You are on page 1of 9

Superlista biologia molecular

1. (Uerj 2015) Diversos mecanismos importantes para a manuteno da vida na


Terra esto relacionados com interaes qumicas.
A interao qumica envolvida tanto no pareamento correto de bases nitrogenadas
no DNA quanto no controle de variaes extremas de temperatura na gua uma
ligao do seguinte tipo:
a) inica
b) covalente
c) de hidrognio
d) de van der Waals
2. (Fuvest 2015) No processo de sntese de certa protena, os RNA transportadores
responsveis pela adio dos aminocidos serina, asparagina e glutamina a um
segmento da cadeia polipeptdica tinham os anticdons UCA, UUA e GUC,
respectivamente.
No gene que codifica essa protena, a sequncia de bases correspondente a esses
aminocidos
U C A U U A G U C.
a)

A G T A A T C A G.
b)

A G U A A U C A G.
c)

T C A T T A G T C.
d)

T G T T T T C T G.
e)
3. (Uerj 2015) Quando um filamento de RNAm traduzido para a produo de uma
protena, ele pode sofrer uma mutao em que bases nitrogenadas adjacentes so
substitudas simultaneamente por outras.
Admitindo que todas as substituies resultem em produo de aminocidos, o
nmero de bases substitudas simultaneamente capaz de gerar mais alteraes na
protena produzida :
a) 3
b) 4
c) 6
d) 9
4. (Fuvest 2014) Observe a figura abaixo, que representa o emparelhamento de
duas bases nitrogenadas.

Indique a alternativa que relaciona corretamente a(s) molcula(s) que se


encontra(m) parcialmente representada(s) e o tipo de ligao qumica apontada
pela seta.
Molcula(s)

Tipo de ligao
qumica

a)

Exclusivamente DNA

Ligao de hidrognio

b)

Exclusivamente RNA

Ligao covalente
apolar

c)

DNA ou RNA

Ligao de hidrognio

d)

Exclusivamente DNA

Ligao covalente
apolar

e)

Exclusivamente RNA

Ligao inica

5. (Uerj 2014) As caractersticas abaixo so referentes aos processos de replicao,


transcrio e traduo, que ocorrem em seres vivos.
I. A sntese de protenas tem incio antes mesmo do trmino da transcrio.
II. A grande maioria dos genes contm ntrons, retirados antes da traduo.
III. A sntese de protenas sempre ocorre em ribossomos livres no citoplasma.
IV. O processo de replicao possui uma nica origem.
As caractersticas I, II, III e IV esto associadas, respectivamente, aos organismos
indicados em:
a) eucariotos eucariotos procariotos eucariotos
b) eucariotos procariotos eucariotos procariotos
c) procariotos eucariotos procariotos procariotos
d) procariotos procariotos eucariotos procariotos
6. (Uerj 2014) Clulas-tronco so clulas no especializadas que tm potencial de
diferenciao, ou seja, em condies favorveis, so capazes de gerar clulas
especializadas e de diferentes tecidos.
Para que essa diferenciao ocorra, as clulas-tronco tm de alterar
necessariamente o seguinte padro do seu metabolismo:
a) expresso gnica
b) nmero de cromossomos
c) quantidade de mitocndrias
d) atividade dos fosfolipdios da membrana
7. (Ufg 2013) Os nucleotdeos so constitudos por uma molcula de desoxirribose
(D), uma molcula de cido fosfrico (P) e uma base nitrogenada (adenina, guanina,
timina ou citosina). A ligao entre os nucleotdeos ocorre pela interao entre as
bases nitrogenadas especficas, resultando em uma molcula ordenada e bem
definida, o DNA. De acordo com essas informaes, a estrutura plana que
representa um fragmento de DNA e o tipo de ligao qumica responsvel pela
interao entre as bases nitrogenadas so, respectivamente,

a)

b)

c)

d)

e)
8. (Uerj 2013) A mutao no DNA de uma clula eucariota acarretou a substituio,
no RNA mensageiro de uma protena, da 15 base nitrogenada por uma base C.
A disposio de bases da poro inicial do RNA mensageiro da clula, antes de sua
mutao, apresentada a seguir:
incio da traduo

AUGCUUCUCAUCUUUUUAGCU...
Observe os cdons correspondentes a alguns aminocidos:

Aminocido
codificado

Cdon

fenilalanina

UUU

fenilalanina

UUC

leucina

UUA

leucina

UUG

leucina

CUC

metionina

AUG

valina

GUU

valina

GUA

Sabe-se que o cdon de iniciao de leitura AUG.


A probabilidade de que a protena a ser traduzida pelo RNA mensageiro da clula
que sofreu mutao no apresente alteraes na disposio de seus aminocidos
de:
a) 0
b) 0,25
c) 0,50
d) 1,00
e)

9. (Ufg 2013) Observe a sequncia de bases nitrogenadas de um fragmento de


DNA apresentado a seguir.
TACAAGGTTCTTTGACTATAATTAGCATTC
A sequncia resultante da transcrio deste fragmento composta de
a) 30% de timina.
b) 40% de timina.
c) 60% de timina.
d) 30% de uracila.
e) 40% de uracila.
10. (Ufg 2013) A figura a seguir esquematiza as duas etapas envolvidas no
processo de sntese proteica em um linfcito B.

Com base nestas informaes, responda:


a) Como se denominam as etapas 01 e 02, respectivamente?
b) Aps uma imunizao ativa, como ocorre a ao do produto final desse processo?
11. (Ufsj 2012) Em um experimento laboratorial, fez-se a anlise da composio de
nucleotdeos do cido nucleico que constitui o material gentico de quatro organismos
hipotticos. Os resultados da anlise esto descritos na tabela abaixo.
Organismo
A
B
C
D

adenina
23,3
17,3
27,5
18,5

% de nucleotdeos
guanina
timina
citosina
26,7
23,5
26,5
40,5
28,2
14,4
14,3
0
35,5
31,5
18,3
31,7

uracila
0
0
22,7
0

Com base nesses resultados, CORRETO afirmar que


a) os organismos A, B e D possuem DNA e RNA.
b) o DNA dos organismos A e D possui duas cadeias polinucleotdicas
complementares (dupla hlice).
c) o DNA do organismo C possui uma cadeia polinucleotdica simples.
d) os cidos nucleicos dos organismos B e C so de cadeias polinucleotdicas
simples.
12. (Ufg 2012) Os esquemas I e II abaixo mostram as etapas da expresso gnica em dois
organismos distintos, um procarioto e um eucarioto.
a) Indique, com justificativa, qual esquema se refere ao eucarioto. Em qual ou quais
compartimentos celulares ocorrem as etapas indicadas por 1 e 2 no esquema I, e as etapas
3 e 5 do esquema II?
b) A remoo diferencial de ntrons do RNA mensageiro pode resultar na produo
de diferentes peptdeos. Qual das etapas indicadas nos esquemas corresponde ao
processo de remoo de ntrons? Explique por que a remoo diferencial de
introns pode acarretar a produo de diferentes peptdeos.

Gabarito:
Resposta da questo 1:
[C]
[Resposta do ponto de vista da disciplina de Qumica]
As pontes ou ligaes de hidrognio so ligaes fortes, estabelecidas entre
hidrognio e flor, oxignio e nitrognio, isso evita que a gua tenha variaes
extremas de temperatura.
[Resposta do ponto de vista da disciplina de Biologia]
O pareamento correto entre as bases nitrogenadas do DNA, bem como o controle de
variaes extremas de temperatura na gua, ocorre por meio de ligaes de
hidrognio.
Resposta da questo 2:
[D]
O segmento do gene que codifica a sequncia de aminocidos serina, asparagina e
glutamina apresenta a seguinte sequncia de bases nitrogenadas:
T C A T T A G T C.

Resposta da questo 3:
ANULADA
Questo anulada no gabarito oficial.
Comentrio: No se conhece o nmero exato de bases nitrogenadas do RNAm em
questo. Logo, o clculo torna-se impossvel.
Resposta da questo 4:
[A]
A figura representa a molcula de DNA e a seta aponta o emparelhamento das
bases nitrogenadas feito por ligaes de hidrognio.
Resposta da questo 5:
[C]
[I], [III] e [IV] so fenmenos gnicos que ocorrem em clulas procariticas, como
bactrias e cianobactrias. Os ntrons correspondem aos trechos no codificantes
do DNA e ocorrem, normalmente, em clulas eucariticas, as quais so verificados
em proctistas, fungos, plantas e animais.
Resposta da questo 6:
[A]
A diferenciao celular ocorre a partir da expresso diferencial de seus genes.
Resposta da questo 7:
[A]
No DNA, a estrutura plana revela o pareamento de adenina (A) com timina, (T) e de
guanina (G) com citosina (C). As interaes que unem as duas cadeias
polinucleotdicas so pontes de hidrognio.
Resposta da questo 8:

[D]
A substituio da base U (uracila) pela base C (citosina) no quinto cdon muda a
sequncia UUU para UUC. Devido degenerao do cdigo gentico, o aminocido
codificado ser o mesmo. Portanto, a probabilidade de que no ocorra alterao nos
aminocidos da protena codificada ser igual a 1.
Resposta da questo 9:
[D]
O RNA mensageiro transcrito apresentar a sequncia
AUGUUCCAAGAAACUGAUAUUAAUCGUAAG e 30 nucleotdeos, dos quais nove so
uracila nucleotdeos. Portanto, o segmento de RNAm possui 30% de uracila.
Resposta da questo 10:
a) Etapa 01: transcrio; etapa 02: traduo.
b) A imunizao ativa estimula os linfcitos B produo de anticorpos (produto
final), molculas proteicas capazes de se ligarem ao antgeno, inativando-o e
tornando-o mais fcil de ser fagocitado por macrfagos, neutrfilos e eosinfilos
(clulas de defesa).
Resposta da questo 11:
[B]
O DNA dos organismos A e D possui duas cadeias polinucleotdicas complementares
porque nos dois casos a relao A+G/T+C igual a 1.
Resposta da questo 12:
a) O esquema II refere-se a um organismo eucarioto. Nos procariotos (esquema I)
o genoma no contm ntrons. Nos organismos procariotos a transcrio (1) e a
traduo (2) ocorrem simultaneamente no citoplasma celular. Em eucariotos, a
transcrio (3) ocorre no ncleo e a traduo (5) se passa no citoplasma.
b) A remoo diferencial dos ntrons ocorre na etapa 4. O agrupamento alternativo
dos ntrons (regies codificantes) pode dar origem a diferentes tipos de RNAs
mensageiros que sero traduzidos em peptdeos distintos.