You are on page 1of 12

PEDIATRIC RESEARCH Vol. 55, No.

3, 2004
Hak Cipta 2004 International Pediatric Research Foundation, Inc.

Genotipe Null Gen Glutathione S Transferase Theta 1


(GSTT1) Berhubungan dengan Peningkatan Risiko
Anemia Aplastik Didapat pada Anak-Anak
Uta Dirksen, Kaveh Asadi Moghadam, Chinara Mambetova, Charlotte Esser,
Monika Fhrer, dan Stefan Burdach

ABSTRAK
Dua faktor utama yang terlibat dalam mekanisme yang mendasari pathogenesis
anemia aplastik didapat: faktor lingkungan dan kerentanan genetik. Kemampuan
individu bervariasi dalam memetabolisme agen perusak DNA dikarenakan
polimorfisme biotransforming enzyme. Genetik menentukan perbedaan pada
ekspresi enzim tersebut dapat menjelaskan risiko antar individu dalam
perkembangan anemia aplastik didapat. Tujuan studi ini adalah untuk
mengkarakteristikan polimorfisme genetik biotransforming enzim fase I (p450-
cyp2E1) dan fase II [microsomal epoxide hydrolase (mEh), glutathione
Stransferase (GST)] pada pasien anak dengan anemia aplastik didapat. Genotipe
GSTT1 null (ketiadaan kedua alel) berhubungan dengan peningkatan risiko
signifikan untuk anemia aplastik didapat (odds ratio, 2.8; confidence interval
95%, 0,15-5,7). Sebaliknya, genotipe GSTM1 null atau polimorfisme di dalam
gen p450-cyp2E1 dan mEh tidak berbeda secara signifikan pada pasien dan
kontrol. Analisis multivariat telah dilakukan untuk menilai apakah enzim
bersamaan dengan variabel lain seperti usia, jenis kelamin atau respon terhadap
terapi dapat memiliki hubungan yang signifikan dengan genotipe yang diujikan.
Pada tidak adanya kombinasi parameter tersebut terdapat hubungan yang
ditemukan pada anemia aplastik didapat. GST terlibat terutama dalam
metabolisme substrat hematotoksik dan mutagenik seperti derivat benzene.
Genotipe GSTT1 null dapat memodulasi metabolisme polutan eksogen atau toksik
eksogen secara langsung. Ketiadaan enzim GSTT1, yang menyebabkan
kerentanan genetik terhadap polutan tertentu dapat menentukan risiko individu
untuk perkembangan anemia aplastik didapat pada anak. (Pediatr Res 55: 466
471, 2004)

Daftar Singkatan
AA, acquired aplastic anemia
CYP, cytochrome p450
GST, glutathione S-transferase
MDS, myelodysplastic syndrome
mEh, microsomal epoxide hydrolase
NSAA, non-severe aplastic anemia
SAA, severe aplastic anemia
VSAA, very severe aplastic anemia

Ciri umum AA adalah kosongnya sumsum tulang dan pansitopenia pada


pembuluh darah perifer (1, 2). Walaupun terdapat banyak penyebab anemia
PEDIATRIC RESEARCH Vol. 55, No. 3, 2004
Hak Cipta 2004 International Pediatric Research Foundation, Inc.

aplastik, sebagian besar kasus masih idiopatik, mekanisme patogenik penyebab


penyakit mungkin terbatas pada dua jalur utama: faktor lingkungan (3, 4) dan
kerentanan genetik (5, 6). Faktor lingkungan meliputi infeksi virus (7, 8), paparan
radiasi (9), obat-obatan (10), dan bahan kimia (11-13). Hal tersebut dapat
menyebabkan kerusakan DNA pada tingkat progenitor hematopoietik (14) atau
menyebabkan aktivasi mekanisme imunologis autolog (15), yang juga
menyebabkan kerusakan pada tingkat progenitor hematopoietik (16-18). Akan
tetapi, riwayat paparan massif terhadap polutan lingkungan akan jarang dijelaskan
pada riwayat anak ras Kaukasia yang menderita AA. Individu memiliki variasi
dalam memetabolisme berbagai agen perusak DNA karena polimorfisme enzim
detoksifikasi. Variabilitas ekpresi atau efsiensi enzim tersebut dapat menjelaskan
risiko antar individu untuk mengebangkan anemia aplastik dengan adanya agen
lingkungan yang disebutkan di atas. Tiga biotransforming enzyme yang paling
penting, CYP isoenzyme, mEh, dan GST, menunjukkan polimorfisme genetik.
p450-cyp2E1 memetabolisme berbagai obat-obatan dan bahan kimia, dengan
preferensi molekul kecil seperti aldehid, keton, alkohol, dan komponen aromatik
(19). Sejumlah polimorfisme pada gen p450-cyp2E1telah dijelaskan (20), dengan
polimorfisme PstI/RsaI pada regio 5' flanking sebagai penjelasan terbaik (21).
Varian C2/C2 menyebabkan enhanced transcription gen (C2) p450-cyp2E1, yang
meningkatkan aktivitas enzim dibandingkan varian C1/C1 (21).

Diantara enzim fase II, mEh terlibat dalam first-pass metabolism epoxide
intermediet dan oksigen radikal yang sangat reaktif. Dua polimorfisme mEh
dengan spectrum substrat luas (22, 23) telah ditemukan berhubungan dengan
kerentanan terhadap beberapa penyakit ganas (24-26). Mutasi exon 3 titik T ke C
menghasilkan pertukaran posisi tirosin terhadap histidin pada posisi 113 (His
113), dengan penurunan aktivitas enzim 50% (alel lambat), dan transisi A ke G
menyebankan pertukaran histidin terhadap arginin pada posisi 139 (Arg 139),
dengan aktivitas enzim lebih cepat 25% (alel cepat) (27, 28).

GST mewakili kelompok enzim detoksifikasi xenobiotik (29, 30), dengan GSTM
(31-34), -T (35, 36), dan -P (37) sebagai polimorf. Genotipe null dikarakteristikan
sebagai ketiadaan protein respective GST (38). Genotipe GSTM1 null telah
ditunjukkan berhubungan dengan peningkatan risiko kanker yang diinduksi rokok
(39-41), kanker payudara (42), dan karsinoma hepatoseluler (43, 44). Genotipe
GSTT1 null telah ditunjukkan berhubungan dengan peningkatan risiko MDS (44-
46). Akan tetapi, studi lebih lanjut pada MDS menunjukkan hasil sebaliknya (44,
47-49).

Pada studi ini, kami menganalisis tiga enzim yang berbeda pada pasien AA
pediatrik. p450-cyp2E1, mEh, and GST (M1 dan T1) dipilih karena spesifisitas
substratnya, meliputi agen perusak DNA hematotoksik dan mutagenik seperti
komponen aromatik, oksigen radikal dan reaktif.

PASIEN DAN METODE


Pasien. Sebagian besar pasien yang menderita AA direkrut antara tahun 1996 san
tahun 1999 melalui studi multisenter koperatif pediatrik SAA-94, yang melibatkan
37 senter di Jerman dan Austria. Beberapa melakukan uji secara independen,
PEDIATRIC RESEARCH Vol. 55, No. 3, 2004
Hak Cipta 2004 International Pediatric Research Foundation, Inc.

karena diagnosisnya dimulai sebelum dilakukan studi. Diagnosis AA dilakukan


mengikuti kriteria Camitta dan dikonfirmasi dengan biopsi sumsum tulang.
Sebagian besar pasien menderita VSAA (polymorphonuclear cells <200/L) atau
SAA (polymorphonuclear cells <500/L). Tiga pasien telah ditandai memiliki
kelainan kromosom (+19, -7, +8) tanpa tanda morfologis acute myeloid leukemia
(AML) atau MDS. Pasien tidak memenuhi syarat jika menunjukkan tanda klinis
paroxysmal nocturnal hematuria, anemia Fanconi, MDS, atau congenital bone
marrow failure disorder, atau sedang menjalani radiasi, kemoterapi atau
pretreatment dengan antilymphocyte globulin, cyclosporine A, atau granulocyte
colony stimulating factor. Usia pasien berkisar antara 1 tahun dan 16 tahun
dengan usia media 9,6 tahun; 38 anak perempuan dan 53 anak laki-laki telah
dianalisi. Detail terkait pasien studi SAA-94, pengobatan dan hasilnya dijelaskan
oleh Fuhrer et al. (50). Protokol penelitian disetujui oleh komite etik Ludwig-
Maximilians University, Munich, dan Heinrich Heine University, Duesseldorf.
Kontrol nonrandom didapatkan dari donor stem cell pediatrik: empat orang
merupakan saudara pasien yang menderita tumor solid (satu neuroblastoma, dua
limfoma non Hodgkin, dan satu limfoma Hodgkin), empat orang merupakan
saudara pasien yang menderita X-linked berat dengan imunodefisiensi, satu orang
merupakan saudara pasien yang menderita adrenoleukodystropy, dan enam orang
merupakan saudara pasien yang didiagnosis relapsed acute leukemia. Tidak
terdapat peningkatan insidensi kanker pada riwayat medis keluarga. Donor
lainnya merupakan sukarelawa sehat ras Kaukasia, yang sampelnya didapatkan
dari bank darah. Karena semua hasil yang didapatkan dari sampel kontrol sangat
cocok dengan pasien kolektif yang lebih besar, kami yakin sampel tersebut dapat
mewakili. Studi ini telah disetujui oleh komite etik University of Munich sebagai
bagian dari studi SAA-94 dan komite etik Heinrich Heine University,
Duesseldorf. Informed consent telah ditandatangani oleh orang tua atau pasien.

Isolasi DNA. DNA dipersiapkan dari spesimen whole blood atau sumsum tulang
menggunakan DNAeasy kit (QIAGEN, Hilden, Jerman).

Polimorfisme p450-cyp2E1. Alel p450-cyp2E1 telah ditentukan pada 91 pasien


AA dan 235 kontrol dengan perbedaan melting curve-nya dalam light cycler
(Roche Molecular Biochemicals, Mannheim, Germany). Beberapa kontrol
dianalisis paralel dari sampel pasien. Data kontrol lain ditegakkan pada
laboratorium yang sama dengan metode yang sama dalam proyek penelitian yang
terpisah. Sekitar 100 ng DNA genomic digunakan untuk setiap reaksi PCR.
Primer berikut telah digunakan: forward primer: 5' CCCGTGAGCCAGTCGAGT
3'; reverse primer: 5' CAGACCCTCTTCCACCTTCTAT 3' (5 M each); sensor
RsaI: 5' CATAAAGATTCATTGTTAATATAAAAGTACAAAATTX 3' (1,5 M);
Rsa anchor: 5'-LCRes 540
CAACCTATGAATTAAGAACTTATATATATTGCCAG ph-3' (1.5 M). Reaksi
PCR berisi 1 L dari DNA, 1 L dari setiap primer, 1,2 L 25 mM MgCl 2, 1 L
dari PCR campuran pabrik [meliputi Taq polymerase dan nucleoside 5'-
triphosphate (NTP); Roche Molecular Biochemicals]. PCR dilakukan dalam 35
siklus pada suhu 45C dan 72C serta melting curve dihasilkan oleh alat.
PEDIATRIC RESEARCH Vol. 55, No. 3, 2004
Hak Cipta 2004 International Pediatric Research Foundation, Inc.

Polimorfisme mEh. Dua polimorfisme mEh dianalisis pada 75 pasien dan 96


kontrol dengan teknik PCR/restriction length polymorphism (RFLP). Karena
masalah teknis dan tingginya konsumsi DNA, tidak seluruh 91 probe dapat
dianalisis. Untuk amplifikasi polymorphic exon 3, 1 M dari primer 5'
CCTTGTGCTCTGTCCTTCCCATCCC dan 3'
AATCCTAGTCTTGAAGTGACGGT +, 0,15 M dNTP, 0,15 M Taq
polymerase, 1 mM 10x buffer, dan 5 L Q-solution (QIAGEN) ditambahkan pada
2,5 M DNA. Tiga puluh lima siklus PCR dilakukan selama 10 detik pada suhu
94C, 30 detik pada suhu 45C, dan 45 detik pada suhu 72C. Produk PCR
dicerna dengan AspI selama 1 jam pada suhu 37C. Restriction enzyme site hanya
terdapat pada wild type saja, memberikan 209-bp fragment, dimana mutan tidak
dicerna dan menunjukkan 231-bp band. Exon 4 polymorphism site diamplifikasi
dengan 5' GGGGTGCCAGAGCCTGACCGT dan 3'
AACACGGGGCCCACCCTTGGC seperti yang dideskripsikan dan dicerna
dengan RsaI selama 1 jam pada suhu 37C. Pemotongan enzim alel mutan,
meberikan 174-bp fragment, dimana wild type menunjukkan 295-bp band yang
lebih besar. Karakteristik produk restriksi untuk polimorfisme exon 3 dan exon 4
dijelaskan pada Gambar 1.

Gambar 1. Analisis genotipe mEh. Exon 3 (panel kiri): (a) pola fragmen yang diperkirakan pada
individu homozigot atau heterozigot untuk polimorfisme mEh. Restriksi dicerna menggunakan
AspI menunjukkan 209-bp fragment dan 20-bp fragment pada individu wild-type homozigot dan
231-bp fragment pada individu mutan homozigot. Individu heterozigot menunjukkan seluruh
band. (b) Gel elektroforesis typical menunjukkan mEh-specific DNA fragment. Hanya 231-bp
fragment dan 209-bp fragment yang ditunjukkan. Exon 4 (panel kanan): (a) pola fragmen yang
diperkirakan pada individu homozigot atau heterozigot untuk polimorfisme mEh. Restriksi dicerna
menggunakan RsaI menunjukkan 295-bp fragment pada individu wild-type homozigot dan 174-bp
fragment dan 62-bp fragment pada individu mutan homozigot. Individu heterozigot menunjukkan
seluruh band. (b) Gel elektroforesis typical menggambarkan mEH-specific DNA fragment. Hanya
295-bp fragment dan 174-bp fragment yang ditunjukkan.
PEDIATRIC RESEARCH Vol. 55, No. 3, 2004
Hak Cipta 2004 International Pediatric Research Foundation, Inc.

Polimorfisme GSTM1 dan GSTT1. Untuk menganalisis polimorfisme gen


GSTM1 dan -T1, kami mengembangkan multiplex PCR detecting GSTM1 dan
-T1 juga kontrol -globin internal dalam reaksi satu tabung. Sampel dari 78 pasien
dan 122 kontrol telah dianalisis. Karena masalah teknis dan tingginya konsumsi
DNA, hanya 78 dari 91 probe yang dianalisis. Singkatnya, GSTM1 diamplifikasi
menggunakan primer yang sesuai dengan regio 3'-coding GST manusia: 5'
GAACTCCCTGAAAAGCTAAAG dan 5' GTTGGGAAATATACGGTG. Koding
primer untuk GSTT1 manusia adalah 5' TTCCTTACTGGTCCTCACATCTC dan
5' TCACCGGATCATGGCCAGCA. Gen housekeeping -globin diamplifikasi
menggunakan primer 5' CAACTTCATCCACGTTCACC dan 5'
GAAGAGCCAAGGACAGGTAC. Reaksi PCR dilakukan dengan pemanasan
hingga suhu 94C selam 4 menit, diikuti oleh 34 siklus selama menit pada suhu
94C, 60C, dan 72C. Pemeriksaan terakhir pada suhu 72C selama 7 menit telah
termasuk. Untuk mengeksklusikan kesalahan sistematik, 14 sampel dianalisis
berulang-ulang. Contohnya digambarkan pada Gambar 2.

Gambar 2. Analisis genotipe GSTM1 dan GSTT1. Frekuensi genotipe GSTT1 dan GSTM1 null
dianalisis pada pasien pediatrik dengan AA dan kontrol sehat. Hasil PCR multipleks
mengamplifikasi gen GSTM1, GSTT1 dan -globin housekeeping dalam reaksi satu tabung
ditunjukkan. 270-bp lane menunjukkan kontrol -globin, ??-bp lane gen GSTT1, dan the ??-bp
lane gen GSTM1. Lane 1 menunjukkan DNA ukuran standar; pada lane 2, produk -globin dan
gen GSTM1 ditunjukkan (GSTT1 tidak dapat dideteksi). Pada lane 3, hanya -globin yang
terdetekdi dan kurang kedua GSTT1 dan GSTM1. Pada lane 4, -globin dan gen GSTT1
ditunjukkan, dan tidak ada GSTM1. Pada lane 5, kedua gen GST yang dianalisis terdeteksi.

Sensitivitas reaksi PCR adalah DNA 8,6 ng/L, seperti yang diujikan stepwise
dilution dari DNA positif GSTT1 dan DNA positif GSTM1. Reaksi PCR
dilakukan dengan adanya DNA 1 ng -globin sebagai kontrol standar.

Statistik. Analisis statistik dilakukan menggunakan SPSS statistical software


(versi 7.5, SPSS Inc., Chicago, IL, U.S.A.). Signifikansi diukur menggunakan uji
exact Fisher (two-tailed), uji X2 (two-tailed), dan metode Bonferoni. Odds ratio
(OR) dihitung dan dengan confidence interval (CI) 95%. Analisis multivariat
unconditional dilakukan secara terpisah untuk setiap genotipe. Usia, jenis
kelamin, keparahan anemia aplastik didapat dan respon terapi dianalisis sebagai
co-variable untuk setiap lokus dan kombinasinya. Analisis statistik dilakukan
dengan bantuan Institute for Statistics di Heinrich Heine University, Duesseldorf.

HASIL
PEDIATRIC RESEARCH Vol. 55, No. 3, 2004
Hak Cipta 2004 International Pediatric Research Foundation, Inc.

Polimorfisme p450-cyp2E1. Frekuensi alel p450-cyp2E1 ditunjukkan pada Tabel


1. Prevalensi homozigositas lebih langka dari pada C2 dapat dibandingkan pada
AA, dengan 0 dari 91 (0%) sampel yang dianalisis dan 1 dari 235 (0.4%) pada
kontrol (OR: 1,6; CI95%: 0,7-4,1; p > 0,28; NS). C1/C2 heterozigot ditemukan
pada 8 dari 91 (9%) pasien dengan AA dan 12 dari 235 (5.1%) kontrol (NS). Alel
C1/C1 wild-type dapat dibandingkan pada 83 dari 91 (91%) pasien dengan AA
dan 222 dari 235 (94.5%) kontrol (NS). Masing-masing prevalensi pada kontrol
sebanding dengan studi lain yang menganalisis pasien Kaukasia (20, 21, 43). Data
ini tidak menunjukkan hubungan polimorfisme p450-cyp2E1 dengan risiko AA
pada anak-anak.

Table 1. Distribusi polimorfisme p450-cyp2E1 pada anak yang menderita anemia


aplastik didapat
C1/C1 C1/C2 C2/C2 O R (CI 95%) untuk
alel C2
Kontrol (n = 235) 222 (94,5%) 12 (5,1%) 1 (0,4%) 1,0
Pasien (n = 91) 83 (91%) 8 (9%) 0 1,6 (0,7-4,1)
Polimorfisme P450-cyp2E1 dianalisis pada anak dengan anemia aplastik didapat dibandingkan dengan kontrol terkai
perbedaan melting curve dalam light cycler. Varian C2 yang lebih langka mewakili polimorfisme enzim restriksi Rsal dan
menyebaban peningkatan aktivitas enzim fungsional. OR, odds ratio; CI, confidence interval.

Polimorfisme mEh. Frekuensi polimorfisme mEh ditunjukkan pada Tabel 2.


Prevalensi masing-masing alel pada kontrol kami sebanding dengan studi lain
(49). Empat puluh satu dari 75 (55%) pasien menujukkan polimorfisme tyrosine
(Tyr) 113 pada exon 3 dan 52 dari 96 kontrol (53%) menunjukkan polimorfisme
Tyr 113 pada exon 3 (NS). Varian alel lambat [histidine (His) 113] dari exon 3
ditemukan pada 15 dari 75 (20%) sampel pasien dan pada 15 dari 96 (16%)
sampel kontrol (NS). Varian alel lambat (His 139) dari exon 4 ditemukan pada 47
dari 75 (63%) sampel pasien dan pada 65 dari 96 (68%) sampel kontrol. Varian
alel cepat [arginine (Arg) 139] dari exon 4 ditemukan pada 4 dari 75 (5%) sampel
pasien dan pada 2 dari 96 (2%) sampel kontrol (NS). Prevalensi masing-masing
untuk setiap alel yang dianalisis pada kontrol sehat sebanding dengan data dari
studi lain yang menganalisis pasien Kaukasia (45, 49, 51). Transfer genotipe
menjadi fenotipe terduga menunjukkan tidak ada perbedaan signifikan antara
kedua alel (Tabel 3).

Tabel 2. Distribusi polimorfisme mEH pada exon 3 dan exon 4 pada anak dengan
anemia aplastik didapat
Homozig. Heterozig. Homozig. OR Frekuensi OR
wild-type mutan (95% CI) alel mutan (95% CI) untuk
frekuensi alel
mutan
Exon 3
Kontrol (n = 96) 52 (53%) 31 (32%) 15 (16%) 1,0 0,32 1,0
Pasien (n = 75) 41 (55%) 19 (25%) 15 (20%) 1,6 (0,6-3,4) 0,35 1,1 (0,5-1,9)
Exon 4
Kontrol (n = 96) 65 (68%) 29 (30%) 2 (2%) 1,0 0,17 1,0
Pasien (n _ 75) 47 (63%) 17 (32%) 4 (5%) 0,8 (0,25,6) 0,16 1,0 (0,6-2,5)
Analisis PCR/RFLP dari gen mEh pada pasien anak dengan anemia aplastik didapat dan kontrol. Mutan exon 3
dikarakteristikan oleh polimorfisme enzim restriksi Aspl. Mutan exon 4 diakarakteristikan oleh polimorfisme Rsal.
Homozig., homozigot; heterozig., heterozigot; OR, odds ratio; CI, confidence interval.

Polimorfisme GST. Frekuensi alel GSTT1 dan GSTM1 untuk seluruh pasien dan
kontrolnya masing-masing ditunjukkan pada Tabel 4. Insidensi GSTT1 meningkat
signifikan pada kasus AA dibandingkan dengan kontrol. Diantara pasien, 34 dari
PEDIATRIC RESEARCH Vol. 55, No. 3, 2004
Hak Cipta 2004 International Pediatric Research Foundation, Inc.

78 (39%) anak negatif untuk gen GSTT1 dibandingkan dengan 24 dari 122 (20%)
kontrol. Kami menemukan peningkatan risiko signifikan untuk AA pada anak-
anak dengan genotipe GSTT1 null (OR: 2,8; CI 95%: 1,5-5,7; p < 0,004).
Genotipe GSTM1 null terjadi pada 34 dari 78 (44%) pasien dan pada 66 dari 122
(54%) kontrol (NS). Genotipe GSTM1 null tidak berhubungan dengan
peningkatan risiko AA. Sembilan dari 78 pasien (12%) dan 3 dari 122 kontrol
(8%) ditemukan negatif untuk kedua alel GST (NS). Prevalensi pada kontrol sehat
sebanding dengan data dari studi lain yang menganalisis pasien Kaukasia.

Tabel 3. Distribusi mEh diduga fungsional pada anak penderita anemia aplastik
didapat
Normal Fast Slow Very slow OR (95% CI)
Kontrol (n = 96) 42 (44%) 16 (17%) 23 (24%) 15 (15%) 1,0
Patients (n = 53) 25 (47%) 8 (15%) 9 (17%) 11 (21%) 1,4 (0,6-3,4)
OR, odds ratio; CI, confidence interval.

Interaksi antara polimorfisme genetik. Untuk menilai efek kombinasi dari


polimorfisme tersebut, interaksi antara genotipe GSTT1 null dan polimorfisme
lain dianalisis dengan analisis multivariat. Analisis ini tidak menunjukkan
peningkatan signifikan pada risiko perkembangan AA untuk interaksi yang
diujikan dengan genotipe GSTT1 null (data tidak ditampilkan). Variabel seperti
usia atau jenis kelamin, fenotipe anemia aplastik (NSAA, SAA, dan VSAA),
respon terhadap terapi imunosupresif, frekuensi relaps, durasi penyakit (data tidak
ditampilkan), dan perkembangan penyakit ganas diujikan untuk hubungan dengan
genotipe yang dianalisis. Akan tetapi, tidak ada parameter yang menunjukkan
hubungan yang signifikan.

DISKUSI
Mekanisme imunologis dan/atau kerusakan DNA oksidatif memiliki arti luas
dalam induksi pathogenesis AA (41). Perlindungan sumsum tulang dari xenobiotik
tergantung pada jalur detoksifikasi yang intak. Perbedaan individual dalam
ekspresi biotransforming enzyme dapat menyebabkan kerentanan terhadap agen
toksik. Kami menganalisis polimorfisme biotransforming enzyme dan data yang
berhubungan dengan risiko AA. Kami menemukan frekuensi yang signifikan lebih
tinggi pada genotipe GSTT1 null diantara anak-anak dengan AA, sedangkan
p450-cyp2E1, mEh, dan GSTM1 tidak berhubungan. Akan tetapi, statistik
menunjukkan GST memainkan peran sekunder dalam pathogenesis AA paa anak-
anak. Melihat literatur, banyak faktor yang berhubungan dengan anemia aplastik,
dan genotipe GSTT1 null dapat menjadi salah satu faktor risiko. GSTT1
menentukan kemampuan untuk konjugasi komponen reaktif (44) seperti
monohalometana (52) dan ethylene oxide (53, 54) dan metabolisme xenobiotik
low-molecular-weight-halogenated atau epoxide reaktif. GSTT1 diekspresikan
dalam eritrosit dan limfosit (51, 52) dan juga bertindak dalam sistem
hematopoietik. Kepentingan GSTT1 dalam melindungi sel hematopoietik dari
polutan lingkungan telah terbukti pada populasi yang terpapar 1,3-butadiene
pertukaran kromatid sister in vitro pada limfosit masusia karena adanya 1,3-
butadiene 16 kali lebih tinggi pada sel yang berasal dari individu yang kekurangan
ekspresi gen GSTT1 (55, 56). Terkait detoksifikasi benzene, yang sangat penting
dalam konteks AA, GSTT1 merupakan faktor pelindung utama dari individu yang
PEDIATRIC RESEARCH Vol. 55, No. 3, 2004
Hak Cipta 2004 International Pediatric Research Foundation, Inc.

rentan terhadap kerusakan kromosom yang diinduksi benzena (51) dan


menginduksi ekskresi metabolit benzeba urin dengan ekskresi t,tMA yang lebih
tinggi (57).

Membuktikan penyebab langsung antara polutan eksogen dan kegagalan sumsum


tulang adalah sulit karena onset kegagalan sumsum tulang tidak dapat diketahui
secara akurat. Keterlambatan penyakit sumsum tulang setelah paparan polutan
dapat bervariasi dan individu dengan kerentanan genetik karena defisiensi enzim
dapat menjadi risiko yang lebih besar dibandingkan individu dengan kadar enzim
normal dengan adanya faktor lingkungan, bahkan pada paparan rendah. Genotipe
GSTT1 null dapat memodulasi metabolisme polutan eksogen atau proses
perusakan DNA endogen. Kerentanan genetik terhadap polutan tertentu dapat
menentukan risiko terhadap kadar umum polutan mutagenik.

REFERENSI
1. Alter BP, Young NS 1993 The bone marrow failure syndromes. In: Nathan
DG, Oski FA (eds) Hematology of Infancy and Childhood. WB Saunders,
Philadelphia, pp 100132
2. Young NS 1999 Acquired aplastic anemia. JAMA 282:271278
3. Sharpe WD 1993 Benzene, artificial leather and aplastic anemia: Newark,
1916-1928. Bull NY Acad Med 69:4760
4. Young N 1988 Drugs and chemicals as agents of bone marrow failure. In:
Testa N, Gale RP (eds) Hematopoiesis. Marcel Dekker, New York, pp 131
159
5. Morley A, Trainor K, Seshradi R, Sorelli J 1978 Is aplastic anemia due to
abnormality of DNA? Lancet 48:911
6. Turner DR, Morley AA, Seshardi RS 1981 Lymphocyte DNA in aplastic
anemia. Br J Haematol 48:207215
7. Young NS, Mortimer 1993 Viruses and bone marrow failure. Blood 63:7580
8. Dilloo D, Josting A, Gbel U 1991 CMV-associated bone marrow
suppression: the role of CMV infection in modulation of interleukin-6
production in vitro. Eur J Pediatr 150:716721
9. Fliedner TM, Nothdurft W, Calvo W 1986 The development of radiation late
effects to the bone marrow after single and chronic exposure. Int J Radiat Biol
49:3546
10. Nagao T, Maurer AM 1969 Concordance for drug induced aplastic anemia in
identical twins. N Engl J Med 218:711
11. Snyder R, Witz G, Goldstein BD 1993 The toxicology of benzene. Environ
Health Perspect 100:172181
12. Sanchez-Medal L, Castanedo JP, Garcia-Rodas F 1963 Insecticides and
aplastic anemia. N Engl J Med 269:13651370
13. Fleming LE, Timmeny W 1993 Aplastic anemia and pesticides. An etiologic
association? J Occup Med 35:11061116
14. Maciejewski JP, Hibbs JR, Anderson S, Katevas P, Young NS 1994 Bone
marrow and peripheral blood lymphocyte phenotype in patients with bone
marrow failure. Exp Hematol 22:11021110
15. Frickhofen N, Liu JM, Young NS 1990 Etiologic mechanisms of
hematopoietic failure. Am J Pediatr Hematol Oncol 12:385395
PEDIATRIC RESEARCH Vol. 55, No. 3, 2004
Hak Cipta 2004 International Pediatric Research Foundation, Inc.

16. Torok-Storb B 1990 Etiological mechanisms in immune-mediated aplastic


anemia. Am J Pediatr Hematol Oncol 12:396401
17. Mentzel U, Vogt H, Rossol R, Geissler RG, Maurer A, Ganser A, Trommer
WE, Hoelzer D 1993 Analysis of lymphocyte subsets in patients with aplastic
anemia before and during immunosuppressive therapy. Ann Hematol 66:127
129
18. Marsh JCW, Chang J, Testa NG, Hows JM, Dexter TM 1991 In vitro
assessment of marrow stem cell and stromal cell function in aplastic anemia.
Br J Haematol 78:258267
19. Lieber CS 1997 Cytochrome p-4502E1, its physiological and pathological
role.
1. Physiol Rev 77:517544
20. Uematsu F, Kikuchi H, Ohmachi T, Sagami I, Motomiya M, Kamataki T,
Komori M, Watanabe M 1991 Two common RFLPs of the human CYP2E1
gene. Nucleic Acids Res 19:2803
21. Watanabe J, Hayashi S-i, Nakachi K, Imai K, Suda Y, Sekine T, Kawajiri K
1990 Pst and RsaI RFLPs in complete linkage disequilibrium at the CYP2E
gene. Nucleic Acids Res 18:7194
22. Omiecinski CJ, Hassett C, Hosagrahara V 2000 Epoxide hydrolase
polymorphism and role in toxicology. Toxicol Lett 112113:365370
23. Seidegard J, De Pierre JW, Guenther TM, Oesch F 1986 The effects of
metyrapone, chalcone epoxide, benzol, clotrimazol and related compounds on
the activity of microsomal epoxide hydrolase in situ, in purified form and in
reconstituted systems toward different substrates. Eur J Biochem 159:415423
24. Snyder R, Chepiga T, Yang CS, Thomas H, Platt K, Oesch F 1993 Benzene
metabolism by reconstituted cytochromes p450 2B1 and 2e1 and its
modulation by cytochrome b5, microsomal epoxide hydrolase, and glutathione
transferases: evidence for an important role of microsomal epoxide hydrolase
in the formation of hydroquinone. Toxicol Appl Pharmacol 122:172181
25. Lancester JM, Brownlee HA, Bell DA, Futreal PA, Marks JR, Berchut A,
Wiseman RW, Taylor JA 1996 Microsomal epoxide hydrolase polymorphism
as a risk factor for ovarian cancer. Mol Carcinog 17:160162
26. McGlynn KA, Rosvold EA, Lustbader ED, Hu Y, Clapper ML, Zhou T, Wild
CP, Xia XL, Baffoe Bonnie A, Ofori Adjei D 1995 Susceptibility to
hepatocarcinoma is associated with genetic variability in the enzymatic
detoxification of aflatoxin B1. Proc Natl Acad Sci USA 92:23842387
27. Hassett C, Aicher L, Sidhu JS, Omiencinski CJ 1994 A human microsomal
epoxide hydrolase: genetic polymorphism and functional expression in vitro of
amino acid variants. Hum Mol Genet 3:421428
28. Hassett C, Robinson KB, Beck NB, Omienski CJ 1994 The human
microsomal epoxide hydrolase gene (EPHXI): complete nucleotide sequence
and structural characterization. Genomics 23:433442
29. Smith CAD, Harrison DJ 1997 Association between polymorphism in gene for
microsomal epoxide hydrolase and susceptibility to emphysema. Lancet
350:630-633
30. Pickett CB, Lu AYH 1988 The structure, genetics and regulation of soluble
glutathione s-transferases. In: Sies H, Ketterer B (eds) Glutathione
PEDIATRIC RESEARCH Vol. 55, No. 3, 2004
Hak Cipta 2004 International Pediatric Research Foundation, Inc.

Conjugation: Its Mechanisms and Biological Significance. Academic Press,


San Diego, pp 137145
31. Board P, Coggan M, Johnston P, Ross V, Suzuki T, Webb G 1990 Genetic
heterogeneity of the human glutathione transferases: a complex of gene
families. Pharmacol Ther 48:357364
32. Mannervik B, Alin P, Guthenberg C, Jensson H, Tahir MK, Warholm M,
Jrnvall H 1985 Identification of three classes of cytosolic glutathione
transferases common to several mammalian species: correlation between
structural data and enzymatic properties. Proc Natl Acad Sci USA 82:7202
7206
33. Islam MQ, Platz A, Szpirer J, Szpirer C, Levan G, Mannervik B 1989
Chromosomal localisation of human glutathione transferases genes of classes
, , . Hum Genet 82:338345
34. Brockmoller J, Kerb R, Drakoulis N, Nitz M, Roots I 1993 Genotype and
phenotype of glutathione S-transferase class mu isoenzymes mu and psi in
lung cancer patients and controls. Cancer Res 53:10041011
35. Mannervik B, Awasthi YC, Board PG, Hayes JD, Di Ilio C, Ketterer B,
Listowsky I, Morgenstern R, Muramatsu M, Pearson WR, Pickett CB,
Widersten M, Wolf CR 1992 Nomenclature for human glutathione
transferases. Biochem J 282:305306
36. Schroder KR, Hallier E, Meyer DJ, Wiebel FA, Muller AM, Bolt HM 1996
Purification and characterization of a new glutathione S-transferase, class
theta, from human erythrocytes. Arch Toxicol 70:559566
37. Harries LW, Stubbins MJ, Forman D, Howard GC, Wolf CR 1997
Identification of genetic polymorphisms at the glutathione S-transferase Pi
locus and association with susceptibility to bladder, testicular and prostate
cancer. Carcinogenesis 18:641644
38. Pemble SE, Wardle AF, Taylor JB 1996 Glutathione S-transferase class Kappa:
characterization by the cloning of rat mitochondrial GST and identification of
a human homologue. Biochem J 319:749754
39. Okkels H, Sigsgaard T, Wolf H, Autrup H 1996 Glutathione S-transferase mu
as a risk factor in bladder tumours. Pharmacogenetics 6:251256
40. Nakajima T, Elovaara E, Anttila S, Hirvonen A, Camus AM, Hayes JD,
Ketterer B, Vainio H 1995 Expression and polymorphism of glutathione S-
transferase in human lungs: risk factors in smoking-related lung cancer.
Carcinogenesis 16:707711
41. Nakachi K, Imai K, Hayashi S, Kawajiri K 1993 Polymorphisms of the
CYP1A1 and glutathione S-transferase genes associated with susceptibility to
lung cancer in relation to cigarette dose in a Japanese population. Cancer Res
53:29942999
42. Ambrosone CB, Freudenheim JL, Graham S, Marshall JR, Vena JE, Brasure
JR, Laughlin R, Nemoto T, Michalek AM, Harrington A 1995 Cytochrome
P4501A1 and glutathione S-transferase (M1) genetic polymorphisms and
postmenopausal breast cancer risk. Cancer Res 55:34833485
43. Murray GI, Paterson PJ, Weaver RJ, Ewen SW, Melvin WT, Burke MD 1993
The expression of cytochrome P-450, epoxide hydrolase, and glutathione S-
transferase in hepatocellular carcinoma. Cancer 71:3643
PEDIATRIC RESEARCH Vol. 55, No. 3, 2004
Hak Cipta 2004 International Pediatric Research Foundation, Inc.

44. Rollinson S, Roddam P, Kane E, Roman E, Cartwright R, Jack A, Morgan GJ


2000 Polymorphic variation within the glutathione S-transferase genes and
risk of adult acute leukaemia. Carcinogenesis 21:4347
45. Chen H, Sandler DP, Taylor JA, Shore DL, Liu E, Bloomfield CD, Bell DA
1996 Increased risk for myelodysplastic syndromes in individuals with
glutathione transferase theta 1 (GSTT1) gene defect. Lancet 347:295297
46. Sasai Y, Horiike S, Misawa S, Kaneko H, Kobayashi M, Fujii, Kashima K,
Tanuwaki M 1999 Genotype of glutathione S-transferase and other genetic
configurations in myelodysplasia. Leuk Res 23:975981
47. Basu T, Gale RE, Langabeer S, Linch D 1997 Glutathion, S-transferase theta
(GSTT) gene defect in myelodysplasia and acute myeloid leucemia. Lancet
349:1450
48. Preudhomme C, Nisse C, Hebbar M, Vanrumbeke M, Brizard A, Lai JL 1997
Glutathione s transferase theta gene defects in myelodysplastic syndrome and
their correlation with karyotype and exposure to potential carcinogens.
Leukemia 11:15801582
49. Okada M, Okamoto T, Wada H, Tademoto Y, Kakishita E 1997 Glutathione S
transferase theta gene (GSTT1) defect in Japanese patients with
myelodysplastic syndromes. Int J Hematol 66:393395
50. Fuhrer M, Burdach S, Ebell W, Gadner H, Haas R, Harbott J, Janka-Schaub G,
Klingebiel T, Kremens B, Niemeyer C, Rampf U, Reiter A, Ritter J, Schulz A,
Walther U, Zeidler C, Bender-Gotze C 1998 Relapse and clonal disease in
children with aplastic anemia (AA) after immunosuppressive therapy (IST):
the SAA 94 experience. German/Austrian Aplastic Anemia Working Group.
Klin Pdiatr 210:173179
51. Xu X, Wiencke JK, Niu T, Wang M, Watanabe H, Kelsey KT, Christiani DC
1998 Benzene exposure, glutathione S-transferase theta homozygous deletion,
and sister chromatid exchanges. Am J Ind Med 33:157163
52. Hayes JD, Pulford DJ 1995 The glutathione S-transferase supergene family:
regulation of GST and the contribution of the isoenzymes to cancer
chemoprotection and drug resistance. Crit Rev Biochem Mol Biol 30:445600
53. Ploemen JH, Van Schanke A, Van Ommen B, Van Bladeren PJ 1994
Reversible conjugation of ethacrynic acid with glutathione and human
glutathione S-transferase P11. Cancer Res 54:915919
54. Hallier E, Langhof T, Danappel D, Leutbecher M, Schroeder K, Goergens
HW, Muller A, Bolt M 1993 Polymorphism of glutathione conjugation of
methyl bromide ethylene oxide and dichloromethane in human blood
influence on the induction of sister chromatid exchange (SCE) in
lymphocytes. Arch Toxicol 67:173178
55. Bernadini S, Pelin K, Peltonen K, Jarventaus H, Hirvonen A, Neagu C, Sorsa
M, Norppa H 1996 Induction of sister chromatid exchange by 3,4-
epoxybutane-1,2-diol in cultured human lymphocytes of different GSTT1 and
GSTM1 genotypes. Mutat Res 361:121
56. Norppa H, Javentaus H, Uuskula M, Tasa G, Ojajarvi A, Sorsa M 1995 Role
of GSTT1 and GSTM1 genotypes in determining individual sensitivity to
sister chromatid exchange induction by diepoxybutane in cultured human
lymphocytes. Carcinogenesis 16:12611264
PEDIATRIC RESEARCH Vol. 55, No. 3, 2004
Hak Cipta 2004 International Pediatric Research Foundation, Inc.

57. Rossi AM, Guarnier C, Rovesti S, Gobba E, Ghittori S, Vivoli G, Barale R,


1999 Genetic polymorphism influence variability in benzene metabolism in
humans. Pharmacogenetics 9:445458