Azadmanesh et al.

, J Plant Pathol Microb 2013, 4:1
Plant Pathology & Microbiology http://dx.doi.org/10.4172/2157-7471.1000154

Research Article Open Access

Detection of Pectobacteria Causal Agents of Potato Soft Rot in North Western
Provinces of Iran
Sima Azadmanesh1*, Alireza Marefat1, and Kayhan Azadmanesh2
1
Plant Protection Department, College of Agriculture, Zanjan University, Zanjan, Iran
2
Virology Department, Pasteur Institute of Iran, Tehran, Iran

Abstract
Various bacteria belonging to Enterobacteriaceae are known to be agents causing blackleg and soft rot in
potato. In this study, a rapid and specific detection method was used to investigate bacteria in some northwestern
provinces of Iran (Zanjan, Kordestan and eastern Azarbaijan). 26 strains were selected for the study that had been
identified in previous studies as representative pathogens, they were as follows: 14 Pectobactrium carotovorum
subsp carotovorum, 7 Dickeya chrysanthemi and 5 Pectobactrium atrosepticum. Primers Y1/Y2, Expccf/r, ADE1/2
and Eca1f/r, published as specific primers for the pathogens. They were tested to determine if they could be used
for specific amplification of DNA in the strains. The expected specific fragment was not amplified in many strains or
several non-specific bands, some close to those expected fragments were amplified. Specific primers for amplification
of the DNA of pathogens were designed by sequencing the ITS region from representative strains and a PCR test
was developed. In the PCR test a 300 bp fragment was amplified from all strains collected from the provinces. In
specificity tests, no PCR products were obtained from other bacteria belonging to other genera.

Keywords: 16S-23S rDNA intergenic transcribed spacer; Pectobactrium time consuming and relatively insensitive because of the high level
carorovorum subsp carotovorum; Dickeya chrysanthemi; Pectobactrium of saprophytes in the samples [9]. Serological techniques using both
atrosepticum polyclonal and monoclonal antibodies have also been used [10] and
current identification methods based on biochemical and phenotypic
Introduction characterization are neither rapid nor accurate [2]. However, diversity
Potato is the second most important crop after cereals in of isolates in serological properties does not allow for reliable and
northwestern Iran because of favorable climatic conditions meaning accurate identification and there are high serologically heterogeneity
that it can be cultivated throughout the region. However, soft rot and cross-reactions in this technique [11]. As an alternative, PCR-
caused by bacteria belonging to Entrobacteriaceae is among the main based methods have been used for specific and rapid detection and
factors contributing to yield loss in this area. identification of pathogens isolates, it is notable that PCR techniques
greatly enhance detection sensitivity, simplicity and rapidity compared
Recently, bacteria belonging to the genus Erwinia, which causes soft with other methods of identification and are based on specific
rot in various plants, were grouped into the genus Pectobacterium and amplification of a target DNA sequence that is unique to a bacterial
Dickeya [1] and the main virulence determinants of these genous are genome [9,12] (Table 1). Also, since Pectobacterium carotovorum
the pectolytic enzymes secreted through the type II secretion system. subsp. carotovorum and subsp. atroseptica can affect potato tubers
There are two species P. carotovorum and D. chrysanthemi that are with another pathogenic fungi and bacteria(Phytophthora infestans,
particularly damaging to potato crops worldwide. The former is a major Phytophthora erythroseptica, Pythium ultimum and Fusarium
pathogen in temperate regions, while the latter is the most damaging in sambucinum), Atallah and Stevenson, developed a methodology to
warmer climates. P. carotovorum has been divided into five sub species detect and quantify of the five aforementioned diseases from whole
based on biochemical, physiological and pathogenicity characteristics potato tubers, using real time quantitative polymerase chain reaction
from which two subspecies carotovorum and atrosepticum are able [13].
to cause symptoms on potato both during the vegetative cycle of the
Recently, Pectobacterium taxa are distinguished and classified with
crop and in stored tubers [2]. Also a new Pectobacterium subspecies,
Multi-locus Sequence Typing (MLST) [14].
P. carotovorum subsp. brasiliensis was recently described in Brazil and
later found in the United States, Israel, and South Africa [3]. While potato soft rot caused by Pectobacterium spp. is considered
to be a serious problem in northwestern Iran, an efficient and reliable
As a first step in this study of the disease in northwestern Iran,
pathogens present in potato crops grown for consumption and seed
tubers were collected and identified as P. c. subsp. carotovorum, P. c. *Corresponding author: Sima Azadmanesh, Plant Protection Department,
subsp. atrosepticum and unusual strains of P. carotovorum [4-6]. College of Agriculture, Zanjan University, Zanjan, Iran, Tel: 0098-2188444836; Fax:
0098-2188451144; E-mail: s.azadmanesh@srbiau.ac.ir
The major source for primary inoculum of these bacteria in potato
Received November 13, 2012; Accepted December 27, 2012; Published January
crops is infected/infested seed tubers. Harmful bacteria can survive in 01, 2013
soil and can be transferred by irrigation water therefore, it is important
Citation: Azadmanesh S, Marefat A, Azadmanesh K (2013) Detection of
to detect the pathogen in seed potatoes and other inoculum sources to Pectobacteria Causal Agents of Potato Soft Rot in North Western Provinces of
eliminate the disease [7]. Iran. J Plant Pathol Microb 4:154. doi:10.4172/2157-7471.1000154

Traditionally biochemical and physiological tests have been used for Copyright: © 2013 Azadmanesh S, et al. This is an open-access article distributed
under the terms of the Creative Commons Attribution License, which permits
identification and differentiation of Pectobacterium isolates [8], however unrestricted use, distribution, and reproduction in any medium, provided the
traditional techniques of bacterial isolation and characterization are original author and source are credited.

J Plant Pathol Microb
ISSN:2157-7471 JPPM, an open access journal Volume 4 • Issue 1 • 1000154

0. 2 min at 72°C and one cycle as final extension for 7 min at 72°C. one Klebsiella pneumonia and the 1491f and L1r from conserved regions in the flanking of 16S -23S rDNA other Escherichia coli (naturally occurring around potato tubers) were transcribed spacer region as described by [17]. was as follows: The PCR mixture per reaction (50 µL) contained. ECA1f/ECA2r derived from a DNA probe specific to 690bp The PCR mixed (20 µL) consist of 0. 2 min at 72°C and for the final step.16 µM each of desoxy nucleotides All bacterial strains were cultured at 27°C on nutrient agar medium dATP.5 U Taq polymerase.5 min and finally 72°C for 10 min. 25 cycles of 1 min at 94°C. and 1 min and 30 the Bioanformatics Net database.5U Taq polymerase. Genomes of D. 2 µL 10X PCR buffer. 5 µL 10X PCR buffer and 2 µL genomic DNA. 200 µM each of desoxy nucleotides dATP. 30 cycles of 1 min at 94°C. which is not pathogenic on potato. chrysantemi were amplified using Iranian isolates and to develop a molecular PCR-based method to ADE1/ADE2 primers obtained from Bioneer (England). dCTP. dTTP.1000154 Page 2 of 6 Primer name Target gene Product length at 94°C as initial denaturation step. an open access journal Volume 4 • Issue 1 • 1000154 . 100 ng DNA. The protocol reactions were carried out by the Seqlab Company. DNA was stored at For all samples. J Plant Pathol Microb 4:154. Reaction conditions for provided from pasture institute of Iran. carotovororum subsp carotovorom. doi:10. 8 min Bacterial strains used in this study and their sources are listed at 72°C [16]. carotovorum subspecies except P. Azadmanesh K (2013) Detection of Pectobacteria Causal Agents of Potato Soft Rot in North Western Provinces of Iran. Detection of bacteria with primers Y1 and Y2. this study was conducted to Detection of bacteria was done with primers ADE1/ADE2. 0. 40 cycles of 30s at 94°C. 8 min at 72°C. 0. DNA of desoxy nucleotides dATP. The modified from [9] and PCR amplification was carried out in Eppendorf chromas software (Technelysium Pty Ltd. Each reaction (50 directly from an agarose gel with a pipet tip after electerophoresis µL). dGTP. After amplification two representative isolates Pcc and Pa were carotovorum subspecies was tested. Azl2(Pcc). 100 µM each of desoxy E. Two standard strains 16S-23S rDNA spacer region amplification and sequencing were obtained from ICMP and to assess the specifity of DNA-based Genomic DNA of all isolated bacteria were amplified using primers methods two isolated bacteria. have been carotovorum was amplified with a set of primers EXPCCF and EXPCCR deposited in Genbank az accession numbers HM130661. and final extension step one cycle at 72°C for 7 sequences in the GenBank. atroseptica nucleotides dATP. The sequences were compared with s at 72°C for 34 cycles.Citation: Azadmanesh S.6. as described by [11] contained 0. using the min.15]. based on the 1491f and L1r primer were recovered betavasculorum. a 50 µL PCR were: 2 mM MgCl2. Twenty-six strains of the pectolytic Pectobacterium and Dickeya were obtained as described by [5. carotovorum sub sp strains Azs52(Pca).5U Taq polymerase. 45s at 62°C. in which resolved detect all P. The protocol detect and distinguish pathogens rapidly and accurately. 0. Qld. (Bayer) for 2 days.2 U taq polymerase (Cinnagen).5% -20°C until required. Therefore. basic Alignment Search Tool (BLAST). 45 s at 72°C and for the final step.2 µmolL-1 final sequencing was performed in both directions and the sequencing concentrations of each primer and 5 µL of DNA extract. 100 pmol each of primers Bacterial strains and 1 µL DNA. 0. Marefat A. dTTP. polymerase chain reaction cycler (Germany). dCTP. dGTP. specific and large subunits 16S-23S rDNA transcribed spacer region of Iranian for P. Azs2(Pcc). HM130662. 0. Australia) was used for editing and regenerating the sequences. method to detect and identify pathogens in pure culture or plant material has been lacking. atrosepticum genomic DNA was ADE1/ADE2 pectate lyase-encoding pel gene belonging 420bp done using primers ECA1f/ECA2r as designed by De Boer and Ward to the pelADE family [8]. dTTP. chrysantemi. 4 µL(1 mmol L-1) each Kit as described by the manufacturer (Roche. Amplification HM130663 and HM130664 respectively. carotovora subsp.5 µM each of primers and 1 µL DNA. A primer set was obtained from chosen for sequencing of the ITS region. The J Plant Pathol Microb ISSN:2157-7471 JPPM. Sequence data from the small Detection of bacteria with primers EXPCCF and EXPCCR. 5 µL of PCR products were analyzed on 1. was performed in a final volume of 50 µL PCR mixture containing 5 Sequence data analysis and design of specific PCR primers for µL 10X PCR buffer.5 µmol (2. extracting method described by Yap et al. specific for P. specific estimate the efficiency of available PCR-based procedures to detect for D.5 U)Taq polymerase and 1 µL (100 ng) the pathogen primers. 1 min at 65°C. dGTP. dGTP.5 µM Mg++. agarose gels in TAE buffer and stained with ethidium bromide (0. dGTP. to the pelY family EXPCCR/ EXPCCF primers generated from a URP-PCR 550bp Detection of bacteria with primers ECA1f/ECA2r. Germany). P. 1 min at Y1 / Y2 pectate lyase-encoding pel gene belonging 420bp 60°C. dCTP. dTTP. using the following program [12] one cycle of 4 min and sequencing of the ITS were carried out as described by [17]. dCTP.5 µg/ Detection of bacteria with published specific primers mL) electrophoresd at 35V/cm for 1 h. PCR amplification was carried out in an Eppendorf thermal cycler. synthesized by Bioneer (England). 0.4 µM each primer. Alignment and comparition thermal cycler and was programmed as follows: An initial denaturation were performed with ClustalX and GeneDoc programs available on step at 94°C for 5 min.5 µL each of desoxy nucleotides dATP. 1 min at 94°C. as described by [12]. The PCR was in identificational studies of pectobacterium ssp. Materials and Methods 2. Azl52(Pca). dTTP. Tehran. 3 µL MgCl2 (25mmol L-1 ). EMBL. 5 and then reamplified [18]. The primer set used in this study was able to obtained by the 'band stab' amplification technique. 64°C for 45 s and Genomic DNA was extracted and purified using modified 72°C for 1. Germany. PCR products were purified using a DNA µL of PCR buffer 10X. fingerprinting derived polymorphic band atrosepticum. carotovorum subsp PCR products. DNA fragments were sigma (Germany). 2 µL Table 1: Target genes and length of the amplicons of PCR primers which are used 10X PCR buffer. run for 5 min at 95°C in the first cycle. DDBJ and PDB databases. PCR amplifications were carried out in an Eppendorf thermal cycler as follows: 94°C for 2 min as Preparation of bacterial DNA an initial step followed by 31 cycles of 94°C for 45 s. in table 1. The PCR was run for 5 min at 94°C in the first cycle. specific for P. dCTP. PCR amplification was performed in an Eppendorf thermal Comparisons of sequences of ITS. 2. PCR amplification of P. [10].4172/2157-7471.

.CGG.CC...AC...............1 : ... S52:Pectobacterium carotovorum subsp atrosepticum (Genbank....1 : ..C.. : - AF373187..............A.........TC......................A............C..A.........C................ : 211 tg a gctgac gtg tgtcccc tcgtctagaggcc aggacac gcccttt 220 * 240 * 260 * 280 * 300 * 3 s52 : ...----...----...A..............-.........ACGG.....C-................------------TAA..T..T..CC.G.... : 211 AF373180..C..................................................... : 211 AF373178.....C........GCGC..........AG......T...........G..A....................................A.....CT........................----.T...................................... Dch17: Dickeya chrysanthemi (Genbank........................................ : 253 AF373203......... Pca8: Pectobacterium carotovorum subsp atrosepticum (Genbank................GA............. : 211 AF373181.....................G..C.........T. : 105 AF373185...T....................... Sequences used in this study were intergenic transcribed spacer region: 23 from the small ITS of the retrieved from Genbank or taken from published reports [17]...............1 : --. one forward primer The sequence alignment of the small ITS region reaveled the presence named S1-F (5'-ACC TGT AAG AAC CTG CCT-3') and another primer of a single copy of the tRNAGlu gene and a single copy of the tRNAIle and as reverse named S1-R (5'-CAG TGT GTC GTT TCA ATT T-3') were designed on the basis of differences between small ITSs (Figure 1).................... AF373179)..........A........... : 102 AF373203..........................1 : ..A..................................G.-GC..................................1 : ............ : 105 AF373199.........G................................ Dch2: Dickeya chrysanthemi(Genbank...........---T........ : 105 AF373184............-....T............GCCGA....G.........GC...A..A.....C............T-.................... : 105 accgtaggggaacctgcggttggatcacctccttac aaga gtg t g g gtg cacacagattgtctgatgaaaa a gag caa gc ct * 120 * 140 * 160 * 180 * 200 * s52 : -------------C.....C.........1 : .....1 : .. : 407 AF373181.. : 304 AF373176......... : 303 AF373178............ Pca3: Pectobacterium carotovorum subsp atrosepticum (Genbank....1 : ---------------------------------AC.....................A---------------------------------CC..---..C... AF232681)................GCGT......-.G..................--TTG......................G................................. : 303 AF373188.........................CG.....--------.1 : .TG........... : 303 AF373199................................A......................... : 68 AF373183...CC..................C.........CG...AC..............-......1 : -------------............TGT.T....-.................................A....................TG-.........G............ : 157 AF373200..................G...G......CA-----C...CGG....................... : 105 AF373178.........................----......TGT...............GC-ACC....T....-----.... : 102 AF373202...-............ Azadmanesh K (2013) Detection of Pectobacteria Causal Agents of Potato Soft Rot in North Western Provinces of Iran.CGG................G.....-.T. : 211 AF373182.........------------..Sequences of the primers are shaded and arrows indicate the direction of the priming of the primers.. HM130664)...... AF373186)........CGG... : 178 AF232681.......... : 105 AF373179.1000154 Page 3 of 6 multiplex sequence alignment consisted of 37 sequences from 16S-23S tRNAAla genes in the large region......G....-----------------------------A.........AA...........T. Marefat A.........---.G...............1 : ..........AA.-----------------------------A.................................T. : 303 AF373189.....AC......................-.............CAC............T............T..C..............1 : ..A.......G...............Citation: Azadmanesh S. Pca9: Pectobacterium carotovorum subsp atrosepticum (Genbank...........AA......................TG..................................T-...G............A...................AGAG--------...GT.........G........T.. Pca10: Pectobacterium carotovorum subsp atrosepticum (Genbank........-.......................T......G........ : 303 AF373185................1 : ................TG............................. Pca4: Pectobacterium carotovorum subsp atrosepticum (Genbank.-........T-...............................A..CCT..............CCT...----.G....-...1 : ....1 : ..CT................. : 302 st : ..............................T.........A..........1 : ..G......... : 407 Figure 1: ITS sequencing used to design primers specific for PCR amplification of potato soft rot pathogen rDNA..1 : --......C. : 82 AF232687.A.............1 : ....................................1 : ...........----..........--------......TG................GT.......A. J Plant Pathol Microb 4:154..........T-----CGC.............-.AGAG--------. : 303 AF373186...................TC..... AF232687)......CC..G..-........... Pcc12: Pectobacterium carotovorum subsp carotovorum (Genbank.......................A....GA..1 : .....................A..... : 211 AF373176.AA......... : 102 AF373201...........CGG...G....... : 339 AF232687.........T......G....................T.......... comparing large and small subunits of the ITS........... * 20 * 40 * 60 * 80 * 100 s52 : -------------------... Pcc13: Pectobacterium carotovorum subsp carotovorum (Genbank....-..... : 105 AF373181...---T.A........................... : 407 AF373177.............C.............T......CC..1 : ................... AF373185).. : 303 cacggc gtaacaggggttcgaatcccct ggggacgccaat c ga tg gtgaaag ca tca g ta c taaa tgatt 20 * 340 * 360 * 380 * 400 * 420 s52 : --C...............AT...TG..-............A....A......T...... AF373183).................G................................... : 304 AF373180........................C.............1 : ..A..............CC..........G........CGA..........GT..CA...................G............TA : 405 AF373178..............AG......................A.....................1 : .................... : 105 AF373188......GT... : 374 AF232681.......GA.........----------....... : 123 AF373183...................AA.............. : 105 AF373189.........1 : --.......C.....TGG..----------------------------------....... : 105 AF373182.......... Pcb11: Pectobacterium carotovorum subsp betavascolorum (Genbank..-----.....C...CGA.......C-... : 211 AF373177..............C--------..1 : ......C...-----.......TG.C..C.-....AC..............AGAG--------.......A---------------------------------AGCGA..A.....1 : --. : 211 AF373188................................. Pcc14: Pectobacterium carotovorum subsp carotovorum (Genbank......................-......G...T......CA............G--..1 : .....................................A----.1 : .....................................................-........1 : ..... : 83 st : -------------------....CTG...T..............................GA........... AF373200)........................................... Pcc16: Pectobacterium carotovorum subsp carotovorum (Genbank.GTAAATAG.....C............................ Dch20: Dickeya chrysanthemi (Genbank.... AF373201)......----.A..A----......1 : ...... HM130661)...................G.............................................1 : .............................. carotovorum subsp carotovorum (Genbank..........G------------AA......................1 : ..C..AA..............AG----------.CGG...C........TC........................................C-.............................TCCGTAA.............................-............... : 407 AF373179... : 105 AF373180...4172/2157-7471.A..............A-A...........................C.....1 : .....................A..............CG... AF373184)..----...CGA..............G...G...............A...............A.......G...C....CGG...................1 : ...............C...........1 : -------------..---......................TG....... : 211 AF373184..........................1 : ..............----.......1 : -------------............... : 271 AF232681.1 : -------------..... : 253 AF373202..........TC... : 72 AF232681................GT.........--------............ AF373182)........1 : .......C--------......CGA....1 : ......TC..T.......C--------......-.C...A..........-----------------------------A......G........ : 105 AF373177...A... : 211 AF373199........... : 211 AF373185........................CGG......CGA.....CG...........................................G...C--------.....C.... AF373203).............................AC................... : 102 AF373200...............C......................T.TG.G........ AF373187).....A.........1 : .................. : 211 AF373179...............1 : ........--------..1 : .1 : ..-.. Pca1: Pectobacterium carotovorum subsp atrosepticum (Genbank........GC...........G................ AF373177).......................1 : .......G..A...AA.....................A............ : 230 st : ...........T... : 305 AF373183.................... AF373199).................C..........--------..............1 : --G.............A...........................C....CTGCT........A----.....A.................--TTG............. S2: P...................T....... AF373180)..A. After 16S-23SrDNA and 14 from the large ITS of the 16S-23S rDNA region.........C..TG.......1 : ....1 : ---------------------------------AC..............1 : ---------------------------------------------------------------------------------------------------------....................A...................-...........C..T........... AF373178).......A.......TC.......C--------.................CGAT-----TGA................................C.....T.................GA.....C.................---............T........................ : - AF373187.....A......G..G.. : 216 AF373183....1 : ........CG...1 : ......... AF373189)....TTG.1 : .............C-.....---.............................. : 105 AF373176.. Pca5: Pectobacterium carotovorum subsp atrosepticum (Genbank. : 137 st : -------------...G.........-..............C--------...........................T.....1 : .....................................................CGG.....................G................C............... : 35 AF373187...............AA.................................--------.................... Dch19: Dickeya chrysanthemi (Genbank................ : 407 AF373180.........A........C................-.................TT-....A.. Pca6: Pectobacterium carotovorum subsp atrosepticum (Genbank.........1 : .....-..G..A----....1 : --..........----..T...----.......T..............................GT............... AF373202)......... AF373188).......1 : ...................................AA...........1 : ............A.........................G....................................... : 157 AF373203..............AC........-..........T.......TC.....G.....................G. doi:10....CA-----CA..........................A.......A........ : 304 AF373181....----................... an open access journal Volume 4 • Issue 1 • 1000154 ...T.GT..-G.....AC.A.......................--------..A.C............C.. : 304 AF373177....1 : --........... : 211 AF373189.A..CTG.......C.........1 : -------------.G.1 : ...1 : ..T.......CC.........--------.............. J Plant Pathol Microb ISSN:2157-7471 JPPM......................1 : ---------------------------------------------------------------------------------------------------------.........A............ : 211 AF373186.............................. : 105 AF373186.............CA..C..........AGAG--------............C....................-----..........T............... : 304 AF373184.............................G.............C...............C.....-----..............C... : 253 AF373201........................G...----............T.----............................1 : ........C..............A.......AA...A........ : 240 AF232687....AA...........1 : ..................GT..............................CC. AF373181)....G...........................G......TC.A....-----................................................A......................... : 304 AF373182... AF373176)..C....AC.....................................................T..T......GT..1 : .C......C.... Pca7: subsp atrosepticum (Genbank........................A.......T-...G..----------------------------------------------------------------------. Dch18:Dickeya chrysanthemi (Genbank.........GT....... : 157 AF373202..............T-.....1 : .. : 251 AF373200.............................AGCA....C..................C--------. : 136 AF232687..AT........................................................................ : 304 AF373179.......-. : 157 AF373201. Dch21: Dickeya chrysanthemi (Genbank...----......C.......1 : ................A............C........1 : .................................A.......................A....1 : ........ Pcc15: Pectobacterium carotovorum subsp carotovorum (Genbank....-.............AAT...............................G......A...........1 : ....G................................................................ATGAG.1 : ......................CGG...................-----------------------------A...............................................................

chrysanthemi isolates following program: initial denaturation in 94°C for 5 min followed by could amplify 420-bp amplification products using ADE1 and ADE2 25 cycles of 94°C for 45 s.atrosepticum . + E2 Potato Ijrood P. atrosepticum strains whereas a 690-bp amplicon buffer and 4 µL genomic DNA. (ECA1f and ECA2r) in PCR. + 34 Potato Dehgolan P. + Eca52 Potato Sarab P. chrysanthemi.c.5 U) Taq polymerase. of which two of them were standard isolates.c. Using P. + Ecc42 Potato Torkamanchay P.carotovorum . - + B5 Potato Zanjan P.1000154 Page 4 of 6 PCR cycling conditions amplicons in PCR in contrast to the 550-bp amplicon obtained with two standard Pcc isolates.c. .carotovorum . . many fragments were amplified from 1 µM of each primer. .c. Phenotypic and bacteria collected from soil around tubers. . carotovorum sub sp carotovorum and P.c. .carotovorum .carotovorum .5 µL( 2. Marefat A.atrosepticum . . - Hv Potato Tajarg D.carotovorum . + Ech25 Potato Azarshahr P. none of the The rRNA genes are essential for the survival of all organisms. 55°C for 45 s and 72°C for 45 s and at the specific primers (Table 2). + D8 Potato Kheir abad P. + 49 Potato Dehgolan P.c. carotovororum subsp carotovorom –specific PCR. .atrosepticum . J Plant Pathol Microb 4:154.carotovorum .carotovorum + .chrysanthemi .19]. . Azadmanesh K (2013) Detection of Pectobacteria Causal Agents of Potato Soft Rot in North Western Provinces of Iran.chrysanthemi . atrosepticum specific primers The reaction mixture in a 50 µL volume containing 2 mM MgCl2. + Ecc16 Potato Ajabshir P.c. . not amplified from any strains of P. IPIb E. + Ech21 Potato Azarshahr P. - E. carotovorum –specific PCR.atrosepticum . atrosepticum and Dickeya chrysanthemi.c. for better comparisons two genotypic technique confirmed this level of diversity [9. 5 µL 10X PCR DNA of all Iranian P.carotovorum . + Ecc74 Carrot Bostan abad P.4172/2157-7471. + 44 Potato Ghorve P. . Using the 1491f/L1r consensus primers. no PCR amplicon were obtained from test strains or other P.c. + 40 Potato Ghorve P. . In test P. + Ecc62 Carrot Bostan abad P.c . The amplification was carried out in an Eppendorf thermal cycler (Germany). + Ecc11523 .carotovorum . carotovorum subsp Discussion carotovorum strains. + Ecc10 Potato Azarshahr P. . The reaction was carried out with the must be obtained using these primers. - Hd1 Potato Tajarg D. IPI Klebsiella pneumonia - Table 2: List of bacterial strains tested in this study and their origins and detection of Iranian pectobacterium with primers Y1 and Y2. dCTP. individual isolates within D.c.carotovorum .c.atrosepticum + . EXPCCF and EXPCCR.c. . dTTP.c. ICMP P. .carotovorum .carotovorum . . . ADE1and ADE2 and designed primers S1f and S2r. . end 72°C for 5 min. 12 strains of Iranian Pcarotovorum subsp carotovorum produced Ribosomal RNA genes evolve slowly and are highly conserved but it has Strain Isolated from Geographic origin Species/sub species Primers Primers Expccf Primers ECA1f PrimersADE1 Primers S1f and Y1and Y2c and Expccrd and ECA2re And ADE2f S2r(designed)g CA3 Cabbage Zanjan P. PCR specificity tests atrosepticum generated several different banding patterns with ITS- To assess the specificity of the designed primers. .carotovorum . . J Plant Pathol Microb ISSN:2157-7471 JPPM.carotovorum + . Produce was observed in five P.carotovorum . . These various banding patterns showed higher levels out with DNA from 27 Enterobacteriaceae ssp strains as epiphytic of diversity than within other species or subspecies.carotovorum + + - Hd Potato Tajarg D. PCR was carried PCR (Figure 2).carotovorum . . + Ech33 Potato Sarab P.16 µM each of desoxy nucleotides dATP. . 1 µL.c. P. + D34 Potato Kheir abad P. None of D. 0.c. isolates belonging Klebsiella and Escherichia genera were examined. . . . + Eco57 Carrot Sarab P. + unnamed Potato Ghorve P. .c. . ICMPa P. an open access journal Volume 4 • Issue 1 • 1000154 .chrysanthemi . . + 62 Potato Dehgolan P. ECA1f and ECA2r.A 434-bp DNA fragment was bacterial genus (Figure 3). doi:10.c. 0. dGTP.chrysanthemi .coli - K .c. + Ecc6 Potato Azarshahr P. . PCR specificity and sensitivity tests Results All 26 strains of these pathogenic bacteria were tested with the CR tests with specific primers designed primer and all Iranian strains produced PCR product (300-bp fragment).carotovorum .c. - Hd3 Potato Tajarg D.carotovorum + + - Ecc55990 . .Citation: Azadmanesh S.

P. atrosepticum strainEca52. P. Marquez-Villavicencio DPM. This failure might be 700 related to genomic differences between Iranian pectobacterium agents 600 500 and other subspecies of pectobacterium. Ward LJ (2012) Pectobacterium spp. (2007) Host Range and (Type strain.6. carotovorum subsp carotovorum strain Ecc74. Avrova AO. P.Ecc11523). Lane1.Citation: Azadmanesh S. Marefat A. However. carotovorum subsp carotovorum strain B5. Genomic DNA from all Iranian isolates from potato previously 10. carotovorum subsp carotovorum Ecc16. P. atrosepticum strainEco57. P.19th Iranian Plant Protection Congress. using these designed primers.5. Azadmanesh K (2013) Detection of Pectobacteria Causal Agents of Potato Soft Rot in North Western Provinces of Iran. carotovorum subsp carotovorum (Type 4070-4076. L. Potato Facts Bullet No. Tehran. carotovorum subsp carotovorum strain Ech33. P. Ophel-keller K.9.13. of the soft rot erwinias by 16S-23S intergenic transcribed spacer-PCR and Tehran. P. carotovorum subsp carotovorum strainEcc42. atrosepticum strain Eca52. however these isolates could not be identified by PCR using Pectobacterium subspecies specific primers. carotovorum strainEcc62.2493.8. carotovorum subsp carotovorum strain Ecc6. isolated around infected tubers and none of strain. P. In summary our results strongly suggest that Iranian pectobacterium agents of potato soft rot strains are different from other pectobacterium 500 400 and that a PCR-based assay based on the 16S-23S transcribed spacer 300 region was developed to detect them. Atallah ZK. Phytopathology 97: 1150-1163. P. Tehran. Ma B. Toth IK. carotovorum 4. Groves RL. subspecies and Iranian pectobacteria causal agents of potato soft rot. Plant Dis 95: 232-241. 1. P. carotovorum by primers generated from a We can not exactly explain the failure of amplification of the URP-PCR fingerprinting-derived polymorphic band. University of Maine. P. P. stem rot syndrome of potato in Canada. carotovorum subsp Disease Severity Is Affected by Potato Physiology and Pectobacterium taxa. et al. Iran). carotovorum subsp carotovorum strainEcc10. These properties made them 6. P. Harighi B. Darrasse A. P. associated with bacterial produced bands were between 200-800 bp [17]. Jouan B. subsp carotovorum and Dickeya chrysanthemi on the basis of 11. strain). D.14. De Boer SH. Reedy RM.11.10.15. Priou S. molecular assessed by amplifying DNA of all Iranian isolates and no amplicons weight markers (bp) (100 bp. Charkowski AO (2004) Genomic diversity of Erwinia carotovora subsp. carotovorum subsp carotovorum strain in detection and identification of xanthomonads associated with pistachio Ech25. carotovorum subsp carotovorum strain CA3. Appl Environ Microb 67: subsp carotovorum strain E2. Kim HS. P. specific PCR detection of Iranian pectobacteria causal agents of potato atroseptica associated with potato tissue. Scott ES. Tehran. similar bacteria. atrosepticum strain49. Hibbing ME.14. carotovorum subsp carotovorum strain 74. Iran).7.6. Ecc11523) Molecular Phylogenies of the Soft Rot Enterobacterial Genera Pectobacterium Figure 3: Amplification of DNA from Pectobacterium carotovorum isolates using and Dickeya. carotovora and its correlation with virulence. them produced the expected band. carotovorum subsp carotovorum strain Ecc16. carotovorum subsp carotovorum (standard isolate Ecc55990)12. Yedidia I.5. soft rot.4. Sedgley M (2006) The use of ARMS PCR subsp carotovorum strainEcc42. Phytopathology 85: 854-858. It Hd5. carotovorum subsp carotovorum sensitivity of the detection method [24]. carotovorum restriction fragment length polymorphism analyses. dieback in Australia.13. Charkowski AO (2011) Soft Rot P. Iran. P. Cinnagen. P. J Plant Pathol Microb ISSN:2157-7471 JPPM. D. Thus a rapid and highly specific method has been developed 9. P. Phytopathology 102: 937-947. Safaie S.9. P.2. De Boer SH. Barak JD. 12. 10. P. Plant pathol 52: 127-133. Marefat A.1000154 Page 5 of 6 No PCR products were observed in standard isolates and type strains using the PCR assay with the Iranian pectobacteium primer set. Appl Environ Microbiol 60: 1437-1443. These results confirm that a delicate chrysanthemi strain Hd3. Kwon SW. P. It is notable that the physiological and biochemical propertie [21- 800 23] but not for the subspecies of Iranian isolates. Stevenson WR (2006) A methodology to detect and quantify five pectate genes [9. P.carotovorum subspecies and D. carotovorum subsp carotovorum strain E2. Iran.16. method has been developed using S1f/S2r primers. P. P.3. chrysanthemi strain were obtained from other bacteria that existed near the tubers. Iranian pectobacterium agents other than to consider variation in the 13. Appl Environ identified as Pectobactrium atrosepticum. Go SJ (2003) PCR-based specific and sensitive detection of Pectobacterium carotovorum ssp. P. carotovorum subsp carotovorum strain Ecc10. Eur J Plant Pathol 116: 57-68. consequently not as highly conserved [20]. Andrivon D (2003) Biochemical and molecular physiological and serological techniques were specifically amplified diversity among Erwinia isolates from potato in Algeria. Marefat A. Ramezanzade R. carotovorum ssp. an open access journal Volume 4 • Issue 1 • 1000154 . Yap MN. Johnson S (1999) Blackleg and bacterial soft rot.2. Zamani Sr.4172/2157-7471. 5. The specifity of primers was strain 40. Kotoujansky A. Ward LJ (1995) PCR detection of Erwinia carotovora subsp. References 1. Plant Pathol 52: 28-40. Using high sequence variation of ITSs between pectobacterium 7. Li X. Marefat A. P. carotovorum strain CA3. of disease on potato tubers determines the minimum required carotovorum subsp carotovorum strain 42.chrysanthemi and the size of the 14. Bertheau Y (1994) PCR and restriction for the detection of pectobacteria causal agents of potato soft rot in fragment length polymorphism of a pel gene as a tool to identify Erwinia northwestern provinces of Iran. However sizes and sequences of the large and pathogens causing potato tuber decay using real-time quantitative polymerase small ITS regions of Iranian isolates were also similar to those of other chain reaction. Kang HW. P. 3.15.12. 19th Iranian spacer regions are not as essential as the rRNA genes themselves and Plant Protection Congress.11. carotovora in relation to potato diseases. two primers were designed from the variation region of small ITS for 8. Zamani Sm (2010) Identity a suitable site for developing specific PCR primers that can differentiate and genetic diversity of bacteria belong to the family Enterobacteriaceae causal agents of soft rot in Kurdistan province. carotovorum subsp carotovorum (Type 27 saprophytic bacteria. Pectobacterium carotovorum Microbiol 70: 3013-3023. carotovorum subsp carotovorum. Mohammadi Pour M (2010) Identification of pathogenic been considered that the nucleotide sequences of the rRNA intergenic bacteria that cause potato and carrot soft rot in East Azerbaijan. P.8. the sensitivity of the designed primer was not tested and the actual number of pectobacterium required for causing of symptoms Figure 2: ITS-PCR amplification patterns of Pectobacterium and Dickeya on agarose gel. Hyman LJ (2001) Rapid identification and differentiation an agarose gel: Lanes: L. J Plant Pathol Microb 4:154. molecular weight markers (bp) (100 bp.4. Phytopathology 96: 1037-1045. Yahiaoui-Zaidi R. Cinnagen.7.3. doi:10.16]. assay designed in this study. The figure shows products of the PCR run on 2. carotovorum must be noted that the specifity of the designed primers tested with subsp carotovorum strain Ecc62.

23. Int J Food Microbiol 97: 259-265. Nassar A.4172/2157-7471. Dervin C. Ann Appl Biol 125: 301-309. de Boer SH. and Pectobacterium wasabiae sp. Reviewers and Editors rewarded with online Scientific Credits Causal Agents of Potato Soft Rot in North Western Provinces of Iran. atroseptica and carotovora by RAPD-PCR. review and publication processing • Indexing at PubMed (partial). Syst atypical Erwinia carotovora strains causing blackleg of potato in Brazil. Gouy C. Marefat A. Azadmanesh K (2013) Detection of Pectobacteria Causal Agents of Potato Soft Rot in North Western Provinces of Iran. Can J Microbiol 48: 387-398. 24. an open access journal Volume 4 • Issue 1 • 1000154 . Smid EJ. Hauben L.. 2nd of DNA encoding 16S-23S rRNA intergenic spacer regions and 16S rRNA of edn. nov. Ward LJ. Hwang WZ. DOAJ. Gorris LGM (1995) Detection of Erwinia carotovora 19. Lemattre M. Kotoujansky A. pectolytic Erwinia species. 16. Scopus. 22. Christen R.com/ J Plant Pathol Microb ISSN:2157-7471 JPPM. Tehran. Gardan L. doi:10. Fessehaie A. Int J Syst Evol Micr 53: 381-391. Plant Pathol 44: 1058-1069. (1996) 21. Lévesque CA (2002) Molecular characterization NW(edn) Laboratory Guide for Identification of Plant Pathogenic Bacteria. St Paul.4172/2157-7471. fragments of pel genes. Pectobacterium betavasculorum sp. J Appl Appl Microbiol 21: 384-397. Steenackers M. Jansem AHJ. et al. Azadmanesh K (2013) Detection of Pectobacteria • Authors. J Plant Pathol Microb • Better discount for your subsequent articles 4:154. Chiu TH.editorialmanager.1000154 Page 6 of 6 15. Marefat A. Karjalainen R (1994) Differentiation of Erwinia carotovora subsp. Vauterin L. Tsen HY (2005) Sequencing of an internal spp. Submit your next manuscript and get advantages of OMICS Group submissions Unique features: • User friendly/feasible website-translation of your paper to 50 world’s leading languages • Audio Version of published paper • Digital articles to share and explore Special features: • 250 Open Access Journals • 20. Tavasoli E. J Plant Pathol Microb 4:154. in food. Moore ER. chain reaction. nov. Dickey RS . Maki-Valkama T. Mergaert J. de Oliveira AM (2004) Characterization of Phylogenetic position of phytopathogens within the Enterobacteriaceae. American Phytopathological Society 44–59. Duarte V.000 editorial team • 21 days rapid review process • Quality and quick editorial.Kelman A (1988) Erwinia carotovora or soft rot group. Vausal agents of potato soft rot in zanjan province. Index Copernicus and Google Scholar etc • Sharing Option: Social Networking Enabled Citation: Azadmanesh S. Appl Environ Microbiol 62: 2228-2235. nov.1000154 Submit your manuscript at: www. (1998) 18.Citation: Azadmanesh S. Marefat A. Darrasse A. doi:10. De Boer SH. for the detection of Salmonella spp. In: Schaad 17. Iran. EBSCO. MN.19th Iranian Plant transcribed spacer region of 16S-23S rRNA gene and designing of PCR primers Protection Congress. atroseptica and Erwinia chrysanthemi in potato tubers using polymerase subsp. Samson R (2003) Elevation of three subspecies Characterization of Erwinia chrysanthemi by pectinolytic isozyme polymorphism of Pectobacterium carotovorum to species level: Pectobacterium atrosepticum and restriction fragment length polymorphism analysis of PCR-amplified sp. et al. Hasanzade N (2010) Genetic diversity of Pectobacterium 20. Chen TR. Microbiol 96: 533-545.