You are on page 1of 7

Human Immunology xxx (2016) xxxxxx

Contents lists available at ScienceDirect

www.ashi-hla.org

journal homepage: www.elsevier.com/locate/humimm

Validation of a novel real-time PCR assay for detection of HLA-B*15:02


allele for prevention of carbamazepine Induced Stevens-Johnson
syndrome/Toxic Epidermal Necrolysis in individuals of Asian ancestry
Dinh Van Nguyen a,b,c,, Christopher Vidal a,, Hieu Chi Chu d, Nga Thi Quynh Do e, Tu Thi Linh Tran f,
Huong Thi Minh Le g, Richard B. Fulton a, Jamma Li a,h, Suran L. Fernando a,b,h
a
ImmunoRheumatology Laboratory, Pathology North-Sydney, St Leonards, Australia
b
Sydney Medical School Northern, University of Sydney, Sydney, Australia
c
Department of Allergy and Clinical Immunology, Hanoi Medical University, Hanoi, Viet Nam
d
Center of Allergology and Clinical Immunology, Bach Mai Hospital, Hanoi, Viet Nam
e
Department of Immunology and Molecular Biology, National Institute of Hygiene and Epidemiology, Hanoi, Viet Nam
f
Hanoi Heart Hospital, Hanoi, Viet Nam
g
Department of Allergy, Immunology and Rheumatology, National Hospital of Pediatrics, Hanoi, Viet Nam
h
Department of Clinical Immunology and Allergy, Royal North Shore Hospital, Sydney, Australia

a r t i c l e i n f o a b s t r a c t

Article history: Objectives: Screening for the HLA-B*15:02 allele has been recommended to prevent carbamazepine (CBZ)
Received 9 June 2016 induced Stevens-Johnson syndrome (SJS) and Toxic Epidermal Necrolysis (TEN) in individuals with
Revised 11 August 2016 Asian ancestry. We aimed, therefore, to develop and validate a robust and inexpensive method for detec-
Accepted 16 August 2016
tion of the HLA-B*15:02 allele.
Available online xxxx
Methods: Real-time PCR using TaqMan probes followed by SYBR Green was used to detect the HLA-
B*15:02 allele prior to treatment with CBZ therapy.
Keywords:
Results: A total of 121 samples were tested. The assay has a sensitivity of 100% (95% CI: 76.84100.0%), a
Carbamazepine hypersensitivity
HLA-B antigens
specificity of 100% (95% CI: 96.61100%), a positive predictive value of 100% (95% CI: 76.84100%) and a
Real-time polymerase chain reaction negative predictive value of 100.0% (95% CI: 96.61100.0%), respectively. There was 100% agreement
Stevens Johnson syndrome between our results and genotyping using Luminex SSO/SBT/SSP. The lowest limit of detection of the
Toxic Epidermal Necrolysis TaqMan probe is 0.05 ng/ll and the SYBR Green is 0.5 ng/ll of DNA. The unit cost of using the
Severe cutaneous adverse reactions TaqMan probe followed by SYBR Green is only $4.7 USD.
SCARs Conclusion: We developed a novel assay for the detection of the HLA-B*15:02 allele, which is robust,
inexpensive and suitable for screening individuals of Asian ancestry in the prevention of CBZ-induced
SJS/TEN.
2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights
reserved.

1. Introduction can cause a variety of hypersensitivity reactions in 510% of indi-


viduals treated. The most serious of these are severe cutaneous
Carbamazepine (CBZ) is classified as an aromatic amino- adverse reactions (SCARs), such as Stevens-Johnson syndrome
anticonvulsant. It has been in use since 1965 and is commonly pre- (SJS) and Toxic Epidermal Necrolysis (TEN) which have been
scribed for multiple indications such as epilepsy, mental health observed to be most prevalent in Asian populations. SJS/TEN cause
disorders and neuropathic pain [1,2]. This medication, however, significant mortality (1050%) and morbidity (60%) with severe
ocular complications, alopecia, mucosal alteration of the gastroin-
testinal and respiratory tracts, and psychological sequelae [3].
Corresponding author at: Sydney Medical School Northern, University of The HLA-B*15:02 allele appears to be the major genetic suscep-
Sydney, Sydney, Australia (D. Van Nguyen). ImmunoRheumatology Laboratory, tibility factor for CBZ-induced SJS/TEN. A strong genetic association
Pathology North-Northern Sydney, RNSH, St Leonards, NSW 2065, Australia was detected in a cohort of Han Chinese in Taiwan where HLA-
(C. Vidal).
B*15:02 allele was found in 100% of 44 patients with CBZ-SJS/
E-mail addresses: vngu3162@uni.sydney.edu.au (D.V. Nguyen), christophervid@
gmail.com (C. Vidal).
TEN patients (OR: 2504 [95% CI: 126-49552]) [4]. These findings

http://dx.doi.org/10.1016/j.humimm.2016.08.010
0198-8859/ 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Please cite this article in press as: D.V. Nguyen et al., Validation of a novel real-time PCR assay for detection of HLA-B*15:02 allele for prevention of car-
bamazepine Induced Stevens-Johnson syndrome/Toxic Epidermal Necrolysis in individuals of Asian ancestry, Hum. Immunol. (2016), http://dx.doi.org/
10.1016/j.humimm.2016.08.010
2 D.V. Nguyen et al. / Human Immunology xxx (2016) xxxxxx

have been replicated in an extended cohort of subjects of Chinese assess the correlation between two methods, with a power of
descent from various geographic areas of China [58], Taiwan [9], 80% (<alpha> = 0.05; <beta> = 0.20, at least 9 positive individuals
Hong Kong [10], Thailand [11,12], India [13], Malaysia [14], Singa- within the group of participants are needed, if the anticipated
pore [15] and Vietnam [16]. correlation coefficient is 0.8. The sample size needed to calculate
A weak association between CBZ-induced SJS/TEN and HLA- the positive and negative predictive values as described by Hanley
A*31:01 has been reported in a meta-analysis by Genin et al. et al. [27], using the receiver operating characteristic (ROC) curve,
[17], with a pooled OR of 3.94 (95% CI: 1.4-11.5), however, this consists of 9 positive cases and 81 negatives, for a power of 80%
association has been mainly observed in Caucasians [1719]and (<alpha> = 0.05; <beta> = 0.20, Area under ROC curve is 0.8, null
Japanese [20]. hypothesis value is 0.5, ratio of negative/positive is 9). The
In order to reduce the mortality and morbidity due to SJS/TEN estimated prevalence of HLA-B*15:02 positive samples is approxi-
caused by CBZ, in 2007, the Food and Drug Administration (FDA) mately 10%. Thus the total number of DNA samples needed for the
[21] recommended that physicians screen patients of Asian validation of the new methodology is at least 90, including 9
backgrounds for HLA-B*15:02 prior to prescribing CBZ. In 2011, positive samples. Peripheral blood (3 ml) was collected into EDTA
Chen et al. [22] screened 4877 patients for HLA-B*15:02 prior to anti-coagulated tubes. Participants completed an informed consent
commencing CBZ. Based upon the historical prevalence of CBZ- which was approved by both the Northern Sydney Local Health
induced SJS/TEN in Taiwan, their results indicated that approxi- District HREC, St Leonards, NSW, Australia (HREC/15/HAWKE/86)
mately 10 cases of SJS/TEN were prevented by screening. and Bach Mai Hospital, Hanoi, Vietnam.
In order to be applied in routine clinical practice, a screening
assay has to be simple, rapid and inexpensive [23]. In this consid-
eration, there has been a number of proposed methods that are 2.2. DNA extraction
potentially used for HLA screening prior to treatment with CBZ.
However, these approaches still have some limitations incompati- Genomic DNA was extracted from peripheral blood leucocytes
ble with a screening test. In 2009, Cheng et al. [24] introduced a using AccPrep Genomic DNA extraction kit (Bioneer Corp, Korea).
new technique for detection of the HLA-B*1502 allele using DNA concentration and purity were measured using NanoPho-
loop-mediated isothermal amplification (LAMP). This approach tometerTM, and the average DNA concentration was approximately
has some advantages such as low cost and visibility to the naked 46 ng/ll and A260/280 ratio was over 1.7.
eye. However, as being very sensitive, cross-contamination from High resolution HLA-B typing using LuminexSSO/SBT/SSP was
sample to sample could occur in LAMP [25], increasing the risk performed blindly on each sample at the New South Wales
for false positive results. In 2012, Virakul et al. [26] reported a Transplantation and Immunogenetics Service (Australian Red Cross
method using nested PCR to detect HLA-B*15:02 that can be imple- Blood Service).
mented in clinical practice. However, the major drawback of this
method is the high risk of cross-contamination between samples
in the second PCR due to high concentration of PCR products. 2.3. Real-time PCR with Taqman probe
Currently, a commercially available kit (PG1502 Detection kit,
Pharmigene Inc, Taiwan) using real-time PCR with SYBR Green Using the Immunogenetics project HLA database (IMGT) [28],
has been widely employed as a screening test. This kit is, however, we compared the HLA-B*15:02 genomic sequence (IMGT/HLA
quite expensive ($15 USD/test) and developing countries such as Acc no: HLA00165) with other HLA-B allele sequences to identify
Vietnam could not afford to implement the screening test nation- a hyperpolymophic region which can be targeted to specifically
wide to prevent CBZ-induced SJS/TEN. Another minor disadvantage amplify the HLA-B*15:02 allele while eliminating the rest of the
of the kit is that the PCRs for target gene and control are performed HLA-B alleles (Fig. 1). A set of oligonucleotide primers and probe
separately. This approach is not ideal for avoiding potential false were designed using IDTs PrimerQuest incorporates Primer3 soft-
negative results. Finally, the FastGel kit requires more than 25 ng ware [29,30] (version 2.2.3) (Integrated DNA Technologies, Inc),
DNA/reaction, making it difficult to perform PCR on genomic yielding a 76 bp amplicon (Table 1). The sequence of the forward
DNA extracted from low DNA yielding samples such as buccal primer (B15:02-F-Primer) is 50 -GGGCCGGAGTATTGGGA-30 , the
swabs. More recently, in May, 2016, Jaruthamsophon et al. [25] reverse primer (B15:02-R-Primer) is 50 -GGTTCCGCAGGCTCTCT-30
proposed a new in house based, 2 step technique using allele and the probe labelled with FAM (6-corboxylfluorescein) is 50 -CG
specific PCR (AS-PCR) followed by direct dot blot hybridization GAACACACAGATCTCCAA-30 . A set of primers and probe amplifying
(DDB). Although this approach is inexpensive, time consumption the housekeeping gene actin (ACTB) was also designed using the
is a major limitation of this method in clinical screening for above mentioned software, yielding a 107 bp amplicon. The
HLA-B*15:02. sequences of primers and probe are ACTB-F 50 -CTG TGC TGT GGA
In view of all this, we developed a robust and inexpensive test AGC TAA GT-30 , ACTB-R 50 -GAT GTC CAC GTC ACA CTT CA-30 and
using real- time PCR to detect individuals carrying HLA-B*15:02 HEX (6-carboxy-20 -4-40 -50 -7-70 -hexachlorofluorescein) labelled
suitable for use in the prevention of SJS/TEN caused by CBZ in those probe 50 -ATG CCT GAG AGG GAA ATG AGG GC-30 , respectively.
of Asian ancestry. All primers and probes were synthesized by Geneworks
(Geneworks Pty Ltd, South Australia).
The optimal multiplex PCR was performed in a total volume of
2. Materials and methods 20 ll, containing input DNA and PCR mixture (10 ll of SsoFastTM
Probes Supermix, 50 pmol of ACTB primer; 5 pmol of ACTB probe;
2.1. DNA Samples 100 pmol of HLA-B*15:02 primer, 10 pmol of ll HLA-B*15:02
probe and PCR water). The PCRs were performed in Rotor-
A group of samples for optimization and validation (n = 121, Gene-Q Cycler (Qiagen, Hilden, Germany) under the optimal profil-
including 14 HLA-B*15:02 positive samples) was randomly col- ing conditions: initial hot-start 95 C for 3 min followed by 40
lected from those submitted for testing to ImmunoRheumatology cycles of 96 C for 15 s, 65 C for 60 s and 72 C for 30 s. A series
Department, Pathology North, Royal North Shore Hospital, Sydney, of four ten-fold dilutions ranging from 50 to 0.05 ng/ll was pre-
Australia (101 samples) and from Vietnamese individuals in pared to evaluate the efficiency and the lowest limit of detection
Sydney and Vietnam (20 samples). Power analysis shows that to of the multiplex real-time PCR with the TaqMan probe.
Please cite this article in press as: D.V. Nguyen et al., Validation of a novel real-time PCR assay for detection of HLA-B*15:02 allele for prevention of car-
bamazepine Induced Stevens-Johnson syndrome/Toxic Epidermal Necrolysis in individuals of Asian ancestry, Hum. Immunol. (2016), http://dx.doi.org/
10.1016/j.humimm.2016.08.010
D.V. Nguyen et al. / Human Immunology xxx (2016) xxxxxx 3

Fig. 1. Binding sites of the set of primers and comparison of the different allele sequences of the target region. Note: Numbered nucleotide positions as per IMGT/HLA
accession number HLA00165 [28]. The HLA-B*15:02:01 sequence is aligned against the selected alleles that can generate false positive results with both PCRs and against
other frequent alleles in the Asian population. The latter includes HLA-B*46:01, which is highly frequent (11.5%) in the Vietnamese population [35]. This described method
should ensure the elimination of common false positive results method. The primers and probe targeted regions within exon 2 and 3 harbouring hypervariable
polymorphisms. More importantly, the probe binds at the polymorphic region allowing the first real-time PCR with TaqMan Probe amplifies only HLA-B*15:02 and HLA-
B*18, whilst eliminating the rest of the HLA-B alleles. The second PCR with a specific set of primers does not amplify HLA-B*18 by 2 mismatches at 30 prime end of the forward
primer (C and A) and 3 mismatches at 30 prime end of the forward primer (C, A and T).

Table 1
Specific primers and TaqMan probe for detection of HLA-B*15:02.

Name Target gene Sequences (50 -30 ) Amplicon (bps) Tm* (C) Potential amplification
B*15:02 F-Primer HLA-B*15:02 GGGCCGGAGTATTGGGA 76 79.8 HLA-B*18
B*15:02 FAM-Probe CGGAACACACAGATCTCCAA
B*15:02 R-Primer GGTTCCGCAGGCTCTCT
B*15:02 F-SBYR HLA-B*15:02 CGCGAGTCCGAGGATGGC 423 91.6 HLA-B*13:01; 15:13; 15:25; 15:36
B*15:02 R-SBYR GCCATACATCCTCTG GAT
ACTB F-Primer ACTB GATGTCCACGTCACACTT CA 107 81.4 None
ACTB HEX-Probe ATG CCT GAG AGG GAA ATG AGG GC
ACTB R-Primer ATGCCTGAG AGGGAAATG AGGGC
*
Using oligo calculator to estimate the theoretical Tm of PCR products.

2.4. Real-time PCR with SYBR Green 20 pmol of ACTB primers and PCR water). PCRs were performed
in a Rotor-Gene-Q cycler (Qiagen, Hilden, Germany) under the fol-
A set of specific primers to amplify the HLA-B*15:02 allele used lowing optimal conditions: initial hot-start 95 C for 3 min fol-
for the second real-time PCR with SYBR Green was previously lowed by 40 cycles of 96 C for 15 s, 63 C for 15 s and 72 C for
reported by Yu et al. [31]. The forward primer (B1502-F-SYBR) tar- 60 s. The lowest limit of detection of multiplex PCR was deter-
gets exon 2 with the sequence of 50 -CGC GAG TCC GAG GAT GGC-30 , mined by running in different concentrations of DNA (Supplemen-
and the reverse primer (B1502 R-SYBR) targets exon 3 with the tary data 1).
sequence of 50 -GCC-ATA-CAT-CCT-CTG-GAT-30 . The amplicon is
423 bps and melting temperature (Tm) at 91.6 C. The same set
of primers used in the TaqMan probe master mix was also used 2.5. Data analysis
for the SYBR PCR. The Tm of amplicon is 81.4 C. To calculate reac-
tion efficiencies, the singleplex PCRs for HLA-B*15:02 and ACTB Raw PCR data were analysed using Rotor-Gene v6 software
were performed in a series of five ten-fold dilutions ranging from (Qiagen, Hilden, Germany). Analyses for sensitivity, specificity,
50 to 0.005 ng/ll. The optimal annealing temperature for both sets positive predictive value (PPV) and negative predictive value
of primers is 63 C. The PCR products were confirmed by elec- (NPV) were performed using MedCalc v12.7.0.0. A Cohens Kappa
trophoresis on 1.2% agarose gel (FlashGel Cassette-Lonza, USA) for measuring agreement between our assay and the Luminex
and by direct DNA sequencing using BigDye terminators v3.1 SSO/SBT/SSB genotyping was analysed using SPSS software version
(Applied Biosystems). 22 (Chicago, USA).
A multiplex PCR was performed in a total volume of 25 ll, con- Direct sequencing data obtained from Applied Biosystems 3130
sisting of genomic DNA and PCR master mix (12.5 ll of SensiMixTM- Genetic Analyser were analysed using Chromas software 2.5.0
SYBR No-ROX Kit, 35 pmol of HLA-B*15:02-specific primers, (Applied Biosystems).
Please cite this article in press as: D.V. Nguyen et al., Validation of a novel real-time PCR assay for detection of HLA-B*15:02 allele for prevention of car-
bamazepine Induced Stevens-Johnson syndrome/Toxic Epidermal Necrolysis in individuals of Asian ancestry, Hum. Immunol. (2016), http://dx.doi.org/
10.1016/j.humimm.2016.08.010
4 D.V. Nguyen et al. / Human Immunology xxx (2016) xxxxxx

3. Results and ACTB primers concentrations were also tested. The best ratio
observed was 0.35:0.20 by comparing dissociation curves. The dis-
3.1. Optimization of real-time PCR with TaqMan probe sociation curve was used to determine HLA-B*15:02 and ACTB
with Tm of 91.4 C and 81.4 C, respectively (Table 1). The thresh-
For the optimization stage, we performed testing on positive old for these curves was set at 0.45 to reduce the chance of a false
controls with the HLA-B*15:02 allele and a negative control to negative result (Fig. 3). The assay was able to detect the target allele
identify an annealing temperature for each set of primers and a in a DNA sample with a concentration as low as 0.5 ng/ll of DNA.
probe for the target and reference genes, respectively. The optimal Total time for this PCR is 128 min.
annealing temperature for HLA-B*15:02 primers and probe was
65 C. The best ratio of final concentrations of primers to probe
in the reaction was 10:1. In order to optimize a multiplex PCR reac- 3.3. Results of validation
tion, different ratios of primers and probe concentrations were
tested. The best results were observed when the concentration of The total number of 121 samples was tested using the method
ACTB primers and probe were half those of HLA-B*15:02 (for of two PCRs (Fig. 3). After the first step, we detected 27 positive
HLA-B*15:02: efficiency: 92%; R2: 0.993; slope: 3.53; lowest Ct: samples by using the first real-time PCR with the Taqman Probe
23.6; highest Ct: 34.5, threshold: 0.02. For ACTB: efficiency: 91%, Ct = 24.08 0.41 (Mean Standard Error of Mean). The average Ct
slope: 3.53; lowest Ct: 21.28; highest Ct: 32.04; threshold: of all samples for ACTB was 22.82 0.21. In the second step, the
0.02) (Fig. 3). The lowest limit of detection is 0.05 ng/lL. Total time positive group was tested by real- time with SYBR Green and only
for this PCR is 110 min. 14 samples carrying HLA-B*15:02 were detected with two peaks of
Tm at 91.31 0.02 C (Mean Standard Error of Mean) (HLA-
B*15:02 allele) and 80.85 0.04 (ACTB). The 13 negative samples
3.2. Optimization of real-time PCR with SYBR Green showed only one peak for ACTB (81.31 0.04 C) (Fig. 3). No false
positives or false negatives were observed. When compared with
For the optimization stage, the best annealing temperature was the results of using the Luminex SSO/SBT/SSP, the first PCR gave
63 C for both HLA-B*15:02 primers (efficiency: 99%; R2: 0.99; 13 false positive samples with genotype of HLA-B*18. No false pos-
slope: 3.34; threshold: 0.02) and ACTB primers (efficiency: 90%, itive was observed after the second PCR.
R2: 0.99; slope: 3.58; threshold: 0.02) (Fig. 2). To optimize the The final result has perfect agreement (k = 1, p < 0.0001) with
multiplex PCR using SYBR green, different ratios of HLA-B*15:02 Luminex SSO/SBT/SSP. The combined assay has a sensitivity of

Fig. 2. Standard curves of real-time PCR with TaqMan probe and real-time PCR with SYBR Green.
Please cite this article in press as: D.V. Nguyen et al., Validation of a novel real-time PCR assay for detection of HLA-B*15:02 allele for prevention of car-
bamazepine Induced Stevens-Johnson syndrome/Toxic Epidermal Necrolysis in individuals of Asian ancestry, Hum. Immunol. (2016), http://dx.doi.org/
10.1016/j.humimm.2016.08.010
D.V. Nguyen et al. / Human Immunology xxx (2016) xxxxxx 5

Fig. 4. The diagram and results of validation progress.

method can be used for the development of a screening test with


the aim of preventing CBZ-induced SJS/TEN in susceptible individ-
uals of Asian ancestry.
When compared with Luminex SSO/SBT/SSP, which is currently
used for tissue typing, our PCR using the TaqMan probe success-
fully detected a number of HLA-B*15:02 positive individuals with
an assay sensitivity of 100% (95% CI: 76.84100.0%). Importantly,
we did not observe any false negative results with negative predic-
Fig. 3. Detection HLA-B*15:02. Note: (A) Detection HLA-B*15:02 using TaqMan
tive value of 100.0% (95% CI: 96.15100.0%). The HLA-B*18 allele,
Probe (Ct at threshold = 0.02). (B) Detection HLA-B*15:02 using dissociation curves
(melting curves). however, was also amplified. Using the second PCR (SYBR), only
HLA-B*15:02 samples were detected and none of the HLA-B*18
alleles were amplified. Ideally, the second PCR should be per-
100% (95% CI: 76.84100.0%), specificity of 100 % (95% CI: 96.61 formed to eliminate any false positive samples for HLA-B*18. In a
100%), PPV of 100% (95% CI: 76.84100%) and NPV of 100.0% population with a very low prevalence of HLA-B*18 (Table 2,
(95% CI: 96.61100.0%), respectively. Fig. 4) [32], however, the second real-time PCR might not be nec-
In the panel of 107 samples negative for HLA-B*15:02 after two essary because the possibility of very rarely occurring false posi-
PCRs, there are 30 different HLA allele groups identified by Lumi- tives would be acceptable for screening purposes and its
nex SSO/SBT/SSP. No false negative results were detected in this omission would reduce the cost and the time taken to perform
group (Supplementary data 2). the test.
Our method, using multiplex real-time PCR, has some technical
advantages when compared with the commercially available test-
4. Discussion ing kit (PG1502 Detection kit, Pharmigene Inc, Taiwan) and other
methodologies (nested PCR, AS-PCR with DDB). Multiplexing is
This paper demonstrates the development of a robust and inex- also an optimal way of reducing the incidence of a false negative
pensive method for the detection of HLA-B*15:02 allele, combining result due to low DNA quality or the presence of potential PCR inhi-
realtime PCR with TaqMan probe followed by SYBR Green. This bitors. Furthermore, it is more likely to be accurate and robust in

Table 2
Frequency of HLA-B*15:02 and HLA-B*18 in Asian populations.

No. Population HLA-B*15:02 allele HLA-B*18 allele References


1 Vietnam 0.13500.1385 0.0100 Allele frequency net 2015 update
2 China Up to 0.3580 <0.0900* (http://www.allelefrequency.net) [32]
3 Hong Kong 0.1020 0.0010**
4 Taiwan Up to 0.1800 <0.0090
5 Singapore Up to 0.1160 0.0100***
6 Thailand 0.08200.0850 0.03900.0800
7 Malaysia Up to 0.1710 0.02000.1600****
8 India 0.0010-0.0600 <0.0630
*
In China, subpopulations with the frequency of HLA-B*18:01 higher than 0.001 are China Southwest Dai (0.0160; sample size is 124), China Shanxi (0.0230; sample size is
22) and China Uyghur (0.0260, sample size is 19). The rest has less than 0.0090 of HLA-B*18.
**
The frequency refers to selected alleles.
***
The frequency of HLA-B*18 allele is less than 0.010 in Chinese Singaporeans and 0.099 only in Malaysian Singaporeans, respectively.
****
The frequency of HLA-B*18 allele is 0.280 in Malaysia Perak Grik Jehai (sample size is 25).

Please cite this article in press as: D.V. Nguyen et al., Validation of a novel real-time PCR assay for detection of HLA-B*15:02 allele for prevention of car-
bamazepine Induced Stevens-Johnson syndrome/Toxic Epidermal Necrolysis in individuals of Asian ancestry, Hum. Immunol. (2016), http://dx.doi.org/
10.1016/j.humimm.2016.08.010
6 D.V. Nguyen et al. / Human Immunology xxx (2016) xxxxxx

Table 3
Comparing the present method using TaqMan probe with other current screening methods in Asians.

Properties of method Nested PCR LAMP method Commercial kit* AS-PCR and DDB TaqMan probe followed by SYBR
[26] [24] [25] (Our method)
Time consumption Estimated assay 240 min 45 min Approximately 300 min 110 min and 128 min
time 80 min
Time for result 35 min (loading 1 min Time for DCt 30 min (loading 0 min
on gel) calculation or on gel)
loading on gel
Total time 275 min 46 min N/A 330 min 238 min
Cost Estimated cost of $6.5 USD $3.8 USD $15 USD $7 USD $4.7 USD**
reaction unit
Robustness Sensitivity 100% 100% N/A 100% 100%
Lowest limit of N/A N/A 25 ng/reaction N/A 0.05 ng/ll (TaqMan Probe) 0.5 ng/ll
detection (DNA (for SYBR)
concentration)
False positive alleles Rare alleles in Heterozygote of Some (less than HLA-B*15:31 and Heterozygote of HLA-B*18 with any
detected in method HLA-B*15 HLA-B*15:25 and 1% frequent) rare alleles in alleles such as HLA-B*13:01; 15:13;
group B*15:15 alleles HLA-B*15 group 15:25; 15:36

SBT: Sequence based-typing; SSO: Sequence-specific oligonucleotide; LAMP: Loop-mediated isothermal amplification; AS-PCR: Allele specific PCR; DDB: Direct dot blot
hybridization; NPV: Negative predictive value; N/A: not applicable.
*
PG1502 DNA Detection Kit Users Manual.
**
The cost of reaction unit was calculated by cost of DNA extracted kit, master mixes, oligos primers and fluorescent dyes.

the detection of the target PCR product using the melting curves One limitation of our assays is that both were validated using
rather than by calculating the delta Ct or by loading an agarose one commercially available master mix (SensiMixTM SYBR No-ROX
gel. Finally, our assay is robust and very sensitive in the detection Kit) and SSOFastTM Probes Supermix (Bio-RAD). Re-validation will
of the target allele in samples with very low DNA concentrations be needed if these kits are discontinued by suppliers. Re-
(0.5 ng DNA). By using 2 ll input DNA for each reaction, both PCRs validation of the assay will also be required prior to implementa-
are able to detect successfully the target allele at only 1 ng. This tion on other real-time PCR cyclers. Finally, another limitation
allows for DNA to be extracted from specimens obtained by non- common to any other existing molecular test for HLA is related
invasive methods such as buccal swabs, which can have a lower to the continuous need for sequence updates owing to the highly
yield of DNA. Buccal swabs have the advantages of being more por- polymorphic nature of the HLA-B gene. New polymorphisms that
table, less invasive and less likely to become infected, making them could be present in the primer binding sites of the assay could
suitable for DNA sample collection for HLA screening aimed at pre- result in allele drop-out. These problems were also reported by
venting drug hypersensitivity reactions [33]. Dello Russo et al. [34]. We also suggest that this assay should be
In comparison with current screening methods in terms of time re-validated before it is introduced for screening in other
and cost, our method seems to be appropriate for clinical applica- populations.
tion. We calculated the unit cost of our method, including DNA In conclusion, we developed and validated a rapid, robust and
extraction reagents, master mixes, oligos primers and probe inexpensive method to use for screening for the HLA-B*15:02 allele
labelled with fluorescent dyes. It costs only $4.7 USD/sample, being in the prevention of CBZ-induced SJS/TEN in susceptible Asian
cheaper than nested PCR, AS-PCR with DDB but slightly more populations.
expensive when compared to LAMP (Table 3). In consideration of
time, even though our method requires two PCRs (TaqMan probe
followed by SYBR), the total time taken of 238 min still makes it Funding sources
suitable for use in screening, as it will not influence significantly
the overall turnaround time. Our report is only addressing the time Pathology North Immunology Trust Fund for funding this pro-
taken for the test to be completed from the time it is received and ject and Australia Awards Scholarship for funding Dr. Dinh Van
accepted at the laboratory to the time the result is issued. This does Nguyen.
not take into account, however, other factors that determine the
overall turnaround time such as the time taken for the sample to
reach the laboratory or the time taken for the result to reach the Conflicts of interest
clinician after the lab issues the report. As shown in Table 3,
although our method is only longer second to LAMP both method- None.
ologies are suitable to be used as screening tests since results from
both methods can be obtained within a day after sample reception
and there is no need to wait for a couple of days or weeks to run Acknowledgements
the tests in batches.
In their original paper [31], the authors previously reported that We would like to acknowledge all the people that contributed
this set of specific primers used for SYBR can also amplify other or helped in any way to make this study possible. We would like
alleles such as HLA-B*15:13, B*15:20-21, B*15:25, B*15:36 and to thank Ms Anne Proos for the use of facilities at the Department
B*13:01. When testing 94 HLA-B*15:02 negative samples using of Molecular Genetics, Pathology North Sydney, RNSH, St Leonards.
SYBR Green, only the presence of HLA-B*15:25 and HLA- We would like to thank Doctor Nguyet Minh Nguyen, Ha Thi Thu
B*13:01 alleles resulted in a false positive result. Our assay then Nguyen, Hanh Hong Chu, Huyen Thanh Nguyen for collecting
can only give a false positive result in heterozygous individuals, DNA samples. We are also grateful to the Pathology North
who harbour the HLA-B*18 allele in combination with any of the Immunology Trust Fund for funding this project and the Australia
above mentioned HLA alleles. Awards Scholarship program for funding Dr Dinh Van Nguyen.
Please cite this article in press as: D.V. Nguyen et al., Validation of a novel real-time PCR assay for detection of HLA-B*15:02 allele for prevention of car-
bamazepine Induced Stevens-Johnson syndrome/Toxic Epidermal Necrolysis in individuals of Asian ancestry, Hum. Immunol. (2016), http://dx.doi.org/
10.1016/j.humimm.2016.08.010
D.V. Nguyen et al. / Human Immunology xxx (2016) xxxxxx 7

Appendix A. Supplementary data in paediatric neurology patients in Singapore, Arch. Dis. Child. 99 (6) (2014)
581584.
[16] D.V. Nguyen et al., HLA-B*1502 and carbamazepine-induced severe cutaneous
Supplementary data associated with this article can be found, in adverse drug reactions in Vietnamese, Asia Pac. Allergy 5 (2) (2015) 6877.
the online version, at http://dx.doi.org/10.1016/j.humimm.2016. [17] E. Genin et al., HLA-A*31:01 and different types of carbamazepine-induced
severe cutaneous adverse reactions: an international study and meta-analysis,
08.010.
Pharmacogenomics J. 14 (3) (2014) 281288.
[18] M. McCormack et al., HLA-A*3101 and carbamazepine-induced
References hypersensitivity reactions in Europeans, N. Engl. J. Med. 364 (12) (2011)
11341143.
[1] L.P. Hsieh, C.Y. Huang, Trends in the use of antiepileptic drugs in Taiwan from [19] U. Amstutz et al., HLA-A 31:01 and HLA-B 15:02 as genetic markers for
2003 to 2007: a population-based national health insurance study, Epilepsy carbamazepine hypersensitivity in children, Clin. Pharmacol. Ther. 94 (1)
Res. 96 (12) (2011) 8188. (2013) 142149.
[2] C.J. Landmark et al., Prescription patterns of antiepileptic drugs in patients [20] T. Ozeki et al., Genome-wide association study identifies HLA-A*3101 allele as
with epilepsy in a nation-wide population, Epilepsy Res. 95 (12) (2011) 51 a genetic risk factor for carbamazepine-induced cutaneous adverse drug
59. reactions in Japanese population, Hum. Mol. Genet. 20 (5) (2011) 10341041.
[3] J.C. Roujeau, R.S. Stern, Severe adverse cutaneous reactions to drugs, N. Engl. J. [21] P.B. Ferrell Jr., H.L. McLeod, Carbamazepine, HLA-B*1502 and risk of Stevens-
Med. 331 (19) (1994) 12721285. Johnson syndrome and toxic epidermal necrolysis: US FDA recommendations,
[4] W.H. Chung et al., Medical genetics: a marker for Stevens-Johnson syndrome, Pharmacogenomics 9 (10) (2008) 15431546.
Nature 428 (6982) (2004) 486. [22] P. Chen et al., Carbamazepine-induced toxic effects and HLA-B*1502 screening
[5] X.T. Wu et al., Association between carbamazepine-induced cutaneous adverse in Taiwan, N. Engl. J. Med. 364 (12) (2011) 11261133.
drug reactions and the HLA-B*1502 allele among patients in central China, [23] R. Pavlos, S. Mallal, E. Phillips, HLA and pharmacogenetics of drug
Epilepsy Behav. 19 (3) (2010) 405408. hypersensitivity, Pharmacogenomics 13 (11) (2012) 12851306.
[6] Q. Wang et al., Association between HLA-B*1502 allele and carbamazepine- [24] S.H. Cheng et al., New testing approach in HLA genotyping helps overcome
induced severe cutaneous adverse reactions in Han people of southern China barriers in effective clinical practice, Clin. Chem. 55 (8) (2009) 15681572.
mainland, Seizure 20 (6) (2011) 446448. [25] K. Jaruthamsophon et al., Comparison of a new in-house and three published
[7] Y. Zhang et al., Strong association between HLA-B*1502 and carbamazepine- HLA-B*15:02 screening methods for prevention of carbamazepine-induced
induced Stevens-Johnson syndrome and toxic epidermal necrolysis in severe drug reactions, PLoS One 11 (5) (2016) e0155907.
mainland Han Chinese patients, Eur. J. Clin. Pharmacol. 67 (9) (2011) 885887. [26] S. Virakul et al., A nested sequence-specific primer-polymerase chain reaction
[8] D. Sun et al., Association of HLA-B*1502 and *1511 allele with antiepileptic for the detection of HLA-B*15:02, Tissue Antigens 79 (4) (2012) 295301.
drug-induced Stevens-Johnson syndrome in central China, J. Huazhong Univ. [27] J.A. Hanley, B.J. McNeil, The meaning and use of the area under a receiver
Sci. Technol. Med. Sci. 34 (1) (2014) 146150. operating characteristic (ROC) curve, Radiology 143 (1) (1982) 2936.
[9] S.I. Hung et al., Genetic susceptibility to carbamazepine-induced cutaneous [28] J. Robinson et al., The IMGT/HLA database, Nucleic Acids Res. 41 (2013)
adverse drug reactions, Pharmacogenet. Genomics 16 (4) (2006) 297306. D1222D1227 (Database issue).
[10] P.K. Kwan, M.H. Ng, S.V. Lo, Association between HLA-B*15:02 allele and [29] T. Koressaar, M. Remm, Enhancements and modifications of primer design
antiepileptic drug-induced severe cutaneous reactions in Hong Kong Chinese: program Primer3, Bioinformatics 23 (10) (2007) 12891291.
a population-based study, Hong Kong Med. J. 20 (Suppl. 7) (2014) 1618. [30] A. Untergasser et al., Primer3-new capabilities and interfaces, Nucleic Acids
[11] C. Locharernkul et al., Carbamazepine and phenytoin induced Stevens-Johnson Res. 40 (15) (2012) e115.
syndrome is associated with HLA-B*1502 allele in Thai population, Epilepsia [31] N. Yu et al., Typing of HLA-B*15 alleles using sequence-specific primers, Tissue
49 (12) (2008) 20872091. Antigens 52 (3) (1998) 260269.
[12] W. Tassaneeyakul et al., Association between HLA-B*1502 and [32] F.F. Gonzalez-Galarza et al., Allele frequency net, Update: new features for HLA
carbamazepine-induced severe cutaneous adverse drug reactions in a Thai epitopes, KIR and disease and HLA adverse drug reaction associations, Nucleic
population, Epilepsia 51 (5) (2010) 926930. Acids Res. 43 (2015) D784D788 (Database issue).
[13] T.Y. Mehta et al., Association of HLA-B*1502 allele and carbamazepine-induced [33] C. Badulli et al., A new approach to safely type for HLA the HIV infected people
Stevens-Johnson syndrome among Indians, Indian J. Dermatol. Venereol. eligible to abacavir therapy: saliva or buccal swab as reliable DNA sources,
Leprol. 75 (6) (2009) 579582. Clin. Chim. Acta 412 (2122) (2011) 19951998.
[14] C.C. Chang et al., Association of HLA-B*1502 allele with carbamazepine- [34] C. Dello Russo et al., Detection of HLA-B*57:01 by real-time PCR:
induced toxic epidermal necrolysis and Stevens-Johnson syndrome in the implementation into routine clinical practice and additional validation data,
multi-ethnic Malaysian population, Int. J. Dermatol. 50 (2) (2011) 221224. Pharmacogenomics 15 (3) (2014) 319327.
[15] K.W. Chong et al., Association of carbamazepine-induced severe cutaneous [35] B.K. Hoa et al., HLA-A, -B, -C, -DRB1 and -DQB1 alleles and haplotypes in the
drug reactions and HLA-B*1502 allele status, and dose and treatment duration Kinh population in Vietnam, Tissue Antigens 71 (2) (2008) 127134.

Please cite this article in press as: D.V. Nguyen et al., Validation of a novel real-time PCR assay for detection of HLA-B*15:02 allele for prevention of car-
bamazepine Induced Stevens-Johnson syndrome/Toxic Epidermal Necrolysis in individuals of Asian ancestry, Hum. Immunol. (2016), http://dx.doi.org/
10.1016/j.humimm.2016.08.010