You are on page 1of 57

Science of

Living System
BS20001
Soumya De
School of Bio Science
Email: somde@iitkgp.ac.in
Tel: 03222-260514
http://www0.cs.ucl.ac.uk/staff/d.jones/t42morph.html

Lecture Date Topic
1 11/01/17 Nucleic acids
2 18/01/17 Transcription and Translation
3 25/01/17 Protein structure
4 01/02/17 Enzymes
** 08/02/17 CLASS TEST-1
** 13/02 to 21/02 MID-SEM EXAM
5 22/02/17 Photosynthesis & Respiration
6 01/03/17 Cellular architecture
7 08/03/17 Cell division and apoptosis
8 15/03/17 Development of multicellular organisms
9 22/03/17 Host defense/Disease biology/vaccines/antibiotics

10 29/03/17 Recombinant DNA Technology & its impact

** 05/04/17 CLASS TEST-2

** 12/04/17 DISCUSSION AND REVISION

Protein Structure, Function, Kinetics
and Energetics

Books Followed:

• How Proteins Work (Mike Williamson)
• Introduction to protein structure (Carl
Branden & John Tooze)
• Biochemistry (Lubert Stryer)

Central Dogma of life
DNA: Storage Medium
Polymer of nucleotides

CCTGAGCCAACTATTGATGAA
RNA: Transmission Medium
Polymer of nucleotides

CCUGAGCCAACUAUUGAUGAA

Protein: Molecular Machines
Polymer of amino acids

PEPTIDE

Amino acids: Building blocks of Proteins

• Protein is a polymer of amino acids.
• There are 20 common amino acids.
• Amino acids have a common
chemical structure - A tetrahedral
sp3 carbon (Cα) with four different
functional groups:
1. Amino group
2. Carboxyl group
3. H-atom
4. Side chain (R) with distinct
chemical property

The L-form reads “CORN” in clockwise direction. . R and N going in a clockwise direction. Looking down the H-Cα bond from the H-atom.All amino acids in protein have the “L-form” H-atom is coming out of the whiteboard. the L-form amino acid has CO.

.

.

Only imino acid .

.

.

pKa ~ 6.4 His can bind or release protons near physiological pH .

Formation of the peptide bond .

The amide plane: partial double bond character of the peptide bond .

Cα Cα Cα Cα TRANS H H Cα Cα CIS Cα Cα .

.

Torsion angles: Φ (phi) and Ψ (psi) Peptide Plane .

Visualizing a few torsion angles Front Back 1 4 4 (behind 1) 1 2 3 2 3 (behind 2) .

Visualizing a few torsion angles 4 1 Front Back 4 1 0° 2 3 2 3 1 1 Front Back 4 4 Atom 4 is above +45° the plane of the 2 3 board .

Visualizing a few torsion angles 1 1 Front Back 4 4 Atom 4 is below -45° the plane of the 2 3 board 1 1 Front Back Atom 4 is below -135° the plane of the 2 3 board 4 4 .

N. Ramachandran Plot G. Ramachandran Φ Ψ Ψ (psi) ω Φ (phi) .

Ramachandran Plot α-Helix β-Strand Ψ (psi) Φ (phi) .

Glycine residues can adopt many different conformations .

φ and ψ torsion angles are the only degrees of freedom for the backbone 3 2 1 .

Properties of Glycine • Glycine with only a H-atom as side chain can adopt a much wider range of Φ-Ψ conformations than the other residues • It thus plays a structurally important role. it allows unusual main chain conformations in proteins • This is the main reasons why a high proportion of Glycine residues are conserved among homologous protein sequences .

Proteins come in various shapes and sizes .

Clearly. which is equal to 5 × 1034 s.The enormous difference between calculated and actual folding times is called Levinthal's paradox.Consider a small protein with 100 residues. the total number of structures would be 3100. . which is equal to 5 × 1047. if each residue can assume three different conformations. it would take much too long for even a small protein to fold properly by randomly trying out all possible conformations. the total search time would be 5 × 1047 × 10-13 s. longer than the age of the universe! . or 1027 years i.The protein folding problem . If it takes 10-13 s to convert one structure into another. . .e.Cyrus Levinthal calculated that.

In other words. the protein sequence contains enough information required for the proper folding of the protein into its functional three-dimensional structure. . The 3D structure of a protein is encoded in its primary sequence: Anfinsen’s Experiment Thermodynamic hypothesis of Protein Folding: The interactions between the atoms in a protein control the folding of the protein molecule into a well-defined three-dimensional structure.

Anfinsen’s Experiment .

Anfinsen’s Experiment If we understand HOW PROTEINS FOLD. we can predict their structure from sequence! Then we can design proteins with novel functions. .

Hydrophobic effect .van der Waals interaction .Electrostatics Most important feature: The interior of proteins is hydrophobic! The main driving force for folding water soluble globular protein molecules is to pack hydrophobic side chains into the interior of the molecule.Hydrogen bonding . Forces that stabilize a protein structure .Conformational entropy . thus creating a HYDROPHOBIC CORE and a HYDROPHILLIC SURFACE. Problem: How to create such a hydrophobic core from a linear protein chain ??? .

.

Hierarchy of Protein Structure .

Protein molecules are organized in a structural hierarchy .

. • Formed when a number of consecutive residues have the similar phi and psi angles.• Alpha helices • Beta Sheets • Characterized by main chain NH and CO groups participating in H-bonds.

Every 3. Alpha helices are formed when a stretch of consecutive residues have the phi- psi torsion angle pair approx -60° & -50°. The C=O of residue ‘n’ is hydrogen bonded to N-H of residue ‘n+4’. This is in the allowed region of Ramchandran plot. The distance (pitch of helix) between two turns is 5.4 Å.6 residues Alpha Helices make one turn. .

The alpha-helix has a dipole moment - + The dipoles of The dipole of a peptide unit peptide units are Numbers in boxes give the aligned along approximate fractional charges the α helical axis of the atoms of the peptide unit .

Glu. Leu . Ser . Tyr. Met Less Preferred: Pro. Gly.Some amino acids are preferred in α-helices Good helix formers: Ala .

Helical Wheel Plot N C .

Hydrophobic Hydrophilic Charged Totally buried Partially buried Helical Wheel: Each residue can be Exposed plotted every 360/3.6=100° around a circle or spiral .

BUT. .Alpha helix can be – Right-handed or Left handed. Right handed – most commonly observed in proteins. left handed helix is not possible for L- amino acids due to close approach of the side chains and CO group.

α-helix: from one continuous region. typically 5-10 residues long . Each β-strand. β-sheet from several regions of the chain.

Antiparallel β-sheet: HBs perpendicular to strands. narrowly spaced bond pairs alternated with widely spaced pairs C N N C β-pleated sheet: ‘pleated’ because side chains point up and down alternatively .

Parallel β-sheet N C C N .

Mixed β-sheet .

.

Loop regions mostly occur at the surface of protein molecules .

Polypeptide chains fold into several domains •Fundamental unit of tertiary structure – DOMAIN •Domain: polypeptide chain or a part of polypeptide chain that can independently fold into a stable tertiary structure •Domains are also units of function .

consisting of two identical subunits. . The simplest sort of quaternary structure is a dimer. Each polypeptide chain in such a protein is called a subunit. Quaternary structure refers to the spatial arrangement of subunits and the nature of their interactions. Quaternary structure Proteins containing more than one polypeptide chain exhibit a fourth level of structural organization.

The structure of the two identical α subunits (red) is similar to but not identical with that of the two β subunits (yellow). The coat of rhinovirus comprises 60 copies of each subunits .Qaternary structure (higher order) The α2β2 tetramer of human haemoglobin. Complex Quaternary Structure.

usually two β sheets packed against each other • α/β Domain structures – made from combinations of β-α-β motifs that form a predominantly parallel β sheets surrounded by α helices . Protein structures can be divided into three main classes • α Domain structures – core is exclusively built from α helices • β Domain structures – core comprises of antiparallel β sheets.

Human plasma retinol binding protein. Retinol molecule vitamin A bound inside Triosephosphate the barrel isomerase .

samanta) NMR spectroscopy • Nuclear magnetic resonance (NMR) spectroscopy • Prof. Amit K Das (http://www.ac. Dibyendu Samanta (http://iitkgp. Soumya De (http://iitkgp.ac.in/department/BS/faculty/bs-somde) BS41002 STRUCTURE DETERMINATION OF BIOMOLECULES .iitkgp.in/department/BT/faculty/bt-amitk) • Prof. Methods to study protein structures X-ray crystallography • Prof.in/department/BS/faculty/bs-dibyendu.ac.