosis (8.7 + %).
Diagnosis was not based on blood tests, rapid tests were also done for diagnostics of giardiasis,
distemper, parvovirosis, leishmaniasis and ehrlichiosis, after which it was concluded that the dog
had a positive finding only for ehrlichiosis.
Keywords: Ehrlichia canis, Labrador, Vector borne infection, Ehrlichiosis
Introduction
In our case, it is the treatment of Ehrlichiosis, male breed dog Labrador, about 2.5 years old, with
signs of depression, reduced limb function in long inactivity, imbalance in the movement of the rear
limbs, nervous signs, reduced body weight.
Ehrlichiosis in dogs is usually caused by Ehrlichia canis, E. chaffeensis, E. ewingii, and possibly E.
ruminantium. There are several types of Ehrlichia, which affect various species of animals. Some
affect humans. Some organisms that were formerly classified as Ehrlichia now reclassified as
Anaplasma. Ehrlichia organisms are called rickettsia that the evolutionary scale between bacteria
and viruses (Tuna and Ulutas, 2009). Canine ehrlichiosis is a disease of dogs and wild canids (e.g.,
wolves) and located around the world. Canine ehrlichiosis is also known by other names such as
"tracker dog disease", "tropical canine pancytopenia, ''canine hemorrhagic fever, 'and' dog typhoid."
Ehrlichia are transmitted by ticks including Brown dog tick, Rhipicephalus sanguineus. When the
mature form of a tick feeds on another animal, Ehrlichia are transmitted to the animal.
Ehrlichiosis can have three stages. Signs of the acute phase of the disease usually develop 1-3
weeks after being bitten by triggers. The acute phase of the illness usually lasts 2-4 weeks. Platelets
small cell fragments that help blood clotting, often destroyed. As a result of infection, lymph nodes,
liver and spleen are often enlarged. Anemia, fever, depression, lethargy, loss of appetite, shortness
234
of breath, joint pain and stiffness and bruising are common symptoms. Many dogs will be able to
fight off the infection. If not, enter the subclinical stage.
In subclinical stage of the animal may appear normal or mild anemia. At this stage of Ehrlichia is
inside the spleen. This stage can last for months or years. The dog will either eliminate Ehrlichia
body or infection can progress to chronic phase.
Chronic phase may have moderate or severe symptoms. Weight loss, anemia, neurological signs,
hemorrhage, eye inflammation, edema (fluid accumulation) of the hind limbs, and cant be seen,
and fever. Blood tests show that one or all types of blood cells are reduced. One type cells,
lymphocytes can be increased and abnormal. This can sometimes interfere with some types of
leukemia. If the dog became chronically infected, the disease can be restored, especially during
periods of stress. In some cases, arthritis or kidney disease called "glomerluonephritis" which can
develop (Yci et al., 2010).
Reducing the number of platelets (platelets that assist in blood clotting) is the most common
laboratory finding in all stages of disease. Changes in the level of proteins in blood are different.
The most common protein albumin is reduced, and globulin increased (Bulla et al., 2004).
Since one tick can infect more than one disease (e.g., haemobartonellosis or babesiosis), dogs
infected with more than one of these diseases at a time, which generally causes serious symptoms
(Mylonakis et al., 2010).
Result
9
11.3x10 /L
5.30x109/L
11.9
36.7
69.2
22.5
32.4
220
235
Reference
4-9x10^9/L
4.2-5.5x10^12/L
14-18g/dl
37.0-54.0%
76.0-96.0um^3
27.0-32.0pg
30.0-35.0x10^6/L
140-340x10^6/L
Blood results were small increase in leucocytes, while the remaining parameters were within the
normal reference values.
Conclusion
Ehrlichia canis is the cause of classical Ehrlichiosis in dogs. This Ehrlichia targets moncytes and is
transmitted by Rhipicephalus sanguineus, the "brown dog tick." The therapy that was given to the
dog, his general condition improved, neurological symptoms and also improved weight gain.
Diagnosis is usually made on the basis of a combination of clinical signs, hematologic
abnormalities and serologic findings.
References
1. Tuna E. G. and Ulutas B. (2009). Prevalence of Ehrlichia canis infection in trombocytopenic dogs.
Lucrri Stinifice Medicin Veterinar Vol. XLII, 2009, Timisoara.
2. Yci B. Ba. et al. (2010) The spread of canine monocytic ehrlichiosis in Turkey to Central Anadolia.
Israel Journal of Veterinary Medicine Volume 65 (1).
3. Bulla C. et al. (2004). The relationship between the degree of thrombocytopenia and infection with
Ehrlichia canis in an endemic area. Vet. Res. 35 (2004).
4. Mylonakis M., Siarkou V. and Koutinas A. (2010) Myelosupressive caninemonogytic ehrlichiosis
(Ehrlichia canis): An update on the pathogenesis, diagnosis and management. Israel Journal of the
veterinary medicine; Volume 65 (4) 2010.
236
Univesity St. Kliment Ohridski - Faculty of Veterinary Medicine, 7000 Bitola, R. Macedonia
2
Pet Land Veterinary Hospital, 7500 Prilep, R. Macedonia
* Corresponding author: zlatko_raja@yahoo.com
Abstract
Leishmaniasis is a protozoan disease transmitted among domestic and wild animals, as well as
humans. It is widespread in tropical, subtropical regions, but is prevalent in temperate regions.
Leishmaniasis is a transmissible disease caused by protozoa of Leishmania genus, and it is primarly
spread with a bite of female sand fly - Phlebotomine (Phlebotomus). The disease occurs in many
forms of which the most common are two following forms: visceral (caused with Leishmania
donovani) and cutaneus form (caused by Leischmania tropica).
In this report we will present the diagnosis of leishmaniosis and treatment in a dog of Pekingese
breed, male, about twelve years old. The only distinctive symptom in the dog, observed by the
owners and according to the anamnesis - was sharply aging, during a week and was mostly visible
on the head of the dog. There were no characteristic signs as alopecia or skin changes, lethargy and
hyperthermia. Due to the wide spreading of leishmaniasis in our region, a rapid immunological test
for leishmaniosis was conducted and the result was positive finding. Also, laboratory tests were
made such as haematological analysis (WBC 31.27x109/L, Lymph 21.04x109/L, Gran.8.60x109/L,
Lymph 67.3% Mon 5,5%, Gran. 74,9%, RBC 5,04x1012/L, HGB 100g/L, HCT 30,04%, MCV
65,5fL, MCHC 333 g/L, RDW 15,7%, PLT 154x109/L, MPV 8,9 fL, PDW 39,6, PCT 0.079%) and
blood biochemistry test (creatinine 168,6 mol/L, urea 10.8 mmol/L, S 124 U/L, ALT 62 U/L,
ALP 23,55 U/L) in the blood. Despite these trials a fast test for leishmaniasis was further made.
According to the test, the dog was positive to leishmaniasis. We chose therapy with allopurinol
(20mg/kg, P/O in period of 9-12 months), Rubenal 300, Ipaktin phosphate reducer and Milteforan
(2mg/kg body weight, for 28 days).
Keywords: Leishmaniasis, Pekingese dog, haematological and biochemical profile, fast
immunological test, Allopurinol, Milteforan
Introduction
Canine leishmaniasis (CanL), cause Leishmania infantum is the largest global zoonosis potentially
fatal for humans and dogs, which is the main reservoir of infection in humans. CanL is endemic in
more than 70 countries worldwide (Shaw et al., 2009). CanL manifest a wide range of clinical signs
and degrees of severity, and although there is an insufficient number of research contracts for the
management of this disease. CanL is systemic disease that may potentially relate to any organ or
tissue, presents with nonspecific clinical signs.
Some dogs show clinical signs, while others remain asymptomatic carriers and are infectious for
sand fly. Infected animals are usually affected with lymphadenopathy, anemia, desquamated and
ulcerative lesions of the skin and glomerulonephritis with proteinuria (Zatelli et al., 2003). Ocular
lesions as blepharitis, uveitis, corneal edema or chorioretinitis, can also be present. Unspecific
symptoms may occur frequently, making it difficult to diagnose the disease. Renal lesions are most
commonly affected organs present in dogs with leishmaniasis (Baneth et al., 2008). Proliferation of
glomeruli appears, because circulating immune complexes deposited, which leads to proteinuria.
237
These lesions may progress to chronic renal failure or nephritic syndrome. Renal failure is one of
the classic general symptoms that appear in leishmaniasis, but rarely only manifestation of the
disease.
The dog was treated with Milteforan analkylphosphochorine, it is currently the standard treatment
of leishmaniasis Dog. The drug was administered orally for 28 days. The drug is in the form of
liquid, administered orally. The most common contraindication is vomiting, which is transient.
238
Also, the drug showed no adverse effects on the liver and kidneys, and it can be attributed to dogs
with renal failure and avoiding danger, if the dogs do not have renal insufficiency treatment. This
drug is an orally bio-available chemical that was originally studied as an antitumor agent.
Subsequent to the serendipitous laboratory finding that Milteforan was active against Leishmania, it
was tested in dogs in vivo and found to be an effective agent at eliminating parasitemia. The
advantage of this drug is that its direct anti-parasitic activity is not dependent on a functional
immune system.
Result
9
Ref.values
4.1 x10 /L
0.7 x109/L
0.2 x109/L
3.2 x109/L
16.40%
3.80%
69.90%
3.08x109/L
4.1 x109/L
71g/l
15.7%
89.5fL
29.3
358g/L
103x109/L
8.3 fL
0.079%
6.0-17.0
0.8-5.1
0.0-1.8
4.0-12.6
12.0-30.0
2.0-9.0
60.0-93.0
5.50-8.50
6.0-17.0
110-190
39.0-56.0
62.0-72.0
20.0-25.0
300-380
117-460
7.0-12.0
Parameter
Result
Ref.values
Creatinin
ALP
Urea
AST
ALT
315.9mol/L
72.64 U/L
45.0mmol/L
54.1 U/L
35.7 U/L
44-138
<136
3.1-9.2
9-49
8-57
From the tables we conclude that the dog was severally affected. The dog had overall leukopenia
with low number of leucocytes, and also got severally anaemia because of eritropenia and
hypohaemoglobulinemia, wich probably results from reduced synthesis of erythropoietin in
damaged kidneys and reduced intake of food. The kidneys are severally affected and they cant
normally clear the creatinine and urea from the body. AST (asparat aminotransferase) showed
increased acctivity, probably because of kidney tissue inflammation. In the specific treatment, we
have included also some maintenance therapy for kidneys (Rubenal 300 and Epakitin).
239
After 28 days of therapy has been shown to improve the general condition of the dog and improved
renal function and liver function. The leukocytes count has normalized, the finding of anemia has
also improved, with normal number of erythrocytes, hemoglobin concentration and hematocrit
value. Platelet count is also near normal value. AST level is normal. Creatinine is in normal values,
wich means that kidneys are working well in respect of clearence. Urea in the serum show normal
levels.
Table 4: Blood results 28 days of therapy with Milteforan and other supportive therapy results
after blood analysis and biochemistry
Parameter
WBC
Lymph.
MCH
Gran.
Lymph.%
Mon. %
Gran. %
RBC
HGB
HCT
MCV
MCH
MCH
PLT
MPV
PCT
Result
9
Reference
8.5 x10 /L
1.1 x109/L
0.9 x109/L
6.3 x109/L
21.10%
4.30%
77.40%
6.06x1012/L
137g/L
41.6%
68.3fL
27.3
315g/L
239x109/L
8.9fL
0.071%
6.0-17.0
0.8-5.1
0.0-1.8
4.0-12.6
12.0-30.0
2.0-9.0
60.0-93.0
5.50-8.50
110-190
39.0-56.0
62.0-72.0
20.0-25.0
117-460
117-460
7.0-12.0
Result
57mol/L
64.52 U/L
8.2mmol/L
30.1 U/L
32.4 U/L
Ref.values
44-138
<136
3.1-9.2
9-49
8-57
Parameter
Creatinin
ALP
Urea
AST
ALT
Conclusion
In this case report, we have concluded that: Allopurinol together with Milteforan is acceptable
specific therapy for canine Leishmaniasis. Supportive therapy for kidney is also important,
especially in cases in wich there is kidney damage. Maybe we should also include some other
reasonable drugs (namely to support kidney function) like diuretics (furosemide and
spironolactone), but also synthetic erythropoietin and antimonials.
References
1. Shaw SE, Langton DA, Hillman TJ (2009) Canine leishmaniosis in the United Kingdom: a zoonotic
disease waiting for a vector? Vet Parasitol 2009.
2. Zatelli A, Borgarelli M, Santilli R, Bonfanti U, Nigrisoli E, Zanatta R, Tarducci A, Guarraci A (2003)
Glomerular lesions in dogs infected with Leishmania organisms. Am J Vet Res 2003.
240
241
________________________________________________________________________
Session 4
242
Plenary lecture:
INFLUENZA IN BIRDS AND OTHER ANIMALS
Vladimir Savi
Croatian Veterinary Institute, Poultry Centre, Zagreb, Croatia
* Corresponding author: v_savic@veinst.hr
Abstract
There are three types of influenza viruses: A, B, and C; and the latter two are primarily of a human
health importance. In contrast, influenza A viruses have been isolated from a variety of birds and
mammals, nevertheless the natural hosts of the virus are wild waterfowls, gulls and related birds.
Other species that are infected with influenza A viruses, particularly chickens, turkeys, swine,
horses, and humans, are considered aberrant hosts. Majority of influenza A viruses are fully adapted
to the natural hosts in which they multiply mainly in intestines and the infection causes no
symptoms. Influenza A viruses in their natural hosts are in evolutionary stasis. On the other hand,
the infection in aberrant hosts usually results in rapid evolution due to selection pressure driven by
the virus adaptation to a new host. Such rapid evolution can result in high virulence for the new
host, and sometimes even for other species. Emergence of highly virulent influenza A viruses is of a
particular concern for the poultry industry because such viruses cause up to 100% mortality in
chickens and turkeys. Few influenza viruses are well adapted and established in mammalian hosts,
causing primarily respiratory disease like swine influenza, equine influenza and human influenza.
Swine, as an aberrant host, plays an important role in ecology and epidemiology of influenza A
viruses because this species is prone to infection with viruses originating from wild birds, domestic
poultry and mammalian hosts. Such a universal host can serve as a vessel for mixing of the genetic
material of different viruses which can result in new influenza A viruses with unpredictable
features.
Keywords: Influenza A, virus, birds, mammals
Introduction
Influenza viruses are classified into types A, B and C, according to the antigenic properties of
matrix proteins or nucleoproteins. The majority of human influenza virus epidemics, including all
pandemics, are caused by influenza virus type A, which is also the type associated with influenza of
avian, equine and swine species (Webster et al. 1978.). Influenza B and C viruses are isolated
mainly from humans and are less pathogenic than influenza A viruses (McCauley and Mahy, 1983).
Influenza A viruses can be further divided into sub-types on the basis of the antigenic reactivity of
the surface glycoproteins, the haemagglutinin and neuraminidase molecules. So far there are 16
haemagglutinin (H) and nine neuraminidase (N) subtypes (Fouchier et al., 2005) and each virus
possesses one H and one N subtype, apparently in any of 144 possible combinations from H1N1 to
H16N9. Recently, two influenza-like virus genomes designated H17N10 and H18N11 were
identified in South American bats, but attempts to propagate this virus in cell cultures and chicken
embryos were unsuccessful (Wu et al. 2014).
According to numerous authors, influenza A virus was first isolated from chickens at the beginning
of the 20th century (A/Brescia/1902 [H7N7]). Although there is some dispute on a later year of the
isolation of the virus, another isolate of the same subtype (A/FPV/Dutch/27 [H7N7]) dates back in
1920s (Alexander, 2009). This was followed by isolation of influenza virus from pigs (Shope, 1931)
and humans (Smith et al., 1933) in 1930s and two decades later from horses (Sovinova et al., 1958).
243
Influenza virus isolates from chicken were initially called fowl plague virus because until 1955 it
was not known that they were actually influenza viruses (Schfer, 1955). Subsequent extensive
research revealed more or less barriers to frequent interspecies transmissions of influenza A viruses.
They are influenced by the virus composition and the host specific receptors (Ito eta al., 2000;
Suarez, 2000; Matrosovich et al., 2009). Despite these barriers, influenza A viruses occasionally
transmit from its natural host to other species in which usually cause short-term spread and soon
vanish. In extremely rare cases these viruses adapt to the new host, and such adaptation usually has
far-reaching consequences.
Figure 1. The most important hosts and transmission of influenza A viruses. Solid line shows usual
transmission. Dotted line shows transmission which occurs rarely or only presumed transmission.
244
domestic poultry into the ecosystem which resulted in migratory waterfowl infection. Seasonal
migration during 2005 and 2006 resulted in spread of the virus from China to the rest of Asia,
Europe and Africa (Salzberg et al., 2007). This virus still circulates among migrating wild birds in
Asia, Europe and Africa. Similar scenario happened with a HPAI virus of H5N8 subtype, which is a
reassortant of H5N1 and therefore also poultry origin influenza virus. The novel reassortant virus
occurred in 2014 among poultry and wild birds in South Korea (Lee et al., 2014) and afterwards in
Japan and China. This H5N8 virus probably spread by wild birds further into Europe and North
America and consequently infected the local poultry. So far there is no evidence of infection of
mammals including humans with this virus.
Figure 2. Phylogenetic tree from the NS gene of different subtypes of influenza A viruses. Thirty-three
isolates from the most important host of influenza A virus with different geographic origin in the period from
1956 to 2011 were compared. Groups of viruses with respect to the host, geographical origin and
evolutionary features are marked on the right side of the image. Viruses from different host within the
respective groups are underlined. The tree was made using Maximum Composite Likelihood and Neighbour
Joining algorithm with 1000 repetitions, and the tree is midpoint rooted.
Swine influenza
Commonly circulating subtypes in pigs are H1N1, H1N2, and H3N2 influenza A viruses which are
adapted to this species. Nevertheless, pigs have receptors for avian and human influenza viruses.
Therefore, if the waterfowl is considered a natural host of influenza A viruses, the pig can be
246
considered as a universal host of this virus (Figure 1). Hence the same subtype of swine influenza
virus can be of a different origin, genetic makeup and antigenic reactivity. Swine influenza virus of
H1N1 subtype which is swine entity and evolutionarily has a common origin with the Spanish flu
virus prevails in the North American pig population. In contrast, avian origin swine adapted H1N1
virus prevails in the pig populations in Europe and Asia which is also referred as avian-like H1N1
(Figure 2). The North American and Eurasian swine H1N1 viruses, although of the same subtype,
can be easily distinguished by serology. Beside these two H1N1 viruses, human H1N1 viruses (both
seasonal and pandemic) can be found in pigs which is usually result of a direct transmission from
humans. Similarly to H1N1 subtype, viruses of H3N2 subtype create a very complex
epizootiological situation in pigs (Figure 2) including human-like and avian-like H3N2
variants. Swine H1N2 viruses are various reassortants from mentioned H1N1 and H3N2 viruses.
Occasionally, true avian and even equine influenza viruses could be found in pigs, but they usually
did not establish in this species and soon disappear from the swine populations (Brown et al., 2000).
Other subtypes, like H2N1, H2N3 and H3N1 were also found in pigs.
Swine influenza is generally mild and short-lasting illness manifested similarly to a mild clinical
picture of human influenza. More important is the role of pig as an intermediate host for avian and
human influenza viruses (Figure 1). Simultaneous infection of pigs with two or more different
influenza viruses may result in reassortment of the gene segments between viruses of different
origin. This can result in a new progeny virus with genetic makeup of both (or all) parental viruses.
The new progeny virus may have possibility to cross host species barrier and even to cause
pandemic (Ito et al., 2000; Matrosovich et al., 2009).
References
1.
Alexander D.J., Brown I.H.: History of highly pathogenic avian influenza. Revue scientifique et
technique, 28, 1, 19-38, 2009
2. Alexander D.J., Capua I.: Avian influenza in poultry. World's Poultry Science Journal, 64, 4, 513-532,
2008
3. Berendt R.F.: Simian model for the evaluation of immunity to influenza. Infection and Immunity, 9, 1,
101-105, 1974
4. Brown I.H.: The epidemiology and evolution of influenza viruses in pigs. Veterinary Microbiology, 74,
1/2, 29-46, 2000
5. Brown I.H., Banks J., Manvell R.J., Essen S.C., Shell W., Slomka M., Londt B., Alexander D.J.: Recent
epidemiology and ecology of influenza A viruses in avian species in Europe and the Middle East.
Developments in biological, 124, 4550, 2006
6. Capua I., Alexander D.J.: Avian influenza infections in birds a moving target. Influenza and Other
Respiratory Viruses, 2007; 1, 1. 11-18, 2007
7. Crawford, P.C., Dubovi, E.J., Castleman, W.L., Stephenson, I., Gibbs, E.P., Chen, L., Smith, C., Hill,
R.C., Ferro, P., Pompey, J., Bright, R.A., Medina, M.J., Johnson, C.M., Olsen, C.W., Cox, N.J., Klimov,
A.I., Katz, J.M., Donis, R.O.: Transmission of equine influenza virus to dogs. Science, 310, 5747, 482485, 2005
8. Daly J.M., MacRae S., Newton J.R., Wattrang E., Elton D.M.: Equine influenza: a review of an
unpredictable virus. Veterinary Journal, 189, 1, 7-14, 2011
9. Daly J.M., Whitwell K.E., Miller J., Dowd G., Cardwell J.M., Smith K.C.: Investigation of equine
influenza cases exhibiting neurological disease: co-incidence or association? Journal of Comparative
Pathology, 134, 2/3, 231235, 2006
10. Fouchier R.A., Munster V., Wallensten A., Bestebroer T.M., Herfst S., Smith D., Rimmelzwaan G.F.,
Olsen B., Osterhaus A.D.: Characterization of a novel influenza A virus hemagglutinin subtype (H16)
obtained from black-headed gulls. Journal of Virology, 79, 5, 2814-2822, 2005
248
249
250
Invited lecture
VIRUS INFECTIONS OF THE HONEYBEE (APIS MELLIFERA L.) IN CENTRAL
EUROPE
Tams Bakonyi1,2*, Petra Forgch1, Ale Gregorc3, Ivana Tlak Gajger4, Lszl Bksi5, Mikls
Rusvai1, Norbert Nowotny2,6
1
Abstract
Viral infections of the honeybee (Apis mellifera L.) became into the scope of the veterinary interest
in the last two decades due to their pathogenic role and the increasing importance of the host
species. Since 2004 extensive losses of honeybee colonies have been observed in North America
and Europe, but its aetiology remained unclear. The phenomenon was named to Colony Collapse
Disorder, and viruses were also considered as causative agents. Moreover, winter losses of
honeybees seemed to be increasing everywhere, and resulted in decline of managed honeybee
population. The presence of bee viruses has been reported from several countries worldwide. Many
of them can be detected in apparently health colonies. Subclinical infection, however, might be
activated by predisposing- and weakening factors, which lead to depopulation or sudden collapse of
the colonies. The most important predisposing factor is the parasitic mite Varroa destructor, which
is a vector of several honeybee viruses, and also weakens the pupae and adult bees by its feeding.
The presence of other pathogens, parasites (i.e. Nosema apis), intoxications and environmental
pollution may also act as an activator of viral infections. The conventional diagnostic methods have
limited value in the case of bee virus infections and diseases; therefore, molecular methods,
predominantly reverse-transcription polymerase chain reaction (RT-PCR) assays are used to detect
viral RNA in honeybee samples.
Our research groups are investigating honeybee virus infections in central-European countries since
1997. We have been detecting the presence of Acute bee paralysis virus, Black queen cell virus,
Chronic bee paralysis virus, Deformed wing virus, and Sacbrood virus in Hungary, Austria,
Slovenia and Croatia. The frequencies of the viruses in different countries varied significantly.
Phylogenetic comparisons revealed closer genetic relationships between bee viruses collected in the
Carpathian basin. Although the prevalence of bee viruses in central-European countries was lower
than those reported in Western Europe, a steady increase has been observed in Hungary between
2004 and 2007. Besides increasing bee colony density and problems with varroa-control, the
domestic and international trade of bees and bee products may also contribute to the aggravation of
virus-associated problems in beekeeping in the region.
Key words: honeybee, virus infections, Varroa destructor, RT-PCR
Introduction
Approximately 25,000 species of bees have been identified worldwide. Nevertheless, only ten
species can be regarded as honeybees. Since bees are highly adaptable insects, they are able to
251
adjust to a wide variety of climates and geographic regions. The habitat of the western honeybee or
European honeybee (Apis mellifera L.) ranges from the tip of southern Africa to southern
Scandinavia, and from Americas, through Europe to western Asia (Whitfield et al., 2009).
Beekeeping is deeply rooted in human society. The apiculture provides full or additional family
income with a considerable market for bee products used as food, pharmaceutics and medical
products. Bee products (i.e. honey, wax, propolis, royal jelly and bee venom) have been used since
the prehistoric times for consumption and for therapeutic purposes. In 2012 the total world honey
production exceeded 1,500,000 tonnes (FAO, 2013). The two leading producers of honey are China
and the European Union (Word Trade Daily, 2012). The direct value of the produced honey is about
140 million EUR, but the total added crops due to pollination services has estimated 14,2 billion
EUR in 2005 in the EU (Gallai et al., 2008).
Honeybees are key pollinators native to Europe and have great impact for many agricultural crops
and conservation of natural plant diversity. In light of the decline of wild insect pollinators the
importance of managed beekeeping is greater today than ever. In the last decade extensive losses of
honeybee colonies have been observed in North America and Europe (Communication from the
Commission on honeybee health, 2010), but the aetiology of the losses remain unclear (Le Conte et
al., 2010; Neumann and Carreck, 2010; Moritz et al., 2010). The phenomenon was named to
Colony Collapse Disorder (CCD) with defined signs and was characterized by disappeared
colonies, which were not typically found later in many parts of the world. However, winter losses of
honeybees seemed to be increasing everywhere, and resulted in decline of managed honeybee
population. Honeybee experts in the USA and Europe formed networks to collect more exact data to
identify factors that seem to be not only multifactorial, but interact with individual situations by
countries. The European concerted action was designed in 2008 as a COST action FAO803 by the
name of Prevention of honeybee COlony LOSses (COLOSS).
The Working Group 1 (WG1) of the COLOSS epidemiological unit developed a detailed selfadministrated questionnaire to collect exact data on losses. The first results were published recently
(van der Zee et al., 2012) with the analysed information from 12 countries in 2009 and 24 countries
in 2010. According to the survey the mean losses varied between 7-22 % in 2009 and 7-30 % in
2010 winter. An important finding was that for all countries which participated in 2009, winter
losses were found to be substantially higher in 2010. Beekeepers in the majority of the countries
who reported disappeared colonies experienced higher winter losses compared with beekeepers that
experienced winter losses but not reported disappeared colonies. The same was noticed in the USA
where survey responders had lost an average 38.4 % of their colonies in 2011 (van Engelsdorp et
al., 2012). Studies focusing on infectious agents in the background of CDD identified viruses,
microsporidia and parasites as most important factors.
Although more than 20 different viruses were detected from bees, only a few of them are
considered to be able to cause severe diseases in honeybees, and hence are relevant in beekeeping.
The most important beeviruses in Europe are Acute bee paralysis virus (ABPV), Black queen cell
virus (BQCV), Chronic bee paralysis virus (CBPV), Deformed wing virus (DWV), Israeli acute
paralysis virus (IAPV), Kashmir bee virus (KBV), and Sacbrood virus (SBV).
ABPV is commonly present in apparently healthy bees; however, this virus may play a role in cases
of sudden collapse of honeybee colonies infested with the parasitic mite Varroa destructor. Due to
the world-wide spread of the varroa mite in the last decades, also ABPV gained more and more
importance (Ball, 1997). On one hand, the mite is a possible vector for the virus; on the other hand
it weakens the bees and activates viral infections (Nordstom et al., 1999).
BQCV causes frequent subclinical infections in adult bees; however it affects clinically prepupae or
pupae of the queen especially in spring and early summer (Laidlaw, 1979). Infected queen pupae
252
die and darken, and the cell walls get black. Nosema apis infestation is a suspected predisposing
factor for disease manifestation (Allen and Ball, 1996).
Two manifestations of CBPV infection have been noted: I. the bees are unable to fly, they are
trembling and crawling and the wings are asymmetric outspread. They often suffer from dysentery
and die within a few days; II. the bees look black because of hair loss. The guard bees do not
recognize them and dismiss them because of their altered look. Although in some cases up to 30%
of worker bees are affected, CBPV infection remains sometimes undetected, and the colonies
usually recover spontaneously from the disease (Bailey, 1967).
DWV is mostly detected in varroa-infected bees (Bowen-Walker et al., 1999). The virus propagates
slowly, and pupae infected at the white-eyed stage of development may have malformed wings and
shortened life span. Adult bees carry the virus without apparent signs.
IAPV was discovered in Israel, but its presence was also demonstrated in other countries. Because
IAPV infections were diagnosed more frequently in CCD-affected honeybee colonies, compared to
healthy colonies in the USA, the role of this virus was hypothesized in the background of CCD
(Cox-Foster et al., 2007; Chen et al., 2014). IAPV is genetically closely related to ABPV and KBV.
KBV is closely related to ABPV and IAPV, however it has been rarely reported in Europe so far
(Allen and Ball, 1996; Siede and Buchler, 2004.). It affects brood and adult bees. Adult bees usually
die within a few days after infection, but larvae may survive following ingestion of the virus, and
some of them become inapparently infected adults.
SBV affects primarily the brood of the honeybee and results in larval death (Ritter, 1996). Infected
larvae fail to pupate and the ecdysial fluid aggregates around the integument, forming the "sac" for
which the disease is named. Larvae change in colour from pearly white to pale yellow and after
death they dry out and change to a dark brown ship-shaped scab. Infection of adult bees is possible,
the viruses are able to propagate in them, but the bees remain apparently healthy. Sacbrood appears
mainly in spring, when the brood-season begins and large numbers of infected young adults are
present (Ritter, 1996).
The virological diagnostic methods have limited value in the case of bee viruses. Because bees are
colonial animals, investigations of individuals are usually less informative. Possibilities for
observation of clinical signs are often complicated, and signs of different virus infections may be
similar. Due to the size of bees, gross pathology is rarely informative. Histopathology is
complicated by the presence of chitin, causing poor penetration of tissue fixation substances, and
causing problems with sectioning of embedded tissues. Identification of beeviruses on
morphological basis, using electron microscopy is on one hand expensive and time-consuming, on
the other hand poorly selective, because of similarities in size and virion morphology. Virus
isolation based on serial passages of viruses in cell cultures is not applicable due to the lack of beespecific and beevirus-susceptible cell cultures. The only possibility for beevirus isolation is
experimental infection of larvae, pupae or newly emerged bees. This technique is, however,
laborious and time consuming. Additionally, the availability of brood is seasonal, and because
viruses frequently cause inapparent infections in honeybee colonies, finding virus-free brood for
experimental virus isolation is rarely possible. Serological methods using virus-specific antibodies,
raised in experimental mammals have been developed in specific laboratories. Viral antigens were
detected and characterized with these methods using agar-gel immunodiffusion (AGID) or enzymelinked immunosorbent assay (ELISA) platforms (Bailey, 1967; Bksi et al., 1999). However, the
availability of such sera is limited, and their specificity due to virus mixtures used for
immunization might be impaired. Because the immune system of invertebrates is mainly based on
non-specific, innate immunity; classical serological methods are not applicable for indirect virusdiagnostic approaches, due to the lack of adaptive immunity, specific anti-viral antibodies and
immune memory in bees (Azzami et al., 2012). The advances of developments of molecular
diagnostic techniques had a revolutionary effect on honeybee virology diagnostics. As more and
253
more beeviruses were genetically characterized, specific, sensitive and rapid diagnostic assays were
developed on the basis of the polymerase chain reaction (PCR) technology. These techniques are
widely used in the last decade for the diagnosis, surveillance and molecular epizootiology of virus
infections in honeybees. In this paper, our studies on certain honeybee viruses in Europe are
summarized.
254
Primer position
on the genome
GTGCTATCTTGGAATACTAC
AAGGYTTAGGTTCTACTACT
AGTAGTTGCGATGTACTTCC
CTTAGTCTTACTCGCCACTT
TGTCGAACTGAGGATCTTAC
GACCTGATTAACGACGTTAG
ATTGTGCCAGATTGGACTAC
AGATGCAATGGAGGATACAG
ATTGAGAGTTGCCAAGGAGT
GTCTGTGCTTCGATCACAAT
GATGAACGTCGACCTATTGA
TGTGGGTTGGCTATGAGTCA
ACCAACCGATTCCTCAGTAG
CCTTGGAACTCTGCTGTGTA
7928-7947
8527-8546
252-277
710-729
111-130
407-426
2345-2364
2760-2997
3042-3061
3780-3799
5406-5425
5781-5800
221-240
689-708
Length of the
amplified
product (bp)
618
472
315
434
758
395
487
Nucleotide positions refer to the published sequences of aABPV (GenBank accession number AF150629), bBQCV
(accession number AF125252), cCBPV (accession number AF375659), dDWV (accession number AJ489744), eIAPV
(accession number EF219380), fKBV (accession number AY275710) and gSBV (accession number AF092924). f:
forward primer; r: reverse primer
Results
Occurrence of honeybee viruses in Central European countries
Between 1999 and 2010 we have been investigating the occurrence of the most important honeybee
viruses in four central European countries: Austria, Hungary, Slovenia and Croatia (Bernyi et al.,
2006, Forgch et al., 2008, Gregorc and Bakonyi, 2012, Tlak Gajer et al, 2014). Four honeybee
viruses, ABPV, BQCV, DWV and SBV were detected in all four countries. The occurrence of
CBPV was tested and detected in Austria, Hungary and Croatia. The presence of KBV and IAPV
were tested in Austria, Hungary and Croatia, but were not found in any of the investigated samples.
The detection frequencies are summarised in Table 2.
Table 2: Occurrence of honeybee viruses in four central European countries
Country
n*
year
ABPV
2003Austria
131
68%
2004
199952
37%
Hungary
2004
72
2007
71%
81
2006
12%
Slovenia**
72
2008
10%
Croatia
82
2010
11%
*n= number of samples; NT= not tested
**Newly mated queens were investigated
BQCV
CBPV
DWV
IAPV
KBV
SBV
30%
9%
91%
0%
0%
49%
54%
0%
72%
NT
0%
2%
40%
0%
24%
29%
6%
NT
NT
10%
49%
7%
58%
95%
0%
NT
NT
0%
0%
NT
NT
0%
61%
1%
11%
40%
255
Discussion
Our studies described the presence of five different honeybee viruses (Acute bee paralysis virus
ABPV, Black queen cell virus BQCV, Chronic bee paralysis virus CBPV, Deformed wing virus
DWV, and Sacbrood virus SBV) in four central European countries (Bernyi et al., 2006,
Forgch et al., 2008, Gregorc and Bakonyi, 2012, Tlak Gajer et al, 2014). Simultaneous infections
with different virus species in colony level have been frequently diagnosed. The investigations
revealed that the infection rate of the Hungarian honeybee colonies have been increasing within the
last years (Tapaszti et al., 2010). Usually, honeybee virus infections are not apparent as they remain
in a latent state within individuals and spread among bee populations at a low level. This means that
clinical signs appear only when virus replication is initiated and infection becomes systemic. When
cells of honeybees are infected with virus particles, they cannot work efficiently; this inevitably
causes vital organs to dysfunction (Bksi et al., 1999). This can lead to outbreaks of disease and
induce significant losses. Infestation with the parasitic mite Varroa destructor is a major
predisposing factor which has a weakening effect on the honeybee (Yang and Cox Foster, 2005)
and viruses may directly spread through the lesions induced by the mite (Ball, 1989). Also, it has
been experimentally proven that these mites carry ABPV (Bksi et al., 1999), DWV (Tentcheva et
al., 2004) as well as KBV (Chen et al., 2004). Other predisposing factors include, for example
nosema infestation, intoxications, environmental pollution, cold weather, dysentery, overcrowding
and further infectious agents such as bacteria, fungi, and parasites. With the spread of Varroa
destructor almost worldwide, attention has been focused on viruses of bees because of the role of
the mite in transmission of a number of these infections and their connection with colony mortality
(Ball and Allen, 1988). This has led to use of the term bee parasitic mite syndrome (Hung et al.,
1996). Therefore, the control of honeybee virus infections must be based on optimal keeping and
breeding conditions (avoiding the above-mentioned predisposing factors) with a particular attention
to varroa-control. Additionally, the possibility for specific treatment or prevention for certain
honeybee virus infections (IAPV and DWV) were reported by using RNA silencing technologies
256
(Maori et al., 2009; Desai et al., 2012; Chen et al., 2014). Because the dominance of innate
immunity and lack of immune memory in bees, active immunisations (vaccinations) are not
applicable for the prevention of bee colonies from virus infection or from the development of virusassociated disease manifestations. The results of our studies indicate that movement and
importation of non-apparent infected stocks of bees may introduce viruses into areas where they are
not endemic. It is therefore important to identify bee virus infections and take this aspect into
consideration in domestic and international transport and trade of honeybees and bee products.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Allen M., Ball B.V.: The incidence and world distribution of honey bee viruses. Bee World, 77, 141162, 1996
Azzami K., Ritter W., Tautz J., Beier H.: Infection of honey bees with acute bee paralysis virus does not
trigger humoral or cellular immune responses. Arch Virol., 157, 4, 689-702, 2012
Bailey L.: The incidence of virus diseases in the honey bee. Ann. Appl. Biol., 60, 43-48, 1967
Bakonyi T., Farkas R., Szendroi A., Dobos-Kovacs M., Rusvai M.: Detection of acute bee paralysis
virus by RT-PCR in honey bee and Varroa destructor field samples: screening of representative
Hungarian apiaries. Apidologie, 33, 63-74, 2002
Ball B.V., Allen M.F.: The prevalence of pathogens in honey bee (Apis mellifera) colonies infested with
the parasitic mite Varroa jacobsoni. Ann. Appl. Biol, 113, 237-244, 1988
Ball B.V.: Varroa and viruses. In: P. Varroa! Fight the mite, ed. Munn and R. Jones, Cardiff:
International Bee Research Association, 1997. 11-15.
Ball B.V.: Varroa jacobsoni as a virus vector. In: Proceedings of a Meeting of the EC- Experts Group,
Udine, ed. R. Cavallaro, vol. EUR 11932 EN, Commission of the European Communities, Brussels,
Belgium. 1989, 241-244.
Bksi L., Ball B., Dobos-Kovcs M., Bakonyi T., Rusvai M.: Occurrence of acute paralysis virus of the
honeybee (Apis mellifera) in a Hungarian apiary infested with the parasitic mite Varroa jacobsoni. Acta
Vet. Hung., 47, 319-324, 1999
Bernyi O., Bakonyi T., Derakhshifar I., Kglberger H., Nowotny N.: Occurrence of six honeybee
viruses in diseased Austrian apiaries. Appl Environ Microbiol,. 72, 4, 2414-2420, 2006
Bernyi O., Bakonyi T., Derakhshifar I., Kglberger H., Topolska G., Ritter W., Pechhacker H.,
Nowotny N.: Phylogenetic analysis of deformed wing virus genotypes from diverse geographic origins
indicates recent global distribution of the virus. Appl. Environ. Microbiol. 73, 11, 3605-3611, 2007
Blanchard P., Schurr F., Olivier V., Celle O., Antnez K., Bakonyi T., Berthoud H., Haubruge E., Higes
M., Kasprzak S., Koeglberger H., Kryger P., Thiry R., Ribire M.: Phylogenetic analysis of the RNAdependent RNA polymerase (RdRp) and a predicted structural protein (pSP) of the Chronic bee
paralysis virus (CBPV) isolated from various geographic regions. Virus Res., 144, 1-2, 334-338, 2009
Bowen-Walker P.L., Martin S.J., Gunn A.: The transmission of deformed wing virus between
honeybees (Apis mellifera L.) by the ectoparasitic mite Varroa jacobsoni Oud.. J. Invert. Pathol., 73,
101-106, 1999
Chen Y.P., Pettis J.S., Corona M., Chen W.P., Li C.J., Spivak M., Visscher P.K., DeGrandi-Hoffman
G., Boncristiani H., Zhao Y., van Engelsdorp D., Delaplane K., Solter L., Drummond F., Kramer M.,
Lipkin W.I., Palacios G., Hamilton M.C., Smith B., Huang S.K., Zheng H.Q., Li J.L., Zhang X., Zhou
A.F., Wu L.Y., Zhou J.Z., Lee M.L., Teixeira E.W., Li Z.G., Evans J.D.: Israeli acute paralysis virus:
epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, 7, :e1004261,
2014
Chen Y.P., Pettis J.S., Evans J.D., Kramer M., Feldlaufer M.F.: Molecular evidence for transmission of
Kashmir bee virus in honey bee colonies by ectoparasitic mite, Varroa destructor. Apidologie, 35, 441448, 2004
Communication
from
the
Commission
on
honeybee
health,
(2010):
http://ec.europa.eu/food/animal/liveanimals/bees/docs/honeybee_health_communication_en.pdf
257
259
Invited lecture
THE MOST COMMON HEALTH DISTURBANCES DETECTED IN WILD BOARS IN
ENCLOSED HUNTING GROUNDS IN VOJVODINA PROVINCE
Jasna Prodanov-Radulovi1*, Radoslav Doen1, Igor Stojanov1, Tama Petrovi1
1 Scientific veterinary Institute Novi Sad, Novi Sad, Serbia
* Corresponding author: jasna@niv.ns.ac.rs
Abstract
The control of health status of wild boar population is quite demanding and it is not easy to achieve.
Also, often is not possible entirely to perform a complete diagnostic examination in wild boars in
each evaluated case. The aim of this research was to evaluate the most common health disturbances
detected in wild boars in enclosed hunting grounds in Vojvodina Province. The material for this
research included enclosed hunting grounds, where clinical signs of health disorders and dead of
different categories of wild boars were recorded. The following research methods were applied:
epidemiological investigation, clinical examination of live and gross pathological examination of
dead and/or shot diseased wild boars. The clinical examination was performed from the safe
distance at the feeding place. In the laboratory, the applied research methods included:
bacteriological testing, virusological testing (ELISA test, HI test and RT-PCR) and parasitological
examination. On the basis of the achieved results it may be concluded that wild boars could be
source of different endoparasites species. By gross pathological examination it was discovered that
in the largest number of animals the health problems were mainly connected to the parasitic
infestations and bacterial infections of digestive and respiratory organs.
Keywords: wild boars, enclosed hunting grounds, Vojvodina Province
Introduction
Wild boar (Sus scrofa scrofa) numbers have dramatically increased over the past 60 years and the
species also shows a more widespread distribution (Artois et al., 2001; Sedlak et al., 2008; Wu et
al., 2011), which not only means a larger number of hosts available for the transmission of disease,
but also a higher contact rate between hosts (Ruiz-Fons et al., 2008). The population of wild boar in
15 member states of European Union (EU) has been roughly estimated between 800,000 and 1
milion heads, but its density varies from country to country (Laddomada, 2000). Increasing food
availability and climatic change provide optimal conditions for a rapid wild boar multiplication and
expansion (Wu et al., 2011). According to available data of the Veterinary directorate of the
Ministry of Agriculture and Environmental protection, in the Republic of Serbia, the population of
wild boars was aproximatelly estimated on 30.000,00 heads and the density of the wild boar
population ranges from a minimum of 0.2/km2 to over 20/km2. In Serbia, there are about 300
hunting grounds with wild boars. Hunting grounds are managed by two public enterprises, also two
hunting association, four National parks in wich hunting is allowed and 5 hunting grounds are
managed by Ministry of Defence. In Vojvodina Province, there is one public enterprise
Vojvodinaume with 17 hunting grounds, one National park Fruka gora, one private hunting
ground and 86 hunting associations.
Wild boar pathogens are highly relevant not only for the livestock industry but also for wildlife
conservation and for the hunting industry (Doen et al., 2013; Laaksonene and Paulsen, 2015;
Prodanov-Radulovi et al., 2014a). Knowledge of diseases circulating in wildlife populations can be
260
important not only for conservation and livestock production but also for public health (Boadella et
al., 2012; Meng et al., 2009). Because several million wild boars are harvested and consumed yearly
in Europe, wild boar meat and derivates are a likely source of human infections (Boadella et al.,
2012).
Wildlife is a reservoir for several economically important diseases and epizootiologic surveys are
needed, especially in large wild boar populations (Garcia-Gonzlez et al., 2013). Many diseases
may cause external symptoms and abnormal behaviour in game animals. They can also diminish the
value of the end products obtained from game. In the most of the cases, the assessment of game
animal health is based on medical history of the game and, after shoting, observations made of the
carcass and viscera (Laaaksonen and Paulsen, 2015; Prodanov et al., 2009a; Prodanov-Radulovi et
al., 2013a). Migrating and roaming animals can carry pathogens over long distances (Laaaksonen
and Paulsen, 2015). The parallel increase of outdoor piggeries has led to a higher risk of contacts,
and thus of disease transmission, between wild boars and domestic pigs. Because pigs and wild
boars belong to the same species, they share the same pathogens (Prodanov et al., 2009a; Prodanov
et al., 2009b; Wu et al., 2011). The overabundance of wildlife, recognized as a relevant risk factor
for disease transmission between wildlife and domestic animals, compromises the health
surveillance programs carried out both populations (Frlich et al., 2002; Ruiz-Fons et al., 2008).
Hunting and consumption of wild boar meat enables direct contact of humans and wild pigs,
providing ideal conditions for pathogen transmission from wild to domestic pigs and humans. It
should be taken into consideration that domestic animals and humans usually have never been
exposed to pathogens common for wild pigs, and thus are highly susceptible to infection (Ruiz-Fons
et al., 2008). Hunters have a greater than average risk of encountering various pathogens
communicable from animals to people. The ways of handling the carcass, meat, offal and hides
have an effect on this risk (Laaaksonen and Paulsen, 2015).
Animal health surveillance is routinely applied to domestic animals, but limited data exist on the
prevalence and distribution of infectious agents of wild boars in Vojvodina Province. Also, often is
not possible entirely to perform a complete diagnostic examination in wild boars in each evaluated
case (Petrovi et al., 2012, Prodanov-Radulovi et al., 2013a; Prodanov-Radulovi et al., 2013b). In
Vojvodina Province a certain number of wild boars is controlled and reared in an enclosed hunting
ground while the number of free-ranging population is mainly unknown (Prodanov et al., 2009b).
One of the characteristics of outdoor swine production in some regions of Vojvodina is raising freeroaming domestic pigs, where they share forest habitat with wild boar population. It can be assumed
that direct contacts between wild boars and domestic pigs kept in outdoor farms occur occasionally
(Doen et al., 2013; Prodanov-Radulovi et al., 2011; Prodanov-Radulovi et al., 2014a).
In some regions, especially near the river banks, domestic pigs are kept outdoors on the pasture,
which provides favourable conditions for infection transmission. Domestic pigs move freely in the
woods, thus getting in contact with wild boars. However, after summer pasture, domestic pigs are
returning into the pens. It is especially important that owners of the free-roaming animals in the
same time have backyard pigs (Prodanov et al., 2009b). In areas in which traditionally raising freeroaming domestic pigs has been introduced in the woods, hybridization with the wild boars has led
to crossbreeding, production which is often referred to as a feral pig or feral hog (Ruiz-Fons et al.,
2008). In our research during the epizootiological and clinical examination, we discovered the
existence of this type of animal hybrids in the backyards of the owners who practice extensive
grazing (Prodanov et al., 2009b).
The objective of our study was to evaluate the most common health disturbances detected in wild
boars in enclosed hunting grounds in Vojvodina Province, focusing on detected diseases that are
epidemiologically and economically important to the health of both wild boar and domestic swine
populations.
261
262
In various game animal species, the bacteria from the genus Pasteurella can cause epidemics with
high mortality rate (Laaaksonen and Paulsen, 2015). The bacteria from the genus Pasteurella is
probably the most frequent and damaging invader in the lung i.e. tipically secondary invader and
was never isolated in the bronchial tree of healthy pigs. Even the most pathogenic strains are not
capable of infecting a healthy lung, unlike A. pleuropneumoniae (Le Potier et al., 2006). It is
consider that the outbreak of the disease in wild boars requires stressful and predisposing factors,
such as poor state of nutrition, overexertion, overdensity of population, unfavourable weather
conditions and great number of parasites. Common clinical symptoms in wild boars include hanging
of head and severe functional disorder of respiratory organs (Laaaksonen and Paulsen, 2015;
Prodanov-Radulovi et al., 2013b).
Actinobacillus pleuropneumoniae is considered an obligate parasite of the porcine respiratory tract
and there are no other natural hosts. Transmission occurs via aerosols or direct contact between
pigs. The clinical and pathologic outcome of infection depends on serovar and virulence factors, but
also on age, immunity, hygiene, infectious pressure, breed, and stress factors (Reiner et al., 2010).
Pleuropneumonia caused by A. pleuropneumoniae is one of the important bacterial diseases of the
respiratory tract of the pig and occurs in most pig-keeping countries (Boadella et al., 2012).
Subclinically and chronically infected pigs may enter a permanent carrier state, harbouring A.
pleuropneumoniae in sequestra or well-encapsulated abscesses in the lung and in tonsillar crypts
(Le Potier et al., 2006). Survivors of acute infections become carriers, and the infectious agent is
located mainly in nerotic lung lesions and/or in the tonsils, less frequently in the nasal cavity
(Boadella et al., 2012). Reiner et al. (2010) discovered that the overall prevalence of wild boars that
were PCR-positive for A. pleuropneumoniae DNA was 35.8%. Actinobacillus pleuropneumoniae
DNA was amplified from tonsils of 34.8% and from lungs of 6.4% of wild boars. The discrepancy
between A. pleuropneumoniae loads in lungs and tonsils likely demonstrates the higher colonization
of tonsil tissue with A. pleuropneumoniae in wild boars, although it cannot be excluded that lungs
were categorized as false negatives. Prevalence of A. pleuropneumoniae increased with age and
body weight. Higher prevalences in tonsils without gross pathologic signs of pleuropneumoniae
suggest colonization of most of these animals by non-pathogenic or low-pathogenicity serotypes
(Reiner et al., 2010).
In Europe, most attention has been devoted to diseases that are under official surveillance and
control in either pigs, wild boar or both, while other infections have received comparatively less
effort. Monitoring wildlife diseases faces a number of wildlife-specific constaints, including
sampling difficulties regarding proper sample and site stratification, consistent sampling of the
same sites, and limitations of the diagnostic test available for wildlife (Boadella et al., 2012). It
should be stressed that overdense regional game populations are a predisposing factor for the
disease (Laaaksonen and Paulsen, 2015).
In only few examined enclosed hunting grounds, by clinical examination of wild boars during the
feeding, the clinical signs (greyish to brownish diarrhea) of the enteric infection were observed.
Applying bacteriological testing on tissue samples (kidney, liver, spleen, mesenterial lympho nodes)
derived from diseased shot and dead wild boars the presence of Escherichia coli and Escherichia
coli haemolytica was detected. Most common gross pathology findings included moderate signs of
gastric and intestinal infection and enlarged mesenterial lymph nodes.
Escherichia coli bacteria cause a group of enteric diseases mostly found in young wild boars
(Laaaksonen and Paulsen, 2015). Disease outbreak usually requires predisposing factors, depending
on the virulence of bacterium. Starvation and poor condition of mothers/dams set the scene for an
outbreak of the disease. Infection pressure is also increased when the number of diseased animals is
high and the population is dense (Laaaksonen and Paulsen, 2015; Prodanov-Radulovi et al.,
2013a). In the treatment, usually the same antibiotics are used in the treatment of bacterial diseases
of domestic pigs and wild boars. Bacteria have a genetic ability to mutate and develop strains that
263
are resistant to antibiotics. This, together with poorly planned treatment or mass uncontrolled use of
antibiotics, may cause great problems in the health care of humans and animals (Doen et al., 2014).
In the control, important precautions include game animal feeding ground hygiene and prevention
of contacts between game and production animals (Laaaksonen and Paulsen, 2015).
Wild boar diseases caused by parasites
By gross pathology examination, the adult forms of several gastrointestinal parasites were
discovered: Ascaris suum, Macracanthorhinhus hirudinaceus, Trichuris suis. However, no gross
pathology lesions were detected in the gastrointestinal tract of examined wild boars. Applying
parasitological control of the intestinal content and/or faecal material extracted from the rectum, the
presence of eggs from several parasites was discovered: Trichuris suis, Oesophagostomum sp. and
Hyostrongylus sp. Also, in most of the examined cases, the presence of Protozoa of genus Eimeria
(Coccidia) was detected. Parasites, and changes caused by them, are the most common findings that
a hunter confronts in game handling. It is important to distinguish between a parasitic infection,
which practically all animals have, and a disease caused by parasites. The manifestation of disease
is often directly comparable to the severity of parasitic infection (Laaaksonen and Paulsen, 2015;
Prodanov-Radulovi et al., 2011).
The parasite from genus Coccidia reproduces in the intestines and damages the intestinal lining,
causing diarrhea and intestinal dysfunction of host animals and produce egg-like oocysts to their
feces. The infection is transmitted to another animal via feces-contaminated food or water. In dense
populations, the transmission of the parasite increases and infection pressure grows. Consequently,
coccidian may become a significant cause of mortality in young animals. In the prevention, correct
location and hygiene of game feeding grounds is important (Laaaksonen and Paulsen, 2015).
Roundworms (Trichostrongylidae, Trichuroidea, Strongylidae and Ascaroidea) that parasitize in
the gastrointestinal tract are frequently found in wild boars (Prodanov-Radulovi et al., 2013a). An
adult parasite inhabiting the stomach or intestines of a host animal produces eggs that are passed to
the environment in feces. In general, parasites of the gastrointestinal tract do not cause problems
under normal conditions, and their spread is self-limiting. However, these parasites are significant
in dense animal populations, as well as when starvation occurs. In that case, diseases may be caused
especially by large roundworms (Ascaroidea), they can cause weakening of the animal and
significant mortalities. In addition, animals with a parasitic infection can present a weight loss,
wasting, swollen abdomen, dry and dull hair and diarrhea (Laaaksonen and Paulsen, 2015).
In most of the shot healthy, diseased or dead found wild boars originated from different enclosed
hunting areas the presence of lung worms was established. Clinically, the case history data revealed
the problem in piglets category (signs of growth retardation). The piglets were described as
reluctant to move, fatigued, easy to catch. In several examined hunting grounds, by clinical
examination clinical signs of respiratory infection in young wild boars were detected: dispnoea and
intensive coughing (thumping). The wild boars were emaciated and slow gait, with shrunken eyes
and tough dry hair, and lagging behind the pack were noticed. As part of health control program of
clinically diseased wild boars shot by hunters, gross pathological examination of trunci and internal
organs deriving from shot wild boars was performed. In all examined cases, the gross pathology
examination revealed changes dominantly in the respiratory tract: purulent nasal discharge,
effervescent content in bronchi and bronchioles, mixed with a large number of lung worms, which
were like mucoid plugs filling the respiratory pathways (Metastrongylosis pulmonum summ). All
lobes of the lungs were diffusely swollen, edematous and reddened with marginal emphysema and
consolidation. A large amount of clear, foamy fluid and numerous slender, white nematodes 4-7 cm
long were visible in the trachea and bronchial trees. In several cases, pathomorphologically the
presence of numerous abscesses (Pneumonia apostematosa disseminata) in lung tissue were
detected. In the cases when macroscopically changes on the lung tissue were noticed, the
pathohystological examination were performed and in two examined shot wild boars Pneumonia
264
The other detected parasitic agent in examined wild boars is cysts of a tapeworm, Echinococcus
granulosus. The definitive hosts of E. granulosus are canines, often wolves, whose intestines are
inhabited by adult parasites. The eggs produced by the parasite are spread to the environment
through the host animals feces, and further via food to the intermediate host. Inside the intermediate
host, the parasite forms cysts that contain a large number of infectious larvae. When the animal and
cysts are ingested by carnivores, the parasites life cycle is completed (Rojo-Vazquez et al., 2011).
Typical cysts (hydatid cyst) are commonly found in the liver of the wild boars. Their size varies,
depending on the duration of the infection. The cysts are often pearly grey colour and contain clear
liquid with thousands of small, infectious larval forms of the parasite. The number of cysts may
vary from a single one to over a hundred cysts. An animal suffering from severe infection and large
cysts in abdominal cavity or lungs is more easily killed by carnivores. This assists in the completion
of the parasites cycle. E.granulosus infection can be contracted by humans, who ten act as
intermediate hosts and the infection causes a so called hydatid disease (hydatidosis) (Laaaksonen
and Paulsen, 2015).
Mycotoxicoses in wild boars
In two examined enclosed hunting areas, the problem of diarrhoea, slow growth and mortality in
piglets was discovered. The clinical examination was performed from the safe distance at the
feeding place. The signs of weakness and growth retardation, staggering gait, trace of fecal content
on the hind body parts and on the ground were found. In the feed control a significant quantity of
moldy corn was discovered. Having in mind all the facts, the potential problem of mycotoxicosis
was suggested.
Different fungal species (Fusarium, Aspergillus, Penicillium genera) produce mycotoxins in food
and cause intoxication to those animals that eat the contaminated food. On entering the body, the
toxins possibly produced by fungi may cause a group of different symptoms that are often difficult
to recognize (Prodanov-Radulovi et al., 2014b). Mycotoxins can get to wild animal food from
grass of fodder made from grass, from silage and grain feed (Laaaksonen and Paulsen, 2015).
Symptoms caused by mycotoxins in animals depend on the toxin and the ingested dosage. Clinical
symptoms vary from organ-destroying acute intoxications to chronic states of intoxication that may
include reduced appetite, diarhoea, weight loss and reproductive disturbances. Diagnosis is difficult
to make as the mycotoxin content is very small and several toxins can be found in the same sample
(Prodanov-Radulovi et al., 2014b). Fungal intoxication has rarely been reported in game animals,
perhaps due to difficulty of reaching a diagnosis. In nature, the occurrence of mycotoxins cannot be
controlled. However, the entrance of mycotoxins into the nourishment of game animals can be
avoided with careful hygiene of game animal feeding grounds, using only feed that would be
acceptable for production animals, do not offer feed from the ground but from a feeding device that
prevents the feed from getting wet (Laaaksonen and Paulsen, 2015).
Wild boar diseases caused by viruses
In cooperation with the hunting societies and local veterinary service gathering of sera samples of
hunted wild boars was organized. Serological examination in year 2009 on the presence of specific
antibodies against CSFV (ELISA test) comprised only 259 blood samples obtained from wild boars
in the hunting area of Vojvodina region and it revealed negative result. In year 2010 the serological
control of CSFV antibodies in wild boars population included significantly larger number of
animals i.e. in total 471 tissue samples and 455 blood samples were examined. From examined
blood samples, in 36 positive results i.e. the presence of specific antibodies against CSFV was
detected. However, applying reverse transcription-polymerase chain reaction (RT-PCR) analysis the
presence of viral genome was not established in tissue samples deriving from shot wild boars. The
serological control of the CSFV presence in wild boars population in Vojvodina region was even
more intensified during years 2011-2012. In total 2038 samples were examined: 996 sera samples
266
and 1042 tissue samples (spleen, lymph node, and kidney). Once again, in 33 sera samples the
presence of CSFV specific antibodies was detected. Clinically, no abnormal mortality has been
reported in the analyzed districts of Vojvodina region (Prodanov-Radulovi et al., 2013a; ProdanovRadulovi et al., 2014a). By additional epidemiological evaluation, it was discovered that some of
the examined sera samples from certain hunting grounds that tested positive were a consequence of
previous vaccination against CSFV in the past, with modified live (China strain) vaccine. Although
prohibited from 1983 in Serbia, CSFV vaccination of wild boars may have been applied for a while
after vaccine ban (Prodanov et al., 2009b). Therefore, we cannot exclude the possibility that
vaccinated wild boars may have been sampled and detected as positive in the survey. This could
explain the presence of antibodies against CSFV in some of examined sera samples. In research
conducted in 2013, applying RT-PCR analysis the presence of CSFV genome was not established in
tissues samples deriving from shot wild boars in Vojvodina (Prodanov-Radulovi et al., 2014a).
However, the results of the epizootiological questionnaire indicated that CSFV may be present in
hunting grounds in the region of Danube River, implying that the wild boars population represents
also a source of infection with CSFV (Prodanov et al., 2009b).
Classical swine fever (CSF) is a viral disease caused by a member of Flaviviridae family, genus
Pestivirus and of great economic concern for the pig farming industry (Artois et al., 2002; Rossi et
al., 2005). The disease in the wild boar population was diagnosed and/or serologically confirmed in
several Central and Eastern European countries (Artois et al., 2002; Montagnaro et al., 2010;
Prodanov et al., 2009b; Roic et al., 2012; Rossi et al., 2005; Vengust et al., 2006). In some
European countries, CSFV has been reintroduced periodically into domestic pigs via contact with
infected wild boars (Le Potier et al. 2006; Rossi et al., 2005). Moreover, epidemiological links
between CSFV infections in wild boars and domestic pigs have been repeatedly reported, mainly in
Germany (Ruiz-Fons et al., 2008). At present, CSF monitoring program in Serbia is primarily
focused on the serological investigations of blood samples and control of tissue samples by RTPCR from hunted wild boar. Sampling is performed randomly based on the density of the wild boar
population in different regions (Prodanov Radulovi et al., 2014a). The inveterate tradition to
keep domestic pigs at free range and the consequent contacts with the wild boars are considered the
major cause of outbreaks of CSF, which seems to facilitate disease persistence (Laddomada, 2000;
Rossi et al., 2005).
In one enclosed hunting ground, according to the history data and clinical signs detected in wild
boars (a small number of newborn piglets, stillborn and mummified piglets in the litters), the
problem of PPV infection was suggested. However, the clinical examination was feasible only in a
certain number of wild boars located in specially separated, fenced area. During the visit of hunting
area it was noticed that the fence was not entirely surrounding the area and there were parts without
fence. Having in mind migratory characteristics of population, this could facilitate contact with
domestic pigs located in forest habitat. Applying serological examination (HI test) of blood
samples, antibodies against PPV were widely distributed among the wild boar population in
Vojvodina province: 148 (49.33%) of the 300 examined samples tested PPV positive. The highest
prevalence of seropositive animals was associated with the hunting areas in Baka and Srem
districts. We believe that this is connected with the tradition of keeping domestic pigs in woods
(especially in Srem district), thus increasing possible contact and transmission of diseases between
wild boars and domestic swine (Prodanov et al., 2009b; Prodanov-Radulovi et al., 2014a). The
high prevalence of PPV antibody suggests this virus is endemic in our wild boar populations. In
Europe, PPV is highly prevalent in wild boars, with an incidence ranging from 14 to 57 % (RuizFons et al. 2008; Vengust et al., 2006), except Italy, where low prevalence of antibody to PPV was
reported (Montagnaro et al., 2010).
267
Conclusion
On the basis of the achieved results we can conclude that wild boars could be source of different
endoparasites species. The gross pathological examination discovered that in the largest number of
animals the health problems were mainly connected to the parasitic infestations and bacterial
infections of digestive and respiratory organs. Discovered parasitic infestations in the evaluated
wild boars are economically significant because of retardation in the growth and weigh gain. The
obtained serological results suggest that wild boars have direct or indirect contact with domestic
pigs, which facilitate transmission of pathogens. Avoiding close contact between wild boars and
domestic animals is of logical importance in disease control and eradication programmes. Having in
mind this fact, the special attention should be given to active surveillance of wild boars population
in the areas where close contact with domestic swine is possible. The measures should include the
serological monitoring of wild boars and free-roaming domestic swine, even the prohibition of
extensive grazing, pathological examination of the trunci deriving from shot wild boars. The study
underlines the importance of improving surveillance strategies for pathogens shared between
wildlife and domestic animals and the need to increase disease awareness of hunters, farmers and
veterinary practitioners. In the future, a better connection between veterinary service and experts
from hunting area is needed in order to solve to problems comprehensive way.
Acknowledgements
This paper is a result of the research within the project TR 31084, financed by the Ministry of
Education, Science and Technological Development, Republic of Serbia
References
1.
Artois M., Delahay R., Guberti V. and Cheeseman C.: Control of Infectious Diseases of Wildlife in
Europe. The Veterinary Journal, 162, 141-152, 2001
2. Boadella M., Ruiz-Fons J.F.,Vicente J., Mart n J., Segales J. and Gortazar, C.: Seroprevalence Evolution
of Selected Pathogens in Iberian Wild Boar. Transboundary and Emerging Diseases,59, 395404, 2012
3. Da Silva D., Mller G.: Parasites of the respiratory tract of Sus scrofa scrofa (wild boar) from
commercial breeder in southern Brazil and its relationship with Ascaris suum. Parasitol Res 112:13531356, 2013
4. Doen R., Prodanov-Radulovi J., Pui I., Stojanov I., Petrovi T.: Man, wild and domestic pigs :
Major risk points in disease transmission and perspective. Book of Abstracts, 2nd International
symposium on hunting 'Modern aspects of sustainable menagement of game population', 17-20 October,
2013, Novi Sad, Serbia organized by Faculty of Agriculture, Novi Sad, 2013, 97
5. Doen R., Prodanov-Radulovi J., Pui I., Ratajac R., Stojanov I., Gruba S.: The uncontrolled use of
antibiotics in pig production - a threat to public health. XVI International congress Feed technology,
October 28-30, 2014, Novi Sad, organized by Institute of food technology, 2014, 20-24
6. Frlich K., Thiede S., Kozikowski T., Jakov, W.: A Review of Mutual Transmission of Important
Infectious Diseases between Livestock and Wildlife in Europe. Ann. N.Y. Acad. Sci., 969, 4-13, 2002
7. Garcia-Gonzlez A., Prez-Martin J.E., Gamito-Santos J. A., Calero-Bernal R., Alcaide Alfonso M.,
Frontera Carrin E. M.: Epidemiologic Study of Lung Parasites (Metastrongylus spp.) in Wild Boar
(Sus scrofa) in Southwestern Spain. Journal of Wildlife Diseases, 49,1, 157-162, 2013
8. Jrvis T., Kapel Ch., Moks E., Talvik H., Mgi E.: Helminths of wild boar in the isolated population
close to the northern border of its habitat area. Veterinary Parasitology, 150, 366-369, 2007
9. Laddomada A.: Incidence and control of CSF in wild boar in Europe. Vet Microbiol, 73, 121-130, 2000
10. Laaaksonen S. and Paulsen P.: Hunting hygiene, Wageningen Academic Publishers, 2015
268
270
Abstract
A steady increase in the number of dogs is a serious sanitary-epidemiological problem of urban
areas. Those animals permanent contaminated those areas with faeces which present a significant
health problem from human. From these reason at Belgrade we had parasitological research of that
places continuously since 1993. Here we presented results of our examination performed at central
Belgrade municipalities in period 2013-2014. Parasites contamination were detected at 45.91%
(45/98) soil samples and 72.5% (58/80) dog faeces. Toxocara canis were found at 31.63% soil
samples and 72.5% dog faeces, Dipyllidium caninum at 19.9% and 25.6%, Ancylostomidae spp. at
18,36% and 22,5%, Trichuris vulpis at 16.32% and 21.25%, Toxacaris leonina at 14.28% and
18.75%, and Taenia-type helminths at 5.1% and 6.6%, Giardia intestinalis at 16.32% and 22.5%,
Amoebae spp at 6.6% and 7.5%, Eimeria canis 7.14% and 12.5% and and Isospora canis 10.28%
and 15.0%.
Keywords: dogs, parasites, zoonoses, environmental contamination
Introduction
The presence of a large number of dogs, pets and stray, whose droppings dirty sidewalks and green
areas, is the current epidemiological problem in urban areas. In close cohabitation stray animals and
pets oriented on the same surface movement in the immediate environment of people and
contamination of public areas eggs zoonotic parasite species leads to constantly attend on the
possibilities of human infection (Mangaval and Pavlovi, 2005; Pavlovi, 2006; Laloevi and
Laoevi, 2008; Elaine et al., 2011). Commenting on the results of parasitological examination of
green areas in in cities around the world, we will see that those polution in Madrid is 9%, London
15-17 % , Michigan 19 % , Kansas 20.6% , Utrecht 23% , Belgrade, Paris and Prague 28 %, Dublin,
32 %, Tokoshima 63 % and etc (Gothe and Reichler, 1990; Jansen et al., 1993; Cielecka et al.,
2005; Demirci et al., 2010; Tylkowska et al., 2010). If it is known that more than 5% of the
contaminated urban areas pose a serious threat to people's health is our opinion that this is not to
comment (Woodroff, 1976).
In order to monitor the contamination in the Belgrade area since 1993 continuously monitors the
contamination of public areas for the presence of parasites originating from dogs (Pavlovi et al.,
1997, 2009; Pavlovi and Surla, 2003). In our paper we presented results of our examination
performed at central Belgrade municipalities in period 2013-2014.
271
Results
Parasites contaminations were detected at 45.91% (45/98) soil samples and 72.5% (58/80) dog
faeces. Toxocara canis were found at 31.63% soil samples and 72.5% dog faeces, Dipyllidium
caninum at 19.9% and 25.6%, Ancylostomidae spp. at 18,36% and 22,5%, Trichuris vulpis at
16.32% and 21.25%, Toxacaris leonina at 14.28% and 18.75%, and Taenia -type helminths at 5.1%
and 6.6%, Giardia intestinalis at 16.32% and 22.5%, Amoebae spp at 6.6% and 7.5%, Eimeria
canis 7.14% and 12.5% and and Isospora canis 10.28% and 15.0%.
Discusion
Epidemiological study of parasites contamination in the area of Belgrade is the research carried out
continuously since 1993. Throughout this period, this study was performed for scientific purposes
and were unprofitable (which is sometimes caused misunderstanding in the institute), exception of
three occasions when the city government paid for this study (in 2002, 2011 and 2012).
On the basis of the control of parasitic contamination of land from parks and other green areas
between 1993 and 2002 (Pavlovi et al., 1997, 2000), the presence of the locations parasite eggs
was found 65.90% of the examined samples. This was followed by the first reactive in terms of
cleaning the playgrounds so that in the period 2003-2007. The contamination has been established
at 45.90% of the area (Pavlovi et al., 2007).
The following progress has been made by introducing during 2008-2009 in central city districts has
taken root system of baskets with plastic bags from dog feces (Dogi-pot system). During 2011 in
some parks are form of eco zones or parks for dogs (Pavlovi and Terzin, 2012)
A special segment of solving this problem in Belgrade has been the adoption of problem-solving
strategies non-owner of dogs and cats in the city of Belgrade, which was adopted at the Belgrade
City Assembly held 21.9.2011. The city of Belgrade has become one of the few cities that have a
strategy to solve the problem of non-proprietary dogs and it is a document that defines the
principles, objectives and measures to solve the problem in terms of non-owner dogs carry out
administration of local government. In developing this strategy for the City of Belgrade and its
implementation was guided by the principle of humanity, combining the method of euthanasia
without (no kill strategy) and CNR method "catch - treat - let " ( CNR - catch - neuter -release),
with special emphasis on the protection of human and animal health. At the same time more shelters
for dogs has been built and a regular parasitological examination of parks and green areas in the city
was introduced (Pavlovi and Terzin, 2012; Terzin et al., 2012).
On the basis of parasitic control of soil contamination from the parks during the 2012 presence of
parasite eggs was found in over 40% less than in the period 2008-2009.
272
At last two years (2013-2014), activities related to the parasitological control of green areas will
terminate and implementation of Strategies for addressing non-owner of dogs in the City of
Belgrade will partially apply. Those result with increase of number of non-owner dogs, dogs fecal
and parasites contamination of public places (parks, green areas and etc.) for more than 30%
compared to the previous period and high possibility to human infection. To solve that problem we
must to back to permanent parasitological control of public places.
Reference
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
273
274
Abstract
In the Balkan region of Europe, Trichinella spp. infections are endemic. These zoonotic parasites
are a serious problem for the human health and animal husbandry in Serbia. The aims of the present
study were to define risk factors in transmission of Trichinella spp. in domestic animals and
synanthropic and wild animals.
Through the surveillance and monitoring of Trichinella spp. in wild boars (Sus scrofa), red foxes
(Vulpes vulpes), golden jackals (Canis aureus), wolves (Canis lupus), stray dogs (Canis familiaris)
and domestic pigs (Sus scrofa domestica) we investigated presents and possible pathways for
transmission of Trichinella species. After examination of muscle samples from wild and domestic
animals for presents of Trichinella larvae, genotyping was performed by multiplex PCR. GIS
(Geografical Information System) was used for mapping the spatial distribution of Trichinella spp.
infected animals and all defined point of interest (pig farms, hunting section, slaughterhouses, and
dumps).
Trichinella spp. infection was detected in domestic and wild animals. Trichinella spiralis and
Trichinella britovi were the only two species identified in the isolates as single or mixed infections.
The identification of Trichinella spp. positive animals allowed to identify the foci of transmission
and to inform the veterinary services, the owners of pig farms and slaughterhouses and hunters
associations about the risk of transmission of these zoonotic agents.
The results point out the circulating of Trichinella species by a domestic or a sylvatic cycle, the
transmission between these two cycles and the role of some host species as reservoirs of T. spiralis
or T. britovi or of both species in Serbia.
Key words: Trichinella spp., zoonotic, domestic, wild, transmission
Introduction
In the Balkan region of Europe, Trichinella spp. infections are endemic. These zoonotic parasites
are a serious problem for the human health and animal husbandry in Serbia (Cuperlovic et al.,
2005). Human health problem is mainly the consequence of high prevalence of infection in
domestic animals, especially swine. According to the most important risk factors for trichinellosis
in the domestic and sylvatic cycles (Pozio, 2007), many are present in the endemic district of
Branicevo and Podunavlje, and include intentional feeding of food waste containing pork scraps,
scavenging on garbage dumps by pigs and dogs, and disposing of animal carcasses in the field
which allows sylvatic animals to scavenge on carcasses of infected domestic swine and increases
the probability of transmission to new hosts. The aims of the present study were to define risk
factors in transmission of Trichinella spp. in domestic pigs and synanthropic and wild animals
through surveillance and monitoring of Trichinella spp. among wild and domestic animals in this
region.
275
Figure 1 Trichinella prevalence in the region of Branicevo and Podunavlje in period 1995-2012.
276
Results from meat inspection at Branicevo and Podunavlje regions over an 18-year period (1995
2012) indicated that the level of Trichinella prevalence in slaughter domestic swine was relatively
steady from 1995 to 1998 (Figure 1).
A significant increase (0.839%) was observed from 1999 to 2004 followed by a significant decrease
in 2005 (0.27%) (Zivojinovic et al., 2009). Thereafter, the incidence declined from 2006 to 2010
with low increase in 2011 (0.15%) (Fig. 1). The decrease in prevalence can be explained by the
continued application of the control program organized at the VSI which is based on: the
identification of all the pig farms; systematic rodent control and improvement of biosafety measures
at pig production facilities; antihelminthic treatment of pigs with mebendazole; and the traceability
of infected animals (Zivojinovic et al., 2010). The education of farmers, hunters and consumers was
also included in the control program.
During the period 2010, from 192.707 muscle samples Trichinella infections were detected in 136
(0.07%) pigs. At slaughterhouses from 116.966 samples, 13 samples (0.01%) were positive, while
from 75.741 households, Trichinella infection has been detected in 123 (0.16%) pigs. Swine that
have been examined at slaughterhouses are mainly from big farms with high level of biosecurity
measures which is in accordance with determined t value (t=10,118) and statistically significant
difference (p<0.01) in percent of positive findings at slaughterhouses and slaughtering at
households (Table 1).
Table 1 Results of examinations domestic pigs in slaughterhouses and households in districts of Branicevo
and Podunavlje in 2010
Location of examination
Slaughterhouses
Households
In total
No of examinated pigs
116.966
75.741
192.707
No of Trichinella infected
13
123
136
%
0,01
0,16
0,07
We isolated 211 samples of domestic pigs which originated from households where Trichinella
infection was found in 2010 and 150 samples of pigs from big industrial farms. Trichinella infection
was detected in 25 (11.85%) samples, while 186 (88.15%) samples were negative. In fact, from the
total number of pigs from households, 40.98% were with Trichinella infection, while at industrial
farms that percent was 0%. The larvae isolated from 25 pigs were identified as T. spiralis. The
worm burdens were expressed as the number of larvae per gram of muscle tissue (LPG) and it was
from 0.03 to 20.
In the last 100 years, the increase in forests and fallow land, concomitant with a decrease in farms,
in Europe over the past 100 years has facilitated a great expansion of wild boar (Sus scrofa)
populations in some regions and increased transmission of Trichinella to animals and humans. The
common habit of hunters is leaving animal carcasses in the field after skinning or removing and
discarding the entrails, which increases the probability of transmission to new hosts (Pozio and
Murrell, 2006).
In total of 30 dogs from Branicevo and Podunavlje districts Trichinella infection were found in 7
(23.33%). All of them were stray dogs from municipality Pozarevac. T. spiralis was the only specie
found in dog population. The LPG was from 0.04 to 3.2.
During the same period, Trichinella infections were detected in 27 wild animals (7.99%), which
included 7 (4.02%) wild boars, 8 (6.78%) red foxes, 8 (19.05%) golden jackals and 4 wolves (Table
2).
T. spiralis was detected in 5 red foxes and 3 wild boars; T. britovi was detected only in population
of wild animals: 1 wild boar, 1 golden jackal, 1 red fox and 4 wolves; mix infection with T. spiralis
277
and T. britovi was detected in 2 red foxes and 1 golden jackal. T. spiralis and T. britovi are the two
main species circulating in Europe (Pozio et al., 2009) and in particular in the Romanian counties
bordering Serbia (Blaga et al., 2009).
Table 2. Results of examinations wild animals by artificial digestion in districts of Branicevo and Podunavlje
in 2010.
Animal species
No of examinated samples
174
118
42
4
338
7 (5,93%)
8 (6,78%)
8 (19,05%)
4 (100%)
27 (7,99%)
The larval burdens related to T. spiralis ranged from 0.12 to 8.12, T. britovi from 0.11 to 19.45 and
mixed infections with both T. spiralis and T. britovi from 0.97 to 7.2. The lowest and the highest
worm burdens were detected in a wild boar and in a golden jackal, respectively.
According to Pozio and Murrell, 2006, the most important risk factors for domestic cycle are:
1) the intentional feeding of food waste containing pork scraps (Gamble et al., 2000) or intentional
or unintentional exposure to carcasses of dead swine or wildlife; these risks are usually
encountered in free-range pasturing
2) pigs allowed to scavenge on garbage dumps
3) feeding of wild game carcasses or scraps from hunting
4) horses fed with pork scraps or with carcasses of fur animals
5) sled dogs fed with carcasses of other dogs or of game in the arctic
6) the use of carcasses of slaughtered fur animals as food for other fur animals present at the farm
7) the use of meat of slaughtered crocodiles to feed other farmed crocodiles as observed in
Zimbabwe
8) the use of pork scraps to feed young crocodiles as demonstrated in Papua New Guinea.
In our work, epizootiological data were obtained by a questionnaire which included data on the type
of farm, number and species of all animals on farm, swine age category, type of production
(fattening or reproduction), breeding conditions, presence of stagnant water, water currents in the
backyard and near the backyard, contact with swine from other husbandries or with wild animals,
whether breeding of swine was the only occupation of the owner, feeding practices (whether swine
are fed with scraps or whether they have access to free ranging), former parasitological
examinations of slaughtered swine from the same farm, existence of Trichinella infected swine in
the yard, anti-helminthic treatment of swine. Introduced to the Animal Notification System (ANS)
and approached only by licensed users, data collected contributed to a better knowledge on endemic
foci and traceability. Since 2006, the spatial and temporal patterns of Trichinella infections in
domestic pigs have been recorded for Branicevo and Podunavlje area (Zivojinovic et al., 2010). We
identified risk factors such as the behavior to raise pigs near rivers (e.g., Danube, Morava, Mlava,
Pek, Jasenica, Kubursnica, Veliki Lug), small waterways and ponds where they can be in touch
with wildlife, which explained the finding of T. spiralis in domestic pigs as well as wild animals
hunted near human settlements. Also, the husbandry conditions on 90% of these backyard farms are
very poor due to the intentional feeding of food waste containing pork scraps, scavenging of pigs in
garbage dumps and the improper disposing of pig carcasses in the field. Furthermore for 10
settlements of this region, the Danube River forms a natural border between Serbia and Romania
where T. spiralis and T. britovi circulate among wild and domestic animals (Blaga et al., 2009). Our
results, as well as those from other authors (Cvetkovic et al., 2011), support the role of wolves as
278
the main reservoir of T. britovi in Serbia. In Serbia, it is mandatory to report Trichinella findings in
pigs to the veterinary services (Plavsic et al., 2009) because of their zoonotic potential.
Application of tools for epizootiological investigations in veterinary medicine, such as
Geographical Information Systems (GIS), offered a new approach and possibilities for the
eradication or control of infectious diseases. GIS is particularly useful for research conducted in
small areas strongly impacted by man. The first report of GIS application in Serbia was for
surveillance and monitoring of Trichinella spp. (Zivojinovic et al., 2010) at district Branicevo. We
used geographical data included location (latitude, longitude) of farm/ premises where Trichinella
infection has been detected, object relationship (proximity of piggeries to stagnant water, water
currents, garbage dumps), points of interest proximity of main roads, hunting sections, forests
with wild animals, industrial farms and slaughterhouses (Figure 1, and 2) all collected by
application of GARMIN Map Source (Garmin, Taiwan) that contains maps, waypoints, routes and
track.
Figure 1 Geographical location of big industrial swine farms (n = 5) in Branicevo and Podunavlje region
Figure 2 Geographical location of hunting sections (26) in Branicevo and Podunavlje region
279
Spatial and temporal patterns of Trichinella infection were made for the Branicevo and Podunavlje,
all settlements were recognized for the presence of Trichinella infection. According to geographical
distribution at Branicevo district, we identified presence of T.spiralis and T.britovi, but at
Podunavlje district only T. spiralis was present. From 11 investigated municipalities, at territory of
nine (Pozarevac, Kucevo, Veliko Gradiste, Malo Crnice, Golubac, Zabari, Smederevo, Velika Plana
and Smederevska Palanka) which present 81.82% of investigated territory we confirmed presents of
Trichinella species (Figure 3).
Figure 3 Geographical location of Trichinella infected domestic pigs in Branicevo and Podunavlje region
280
T.spiralis,
Trichinella infection hasnt been confirmed in two municipalities Petrovac and Zagubica. Five big
industrial farms were recognized as Trichinella free (Figure 1). We also marked all 26 hunting
sections at this territory in aim to investigate Trichinella infection in wild animals, necessary for
monitoring parasite flow between the domestic and sylvatic cycles (Figure 2). In population of wild
boars, red foxes, golden jackals and wolves Trichinella infection has been confirmed in seven
municipalities (Pozarevac, Veliko Gradiste, Kucevo, Malo Crnice, Golubac, Petrovac and
Zagubica). Trichinella infection only in population of wild animals at territory of those two
municipalities Petrovac and Zagubica indicated high risk for domestic pigs, especially for free range
pigs which are common in this area.
Trichinella spiralis and Trichinella britovi were the only two species identified in the isolates as
single or mixed infections (Figure 4).
The identification of Trichinella spp. positive animals allowed to identify the foci of transmission
and to inform the veterinary services, the owners of pig farms and slaughterhouses and hunters
associations about the risk of transmission of these zoonotic agents.
Conclusion
According to our results, we concluded that risk factors for circulating Trichinella species between
domestic and wild species are numerously at Branicevo and Podunavlje district. The finding of T.
spiralis in domestic pigs as well as wild animals hunted near human settlements can be explained by
the behaviour to raise pigs near rivers (e.g., Danube, Morava, Mlava, Pek, Jasenica, Kubursnica,
Veliki Lug) small waterways and ponds where they can be in touch with wildlife (Zivojinovic et al.,
2013). Pigs and dogs allowed scavenging on garbage dumps (Zivojinovic et al., 2010). The
husbandry conditions on 90% of backyard farms with Trichinella infection are very poor. There is
intentional feeding of food waste containing pork scraps, scavenging of pigs in garbage dumps and
the improper disposing of pig carcasses in the field (Zivojinovic et al., 2013). Possibility of sylvatic
animals fed with carcasses of infected swine is present. There is a influence of human action such as
the habit of living animal caracasses in the field, which increase the probability of transmission to
new hosts. For 10 out of 256 settlements of this region, the Danube River forms a natural border
between Serbia and Romania where T. spiralis and T. britovi circulate among wild and domestic
animals (Blaga et al., 2009).
References
1.
2.
3.
4.
5.
Blaga, R., Gherman, C., Cozma, V., Zocevic, A., Pozio, E., Boireau, P.: Trichinella species circulating
among wild and domestic animals in 174 Romania. Vet. Parasitol. 159, 218221, 2009
Cuperlovic, K., Djordjevic, M., Pavlovic, S.: Re-emergence of trichinellosis in southeastern Europe due
to political and economic changes. Vet. Parasitol. 132, 159166, 2005
Cvetkovic, J., Teodorovic, V., Marucci, G., Vasilev, D., Vasilev, S., Cirovic, D., SofronicMilosavljevic, Lj.: First report of Trichinella britovi 177 in Serbia. Acta Parasitol. 56, 232235, 2011
European Community (2005) - Regulation (EC) No 2075/2005 of the European Parliament and of the
Council of 5 December 2005 laying down specific rules on official controls for Trichinella in meat. Off.
J. EC, L 338, 60-82.
Gamble H.R., Bessonov A.S., Cuperlovic K., Gajadhar A.A., van Knapen F., Nockler K., Schenone H.,
Zhu X.: International Commission on Trichinellosis: recommendations on methods for the control of
Trichinella in domestic and wild animals intended for human consumption. Vet Parasitol.