UNIVERSIDAD DE LAS FUERZAR ARMADAS – ESPE

DEPARTAMENTO CIENCIAS DE LA VIDA Y AGRICULTURA
INGENIERÍA EN BIOTECNOLOGÍA
Biología Molecular III

Nombres: Criollo Miguel, Morillo Andrea, Suquillo Nadia, Vargas Kathya
NRC: 1659
Fecha: 28/11/2016

TEMA: Enzimas de Restricción

INTRODUCCION

Las enzimas de restricción son endonucleasas que reconocen una
secuencia entre 4-8 pb en el ADN. El sitio de reconocimiento se llama
sitio de restricción, la enzima rompe un enlace fosfodiéster tanto en
la hebra de arriba como en la hebra complementaria. Estas enzimas
se encuentran en muchas especies de bacterias, donde funcionan in
vivo como parte de un sistema de restricción y modificación (sistema
R/M). Este sistema es análogo a un sistema inmune, y le permite
distinguir a la bacteria entre su propio ADN y el ADN exógeno
(Herverg y Barcia, 2007).

BamHI es una endonucleasa de restricción tipo II, aislada del
microorganismo Bacillus amyloliquefaciens H, que tiene la capacidad
para reconocer secuencias palindrómicas cortas (6 pb) de ADN y
escindirlas en un sitio diana (Segal, 2005).

La BamHI se une a la secuencia de reconocimiento 5'-GGATCC-3 ', y
escinde estas secuencias justo después de la 5'-guanina en cada
hebra; es decir que hidroliza los enlaces fosfodiéster que unen las
bases G y G de cada hebra. Según (Kenneth, 2008) esta escisión da
como resultado, extremos pegajosos, de modo que los cortes son
escalonados y dan lugar a la formación de fragmentos de ADN cuyos
extremos tienen una corta región monocatenaria complementaria.
Los extremos pueden permanecer asociados por puentes de
hidrógeno o desnaturalizarse (según sean las condiciones de
salinidad, temperatura, etc.).

BamH I genera extremos que son compatibles con los fragmentos
(GATC) generados por Sau3AI, BglI, BamHI, BclI et XhoIl (Segal, 2005).

REBASE Fig. 2 DNA de DNA obtenida de GenBank B. 5 Secuencia protéica de BanH I en formato FASTA . 4 Secuencia en formato FASTA del gen de BanH I Fig. grupo control y endonucleasa Fig.amylolicuefaquefaciens con los genes de metilasa. 3 Información de la secuencia de Fig. 1 Ventana principal de REBASE Fig.

la secuencia de reconocimiento y el sitio donde se dará la escisión. Fig. se encuentra el gen de la BamHI y ya la proteína en sí tiene un tamaño de 213 aa. la temperatura a la que se debe trabajar. etc.amylolicuefaquefaciens. se pude ver que la frecuencia máxima para la BamHI es de 434 sitios en Thermoplasma acidophilum. si presenta o no actividad estrella. se observan también los genesde la metilasa. con tamaño de 642 pb. entre las bases 1656 y 1964 se encuentra el gen del grupo de control y a partir de la base numero 1981 hasta la 2622.En REBASE podemos encontrar información general de la enzima como: el nombre de la bacteria de la cual fue aislada. También existe la opción que muestra gráficamente la secuencia de ADN de B. 6 4 Gráfico de frecuencias para sitios de reconocimiento en diferentes organismos Con el gráfico que muestra la frecuencia de sitios de reconocimiento en genomas secuenciados de diferentes organismos. El gen de la metilasa se ubica a partir de la base 351 hasta la base 1622. del grupo de control y de la endonucleasa. Fig 7 Listado de enzimas similares a la BamH . la cual tiene una longitud de 3014 pb.

Se conoce que las enzimas de restricción (RE). se ha encontrado que las siguientes condiciones generales pueden aumentar la actividad estrella: alta concentración de glicerol (> 5%). pero no idénticas. entre ellas la BamHI. Experimentalmente. presencia de disolventes orgánicos (tales . pH alto. en condiciones no óptimas. escinden secuencias similares. a sus secuencias de reconocimiento definidas. a esto se denomina actividad estrella y existen muchas enzimas con este tipo de actividad. APLICACIONES Introducción: Las endonucleasas de restricción son las herramientas básicas de la biología molecular. 2005). Como se muestra existen más enzimas que pueden generar fragmentos compatibles a BamHI pero que no se encuentran disponibles comercialmente. Para cuantificar esta propiedad se propone el concepto de Índice de Fidelidad (FI) que se define como la relación de la cantidad máxima de la enzima que no muestra actividad estrella con la cantidad mínima necesaria para la digestión completa en el sitio de reconocimiento relacionado para cualquier endonucleasa de restricción particular (Roberts. alta concentración de enzima con respecto a ADN (normalmente> 100 U de enzima por microgramo de DNA). baja resistencia iónica. Muchas de ellas muestran actividad estrella en diferentes condiciones de digestión del DNA incluyendo los óptimos.

0. La actividad de la BamHI puede cambiar durante el almacenamiento y la manipulación.). Típicamente. se cubrió con una tapa. etc. En algunos casos. para dar 20 concentraciones diferentes (1 x. Después de la electroforesis.6 g de sustrato de ADN en cada uno de los cuatro tampones que se utilizaron. MATERIALES Y MÉTODOS Ensayo de determinación del FI Se utilizaron ER de New England Biolabs. IF para diferentes sustratos . la actividad estrella destruirá banda(s) existente y generar nueva banda. se incubó a 37°C durante una hora y se cargó en un gel de agarosa. lo que complica el análisis (Sidorova. En casos como aplicaciones forenses. etanol) y la sustitución de Mg 2+ con otros cationes divalentes (Mn 2+. pero la actividad estrella puede introducir cortes no deseados en el vector y el inserto disminuyendo el rendimiento de dichos extremos. en los años en que había un número limitado de RE disponible se utilizó la actividad estrella de BamHI para generar vectores de deleción unidireccionales (Vincze. 2003).25 x. se sometió una solución RE madre concentrada a una serie de diluciones con diluyentes adecuados (50% glicerol cada uno). donde el ADN cortado por una RE genera una huella digital única.como DMSO. Los productos de esta actividad son mucho menos predecibles que la actividad afín lo que hace que sea indeseada. la actividad estrella fue ventajosa. Las reacciones se llevaron a cabo en una microplaca de 96 pocillos. el FI se calcula en base a la dilución de la muestra del primer carril sin primera actividad estrella comparado con el último carril sin mostrar digestión parcial. como soluciones madre de la concentración más alta disponible y se compararon con enzimas de otros proveedores. Para cada conjunto de reacciones. La placa se selló con cinta. una imagen del gel fue tomada usando un generador de imágenes UV (Bio-Rad). para medir el FI. 0. y por lo tanto la integridad de reacción y los efectos de la actividad estrella puede variar.5 x. 2006). 2004). porque por ejemplo en casos de clonación las ER generan extremos compatibles para la ligación. Tres microlitros de la solución de enzima se mezclaron con 0. Co 2+) (Samuelson.

por lo que poco o ningún ADN se digiere. RESULTADOS La definición de FI En el extremo derecho.Con la BamHI se compararon los IF obtenidos para diferentes sustratos de ADN. Por ello. que incluyen dos o más RE con diferentes tampones óptimas son muy comunes. Este patrón se mantiene pero la cantidad RE continúa aumentando hasta que la actividad estrella comienza a aparecer. sin embargo. Los IF eran esencialmente los mismos para EcoRI y BamHI a partir de diferentes proveedores. una selección de cuatro tampones de reacción en lugar de uno se puso a prueba en este estudio. las digestiones de restricción. Una vez que aparece la actividad estrella. RE están idealmente utilizadas en sus tampones óptimos. que describe el grado de actividad estrella para a la BamHI. A medida que la cantidad aumenta hacia la izquierda. como la relación de la cantidad de enzima más alta que no muestra actividad estrella (HNS) con la cantidad más baja necesaria para la escisión completa de los sitios afines (LCC): Una variación de 2 a 4 veces se considera que es idéntica dentro del error experimental. Inc. y los IF se compararon para los sustratos superenrollados y lineales. a esto lo llama la cantidad RE más baja necesaria para la escisión completa de los sitios afines (LCC). hay muy poca enzima. la banda de escisión normal se escinde adicionalmente en fragmentos más pequeños. . fragmentos parcialmente digeridos comienzan a aparecer. El efecto de las formas superenrolladas y lineales de ADN en el FI Las mismas cantidades de sustrato superenrollado se digirieron con BamHI y EcoRI. Se define al FI. están completamente digeridos cuando la cantidad de la enzima alcanza un punto crítico. Todos los sustratos eran de New England Biolabs.

el FI puede ayudar en la elección de las condiciones de reacción necesarios para obtener la escisión completa sin causar actividad estrella grave. se han encontrado 44 miRNAs VEB codificada. hepatoesplenomegalia. citopenias. La infección primaria por el VEB en las células B suele ser asintomática o causa la enfermedad autolimitada mononucleosis infecciosa (IM). y su función se ha relacionado con ciertas enfermedades humanas. entre los cuales 4 miRNAs derivan del Bam fragmento HI H hacia la derecha marco de lectura abierto 1 (BHRF1). esta definición también sienta las bases sobre las que más investigación se puede hacer sobre el tema de la actividad estrella. Los resultados del síndrome de la activación de células T anormal y producción de citoquinas inflamatorias.Se han encontrado los IF de BamHI y OkrAI a temperatura ambiente en alrededor de 10 veces mayor que a 37 ° C. . Estos ARN no codificantes regulan negativamente la expresión génica por direccionamiento de secuencias complementarias en los ARN mensajeros. Introducción: Virus de Epstein-Barr (EBV) es un exitoso virus herpes gamma que infecta a más del 90% de los adultos y mantiene la infección latente persistente durante toda la vida. disfunción hepática. la regulación del ciclo celular y la inmunidad. Si las opciones son limitadas y una enzima con actividad estrella se deben utilizar. Se caracteriza por fiebre prolongada. y los 40 restantes son codificados por el Bam HI-Una región transcripción hacia la derecha (BART). EBV fue el primer virus humano identificado para expresar miRNAs. Los microARN (miRNA) son un subconjunto de 18-25 nucleótidos. Ellos han demostrado que desempeñan un papel clave en el crecimiento y el desarrollo. y hiperferritinemia. El FI puede proporcionar directrices generales para la elección de las condiciones óptimas RE (BamHI). EBV-HLH es un trastorno potencialmente mortal que progresa rápidamente. Hasta la fecha. y que en su mayoría se presenta en niños. Además de la aplicación inmediata de estos hallazgos para guiar la digestión RE. No existió un efecto sobre el FI de la BamHI en relación a la forma superenrrollada o linealizada del DNA. Discusión y conclusión: Cada RE tiene su propio FI en cada buffer específico.

Las células infectadas con EBV se determinaron mediante la comparación de la carga viral de tipo celular específico. Muestra de sangre Muestras de sangre periférica con EDTA se obtuvieron de los 45 sujetos. entre septiembre de 2012 y septiembre de 2014. La diana celular fue la subpoblación de linfocitos que mostró la carga viral más alta. así como los criterios de diagnóstico para EBV-HLH. Células mononucleares de sangre periférica se separaron de 4 ml de sangre entera fresca por centrifugación en gradiente de densidad usando el Medio de Separación de Linfocitos y después se resuspendieron en medio RPMI 1640.70 ) se consideró positiva.Materiales y Métodos Los pacientes Quince pacientes con diagnóstico de EBV-HLH se inscribieron en este estudio en el Hospital de Niños de Beijing. CD8 + . China). El estado de la infección (infección primaria y la reactivación del EBV) fue definida por pruebas serológicas para anticuerpos específicos para los antígenos de EBV. Una carga viral de ≥ 5 × 10 2 (10 2. y CD56 + y se incubaron durante 30 min a temperatura ambiente. Si los métodos serológicos eran difíciles de estado de infección por VEB diagnóstico. Las concentraciones de ADN de EBV en las muestras de células se expresaron como copias por microgramo ( μ g) de ADN. CD19 + . la detección de genoma EBV usando PCR se utilizó para evaluar la infección por VEB. utilizando ya sea QIAmp DNA Micro Kit (Qiagen. Cuantificación EBV-DNA El ADN total fue extraído de 200 mu plasma L o 1 × 10 5 células (como un estándar). Todos los pacientes con diagnóstico de EBV- HLH cumplen los criterios diagnósticos HLH-2004. 15 pacientes con diagnóstico de la mononucleosis infecciosa (IM) y 15 niños sanos previamente infectados con EBV se utilizaron como grupos de control. La carga viral se detectó mediante PCR en tiempo real cuantitativa (qPCR) usando un kit comercial EBV ADN cuantitativa (Genes Daan. Las suspensiones celulares se mezclaron con los anticuerpos de talón conjugado magnéticos respectivos contra CD4 + . Discusión y Resultados: Este es el primer estudio que reporta el perfil y el patrón de miRNAs codificados por EBV en niños con EBV- . Alemania) o QIAamp Viral RNA Mini Kit (Qiagen).

Objetivos: Se investigó la influencia de la variación genética del locus de la transformación del factor de crecimiento alfa (TGFA) sobre la relación entre el tabaquismo y las fisuras orales. El elevado EBV-miRNAs puede estar implicado en el mecanismo de EBV-HLH. (Nivel de latencia II). la ubicación geográfica. los fármacos antiepilépticos. Se observó que miR-BART22 se expresa en niveles más altos en EBV-HLH que los de monocleosis o niños sanos. el sexo. La expresión de miRNAs BHRF1 podría estar asociado con VEB lítico de replicación. posiblemente. nutrición y el consumo de ácido fólico).HLH. Muchos pacientes con EBV-HLH manifiestan en la fase precoz de esta enfermedad. Los estudios de análisis de segregación se han ampliado mediante el estudio de genes y desequilibrio de unión. También se ha informado de que el consumo de tabaco. La asociación detectada entre CL / P y alelos específicos en el gen transformador factor de crecimiento alfa (TGFA) apoya fuertemente a TGFA como el mayor gen componente en CL / P . el medio ambiente y su interacción. y. que sus factores de riesgo incluyen genes. en el que el BART miRNAs se expresa en niveles altos y BHRF1 miRNAs se expresan en niveles bajos. Introducción: El labio leporino y la hendidura en el paladar (CL / P) es un defecto de nacimiento común. consumo de alcohol aumenta la tasa de incidencia de fisuras orales en los recién nacidos. El trabajo subsiguiente demostró que durante el desarrollo craneofacial TGFA se presentó a niveles altos en el tejido epitelial del . EBV. nacionalidad.

el producto amplificado se digirió completamente con un sitio de restricción. En comparación con los controles. . para la detección de la variante de BamH1 en el gen TGFA. Resultados: El polimorfismo para BamH1 TGFA se genotipo para 76 casos de CL / P. TGFA promueve la síntesis de la matriz extracelular y la migración de las células mesenquimales para asegurar la resistencia del paladar fusionado durante la ruptura de la costura. el exón VI del gen se amplificó por PCR utilizando condiciones estándar junto con primers modificados (Forward Primer: gcctggcttatttggggatt 3 'y cebador inverso: 5'aaagggcaaggaaacacagg'3). Irán. el análisis del genotipo de regresión logística mostró que el genotipo BamH1 se asoció con una mayor susceptibilidad de CL / P. Taq I en el intrón 5 y BamHI en el exón 6). Genotipado del gen TGFA: El genotipado del SNP (Polimorfismo de nucleótido simple) se realizó mediante un ensayo con una reacción en cadena de polimerasa- polimorfismo de longitud de fragmentos de restricción (PCR-RFLP). Materiales y métodos: Las muestras fueron obtenidas en el Hospital Mofid en Teherán. El grupo control consistió en 218 muestras de ADN de iraníes. Los fragmentos de ADN se separaron y se visualizaron por electroforesis utilizando 8% geles de poliacrilamida. En los cultivos palatales. El sitio polimórfico BamH1 se encuentra en el exón VI. y dos bandas específicas de 120 pb y 54 pb fueron indicados en el genotipo de tipo silvestre. 29 casos de hendidura de paladar. contiene seis exones y se extiende por 80 kb del ADN genómico.borde medial de los estantes palatinos en el momento de la fusión en estante. Después de la digestión con la enzima de restricción BamHI. y 218 controles. Tres polimorfismos comunes del gen TGFA han sido investigados con la susceptibilidad a la CL / P (RSA I. por lo tanto. en 2013-2015. El primer para el PCR se diseñó basándose en la secuencia de flanqueo SNP descrito en “Ensembl genome”. sin hendiduras (102 varones y 116 mujeres) cuyas muestras de sangre estaban disponibles. El TGFA gen se localiza en el cromosoma 2p13 11. El grupo de casos consistió en 105 niños (65 varones y 40 mujeres) con CL / P no sindrómica (76 con labio y paladar hendido y29 solo labio leporino).

(2007). Genemol. estratificada por la presencia o ausencia de polimorfismo en BamH1 TGFA. Segal.2006. Sci. 2005. How restriction enzymes became the workhorses of molecular biology. Benner JS. Nucleic Acids Res. Biophys. Obtenido de http://genemol. Conclusiones: Los resultados de este estudio indican que el fumar de la madre al primer trimestre de gestación y mutaciones en el locus TGFA de lactantes están asociados con la fisura labial y / o paladar (CL / P) no sindrómica. NEBcutter: a program to cleave DNA with restriction enzymes. MAnual de Prácticas Biología molecular . Roberts RJ.-Y. USA. e. Claus TE. Proc. Packard SL. Natl Acad. a. Samuelson JC. M. 2003. Posfai J. Rau DC. Sidorova NY. revelaron que el riesgo de fisura entre los niños con polimorfismo en BamH1 TGFA fue mucho mayor que para los niños con el alelo común cuando sus madres fumaban cigarrillos. (2005). J.html Kenneth. Engineering a rare-cutting restriction enzyme: genetic screening and selection of NotI variants.Los análisis para el riesgo de fisura a partir del tabaquismo materno. Nucleic Acids Res. . (2008). Morgan RD. Xu S. Vincze T.org/biomolespa/Enzimas/enzimas-de-restricc. BamHI Complexed with B-DNA.: Publidisa. México D. 2004. Roberts RJ.F. Differences between EcoRI nonspecific and “star” sequence complexes revealed by osmotic stress. Bibliografía Herverg y Barcia.