You are on page 1of 6

Journal of Archaeological Science 40 (2013) 465e470

Contents lists available at SciVerse ScienceDirect

Journal of Archaeological Science


journal homepage: http://www.elsevier.com/locate/jas

Ancient-DNA reveals an Asian type of Mycobacterium leprae in medieval


Scandinavia
Christos Economou a, *, Anna Kjellstrm b, Kerstin Lidn a, Ioannis Panagopoulos a
a
Archaeological Research Laboratory, Stockholm University, Wallenberglaboratoriet, Lilla Frescativgen 7, 114 18 Stockholm, Sweden
b
Osteoarchaeological Research Laboratory, Stockholm University, Wallenberglaboratoriet, Lilla Frescativgen 7, 114 18 Stockholm, Sweden

a r t i c l e i n f o a b s t r a c t

Article history: Leprosy is a chronic infection of the skin and peripheral nerves caused by the pathogen Mycobacterium
Received 9 March 2012 leprae. Its impact on human populations and societies of the past as well as its phylogeographic patterns
Received in revised form around the world e at least in modern times e has been well documented. This slow growing bacterium
10 July 2012
has been shown to exist in distinct SNP types that occur in relatively dened parts of the globe. The
Accepted 11 July 2012
routes that the disease followed in the past are, however, still uncertain. This study of ancient-DNA
typing of archaeological human remains from Sweden dated to early Medieval times provides genetic
Keywords:
evidence that a transmission of M. leprae SNP subtype 2G e found mainly in Asia e took or had already
Ancient DNA
Leprosy
taken place at that time from the Middle East to Scandinavia. This nding is unique in the history of
Scandinavia leprosy in Europe. All human specimens from this continent e both modern and ancient e that have
Palaeopathology been tested to date showed that the one responsible for the infection strains of M. leprae belong to SNP
Phylogeography type 3, whereas our results show that there were some European populations that were hosts to bacteria
Microbial disease representing SNP type 2 of the species as well.
Middle Ages 2012 Elsevier Ltd. All rights reserved.

1. Introduction Manchester, 1984; Sabbatani and Fiorino, 2010). More concrete


evidence for the presence and prevalence of actual leprosy through
The dramatic effect that leprosy and its symptoms had on past the ages can now be obtained from the eld of palaeopathology;
human societies can easily be deduced from the various references either by the macroscopic or biomolecular examination of human
to the disease found in texts dating back to 600 BC from India, from remains. The oldest physical evidence of leprosy probably comes
descriptions by ancient Greek and Roman physicians, from refer- from skeletal remains in India dated to 2000 BC (Robbins et al.,
ences in Biblical stories, and from the leprosaria that were founded 2009). Historically, the disease is thought to have reached the
during the Middle Ages in Europe. The stigmatization of its victims Mediterranean with the returning army of Alexander the Great,
is evident from the way they were treated as the common belief of although this view has been criticized (Grimm, 2005 by Monot
the time would ascribe supernatural reasoning to the phenomenon. et al., 2005). Alternative explanations, such as leprosy reaching
People who had been diagnosed as lepers by the various religious Egypt somewhat earlier through young slaves from India (Mark,
authorities through the centuries were obliged to live in exile, wear 2002) have also been advanced. Leprosy became prevalent in
special insignia and were isolated from social life. It can often be Europe in the 12the13th centuries AD. The disease subsequently
disputed, however, whether the disease-states described in these declined in continental Europe, but in some areas of Scandinavia it
ancient accounts can in fact be attributed to leprosy, either because persisted until the late 19th century, with cases being reported
the description of the symptoms is too general, as in the case of the during the 20th century as well (Stone et al., 2009; Sundelin and
Old Testaments zaraath, or because they better conform to other Srman, 2004). The decline of the disease in Europe may be
diseases with similar symptoms such as psoriasis. The latter is attributable to the rise of another disease, tuberculosis, which
thought to be the case for the Hippocratic term lepra where provides cross-immunity against leprosy (Donoghue et al., 2005).
leprosy takes its name from (Browne, 1975; Carmichael, 2008b; In other parts of the world such as central/south Asia, Brazil and
Africa, however, leprosy remains a health problem with over
* Corresponding author. Tel.: 46 08 16 2176.
200,000 new cases reported per year.
E-mail addresses: christos.economou@arklab.su.se (C. Economou), The physiology of leprosy (also known as Hansens disease after
anna.kjellstrom@o.su.se (A. Kjellstrm), kerstin.liden@arklab.su.se (K. Lidn). the Norwegian physician who identied its causative agent in 1873)

0305-4403/$ e see front matter 2012 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.jas.2012.07.005
466 C. Economou et al. / Journal of Archaeological Science 40 (2013) 465e470

has e also e been extensively studied during the last century. Europeans (Truman et al., 2011). Another consequence of this
Caused by the slow growing bacterium Mycobacterium leprae, limited metabolic function is the long incubation time of the
leprosy is a chronic granulomatous infection that damages the skin bacterium; in the case of lepromatous leprosy it can take more than
and peripheral nerves causing characteristic disabilities and ten years from the time of infection for the disease to develop.
deformities (Lockwood, 2003; Britton and Lockwood, 2004). The Comparative genomics studies, such as the ones mentioned above,
pathogen prefers to colonize the cooler parts of the hosts body and have shown that very low levels of genetic variability do exist
due to its usual transmission through inhalation one of the com- among different strains of M. leprae around the globe. Our current
monest affected parts is the nasal area. The categorization of the tools for inferring the phylogeographical patterns of the microbe
clinical manifestations of the disease is based on the hosts immune are mainly based on the model by Monot et al. (2005) where four
system reaction against the M. leprae bacteria and ranges from combinations of three Single Nucleotide Polymorphisms (SNPs)
tuberculoid, where the immunological response is high and the distinguish between four different SNP types (type 1, 2, 3 and 4)
bacterial load low, to lepromatous form, where low immunity leads of the pathogen, each strongly associated with a distinct
to heavy bacterial load. A number of intermediate borderline forms geographical area. SNP type 2 in particular seems to be connected
that vary according to the patients treatment towards one of the with central Asia/Middle East and East Africa, whereas Europe is
two stable poles have been described by Ridley and Jopling (1966). plagued by SNP type 3. Later studies (Monot et al., 2009) added
In severe cases, leprosy even affects the bones leaving characteristic more markers (SNPs and InDels) to the model, thereby increasing
lesions (Boldsen, 2001) that can be identied by osteo- this informative differentiation by further dividing the four SNP
archaeologists (Fig. 1). This makes it possible to infer the presence types into sixteen SNP subtypes, which retained their geograph-
and prevalence of the disease in centuries past e even when no ical connections. Analyses of archaeological material suggest that
written documentation or other historical evidence exists. In the these geographical connections apply to ancient distributions of
last couple of decades an even more sophisticated method for the pathogen as well as the modern one (Taylor et al., 2006; Taylor
tackling with diseases of the past has emerged; that of ancient DNA and Donoghue, 2011; Watson and Lockwood, 2009). All of these
(aDNA), meaning it has become possible not only to certify the studies agree on the pattern that ascribes SNP type 3 as the sole
presence of pathogens in archaeological material by targeting type of M. leprae found in Europe, both in the past and the present
species-specic nucleotide sequences but also to comment on their day (Fig. 2).
various strains and types at each particular place and time and, In this study aDNA methods were employed to type skeletal
thus, get new insights into their spread and evolution (Drancourt remains that had previously been examined for skeletal signs of
and Raoult, 2005; Zink et al., 2002). Several studies have also leprosy and had been differentially diagnosed as having suffered
tackled the evolution and adaptation of the human genome in from the disease (Kjellstrm, 2010). The skeletons came from Sig-
terms of the immunity it provides to the host against the infection. tuna, Sweden, and dated to 10the14th centuries AD. Sigtuna was
A number of loci, such as human leukocyte antigen (HLA) genes a commercial and administrative centre at the time. Various grave-
(Geluk and Ottenhoff, 2006), Toll-like receptor 1, HLA-DRB1/DQA1 goods and other nds imply that the town had trade connections
(Misch et al., 2008; Wong et al., 2010) and PARK2/PACRG (Bakija- with places as far away as the Middle East, as has also been
Konsuo et al., 2011) have been identied as major determinants established for the preceding Viking Age for this area of Scandi-
of leprosy susceptibility. M. leprae is considered to be a genetically navia (Fig. 2). Previous studies have provided biomolecular
monomorphic bacterium with extremely low levels of genetic evidence of leprosy in Sweden at that time (Nuorala et al., 2004;
diversity (Achtman, 2012). An evolutionary bottleneck Donoghue et al., 2005).
(Frothingham, 1999) has left the bacteriums genome severely
reduced in length to just 3.3 Mb, only half of which is comprised of 2. Materials and methods
functional genes (Singh and Cole, 2011 by Cole et al., 2001). This
genome reduction has negatively affected the metabolic features of 2.1. Samples
the microbe making it an obligate intracellular pathogen whose
only natural reservoirs are humans and wild armadillos in America; In total ten skeletons were analysed for M. leprae genomic
a continent where the disease was absent before its colonisation by sequences (Table 1). Eight of them had previously been charac-
terised as showing bone lesions indicative of leprosy. The speci-
mens were excavated in 2006 from two cemeteries in Sigtuna
dating to early Medieval times. Radiocarbon and stratigraphy
methods have calculated skeletons S.I. 34 and 19 to date from 900 to
1100 AD while the rest were dated to 1100e1300 AD (Kjellstrm
et al., 2005, Kjellstrm and Wikstrm, 2008). Six different bones
e mainly metatarsals, metacarpals and vertebrae e from each
skeleton were sampled (w100 mg per sample) in order to increase
the likelihood of targeting the preserved mycobacterial DNA and
check which parts of the skeleton would be best targeted in future
leprosy projects. Of those six bones per skeleton, three were
sampled twice and three once, totalling nine samples per
individual.

2.2. Methods

The samples were incubated at 37  C for three days in a solution


of EDTA, Triton X and Proteinase K in order to release the nucleic
acids from the bone minerals and proteins. The extraction was
Fig. 1. An adult male (S.I. 3159) showing pencilling deformities of the left fourth and performed according to a slightly modied (increased volume of
fth metatarsals. reagents) version of Yang et al.s (1998) protocol and using the
C. Economou et al. / Journal of Archaeological Science 40 (2013) 465e470 467

Fig. 2. Map of Europe and the Middle East depicting the eastward trade-routes and connections of Scandinavians at the time (Viking age/ early Medieval), as well as the distribution
of the M. leprae SNP types that have been detected so far (from both modern and archaeological samples).

QIAquick PCR Purication Kit by Qiagen for the purication step. 2.3. Contamination prevention measures
The initial analysis targeted the RLEP repetitive element that is
considered specic to M. leprae, in order to test which of the Both extraction and PCR negative controls were used in order to
specimens exhibited preserved DNA sequences of the bacterium ensure that no contamination from the laboratory would interfere
and thus attest the osteological interpretations. This was performed with our results. In addition, no previous research on the SNP
by nested-PCR using primers (LP1, LP2, LP3, LP4) and cycle types of M. leprae had ever taken place in our department before.
parameters previously described (Donoghue et al., 2001) giving All sampling and extraction steps were performed at the dedicated
products of 129bp and 99bp fragments of the RLEP element. For the to ancient-DNA laboratory of Stockholm University. All the
SNP types and subtypes we used primers (Table 2) designed common practices for such areas (UV-irradiation of the workplace
according to Monot et al.s (2005 & 2009) supplementary material and samples, mechanical removal of the outer surface of the bones,
papers and guidance from one of their authors. All the PCR products cleaning with NaOCl bleach, wearing protective suits and
exhibiting specic band upon agarose (3%) gel electrophoresis were disposable gloves and masks among others) were followed. Post-
sent to be sequenced at Karolinska Institute, Stockholm, after being PCR analysis was performed at another department (Zoology) of
treated with ExoSAP-IT that would remove any unused primers the university so that the areas would be physically separated.
and nucleotides. The DNA sequences were analysed using the
BLAST program. All steps from specimen-drilling to amplicon-
sequencing were performed twice in order to ensure the repro- 3. Results
ducibility of the results.
Nine out of ten of the skeletons tested yielded the expected
Table 1 bands and DNA sequences for the RLEP element (Table 1). One of
Osteological (based on previous study e Kjellstrm, 2010) and aDNA results of the
ten skeletons tested.
Table 2
Skeleton Sex Age Osteological M. leprae Positive SNP type (a) Primers used for amplifying the three M. leprae SNP type loci. (b) Primers used
I.D. signs of DNA samplesa & subtypeb for amplifying the four SNP subtype loci.
leprosy resultsa
3320 e Adult 3 e Primer Targeted SNP Primer sequence 50 -30 Product size (bp)
3159 M 20e23 5 e (a)
3092 e 11e12 4 2G SNP14O-F 14676 ACGAATTCGTTGAACAGTCTC
3093 M 20e25 7 3I SNP14O-R 14676 TGGTAATAAACAATGCATGCT 141
34 e 14e26 2 e SNP16O-F 1642875 CGGCATGTGCGGCTTCATGG
10 F 40e60  2 e SNP16O-R 1642875 ACCGTCGGGGGTAGTAGTCTTCC 143
32 M 20e40 3 e SNP29O-F 2935685 AGGTACGGTGGTGTCGGTCTCC
19 F 17e22   0 e SNP29O-R 2935685 CGAGCGTGACCGGCCGTTAAT 148
3401 M 35e50 2 e
(b)
3077 F 20e30 9 2G
SNP31F 3102778 CGGTGACTTCGCTAAGCAGTA
Total 8 9 9 (samples 3 SNP31R 3102778 ACTGATTGCCTTCCCGAGT 233
per skeleton) SNP110F 1104232 TCGACCACGTTACCACGTTA
a SNP110R 1104232 CAGGCTTGCAGTCTGTTGAA 254
Nine samples in total were used from each individual. Column indicates which
SNP27F 2751783 ACTCACCCGTGGATCATAGC
and how many of those samples yielded the expected gel-band and RLEP sequence.
b SNP27R 2751783 GTGAAGCTGGTCGATGTGC 205
Only the samples that yielded all three SNP type amplicons are included in this
SNP113F 1133495 ATCGATACGTGATTCCCACGACAAC
column. The rest yielded results for none, one or two loci only thus were not
SNP113R 1133495 TGAGCAGTCACAGTCGTTACACACC 121
informative.
468 C. Economou et al. / Journal of Archaeological Science 40 (2013) 465e470

them yielded positive results for all of the bones tested, with the Museum of Natural History where they were processed by GS 454
rest showing various degrees of signal strength. All extraction and Sequencing System in order to check whether that outcome was
PCR blank controls were negative. Of the bones tested, the ones that due to a sole strain of M. leprae. The results supported this inter-
proved to yield the best results for M. leprae DNA were the meta- pretation, as all sequences exhibited the characteristic A of SNP
tarsals. Amplicons of all the three loci used to distinguish between type 2 (Fig. 4), although some inconsistencies that dont affect the
M. leprae SNP types were successfully amplied from three of the outcome were present. Sequences 2, 6 and 7 showed deletions of
skeletons, one (S.I. 3093) characterised as SNP type 3 and two (S.I. nucleotides that could be attributed to amplication or sequencing
3092 and 3077) as SNP type 2 (Fig. 3). The SNP type 3 skeleton errors whereas sequence 8 exhibited a G to A substitution that
yielded the SNP combination of SNP14676-C, SNP1642879-T and could be a result of hydrolytic deamination of cytosine (Willerslev
SNP2935693-C, whereas the SNP type 2 skeletons yielded the and Cooper, 2005).
following combination: SNP14676-C, SNP1642879-T and
SNP2935693-A. The rest, probably due to the relatively long 4. Discussion
(w140bp) DNA templates required, yielded amplicons for only two,
one or none of the loci. Attempts to design pairs of primers tar- Our results on the presence of M. leprae DNA in the skeletons
geting shorter parts of the sequence of interest werent fruitful as tested strengthen the previous osteological interpretations of the
the candidate oligos were either non-species specic or showed lesions that were present. The skeleton (S.I. 10) that yielded positive
high self-complementarity. The three positive skeletons were results without showing obvious bone lesions ascribed to leprosy is
successfully tested as well for their SNP subtype and the results interpreted as having been infected by a less severe form of the
ascribed them to SNP subtypes 3I and 2G respectively. The SNP disease such as tuberculoid leprosy. On the other hand, lesions that
combinations and the results obtained for the SNP subtype were had been ascribed to tuberculosis were present, implying that the
as follows: For the 3I SNP subtype the locus taken into account was leprosy infection did not have time to develop further in this
SNP1133495-T, which in combination with the SNP2935693-C individual prior to death. Due to the scientic interest in cases
result, differentiates between SNP subtype 3I and the rest of the where leprosy and tuberculosis co-exist (Donoghue et al., 2005)
subtypes of SNP type 3. For the two SNP subtypes 2G the results three aliquots of DNA extracts of skeleton S.10 were typed for the
that allowed them to be ascribed as such were SNP3102778-C, presence of markers (IS6110 and IS1081) used for the identication
SNP1104232-G and SNP2751783-A. The PCR product for SNP2935693 of Mycobacterium tuberculosis complex (MTBC) (Stone et al., 2009).
of skeleton S.I. 3092 that distinguishes between SNP types 2 and 3 Neither of the markers targeted yielded any positive PCR products.
were sent to the Molecular Systematics Laboratory at Swedish This outcome does not however exclude the possibility that that

Fig. 3. The three SNP loci that distinguish between the different types of M. leprae. Here are presented the DNA sequences obtained from sample S.I. 3093 (SNP type 3) and S.I.
3092 (SNP type 2).
C. Economou et al. / Journal of Archaeological Science 40 (2013) 465e470 469

Fig. 4. A characteristic collection of sequences obtained from GS 454 Sequencing System for the SNP2935693 PCR product of skeleton S.I. 3092. The nucleotide of interest is
highlighted in bold.

particular individual had been indeed infected with tuberculosis for the disease in Asia cannot be addressed by the present study. It is
reasons such as that there are strains of the bacterium that lack also possible that the infected individuals were not of a local origin
copies of the repeat element IS6110, as well as the stochastic nature but of one that corresponds to the current distribution of SNP
of molecular palaeopathology when it comes to sampling parts of subtype 2G and had travelled to Sigtuna as merchants or similar.
the skeleton likely to have hosted the specic microbe species. The Future analyses could help shed light on the matter as the variety of
other skeleton (S.I. 19) that lacked bone lesions served as negative grave goods and cultural ndings associated with that particular
control and, together with the extraction and PCR blanks as well as cemetery imply that the individuals buried there could had
the rest of the bones that didnt yield any result, strengthens our belonged to several ethnic groups. Whatever route this disease
condence that contamination from the environment or cross- followed however, our results show that transmission of various
contamination in the laboratory could not have taken place. strains of leprosy did take place in antiquity, and between lands
M. leprae is known to not survive outside of its hosts for more than that are very far apart even by todays means of transportation. Of
a couple of months (Desikan and Sreevatsa, 1995) being an obligate course this isnt something new in the history of medicine; other
intracellular parasite (Britton and Lockwood, 2004) and is unlikely diseases, such as the Plague, have been shown (Carmichael, 2008a)
to form endospores that could survive for long periods (Traag et al., to have been transmitted from far away in times past. It is, however,
2010). The specicity of the markers used is once more supported an interesting addition to the phylogeography of leprosy that a rare
by this study as otherwise we would expect to have amplicons from type previously found only in central Asia was also present in
all the bones from the same cemetery regardless of whether they Scandinavia. This raises the interesting question as to whether the
had been infected by leprosy or not. In addition, the results show lengthy persistence of the disease in Scandinavia was due only to
two different SNP types to be present, a pattern highly unlikely if the poor living conditions of the time, or whether the different
an external source of DNA had interfered. mycobacterial strains do indeed activate the host immune system
Although no skeleton was typed in its entirety in this study and in different ways (Wong et al., 2010).
the most common region (rhinomaxillary) affected by leprosy was
not available for analysis, we could, nevertheless, see a pattern of 5. Conclusions
stronger signals of the pathogens DNA in metatarsals and meta-
carpals, followed by the vertebrae. This is in line with the haema- In this study we successfully used aDNA methods to type
togenous spread of the microbe through the hosts body to bones of medieval human remains from Scandinavia exhibiting bone lesions
hands and feet where the bacterial load causes alterations characteristic of leprosy. The samples yielded positive results of
(Lockwood, 2003). M. leprae DNA, thus supporting the conclusions of the previous
The outcome of the M. leprae SNP types and subtypes was osteological study and enhancing the role that molecular biology
most unexpected as all previous leprosy studies on European can play in the eld of palaeopathology, especially when there are
material, both modern and ancient, had constantly found that SNP forms of disease that do not leave diagnostic marks on the skeleton.
type 3 was exclusively responsible for the disease on this conti- By sampling various bones from each skeleton we concluded that
nent. Although a previous nding (Taylor et al., 2009) had detected metatarsals, metacarpals and vertebrae can be useful alternatives
an SNP type 3 in central Asia in a skeleton dated to 1ste4th to crania when studying leprosy. Our results on the SNP types of
century AD, something considered uncommon or even unique for the pathogen are informative regarding its phylogeographic
that area of the world, this is the rst time that an SNP type 2 is patterning, and provide evidence that a transmission of a particular
reported from anywhere in Europe, and e to the best of our type of the disease agent from central Asia/Middle East to Scan-
knowledge e it is the rst time it is reported in archaeological dinavia had taken place during the Middle Ages; something unique
material worldwide. The SNP sub 3I of one of the skeletons tested for that area of the world according to what has been observed
seems to be in accordance with what had been previously reported so far.
(Monot et al., 2009) as its occurrence has been conrmed in anal-
yses of archaeological material found in Europe of roughly the same
Acknowledgements
period of time. The SNP subtype 2G that the other two samples
were ascribed to had so far been reported only in Nepal, interest-
We would like to thank S. Cole for his help on primers and
ingly very close to Uzbekistan where the odd SNP subtype 3 was
comments on our results; P. Singh for comments on the analysis;
found. Scandinavians at that time had already established trade
DIALPAST for providing the chance to discuss our preliminary
routes and had been involved in campaigns that reached as far east
results; M. Oikonomou for helping with the design of Fig. 2; R.
as the Caliphate, thus a transmission of different M. leprae strains
Howcroft for helping with language editing and presentation of the
could have taken place between these distant places of the world.
article.
Taking into consideration the fact that leprosy can have a very long
incubation time, a seemingly healthy person could travel for years
before any symptoms of the disease would appear. The question of References
whether the SNP type 2 pathogen was already present in Scan-
Achtman, M., 2012. Insights from genomic comparisons of genetically mono-
dinavia and/or in lands on the road to the East at this time, or morphic bacterial pathogens. Philos. Trans. R Soc. Lond. B Biol. Sci. 367,
whether the affected individuals had travelled to and contracted 860e867.
470 C. Economou et al. / Journal of Archaeological Science 40 (2013) 465e470

Bakija-Konsuo, A., Muli c, R., Boraska, V., Pehlic, M., Huffman, J.E., Hayward, C., Cho, S.N., Ji, B., Paniz-Mondol, A., Convit, J., Young, S., Fine, P.E., Rasolofo, V.,
Marlais, M., Zemunik, T., Rudan, I., 2011. Leprosy epidemics during history Brennan, P.J., Cole, S.T., 2005. On the origin of leprosy. Science 308, 1040e1042.
increased protective allele frequency of PARK2/PACRG genes in the population Monot, M., Honor, N., Garnier, T., Zidane, N., Shera, D., Paniz-Mondol, A.,
of the Mljet Island, Croatia. Eur. J. Med. Genet. 54, 548e552. Matsuoka, M., Taylor, G.M., Donoghue, H.D., Bouwman, A., Mays, S., Watson, C.,
Boldsen, J.L., 2001. Epidemiological approach to the paleopathological diagnosis of Lockwood, D., Khamesipour, A., Dowlati, Y., Jianping, S., Rea, T.H., Vera-
leprosy. Am. J. Phys. Anthropol. 115, 380e387. Cabrera, L., Stefani, M.M., Banu, S., Macdonald, M., Sapkota, B.R., Spencer, J.S.,
Britton, W.J., Lockwood, D.N., 2004. Leprosy. Lancet 363, 1209e1219. Thomas, J., Harshman, K., Singh, P., Busso, P., Gattiker, A., Rougemont, J.,
Browne, S.G., 1975. Some aspects of the history of leprosy: the leprosie of yesterday. Brennan, P.J., Cole, S.T., 2009. Comparative genomic and phylogeographic
Proc. R Soc. Med. 68, 485e493. analysis of Mycobacterium leprae. Nat. Genet. 41, 1282e1289.
Carmichael, A.G., 2008a. Bubonic plague. In: Kiple, K.F. (Ed.), The Cambridge World Nuorala, E., Donoghue, H.D., Spigelman, M., Gtherstrm, A., Hrding, B.,
History of Human Disease. Cambridge University Press, pp. 834e839. Grundberg, L., Alexandersen, V., Leden, I., Lidn, K., 2004. Diet and Disease in
Carmichael, A.G., 2008b. Leprosy. In: Kiple, K.F. (Ed.), The Cambridge World History Bjrned, a Viking-early Medieval Site in Northern Sweden. Theses and Papers in
of Human Disease. Cambridge University Press, pp. 834e839. Scientic Archaeology. In: Paper II, Molecular Palaeopathology. Ancient DNA
Cole, S.T., Eiglmeier, K., Parkhill, J., James, K.D., Thomson, N.R., Wheeler, P.R., Analyses of the Bacterial Diseases Tuberculosis and Leprosy, vol. 6. Archaeo-
Honor,, N., Garnier, T., Churcher, C., Harris, D., Mungall, K., Basham, D., logical Research Laboratory, Stockholm University.
Brown, D., Chillingworth, T., Connor, R., Davies, R.M., Devlin, K., Duthoy, S., Ridley, D.S., Jopling, W.H., 1966. Classication of leprosy according to immunity:
Feltwell, T., Fraser, A., Hamlin, N., Holroyd, S., Hornsby, T., Jagels, K., Lacroix, C., a ve group system. Int. J. Lepr. 34, 255e273.
Maclean, J., Moule, S., Murphy, L., Oliver, K., Quail, M.A., Rajandream, M.A., Robbins, G., Tripathy, V.M., Misra, V.N., Mohanty, R.K., Shinde, V.S., Gray, K.M.,
Rutherford, K.M., Rutter, S., Seeger, K., Simon, S., Simmonds, M., Skelton, J., Schug, M.D., 2009. Ancient skeletal evidence for leprosy in India (2000 B.C.).
Squares, R., Squares, S., Stevens, K., Taylor, K., Whitehead, S., Woodward, J.R., PLoS One 4, e5669.
Barrell, B.G., 2001. Massive gene decay in the leprosy bacillus. Nature 409, Sabbatani, S., Fiorino, S., 2010. The plague of the Philistines and other pestilences in
1007e1011. the Ancient World: exploring relations between the religious-literary tradition,
Desikan, K.V., Sreevatsa, 1995. Extended studies on the viability of Mycobacterium artistic evidence and scientic proof. Infez Med. 18, 199e207.
leprae outside the human body. Lepr. Rev. 66, 287e295. Singh, P., Cole, S.T., 2011. Mycobacterium leprae: genes, pseudogenes and genetic
Donoghue, H.D., Holton, J., Spigelman, M., 2001. PCR primers that can detect low diversity. Future Microbiol. 1, 57e71.
levels of Mycobacterium leprae DNA. J. Med. Microbiol. 50, 177e182. Stone, A.C., Wilbur, A.K., Buikstra, J.E., Roberts, C.A., 2009. Tuberculosis and leprosy
Donoghue, H.D., Marcsik, A., Matheson, C., Vernon, K., Nuorala, E., Molto, J.E., in perspective. Am. J. Phys. Anthropol. 140, 66e94.
Greenblatt, C.L., Spigelman, M., 2005. Co-infection of Mycobacterium tuber- Sundelin, A., Srman, A., 2004. Skammens hud. Bokfrlaget DN, Stockholm.
culosis and Mycobacterium leprae in human archaeological samples: Taylor, G.M., Watson, C.L., Bouwman, A.S., Lockwood, D.N.J., Mays, S.A., 2006.
a possible explanation for the historical decline of leprosy. Proc. Biol. Sci. 272, Variable nucleotide tandem repeat (VNTR) typing of two palaeopathological
389e394. cases of lepromatous leprosy from Mediaeval England. J. Archaeol. Sci. 33,
Drancourt, M., Raoult, D., 2005. Palaeomicrobiology: current issues and perspec- 1569e1579.
tives. Nat. Rev. Microbiol. 3, 23e35. Taylor, G.M., Blau, S., Mays, S., Monot, M., Lee, O.Y., Minnikin, D.E., Besra, G.S.,
Frothingham, R., 1999. Evolutionary bottlenecks in the agents of tuberculosis, Cole, S.T., Rutland, P., 2009. Mycobacterium leprae genotype amplied from an
leprosy, and paratuberculosis. Med. Hypotheses 52, 95e99. archaeological case of lepromatous leprosy in Central Asia. J. Archaeol. Sci. 36,
Geluk, A., Ottenhoff, T.H., 2006. HLA and leprosy in the pre and postgenomic eras. 2408e2414.
Hum. Immunol. 67, 439e445. Taylor, G.M., Donoghue, H.D., 2011. Multiple loci variable number tandem repeat
Grimm, D., 2005. Global spread of leprosy tied to human migration. Science 308, (VNTR) analysis (MLVA) of Mycobacterium leprae isolates amplied from
1040e1042. European archaeological human remains with lepromatous leprosy. Microbes
Kjellstrm, A., Tesch, S., Wikstrm, A., 2005. Inhabitants of a sacred townscape: an Infect. 13, 923e929.
archaeological and osteological analysis of skeletal remains from late Viking age Traag, B.A., Driks, A., Stragier, P., Bitter, W., Broussard, G., Hatfull, G., Chu, F.,
and Medieval Sigtuna, Sweden. Acta Archaeologica 76, 87e110. Adams, K.N., Ramakrishnan, L., Losick, R., 2010. Do mycobacteria produce
Kjellstrm, A., Wikstrm, A., 2008. Osteologi och fltantropologi. In: Wikstrm, A. endospores? Proc. Natl. Acad. Sci. U S A 107, 878e881.
(Ed.), P vg mot Paradiset e arkeologisk underskning i kvarteret Humle- Truman, R.W., Singh, P., Sharma, R., Busso, P., Rougemont, J., Paniz-Mondol, A.,
grden 3 i Sigtuna 2006. Meddelanden och rapporter frn Sigtuna museum, vol. Kapopoulou, A., Brisse, S., Scollard, D.M., Gillis, T.P., Cole, S.T., 2011. Probable
33. Sigtuna museer, Sigtuna, pp. 165e216. zoonotic leprosy in the southern United States. N. Engl. J. Med. 364, 1626e1633.
Kjellstrm, A., 2010. Possible cases of leprosy and tuberculosis in medieval Sigtuna, Watson, C.L., Lockwood, D.N., 2009. Single nucleotide polymorphism analysis of
Sweden. Int. J. Osteoarchaeol. 22, 261e283. European archaeological M. leprae DNA. PLoS One 4, e7547.
Lockwood, D.N., 2003. Leprosy (Hansens disease). In: Warrell, D.A., Cox, T.M., Willerslev, E., Cooper, A., 2005. Ancient DNA. Proc. Biol. Sci. 272, 3e16.
Firth, J.D., Benz, M.D. (Eds.), Oxford Textbook of Medicine, fourth ed. Oxford Wong, S.H., Gochhait, S., Malhotra, D., Pettersson, F.H., Teo, Y.Y., Khor, C.C.,
Press, pp. 611e618. Rautanen, A., Chapman, S.J., Mills, T.C., Srivastava, A., Rudko, A., Freidin, M.B.,
Manchester, K., 1984. Tuberculosis and leprosy in antiquity: an interpretation. Med. Puzyrev, V.P., Ali, S., Aggarwal, S., Chopra, R., Reddy, B.S., Garg, V.K., Roy, S.,
Hist. 28, 162e173. Meisner, S., Hazra, S.K., Saha, B., Floyd, S., Keating, B.J., Kim, C., Fairfax, B.P.,
Mark, S., 2002. Alexander the Great, seafaring, and the spread of leprosy. J. Hist. Knight, J.C., Hill, P.C., Adegbola, R.A., Hakonarson, H., Fine, P.E., Pitchappan, R.M.,
Med. Allied Sci. 57, 285e311. Bamezai, R.N., Hill, A.V., Vannberg, F.O., 2010. Leprosy and the adaptation of
Misch, E.A., Macdonald, M., Ranjit, C., Sapkota, B.R., Wells, R.D., Siddiqui, M.R., human toll-like receptor 1. PLoS Pathog. 6, e1000979.
Kaplan, G., Hawn, T.R., 2008. Human TLR1 deciency is associated with Yang, D.Y., Eng, B., Waye, J.S., Dudar, J.C., Saunders, S.R., 1998. Technical note:
impaired mycobacterial signaling and protection from leprosy reversal reaction. improved DNA extraction from ancient bones using silica-based spin columns.
PLoS Negl. Trop. Dis. 2, e231. Am. J. Phys. Anthropol. 105, 539e543.
Monot, M., Honor, N., Garnier, T., Araoz, R., Coppe, J.-Y., Lacroix, C., Sow, S., Zink, A.R., Reischl, U., Wolf, H., Nerlich, A.G., 2002. Molecular analysis of ancient
Spencer, J.S., Truman, R.W., Williams, D.L., Gelber, R., Virmond, M., Flageul, B., microbial infections. FEMS Microbiol. Lett. 213, 141e147.