You are on page 1of 183

, ~I
CODIGO
de DIGS
El secreto de nuestro pasado,
la promesa de nuestro futuro

GREGG BRADEN

Grupo Editorial Torno, S.A. de C.Y.
Nicolas San Juan 1043
03100 Mexico. D.F.

la. edici6n, agosto 2005.
D edico este libra a la primera
generaci6n en la historia escrita
que tiene el poder de destruir
o preservar todo 10 que amamos.

© The God Code Que nuestro legado sea un legado de paz
Copyright © 2004 by Gregg Braden para quienes nos lIamaran sus antepasados.
Publicado originalmente en ingles por H&y House, Inc.
P.O. Box 5100, Carlbad, CA 92018-5100
www.hayhouse.com

© 2005, Grupo Editorial Tomo, SA de C.v.
Nicolas San Juan 1043, Col. Del Valle
03100 Mexico, D.F.
Tels. 5575-6615,5575-8701 Y5575-0186
Fax. 5575-6695
http://www.grupotomo.com.Inx
ISBN: 970-775-136-3
Miembro de la Camara Nacional
de la Industria Editorial No 2961

Traducci6n: Graciela Frisbie
Diseiio de Portada: Emigdio Guevara
Formaci6n Tipografica: Servicios Editoriales Aguirre, S.c.
Supervisor de producci6n: Leonardo Figueroa

Ninguna parte de esta publicaci6n podni ser reproducida
o transmitida en cualquier forma, 0 por cualquier medio
electr6nico 0 mecanico, incluyendo fotocopiado, cassette, etc.,
sin autorizaci6n por escrito del editor titular del Copyright.
Este Iibro se public6 conforme al contrato establecido entre
Hay House, Inc.; InterLicense, Ltd. y
Grupo Editorial Torno, S.A. de C. V

Imprcso ell Mcxil.:o - Printed in Mexico

. . . . . . . . . . . . . . 53 SEGUNDA PARTE: El descubrimiento: Toda vida parte del nombre de Dios . . . . . . . . . . . . . . . . esta el nombre de Dios. . . . . . . . . . . . . . . . . . . CONTENIDO Nota del autor . . . . . 1 Capitulo 1: Historia: El relato de nuestras diferencias . . . . . . . . . . . . . . . . . . . libros y celulas: Cuando las evideneias y las teorfas chocan. . . . . . . . . . . . . . . . . 107 Capitulo 6: El codigo dentro del codigo: En cada celula de toda vida. . . 139 . . . . 5 Capitulo 2: Huesos. . . 81 Capitulo 5: El descubrimiento: Cuando las letras se convierten en elementos. . 27 Capitulo 3: De los libros perdidos de la creaeion: Los poderes del eielo en cuerpos de la Tierra. . . . . . . . . . XIII PRIMERA PARTE: (Quienes somos? Indieios del misterio en S1 . . . . . XI Introduccion . . . . . . . . . . . . . . . . . 77 Capitulo 4: El creador del universo: En palabras de otras epocas . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . 335 . .. . . . .. . . .. . 301 Aplndice D: Ilustracion detallada de los atomos de Hidrogeno. .. . . Nitrogeno. . .. . . . . . . . 303 Notas finales 305 Reconocimientos . . 179 Capitulo 8: ~Que hemos aprendido? Como sobrevivir en nuestro futuro con las lecciones de nuestro pasado . . .VIII El C6digo de Dios TERCERA PARTE: El significado: Como aplicar el mensaje a nuestra vida . 299 Aplndice Co El numero de atomos de Hidrogeno. . . .. . . . . 329 Sobre el autor . . . . Oxigeno y Carbono en cada una de las bases del ADN.. que muestra sus equivalentes como letras hebreas . . 211 Capitulo 9: El codigo de Dios: Una razon para creer . .. . . . . . Nitrogeno. 175 Capitulo 7: Mensaje del primer dia: Como leer ellenguaje de Dios . . . . .. . 253 Aplndice A: El orden secreto del alfabeto arabe . . . . .. . . .. . . . Oxigeno y Carbono en cada una de las cuatro bases delADN. . . 297 Aplndice B: La tabla periodica de los elementos.

traduccio- nes modernas y tradiciones que se mencionan en este libra.) y despues de Cristo (d. y por 10 tanto carece de genero. se usa la palabra hombrt para referirse a la humanidad. las referencias a "£1" son referencias al principio masculino de Dios. Fechas convencionales: Sigue existiendo un debate entre arque610gos e historiadores relacionado con la manera de in- dicar fechas hist6ricas como antes de fa era comun (A. unicamente en el acto de la creaci6n. y las notas que soHan usarse: antes de Cristo (a.C.C.C.C).E. con el prop6sito de tener coherencia y claridad.E. Es obvio que en eI contexte de la antigiiedad la intenci6n era incluir al . Por esta raz6n. NOTA DEL AUTOR E n 10 que concierne al genera de Dios: Aunque el principio de Dios definitivamente implica tanto el genera masculi- no como el femenino. se entiende que a 10 largo de este libro. para las fechas anteriores al ano "I".) para fechas desde el ano "1" hasta el presente.C y E.) En este libra se utilizan las notas ya convencionales en la acrualidad de A. y era comun (E.C. las refe- rencias hist6ricas sugieren que el principio masculino activo de Dios en el Cielo se mezcla con el principio femenino recep- tor de la "Madre Tierra" para praducir la dualidad de la vida que se une en el interior de nuestras cuerpos. El termino hombre: En muchos textos antiguos..

de he- cho. La busqueda de evidencias de "la gran explosion". En un esfuerzo por ser coherente con ellenguaje de los textos. En 1960. y r~presenta a toda existencia humana. Para 1962. en El GJdigo de Dios se ha utilizado tambien este termino convencional. es un ejemplo de este tipo de descubrimientos. Nueva Jersey. los Laboratorios de la Bell Telephone en Hol- mdel. En una vision retrospectiva. la explosion cosmica que se cree puso en movimiento este universo. nuevos descubrimien- tos hicieron que la antena fuera obsoleta. es- taban interesados en usar la antena para medir senales debiles de radio entre galaxias distantes. Dos empleados dellaboratorio.XII El C6digo de Dios hombre y a la mujer. 10 obvio parece ocultarse. una vez que los descubrimientos se hacen y los misterios se resuelven. Arno Penzias y Robert Wilson. INTRODUCCION A veces las soluciones a los misterios mas profundos de la vida se encuentran en los lugares mas extranos. como 10 sugiere el proverbio de que "los arboles no dejan ver el bosque". construyeron una antena en forma de pla- to como parte de un proyecto de comunicaciones via satelite llamado Echo. al igual que a los ninos. en- comraron que produda un ruido similar ala estatica el cualles . las respuestas mas escurridizas siempre habian estado pre- sentes y que simplemente no se les habia reconocido. En estos casos. es comun encontrar que. asi que quedo dispo- nible como telescopio de radio para investigaciones. sin embargo. Cuando los investigadores empezaron a usar la antena.

siempre ha estado presente continuaria impregnando el universo hoy en dia. y apareci6 en una propia antena. una y otra bi6 por siempre la naturaleza de la cosmologfa. Despues de que cuidadosas ins. y una clave radiaci6n de microondas. los elementos familiares de hidr6geno. de cada vida. relacionada con la creaci6n. el c6digo de toda vida se transforma en las palabras "estatica" que detectaron en todas partes jera en realidad un de un mensaje eterno.y Wilson habian intentado aprender mas ra reemplazarse con las letras clave de los lenguajes antiguos. claves de nuestro origen. El significado: jLa humanidad es una familia unida a tra- da que se Ie llam6 el modelo estdndar de la creaci6n. tan abundante en nuestro propio mundo que tambien se haya Robert Dicke. formando los bloques con que se construye nuestra exis- Wilson recibieron eI Premio Nobel por su trabajo en 1978. pudieran revelar una ironia similar. un constante ruido de fondo que del misterio de nuestros odgenes. oxigeno y carbono que forman nuestro ADN pueden aho- Aunque Penzias. y el resultado de un acto intencional de call. tencia. la AI hacerlo. Si en realidad habia UN DESCUBRIMIENTO EXTRAORDINARIO QUE VINCULA los alfabetos ocurrido una liberaci6n de energia de tales proporciones. Al traducirse. "1 Penzias y vez. S6lo despues entre nosotros. el mensaje se repite. Para 1970. Penzias cuenta durante al menos dos anos. Preservado dentro de cada celula de los seis mil millones de cubrimiento de la radiaci6n subordinada de microondas cam. que la evidencia que contiene la clave de uno de los mayores lesto ruido. el mensaje revela que las eco que aun persisda de una antigua explosi6n! Sin darse cuenta. de evidencias que poddan servir como desde una prueba nuclear sobre la superficie terrestre llevada un principio sin precedente relacionado con la unidad huma- a cabo en 1962. .. "el principio". habitantes de nuestro mundo. una prueba que sobrevivia desde El mensaje dice: "Dios/Eterno dentro del cuerpo". un notable astroffsico de la Universidad de Princeton. puesta a los misterios mas profundos de nuestra existencia sea En la cercana Universidad de Princeton. buscando. no. jhasta las familias de palomas que vivian en na. ves de un legado comun. La ironia del descubrimiento en los Laboratorios Bell es Aunque los investigadores anteriores habian notado este mo. la teorfa era tan ampliamente acepta. Quizas la busqueda de las y Wilson investigaron en forma met6dica otras posibilidades. sobre nuestro universo estudiando senales entre las galaxias. que se pas6 por alto y no se tom6 en pecciones eliminaron al equipo como fuente del ruido. ~Es posible que la res- la antena! Nada pudo revelar la fuente del ruido. estaba explorando teodas que sugedan que el pasado por alto? universo empez6 en un pasado distante como una primera ex- plosi6n de proporciones inimaginables. AI aplicar este descubrimiento allenguaje de de que los tres cientificos compartieron sus descubrimientos nuestra vida. forma tan inesperada. y 10 ignoraron. nitr6ge- entendieron la fuente de la estatica y 10 que habian descubierto. letras precisas del nombre antiguo de Dios existen como un c6digo habfan encontrado la prueba de la teoda de la Gran Explosi6n en la informaci6n genttica de cada dlula. otro ciendfico. supusieron que era un producto secundario de la misterios de la creaci6n fue tan abundante.XIV El C6digo de Dios Introducci6n XV dificultaba detectar las sutiles senales que estaban. Este antiguo mensaje que data del dfa de nuestros or{. su hebreos y arcibigos de la Biblia con la quimica moderna revela teoda era que debeda haber ecos de ese suceso en forma de ese c6digo perdido: un alfabeto que sepuede traducir. John Bah. hab16 creaci6n! sobre el significado de este descubrimiento diciendo: "El des..

importar gui6 adelante describiendo este cambio: "La era del descubri- cual sea nuestra raza. El Dr. gan una rara capacidad.. la hermosa danza de la naturaleza". de disefiar patrones de clima a la medida de nuestras l6gica que se base en nuestras diferencias finalmente se disuel. Kaku. como especladores. nuesua relaci6n con la cuerpo. numerosas facetas de sus complejos ojos. activos de la naturaleza". nuestros parientes mas cercanos.XVI El C6digo de Dios Introducci6n XVII genes. observo d Dr. ahora nuestro futuro depende de nues- de un vinculo comun. como cia misma.Como veremos en el capitulo 9. field" [campos en serie] y profesor de fisica te6rica en el City Al enfrentar los desafios unicos de nuestros tiempos. Quizas como un testamento para nuestro exito como naturalaa ha asumido un nuevo significado. sin embargo. sino que estamos relacionados con la vida en creaci6n los eternos secretos de la materia. Por primera vez en la historia epoca hist6rica. Despues de una replica perfecta en el interior de cada celula de nuestro lcrminado d siglo XX. hasta la mirada fija encontramos que somos capaces de redisefiar nuestro c6digo de los primates. y tal vez nuestra superviven- humana". necesidades. Nuestros hallazgos recien descubiertos nos otor- hierva hasta las vastas extensiones de las selvas 'inexploradas. una nueva era de dominio. reconocer que somos parte de todo 10 que vemos. la supervivencia de toda nuestra especie depende de narias circunstancias a que se enfrenta el mundo en estos los las opciones que elija una sola generaci6n. hoy en dia estamos en la cuspide sal que produce un mensaje identico cuando se traduce ya sea de una transicion que marcara una epoca: de ser observadores allenguaje hebreo 0 al arabigo! pasivos de La naturaleza nos estamos convirtiendo en coreografos El descubrimiento del nombre de Dios dentro de la esen. y la expre- Michio Kaku. la concepcion. y se esta abriendo cias. Con una prueba tan tangible za. se nos da una razon para ver mas aHa de tra capacidad para usar nuestras recien descubiertas habilidades los temas que pudieron separarnos en el pasado. Hoy en dia. nuevos descubrimientos en la ciencia y la tec- rencias parezcan insuperables. legado. y de crear nuevas formas de vida: poderes que ve ante la evidencia de que toda vida esta hecha con el equiva. en la forma mas intima imaginable. conocida. "solo podiamos observar. cualquier genetico. en los ultimos cien anos Ie hemos arrancado ala unos con otros. parece existir dentro de cada uno de nosotros. Con las fuerzas de la naturaleza a nuestras ordenes. especie. Quizas es precisa- primeros anos del siglo XXI. 2 cia de toda vida demuestra que no s6lo estamos relacionados De hecho.. este libro recibi6 influencia de las extraordi. Al mismo tiempo. Quizas quien ha expresado con mente la presencia de tal poder 10 que ahora nos compele a mas claridad el caracter unico de nuestros tiempos fue el Dr. religi6n. cofundador de la revolucionaria teoria de "string sion de algo aun mas grande. jel c6digo es tan univer. y nos propor. sin. ciona un punto desde el cual empezar cuando nuestras dife. Desde una brizna de y la muerte. estilo de vida 0 creen. con sabiduria. la vida si. cada miemhro de nuestra familia global lIeva el mis- . miento en la ciencia esta Hegando a su fin. hist6ricamente se dejaron en manos de Dios 0 de la naturale- lente quimico de un solo nombre. Kaku si. permanece dentro de nuestro cuerpo hoy. la da- College de Nueva York. nologia han puesto a nuestro alcance el poder de preservar 0 En la medida en que cualquier obra es un producto de su destruir todo 10 que amamos. desconocida en cualquier epoca del desde una mosca de una fruta que nos mira a traves de las pasado. "Durante la mayor parte de la historia ve para la paz de nuestro mundo.

investigadores y Hderes religio- sos indican que la humanidad es la unica y mayor amenaza E/ Codigo de Dios es el resultado de 12 anos de investiga. el mayor conglomerado de armamento y estos lugares. . aislados y remotos que quedan hoy en la Tierra. AI descifrarlo. fucrzas militares desde la Segunda Guerra Mundial representa ran que su deber en la vida. en los primeros anos de un nuevo • En estos idiomas. se presentan ante nosotros como los ma- plos. grabado el primer dia de nuestra existencia. Figura 1. mi busqueda me ha llevado a tem. sin importar cuales sean que se dio muerte a mas personas como resultado de la violen- sus creencias. cia. muchas de las hostilidades se basan en dife- do "por casualidad" es aproximadamente de 1 a rencias religiosas. somos mas grandes que cualquier geno. A partir de 1986. creadas por el hombre.2).XVIII El C6digo de Dios Introducci6n XIX mo mensaje como un recordatorio silencioso de nuestro lega. los cientificos. yen el que bus- mitos. al menos mil anos antes de casi una tercera parte de las naciones del mundo involucradas que la ciencia moderna verificara estas conexiones. en lenguajcs secretos yen regis. como la • Los elementos basicos del ADN: hidr6geno. Las realidades. un tema que las subyace nos recuerda que. de guerras y de genocidio. a traves de divisiones culturales. aldeas y monasterios ocultos en algunos de los sitios mas yores retos de nuestros tiempos. El mismo nombre vive dentro de di6los cien anos mas sangrientos de la historia humana. Estando presentes tales peli- primitivos. y 10 consideran un honor. poderoso se revele ahora. Las estadisticas muestran que e1 siglo xx: compren- nombre de Dios. oxigeno y carbono. 200. Cifra que gado. • Esta relaci6n se describi6 en textos sagrados como el Esa violencia continua en los primeros anos del siglo XXI. nitr6. he conocido individuos dedicados que conslde. supera las muertes causadas por todos los desastres naturales combinados durante ese periodo (Ver Capitulo 1. En gros a nivel mundial. estilo de vida. se traducen directamente diferencia que alguna vez nos haya dividido. de limpiezas etnicas. 3 Ademas de la lucha por obtener ga- • La posibilidad de que esta relaci6n haya ocurri.000. Este es el escenario en que vivimos dia Nuestras tradidones mas preciadas. tros ocultos. nuestro c6digo genetico escribe el milenio. con Sepher Yetzirah hebreo. d riesgo de involucrar a la Tierra en un conflicto de una mag- tfa apecic y la historia del mundo. mediados del siglo. es preservar las memorias de nues. contenidas en antiguos tras dla. (amos la paz para nuestra vida. familia de la humanidad. nitud sin precedente. diferencias raciales y fronteras. A pe- el mensaje revela los siguientes hechos innegables: sar de 10 diferentes que parecen ser las tradiciones a nive1 su- perficial. geograficas y religiosas. religi6n 0 le. Tal vez no sea accidental que un mensaje de unidad tan bigo. Hoy en dia. acciones.. contra nuestro futuro. en conflictos armados. en e1 que educamos a nuestros hijos. formando letras clave de los alfabetos hebreo y ara. nancias y recursos. ci6n y de una busqueda personal de un principio de la unidad de enfermedades que se resisten a todo tipo de medicamentos humana que fuera tan profundo y tan tangible que no pudiera y el colapso de los ecosistemas de la Tierra que se predice para negarse. tienen un tema que es sorprendentemente similar do. en los todos los seres humanos. en danzas uadicionalcs.

xx E1 C6digo de Dios Introducci6n XXI Quizas nuestra situacion es muy similar a la de los miem. 10 EL CODIGO DE DIOS ES DEFINITIVAMENTE una obra de paz. pero relacionadas entre si: la Primera Parte ofrece una historia nes celebren la diversidad y vivan en paz. y une 10 que conocemos de nuestro pasado con 10 que creemos bros de una familia que estan acostumbrados a pasar tanto sobre nuestro presente en un principio unificador unico. los descubrimientos que se describen en estas pagi- tales extremos y tragedias antes de que ocurra ese despertar. dcsenvue1van como un trayecro. la re1igi6n y la historia. en el interior del cuerpo de cada mujer. el deterioro de nuestro mundo. se nos da una razon para en- perspectiva. y presentar tales principios de unidad. y un terreno comun sin precedente a partir del Asi como una perdida puede transformar a una familia. no obstante. fiador de sistemas de computo en la industria del espacio ae- reo y la defensa para dedicarme. y nos haga ver la realidad de 10 valiosa que es nuestra familia global y el tiempo En la primavera de 1990. honrarse unos a otros y creer t e describe el descubrimiento y la traduccion del codigo. requiere de algo que y un contexto que nos dicen por que el mensaje que hay en parece estar ausente en muchas de nuestras sociedades actuales: nuestro cuerpo es importante en nuestra vida. Cruza primordial. del Cada persona lee de manera un poco diferente. la que somos parte de algo aun mayor. Orros prefieren permirir que las ideas del auror se las fronteras tradicionales de la ciencia. t llnidad para sanar las diferencias que dividen a nuestras fami- mos descubrir que esa evidencia viviente del nombre de Dios lias ya nuestro mundo. Estas cualidades pueden 1ercera Parte explica como el mensaje ofrece una rara opor- hacerse realidad solo a traves de la experiencia directa. Aunque la investigacion no es necesario que toda La humanidad sufra continua. iPode . el saber que el nombre dos les hace recordar 10 valiosa que es en realidad la familia y el de Dios esta presente dentro de nuestro cuerpo ofrece una com- tiempo que pasan juntos. podr-ia convertirse en Sobre este [ibro el catalizador que nos despierte. nino y hombre. que se convierte en La experiencia mas significativa de nuestra una manera de ver la vida y los lanza de golpe a una nueva vida. y los intentos de eliminar culturas enteras. ofrece precisamente esa experiencia! nos. es importante conocer1a esencia dellibro en el que estan . contrar la paz. Mediante esa experiencia. la Segunda Par- una razon para honrar la vida. a gran escala. empena un papel en nuestro mundo. nas son en si un corpus completo y significativo de informacion. tiempo completo. deje una prospera carrera como dise- que pasamos juntos. el cual podremos empezar a resolver nuestras dificultades. crear un mundo donde las familias y las nacio. sufrimiento sin precedente. Sin embargo. Para algu- pasado y del presente. confiando que al final los lIe- . antes de leerlo. Aun- tiempo juntos que olvidan 10 profundo que es en realidad su que muchas personas sospechan que un poder superior des- vinculo familiar. a desarrollar A diferencia de La familia de nuestro ejemplo. Para los sobrevivientes. tan personal y sin embargo tan univer- se convierte en el catalizador que los despierta y los saca de sal.1 pumo de invertir su tiempo y energia. la "perdida" prension tan profunda. Solo la perdida inesperada de sus seres queri. He dividido ellibro en tres secciones claramente distintas.

8 y 9 libro "perdido" de Adcin hasta la Biblioteca Gn6stica Nah Ham. de la historia. entrar directamente a la porci6n de este libro que aborda esa El Capitulo 3 detalla c6mo algunos de los registros mas pregunta: la Tercera Parte. es claro que quienes escribieron estos manuscritos an.500 anos antes de nuestra epoca. y relacionar los relatos mas antiguos del Genesis nuestras diferencias. aire y agua. y ahora mas alIa. el Capitulo 6 revela c6mo el da de la historia ha extendido nuestros ojos y oidos colectivos nombre antiguo y personal de Dios. el nombre que se registr6 hasta los confines del sistema solar. la Primera Parte prepara el escena. en la Segunda Parte. tulo 7 nos ayuda a aceptar las implicaciones del nombre de tiguos deseaban compari:ir sus descubrimientos con las Dias en nuestro cuerpo. tanto en las guerras minador de numeros nos permite comparar "manzanas con santas como en los genocidios. la visi6n precisi6n c6mo la molecula del ADN puede leerse como un \c convierte en un terreno camun. Al hacerlo. Esta secci6n sugiere que la experiencia recono- directos en ellenguaje actual de la qu{mica: juna corre1aci6n I c que el hecho de que e1 nombre de Dios este presente en . jrepresenta el fun- tra busqueda por encontrar c6mo embona111Ds. el Capitulo 4 presenta las claves encon. nas parezcan abrumadoras. juntos. 0 Libro de El Capitulo 9. y sus equivalentes flO putdt ntgar. la ironia de nuestro tiempo es que presentar una diferencia en nuestro mundo actual. laci6n oculta que crea un puente entre nuestras creencias anti- do de sus preferencias individuales. Desde el misterioso del mensaje que hay en nuestras celulas. en el damento mismo de nuestro ADN! esquema de la creaci6n.XXII El C6digo de Dios Introducci6n XXIII varan a algo uti!' Los siguientes principios tienen la intenci6n que tiene resultados sorprendentes! El Capitulo 4 revela la re- de ayudar allector a navegar a 10 largo de este libro dependien. con la ciencia actual. el Sepher Yetzirah. este poderoso vinculo y continua el trayecto hacia el misterio rio describiendo c6mo nuestro anhelo de saber quienes somos de los alfabetos y los c6digos ocultos de letras. El capitulo termina presentando 10 que papel que ese mensaje podria tener en la creaci6n de un puen- a menudo se ha considerado ellibro mas antiguo y mas miste. mas de 3. y los Capitulos 8 y 9 describen el generaciones futuras. en nues. rioso de las tradiciones hebreas. hecha primitivos de nuestro pasado han intentado responder las pre. El notable ha- Ie ha dado forma ala historia de nuestro mundo. los invito a todavia no hemos descubierto con precisi6n quienes somos. aplica Para todos los lectores. te entre las diferencias que amenazan nuestra supervivencia. el Capitulo 5. nos hemos definido a traves de manzanas". para la saluci6n de conflictos que se basa en una visi6n compar- Para los lectores que estan interesados en comprender con t ida de un futuro comun. AI mismo tiempo. y desean conocer datos espedficos sobre pczar a al cual regresar cuando las diferencias entre las perso- este descubrimiento. "El descubrimiento". Despues de la presentaci6n. Incluso con los milagrosos avances de A quienes se preguntan c6mo un unico mensaje puede re- la tecnologia del siglo XX. por ejemplo. El Capi- maddi. Tanto en las llazgo que reduce las letras y los elementos a un comun deno- persecuciones como en las inquisiciones. abordan 10 que este mensaje significa en nuestra vida. En ese tipo de tradiciones. guas y modernas. ellugar desde el cual em- lenguaje traducible. la ciencia mas avanza. La clave es que la vision compartida tradas en el Sepher Yetzirah para revelar el vinculo oculto entre (j una txperiencia unificadora que la vision de los participantes los antiguos elementos de fuego. describe un antiguo metodo la Creaci6n. la ciencia y la traducci6n guntas mas antiguas de nuestra existencia. los Capitulos 7.

humano de nuestras opciones cientificas y politicas a medida que creamos nuestro fUturo? Un l1bro basado en una . debe considerarse en la politica y en la ciencia. Hacerlo as!. mos buscar mas aHa del pensamiento que los ha definido. recibi asesoria de algunos ven con claridad y los cursos de acci6n son obvios. los mas avanzados puntos de vista cientificos. Hacer justicia a todas y cada una de las hecho de que el mensaje sea el "material" del que estamos he- implicaciones del c6digo presente en n. no obstante. rios del Oriente Medio. falta algo. Cuan- pos. AI mismo tiempo. en la guerra y rencias que hay en nuestras vidas y traer paz a este mundo. Existe un antiguo refran que sugiere que cuando las res. ver los problemas de nuestra epoca. familias. AI final. AI igual que con cualquier descubrimiento de naturaleza ciente sugiere que este es precisamente el caso e~ 10 que se tecnica. ha quedado. Cada una de problemas a una escala mayor. soluci6n una preocupaci6n mas profunda y mas fundamental. hasta el colapso que se ha predicho de Desde las descripciones mas antiguas de nuestro origen. signitlcaria revelar . rebasa chos nos dice que somos parte de un esquema mucho mayor. en politicas que preparen el camino del mafiana. los problemas que nos dividen como claro q!Je para resolver los desafios de nuestros tiempos debe- individuos. y las opciones son mas dificiles que unir la sabiduria de nuestro pasado con la ciencia de nuestro futuro. religiones y naciones han alcanzado pro. el tema de este libro trasciende lucha de 4. de que una inteligencia superior subyace nuestra existencia. abri- puestas son vagas y las situaciones son dificiles de resolver. necesitamos.a 0 un ardculo tecnlco: El signo tangible. Nuestra relaci6n con esa inteligencia es un factor que ahora me en el poder del mensaje para crear un puente entre las dife. Un corpus de evidencias siempre cre.uestras celulas. verificable y universal de un mensaje. expenos quienes me aconsejaron ofrecer el material desde una Dodrfamos descubrir que las crisis actuales son s!ntomas de perspecriva culta. AI porciones abrumadoras. su capacidad inmediata. que sea exacta y significativa para el publico en general. por mos una ventana sin precedente hacia los misterios de nuestra 10 general se debe a que no tenemos toda la informaci6n que propia creaci6n. el reto ha sido transmitir la informaci6n de tal manera refiere a los problemas mas controvertidos de nuestros tiem. Cuando toda la informaci6n esta presente. hasta los ecosistemas del mundo y el incremento en el acapio de ar.en mas de efectos masivos. en lPor que este enfoque? el fundamento mismo de la vida. los limites tradicionales de la ciencia y de la espiritualidad. ofrece evidencia innegable Es cieno que este libro habla sobre muchas creencias profun. en la paz. creamos instrumentos nuevos y poderosos para resol- nunca antes.nvestigad6n ser. Por esta raz6n.000 alios de duraci6n relacionada con 105 territo. opte por concentrar. Este enfoque pod:ia ser ~s­ plantea exactamente la misma pregunta: pecialmente util para los conflictos que se basan en dlferenclas dCudl es fa "medida"para evaluar el costo religiosas y etnicas. El das y muy personales. Introducci6n XXV XXIV El C6digo de Dios nuestro cuerpo puede tener un prop6sito similar a 13. las opciones se do empece este proyecto en 1990. Desde los problemas complejos que rodean al terrorismo y la Por su misma naturaleza.

AI considerar es. mas p~ofundos en cuanto ala raz6n y la compasi6n". yen la medida en que home- . AI mismo tiempo. Creian que valia la pena teria y de la vida durante muchas generaciones futuras. Los Capitulos 4 y 5. A princi- es ofrecerles el descubrimiento como una narraci6n fluida y pios del siglo XX. durante meses darnente debido a su profundidad. con el fin de permitir un ritmo y un flujo que sea de Dios. la mejor manera de honrar a mis lectores hist6rica tomada del fallecido ffsico Heinz Pagels. Cada una de estas lecciones nos plo. coda vida. hay algo de 10 que podemos estar segu- sea divertido de leer! ros: A partir de las muchas lecciones que nos han ensefiado las Aun teniendo en mente estas consideraciones. por ejem. Espero que al hacerlo que concierne a la manera precisa de aplicar nuestros recien haya yo creado un libro significativo iY que al mismo tiempo descubiertos poderes. (por ejemplo. y al mismo tiempo presentarlo oportu. la energia y la vida y dice que debemos buscar "un orden incluido referencias a la investigaci6n que hizo posible este moral y politico que de cabida a estas fuerzas 0 de 10 contrario libro. tulo un resumen de sus puntos clave. notas a pie de pagina y tion que enfrentamos ahora tiene que ver con el equilibrio referencias con tal de tener la oportunidad de compartir el entre la sabidurfa y el poder. a un unico tema subyacente. sufrimiento del siglo que acaba de pasar. proceso de aprendizaje? En su obra pionera Hiperespacio. equilibrar nuestro conocimiento de la ciencia con las fuerzas tas recomendaciones tan honestas y sinceras. iAdquiriremos la sabidurfa para mensaje con rapidez a una mayor audiencia. la cues- dejar a un lado las tablas. otros me animaron a optar Aunque seguiremos refinando nuestra comprensi6n de la ma- por un enfoque menos academico. El grado en que permanezcamos giiedad. Dentro de la narraci6n. se incluye al final del capi- o incluso mos. fides a 10 que hemos aprendido. se retras6 seis afios mientras fue evaluada por compa- neros y arb'Uros) . el odio y el existen porciones de este libro que se captaran como "verbo. grificas. camino mientras damos forma a las fuerzas de la naturaleza y nes largas. Este enfoque me permite compartir el descubrimiento seremos destruidos. I El poder del C6digo de Dios Durante ese mismo periodo. en todas partes. la publicaci6n final y el poder del mensaje. los desastres ecologicos. de cuerpo se relaciona con ellenguaje de los hebreos de la anti. Esto pondra a prueba nuestros recursos con responsabilidad. me he esforzado al maximo para AI parecer no existen modelos claros que nos muestren el reducir 10 mas posible el vocabulario tecnico y las explicacio.5 namente.XXVI El C6digo de Dios Introducci6n XXVII los hallazgos en etapas que ala larga retrasarian. profundizan los detalles de c6mo la quimica de nuestro recuerda la naturaleza sagrada e interconectada de la vida. sin duda guerras. Pagels comenta los descubrimientos de la no como un informe estructurado. la enfermedad. opte por tomar de la naturaleza antes de sufrir las irreparables consecuen- 10 mejor de ambos enfoques y ofrecer ~n libro-que toma "un cias del mal uso de nuestro poder? iSobreviviremos a nuestro curso medio". el Siento que al representar las diversas ramas de estudio que Dr. Aunque hemos entrado a territorio inexplorado en 10 atractivo para la mayoria de los lectores. he luz. el estudio de los c6digos numericos de la Biblia hebrea. todo puede reducirse sas" y mas tecnicas que otras. Para aquellos lectores que prefieran no leerlo deteni. Michio Kaku comparte una perspectiva de nuestra epoca conforman esta obra.4 .

EL Codigo de Dios no pretende ser La solu- cion cuando nos enfrentamos a los mayores retos de la ciencia.6 Este li- bro es la historia de una razon para creer que tenemos una opcion. EL Codigo de Dios se ha escrito con un proposito expreso en mente: revelar con claridad y sencillez un principio unico de unidad que trasci~nde todas las separa- ciones que se basan en nuestras diferencias y que estan presen- tes en la familia de la humanidad. son controversiales. Ala luz de las muchas posibilidades que este material puede sugerir. resumio en un enunciado nuestra situacion. la tecnologia y la paz en la historia de nuestra especie. nos dan poder y quizas para algunos son abrumadoras. yel poder de un solo nombre para unificar a nuestra familia global aunque existan diferencias que en ocasiones pa- rezcan insuperables. Barbara Marx Hubbard.Gregg Braden Taos. simplemente pretende ser un punto de partida. cuando dijo: ''Ahora debemos decidir entre una evolucion consciente 0 una extincion mediante el mal uso de nuestros poderes". En una epoca en que se pone tanto enfasis en nuestras diferencias.XXVIII EI C6digo de Dios mos el principio de la vida en cada eleccion que hagamos. El fruto de nues- tra disposicion favorable a verlo en esa forma. futurista y arquitecta social. po- dremos estar seguros de no equivocarnos. nuestro papel como administradores en el milagro de nuestra propia existencia. Las implicaciones de ver nuestro ADN como el mensaje de un poder superior son vastas. visionaria. revela nada me- nos que una clave para la paz duradera y una invitacion a asumir P 'fMERA P. Nuevo Mexico Diciembre de 2003 . .

.

Es den- tro de este contexto de extremos donde buscamos la unidad de nuestro mundo y un significado mas profundo para nuestras vidas. Ademas. y que ademas tenemos el poder de hacer realidad cada una de nuestras visiones. al mismo tiempo. tanto temor. sabiendo que en eI interior de cada . Quizas en ningun otro momento de la his- toria hemos compartido nuestro mundo con tantos de nues- tros semejantes sintiendonos. ~Que significaria descubrir una evidencia innegable: una prueba verificable. Capftulo Uno HISTORIA: El relata de nuestras dlferenclas S omos una especie misteriosa de extremos y contradiccio- nes. de que nuestra especie existe como un acto intencional de creaci6n? ~Que tan diferentes sedan nuestras vidas y nuestro mundo. las posibilidades de nuestro futuro nunca han albergado tantas promesas. Se ha dicho que somos capaces de tener los suefios mas hermosos y de albergar las pesadillas mas tenebrosas. y a la vez. tan separados y tan solos.

el mundo que hemos conocido nunca podria antigiiedad. nidad. son claves para la soluci6n de nuestro misterio. los muros labrados y los fragmentos de textos de la se compartiera. sugiriendo que mediante la experiencia de nuestra po y a los estragos de la civilizacion. Con la elocuencia dpica de muchas anti- Buscar [as respuestas correctas guas tradiciones. los eruditos se han hecho este tipo de preguntas y moderno se han convertido. oculto eOn el codigo gistros de quienes vivieron antes que nosotros: los pergaminos quimico de la vida misma? En el momento en que ese mensaje escritos. de legados 0 de herencia historica que alguna vez riamos de nuevo. existen referencias a una clave obsoletas. sobre la traves de la evidencia innegable dellegado comun de la huma. En ese momento. el mismo Dios. para encontrar respuestas a los misterios mas profundos. empeza. se revela la al mismo tiempo han buscado claves en los antiquisimos re- evidencia del antiguo nombre de Dios. A tiene la respuesta. olvidada desde hace tanto tiempo. aunque son interesantes. Consideremos las antiguas heridas que po. el Senor de las creencias logrado hasta la fecha.que con- para condonar atrocidades basadas en nuestras diferencias. limpiezas incompletos y solo revelan una porcion de algo cuyo alcance ernicas. se nos invita a "conocernos" Ya "buscar en en [os [ugares equivocados nuestro interior". Lo que existe. el Dios Supremo de las tradiciones hindues. metaforas. vida adquiriremos la sabiduria de los siglos. hayan podido dividirnos. que sugieren que los registros escritos de nuestropasado esran drian sanarse sabiendo que todas las persecuciones. . guerras religiosas e inquisiciones que se. hasta la ins- Con la revelacion de tal descubrimiento. de creencias. es precisamente sin embargo. ~Existe una evidencia tan poderosa? ~Podria un registro del Tradicionalmente. rios remotos y en fragiles manuscritos que se transcribieron Imaginemos las implicaciones de descubrir que el Dios de tediosamente letra por letra.000 anos. Algunos argumen- to desde el amanecer de nuestra creacion? Durante mas de larian que las tribulaciones y los retos de la vida en el mundo 4.emprendieron es mucho mayor. A traves de la busqueda en bibliotecas de monaste- ser el mismo. se nos dan los medios para zanjar las diferencias de la opcion de crear dificultades. la ignorancia ya no podria usarse universal-una capsula de tiempo de conocimiento. los descubrimientos que se han nuestras plegarias: el Ala del Islam. identidad de nuestro Creador y el origen de nuestra especie. El tema de tales pasajes es decepcio- nantemente simple. esperando a ser descubier. pondido a las expectativas de los investigadores. los conflictos en nombre de Dios solo podrian brotar Con esa clave. cada hombre y cada nino. y el Gran Espiritu de los nativos americanos. en grandes maestros. en nombre de Dios a 10 largo de los ultimos dos mil anos jhan Desde los pasajes misteriosos ~egistrados en el Sepher Yetzi- surgido de un malentendido de este mensaje eterno! rah.6 EI C6digo de Dios Historia 7 celula de cada mujer. los eruditos han visto estos pasajes como legado mas sagrado de la humanidad habet sobrevivido al tiem. el antiguo libro de la creacion de la Cabala. las razones que cripcion original que se Ida sobre la entrada principal del han justificado los horrores de nuestro pasado se volverian Templo de Apolo en Delfos. no han res- judeo-cristianas. A partir de entonees. de hecho.

hemos llevado un registro viviente de la busque- ci6n para buscar una evidencia de su creador no es muy dife. La que nos une como seres humanos. El notable antrop610go. los aparatos domesticos. ras instrucciones. reiter61a importancia de los sen- gastados por el tiempo yen manuscritos que estan a punto timientos de su padre diciendo: "Para darle significado al pun- de desmoronarse. historia tambien nos recuerda las consecuencias que experi- . Si una firma de nuestro Crea.8 El C6digo de Dios Historia 9 Sin embargo. da de nuestra identidad. Al hacerlo. la musica que colectiva. aclamado por Una nueva interpretaci6n de las invitaciones antiguas su. Gran parte de nuestra historia refleja nuestro intento por dor ha sobrevivido a los elementos del tiempo y de la naturale. reconocer aquello dar y acercarnos a nuestra idea siempre cambiante de Dios. entonces seria muy 16gico que esa sefial permaneciera dentro mes templos en los desiertos de Egipto. la biblioteca de la vida. mlsma. Leakey. Los enor- za. s610 necesitamos ver la obra en sf para creencias en un esfuerzo por definirnos. dijo en una ocasi6n: "No creo que podre- contrarse dentro de 10 que nuestras tradiciones mas caras mos avanzar sin una comprensi6n de quienes somos. y 10 que tal vez sea mas importante. el deseo de dar a conocer a otros familias. las cillez dellienzo de un artista. los observatorios ocul- de nuestro cuerpo. las guerras y los logros de quienes nos han antecedi- nuestros logros parece ser parte de la naturaleza humana. Olduvai de Africa. los bloques que construyeron nuestro pasado. hemos dejado pocos lugares sin explorar pues he- mueve nuestras almas y las esculturas que nos inspiran sin pro. podriamos des. hijo de Louis Leakey. La historia es el relato de ese viaje. verdade. la respuesta a nuestros misterios mas pro. sus descubrimientos de antiguos homfnidos en el desfiladero giere que la clave para descifrar nuestros misterios podria en. y de d6nde describen como el maximo logro de la creaci6n de Dios: jnuestra venimos". nuestra busqueda para saber quienes rente a una practica que es comun hoy en dfa. En forma ver los autom6viles. y de precisamente c6mo encajamos en el esquema de construcci6n de complejos aparatos electr6nicos hasta la sen. encontrar gracia en la presencia de un poder superior. Desde la somos. el antrop610go Richard biologfa! En lugar de buscar entre los restos de templos des. la creaci6n. existe. nos reconocer ·los principios universales que nos unen a nuestro recuerdan nuestros esfuerzos a 10 largo de la historia por agra- mundo. la idea de mirar al interior de la crea. tos en las selvas de Yucatan. en el siglo XX. ~seria posible que la invitaci6n que se oos hace a cubrir que nuestra busqueda del pasado ha sido el catalizador "mirar en nuestro interior" sea algo mas? ~Podrian tales pasajes que nos ha guiado ala fuente de conocimiento mas antigua que tomarse en forma literal y leerse como instrucciones. Al do. nas del tiempo. Louis Leakey. Nuestro legado se preserva como las naciones. Mas tarde. A 10 largo de las pagi- Conceptualmente. necesitamos mirar de d6nde • " 1 fundos podria estar oculta dentro de laO expresi6n de la vida vemmos. los santuarios en las cumbres de El secreta para revelar esa firma es que debemos primero las montafias de Peru y las grandes catedrales de Europa. mos puesto a prueba los Hmites mismos de nuestros sentidos y ducir sonido alguno. descubrir la firma de su creador. to en que nos encontramos ahora. que describen d6nde podemos encontrar la Se ha dicho que la clave de nuestro futuro esta en nuestro clave de nuestra creaci6n? pasado.

Nuestra historia es la historia de una 1993. sociedades" basandose en principios que van mas alla de la bles de clase y de nivel social que impulsan nuestro sentido de tierra y la propiedad de recursos naturales. dor Eric Hobsbawm llam6 "el siglo mas asesIDO que regtstra la historia" . incontables miembros blea General de las N aciones Unidas escogi6 el terrnino geno- de la familia global han sufrido en formas que parecen impen. AI ') Causar dano grave corporal 0 mental a miembros del mismo tiempo. En 1948. el ultimo siglo fue testigo de horrores de diferente periodo relativamente breve. nos encontramos en un mundo donde la vida grupo. Durante ese recursos. vidas en un solo dia. nos las hemos arreglado para se.2 Al deterrninar el numero de victimas de 10 que el llama Una especie que se define por sus diferencias "matanzas por motivos politicos". nadas!3 Ian ha existido nuestro mundo. definiendola c. Francia e Italia combi- de los 4. jmaS queza de las sociedades y al avance de la tecnologfa. medad y alargar nuestra vida hasta edades muy avanzadas..L I mponer medidas cuya intenci6n es impedir nacimientos Aunque el desarrollo de armas de alta tecnologfa en el siglo que acaba de pasar hizo posible la destrucci6n de incontables en eI grup( l. Zbiginew Brzezinski. la historia muestra que algo mucho mas :. se ha llamado "la inhumanidad del hombre hacia el hombre". A 10 largo o menos la poblaci6n de Gran Bretana. A partir de estas barreras. . Juntos. quien En nuestro mundo de diversidades. a menudo ha sido mas fuera asesor nacional de seguridad de Estados Unidos duran- facil concentrarse en las diferencias que nos dividen que en los te la adrninistraci6n del presidente Carter. nuestros ancestros humanos Junto con las batallas para zanjar disputas sobre fronteras y mas cercanos surgieron hace s6lo 250~000 anos.omo: sables a la mente de personas racionales y amorosas. la ri.. Matar rniembros del grupo. la violencia provocada por nuestras diferencias habria especie que se define por la religi6n. esclavitud e intentos por eliminar razas en. Transf(:rir por la fller"a a 01 ro grllpo Ii los ninos del grupo. estamos asombrados ante la tecnologfa aparentemente milagrosa que nos permite combatir la enfer. tipo: el aparentemente implacable esfuerzo por "limpiar las nalar nuestras diferencias y transformarlas en barreras invisi. genocidio en 10 que concierne a las poblaciones humanas: En la actualidad. costado entre 167 y 175 rnillones de vidas en el siglo XX. "negarle a grupos humanos completos el derecho la eXlsten- compartimos las tinieblas de una historia llena de persecucio. rutinariamente se ). la Asam- separaci6n. I nflingir deliberadamente al grupo condiciones de vida di- extingue debido a las atrocidades ya la violencia de 10 que senadas para causar su destrucci6n fisica total 0 parcial. El articulo II de la Convenci6n de las N aciones Unidas nes. . cia".5 miles de millones de anos que los ciendficos calcu. el color de la piel. cidio para describir este tipo de violencia. calcu16 que para principios que nos unen. que tantas personas luchan por preservar. sobre el genocidio defini6 mas a fondo cinco categorias de teras de la faz de la Tierra.10 El C6digo de Dios Historia 11 mentaron individuos y poblaciones enteras que no estuvieron profundo es responsable de haber fraguado ~o que el hi~toria­ de acuerdo con las creencias de sus tiempos. inquisiciones. 1.

se perdieron cinco veces mas de vidas debido a la antes de la era moderna. religiosos y ftlosoficos si pulsar a1 nativo americano de sus tierras y eliminar su forma se les compara con los desastres naturales mas importantes y la de vida. durante ese mismo periodo magnitud de los genocidios que han continuado hasta nues.2: Numero de muertes causadas por diferencias de religion y de creencias.1: Numero aproximado de muertes'a causa de inquisiciones y episodios de genocidio. fue 10 que inicio las tendencias actuales.. casi 40 millones de seres humanos ya ha. el esfuerzo de casi 300 anos por ex. Los La forma de genocidio que se basa en diferencias de raza. Las estadisticas correspondientes a los Balcanes son conservadoras debido a la cantidad de muertes de civiles sobre las que no se informo. 10 que incluye el holocausto juelio de la Segunda Guerra Mundial. Laos. " como e1 I am I)Ien Sl~ ' 01qUl'"aca)o I' con Ia paz . (ver la Figura 1. Vietnam. se incluyen por motivos de compara- cion. se llama Para poner estas abrumadoras cifras en perspectiva. Entre el comercio de esclavos africanos estan de acuerdo en estas cifras. y las limpiezas etmcas que han ocurrido en las regiones de los Bal- canes.2). las cifras en sf son menos sig- en el Atlantico y los holocaustos de nativos americanos del nificativas que la magnitud del relato que representan. Aunque las cruzadas se llevaron a cabo antes de la epoca que se describe en este libro. AI agregar las atrocidades del siglo XX en Europa. . y que es responsable por la magnitud de muertes sobre las que informan Brzezinky y otros. violencia basada en conflictos hnicos. (Figura 1.1(. y causo la cpidemia de SIDA combinados.1). desastres naturales incluyen sequias y hambrunas. Aunque los historiadores por 10 general tros elias. 12 E1 C6digo de Dios Historia 13 antes de los horrores del siglo XX. Figura 1. . raza y legado. que el siglo que acaba de pasar es notorio por sus guerras san- Aunque la historia de estas persecuciones empezo mucho grientas. aun- limpieza etnica. Africa y el Tibet. la cifra fa- cilmente excede los 53 millones. y bien podria ascender a 4. Figura 1. por el SIDA y a causa de desastres naturales en el siglo XX. religion y legado.8 millones 12 • Los calculos se tomaron de prome- dios de registros historicos. l'S por esta razc'>n que cl siglo que acaba de pasar se conoce bfan pcrecido debido a diferencias de religibn. Camboya. el holocausto de cristianos y ca- tolicos en Poloma durante la Segunda Guerra Mundial. Quizas siglo XVII al XIX.

la mayoria de las misio- del siglo XXI. en la que se reduce el co~flicto mediante un dos y la Union Sovietica. si eso fuera siempre muy favorables. a los guardianes de la paz. se esta preparando en el es proporcionar paz y estabilidad a una regi6n geografica espe- nuevo milenio el escenario para carreras armamentistas simi- dfica. necesario. cuando esos intentos han fracasado . la represi6n de la violencia que brota del dolor y la ira en una parte del mundo no hace que el conflicto desaparezca. Pakistan. Con el numero del Este. gran parte de la manera de pensar responsable de nes de paz de las Naciones Unidas se concentran en Europa esa siniestra caracterizacion parece persistir. No deberia sorprendernos ver que la ten- si6n de regiones enteras se vuelve aun mayor inmediatamente despues del uso de la fuerza para apagar los brotes de violencia.14 EI C6digo de Dios Historia 15 La paz es mas que la ausencla de guerra En el segundo afio del siglo XXI. la paz que proporcionan puede ser simplemente una lares a las de la Guerra Fria del siglo anterior entre Estados Uni- paz impuesta. la guerra despliegue de poder. En los primeros anos (Ver la Figura 1. mente las que han estado presentes en lugares que van desde AI recordar la imagen de un globo Heno de agua que se Bosnia y Herzegovina hasta tierra Leone y el este de Timor. En la actualidad. la naturaleza internacional de civil y las diferencias religiosas hace indudable que la violencia y las fuerzas de las Naciones Unidas es un recordatorio de que el sufrimiento que desfiguraron al siglo·XX serin ellegado de desde una posici6n "oficial". La historia tambien ha demostrado que a largo pla- el enfoque de retirada ha sido por 10 general un enfoque mili- zo. las intervenciones militares podrian verse como una especie de "curita". una paz impuesta por 10 general es ineficaz. la tensi6n subyacente que es la ralz de esa violencia permanec~. Aunque las tropas y las sanciones pueden ser muy eficaces en cuanto a impedir que haya violencia en una ubica- ci6n en particular. Estas fuerzas son precisa- una lecci6n poderosa. 1 • crisis inmediata mucho mas profunda. Ademas. aetivas en 21M 12.3). Es obvio que el tar: superar las fuerzas de la tirania con una fuerza mayor cuyo numero y la duraci6n de estas misiones nos esta ensefiando proposito es impedir mas tirania. En e1 contexto de las . La amenaza del terrorismo. Africa y el Oriente Medio. las Naciones Unidas em- prendieron 15 misiones de paz. presiona con un dedo en un lugar y ve uno como su volumen crece en otro lugar. con la promesa de Hevar una presen- Aunque los intentos politicos por remediar el conflicto son cia militar aun mayor para resolver la situaci6n. creciente de programas de armas nucleares en paises como In- Aunque el prop6sito de las fuerzas de las Naciones Unidas dia. una respuesta dpida a Una F4~ura 1. 10 que da un total de 54 mi- Las generaciones futuras van a estudiar al siglo XX como el siones desplegadas desde la creaci6n de la comisi6n en 1945 siglo mas violento de la historia escrita. Desde esta perspectiva. la mayor parte del mundo apoya los primeros anos del nuevo milenio.3: Misiones ddas Naciones llnidas a !ilvor dl'(a paz. Iran y Corea del Norte.

vida. en las acciones del vivir. el mundo entero podrian ser criticos en cuanto ala prevenci6n buscamos una senal. Cuando valora. Que tambien 10 sea nuestra respuesta global a traer una paz duradera. ademas de comprar tiempo precioso. EI 28 de abril de 2001. este tipo de crisis. nosotros. derosas de la historia. el hecho de olvidar esta crisis de Kosovo en 1999. la verdadera paz es mas que simplemente la que vivimos cada dia es un eco de nuestro anhelo por encon- ausencia de conflictos. A las 10:27 a. el constante conflicto entre Israel y los palestinos subi6 a nue. Excepto por una breve menci6n en las futuro. y ble en Madrid. Por ejemplo. y proporcionar un paso vital ha. Esta vo siglo? La intensidad de las guerras de los ultimos anos del nueva ola de violencia ocurri6 incluso con la presencia militar siglo XX. debemos estar seguros de algo: Podemos aprender de noticias vespertinas. algo que Ie de significado a 10 que hemos de la violencia a corto plazo. ~C6mo nos vemos a nosotros mismos al inicio de un nue- vas proporciones en los primeros anos del nuevo milenio. de nuestras relaciones interpersonales. experimentamos la espiral descendente de la competen- ner sentido si salvaran vidas a corto plazo. La historia ha mostrado que cuando optamos nistraci6n de Aeronautica y el Espado (NASA) habian por deshonrarnos unos a orros y deshonrar al principio de la rransmirido una selial hacia la vasredad del espacio profundo. Como mos la vida y nos vemos como miembros de una familia glo. al final es poco 10 que pueden hacer. No obstante. cada guerra e intento de lim. 10 que ilustra el hecho de que la fuerza no puede ser elocuentes. el dia anterior los cientificos de la Admi- esas creencias. la busqueda para conocernos continua. un hito en la busqueda que nos lleva a mas que nos dividen. los pieza etnica. creado y a 10 que hemos llegado a ser. tales respuestas p. Ya sea que hablemos de una familia a la hora de la cena 0 Hoy. nuestras acciones revelan de agosto de 2000. cia una soluci6n pacifica de cualquier conflicto. La paz duradera Dcurre en el coraz6n y trar un significado mayor en nuestra vida. Desde la caida de Roma hasta el gracias ala intervenci6n de las fuerzas pacificadoras durante la colapso de la antigua Uni6n Sovietica. recibieron una senal del primer objeto de nuestras relaciones con la creaci6n misma. antes de que ocurra entre los go. hora del Pacifico.16 El C6digo de Dios Historia 17 condiciones actuales del mundo.. el suceso que ocurri6 mas temprano ese nuestro pasado. Espana.m. La forma en de todo el mundo. se impidi6 el exterminio de aldeas y simple verdad ha destruido a algunas de las naciones mas po- comunidades enteras en la antigua Yugoslavia. puede verse como un espejo de nuestra relaci6n cientificos que trabajaban con un radio telescopio muy sensi- con nuestro Creador. dia pas6 desapercibido. comprender nuestro lugar en el cosmos vino y se fue sin mu- Aunque la respuesta a esta pregunta s610 se revelara en el cho bombo y platillo. las limpiezas etnicas y las luchas por el poder pueden en el area. La La busqueda de nuestro [ugar en [a creaci6n cuesti6n se convierte en saber si en ese tiempo tendremos 0 no la sabiduria para encontrar otra forma de resolver los proble. Como una tribu en la mente de las personas. Aunque los esfuerzos de pacificaci6n en do el prop6sito de suviaje. hecho por el homb~e que sali6 de nuestro sistema solar. s610 cia violenta y la agresi6n. no se habia recibido comunicaci6n alguna de ese aparato des- bal y administradores de la Tierra. que ha caminado errante durante tanto tiempo que ha olvida- biernos y las naciones. Cada conflicto.odrian te. .

. de 570 libras de peso.de su viaje.18 El C6digo de Dios Historia 19 en un esfuerzo por iniciar el contacto con el objeto desde la tormentas radioactivas. ".4: Ilustraci6n esquematica de la placa de oro que lleva la nave prendemos la estructura del hidr6geno. las distancias que ha recorrido haran que a la larga El 2 de marzo de 1972. Despues de 29 afios de eludir pardculas espaciales y . los C!)-.4). Ese dfa.. como nosotros.. . precedente que finalmente 10 llevada a los limites de nuestro sistema solar y mas alIa. buscan indi- rna sefial que se habfa transmitido desde la Tierra 22 horas cios de sus origenes y de otros seres de su misma clase.~7-f~ . con informaci6n vital sobre sus creadores y I sobre su origen. la silueta de la nave Pioneer y sfmbolos qufmicos que demuestran que com. el Pioneer 10 inici6 una travesla sin ese tipo de comunicaci6n no sea practico. la sefial reg~es6 y fue bajo cero del espacio profundo. bien podda el Pioneer encon- La sefial que regres6 a la Tierra ese dla de 2001 fue la mis- trar seres vivos inteligentes que. Figura 1. disefiada por el fallecido Carl Sagan y por el Dr. \ 1/ se equip6 al Pioneer con nuestra primera "tarjeta de presenta- ci6n" interestelar. datos que nos ayudadan en !1uestra bus. el futuro. la sonda. as! que la sefial se tard6 11 horas en llegar y otras 11 horas en dencia de nuestra existencia. En algun punta. Francis Drake. En la superficie de la placa se grab6 cuidado- samente un diagrama que indicaba que el origen del Pioneer era el tercer planeta del Sol y que muestra su relaci6n con el o -. que es el elemento mas Pioneer 10. Entre la informaci6n adicional que contie- ne. Aunque la misi6n de la fe en ellegado del Pioneer 10. o o -- • resto de la galaxia.\. una sonda espacial que habla la sonda espacial podria continuar durante cientos de afios hacia sido lanzada desde la Tierra hada tres decadas. dando a los cientl- ficos nueva comprensi6n sobre los campos magneticos.. despues de haber viajado tan lejos de nuestro hogar.C!) / planetas distantes.11:----- ~. regresar). y de soportar las gelidas temperaturas Tierra. Sospechando que la nave podria en- contrar vida inteligente en algun punto de su viaje sin retorno. Viajando a la velocidad de la luz. la gravedad y los patrones climatol6gicos de nuestros vecinos. con evi-. hay imagenes de un hombre y una mujer. abundante en el universo (Ver la Figura 1. La tarea del Pioneer era mandar infor- maci6n a la Tierra a 10 largo de su travesla. el Pioneer todav!a estaba "vivo" captada por el telescopio de Madrid. antes (El Pioneer estaba a una distancia de casi a 11 afios luz.- Se anex6 a la pequefia nave una placa de oro de seis por nueve pulgadas. / queda de quienes somos. Con esa sefial se renov6 y sus instrumentos todav!a funcionaban.

y llegar hasta las regiones inexploradas de nuestro sistema solar y mas alla. 18 Otros eientfficos e investigadores respetados en su campo. la ecuaci6n de Drake sugiere que podrian existir hasta que su unica misi6n es la exploraci6n. basandonos en la mejor informaci6n que tenemos. En la actualidad los cientificos En 1961. Esta f6rmula se conoce como la ecuacion Drake.46 trillortes de millas que la luz recorre en un ano).20 que estamos dispuestos a aplicar nuestra tecnologfa.19 la vasta extensi6n del cosmos. y quizas en muchos lugares". De modo que seria muy extrano que fueramos los unicos. tal y como 10 nes 10 descubrieran que nosotros valoramos la vida a tal grado conocemos. creen que el universo en que habitamos tiene una extensi6n de ci6n con la que es posible calcular el numero de civilizaciones 17 billones de anos luz de un extremo al otro (1 ana luz equi- inteligentes que podrian existir en otros puntos de nuestro vale a los 9. dice Dan Werthimer. El hecho de la vida. sin embargo. Recurriendo a suposicio- vertira en nuestro primer embajador en el espacio profundo. (ver la Figura 1. debemos llegar a la conc1usi6n de que es proba- ble que exista vida alla fuera. ISomos [os unicos? Despues de su alunizaje en 1969. la letra x es el simbolo de la multiplicaci6n. Es mucho mas probable que el universo este lleno de vida".5: La f6rmula del astr6nomo Frank Drake para calcular el nUmero que algunos de esos planetas tengan las condiciones propicias de civilizaciones inteligentes que podrian existir en nuestro universo. y se \' "\Ue la galaxia de la Via Lactea en si tiene una extensi6n de basa en siete factores que los cientificos consideran necesarios )()(). y el Aunque quienes 10 descubran no entiendan los sfmbolos. admiti6 que aunque hasta la fecha no tenemos ninguna prueba. hacen eco al sentimiento de Armstrong.000 civilizaciones inteligentes en el universo. la nUmero de esas estrellas que producen planetas adecuados para mera existencia del Pioneer habla por sf misma. 10. para la existencia de vida inteligente. Neil Armstrong. el primer ser humano de la historia escrita que puso el pie en otro mun- do.()()O a~os luz. nes eruditas. y sabemos que es posible Figura 1. "Sabemos que hay planetas alrededor de otras estrellas. deberia indicar a quie. para la vida. es muy posible que exista vida inteligente en otro lu- gar. Obser- vaci6n: En esta ilustraci6n.2 se con. el astr6nomo Frank Drake propuso una ecua. El C6digo de Dios Historia 21 20 que sali6 de nuestro mundo en la primavera de 197. un fisico de la Universidad de Por el momento. como la tasa de formaci6n de estrellas al ano. Se calcula que en todo el universo existe la . para saber si hay alguien mas "alla fuera".5). universo. "Si extrapolamos. a1 parecer somos Unicos en California en Berkeley.

• A pesar de tener la ciencia mas avanzada de la histo- Al comentar sobre el valor de nuestra busqueda de otros ria. amenazan ahora el futuro de toda la se espera es que al encontrar otros seres vivos nos acercaremos espeCle. Aunque se descubrie- • Los historiadores reconocen que el siglo XX fue el ra una presencia viviente mas alIa de nuestro mundo y se Ie siglo mas sangriento de la historia. Pero del siglo que acaba de transcurrir siguen estando pre- para encontrar esa clave. 10 que ci6n humana. debemos primero enfrentarnos a 10 sente~ hoy en dfa. de legados y estilos de vida se han utilizado como la Aunque es muy posible que exista vida inteligente en otro base de las atrocidades que se conocen como "la in- lugar del universo. 21 Quizas el fundamento del sentimien. y los resultados de una presencia universal superior que se relaciona con Dios.. Con estadlsticas tan sobrecogedoras. es posible que no sea identica a no- vidas por genocidios y limpiezas etnicas que debido sotros. En ese saber se encuentra el sentido que se resisten a todo medicamento.22 El C6digo de Dios Historia 23 abrumadora cantidad de 200 billones de galaxias y que cada que tal vez sea el enigma mas antiguo y mas dificil de todos. manera en que las diferencias de raza. mirando en nuestro in- madamente. Algunos inves- RESUMEN DEL CAPITULO 1 tigadores incluso sospechan que ya nos hemos puesto en con- tacto con elios de una u otra forma. drla ser la mas fundamental de nuestra existencia: la busqueda de una inteligencia extraterrestre es una busque. du- una forma de vida unica en su especie. Como no se han resuelto. de 200 a 500 estrelias aproxi. por el momenta la familia de los seres hu. inciertos de las tecnologlas biol6gicas como la clona- Aunque descubramos que esa presencia no es "el Dios". la humanidad se concretos al respecto. como la nuestra. tal vez descubramos que las cualidades que nos hacen tan distintos encierran tambien la clave de nuestra su. debemos descubrir quienes somos.. Nuestro viaje esta lleno de ejemplos de la nuestro origen nos llevara finalmente ala evidencia mas abun. carcicter unico. Carl Sagan observ6: "En el sentido mas profundo. La posibi- una profunda intuici6n. muchas personas simplemente tienen enfrenta a los mayores retos de la historia. Es muy probable que no cambie nuestra condici6n como a desastres naturales y a la epidemia de SIDA. dante del misterio de la vida: ~l misterio de la humanidad. manos parece ser la unica en la creaci6n. una de elias tiene. Ala luz de nuestro rante ese mismo periodo. existe la posibilidad de que existan seres inteligentes en algun lugar. humanidad del hombre hacia el hombre". • Muchos de los problemas que subyacen la violencia pervivencia ante las gFandes amenazas de nuestro futuro. de creencias. las enfermedades que no estamos solos. A pesar de no tener datos • En los primeros arros del siglo XXI. a la soluci6n del misterio de nuestro propio origen. tenor. han lle- . que se describe como un "saber". de lidad de una tercera guerra global. ~Quienes somos? da de nosotros mismos". aun no hemos respondido una pregunta que po- seres vivos. • La historia es el relato de nuestra busqueda para co- to de Sagan brota de la probabilidad de que la busqueda de nocernos. Se perdieron mas reconociera abiertamente.

£1 Pio- neer 10 continua su viaje sin precedente hacia el es- pacio profundo con una placa de seis por nueve pulgadas disefiada como nuestra primera "tarjeta de presentaci6n" interestelar. • La tecnologla de los ultimos 50 afios nos ha llevado ala busqueda de nuestra identidad en las regiones mas lejanas de nuestro sistema solar y mas alia. . AI comprender la vida en general. poddamos descubrir la forma de superar las diferencias que amenazan nuestra existencia. • Finalmente. la busqueda de nuestros odgenes parece llevarnos ala Fuente mas abundante de claves: la vida misma.24 El C6digo de Dios gado a niveles regionales y ahora amenazan la paz de nuestro mundo. y al saber espedficamente quienes somos.

las discusiones ciendficas sobre el ori- gen del hombre se han basado en gran medida en los hallazgos de restos fosilizados que se cree corresponden a nuestros ante- pasados. publicada por primera vez en 1856 como Elorigtn tk . todavfa no hemos respondido ala pre- guma mas basica de nuestra vida: ~Exactamente quienes somos? ~Debemos nuestra existencia a la evolucion y a una combina- cion al azar de elementos. Capitulo Dos HUESOS. enfrentamos una reali- dad unica que provoca en nosotros un sentimiento de humildad. 0 hay algo mas en nuestra vida? En busca de nuestro origen Hasta tiempos recientes. En 10 que podrfa ser la mayor de las ironfas. aunque tenemos en nuestras manos la ciencia mas avanzada de la histo- ria de nuestra especie. LIBROS Y CELULAS: Cuando [as eVldenclas y [as teorias chocan E n los primeros afios del siglo XXI. De acu~rdo con la teorfa de la evoluci6n de Charles Darwin.

1 Luego. Darwin estaba familiarizado con el trabajo de Hutton y taron sin titubear. son el resultado de la creacion original. de procesos naturales que siempre han existido. Las teorfas de Hutton tambien wrman que las fuerzas que dfa del "Principio". orros cientificos. A este concepto. el que cada generacion elige de sus progenitores las caracteristi. cambiando y evolucionando constantemente como resultado mer dfa de la creacion. el punto de Tierra. 2 Aun- sena16 como ellunes 4 de noviembre del ano 4004 antes de la que estos principios nos parecen obvios en la actualidad. que el investigadores modernos una ventana hacia el pasado. conocido g6 a existir era el resultado de una interpretaci6n literal del como "catastrofismo" se Ie atribuye la creacion de las monta- relato bfblico del Genesis. el realizo sus expediciones. creacionismo declara que toda vida fue creada al mismo tiem- cas que garantizan su supervivencia. y turas fosilizadas que eran desconocidas para el mundo cuando han permanecido fijos y sin cambio. ten en la actualidad 0 que existieron en el pasado. versiones autorizadas de la Biblia y muchas personas las acep. las fechas historieas de nacimientos y muertes que aparecfan A Hutton se Ie conoce como el padre de la geologfa moderna en la Biblia de su tiempo. 1785. antes de la era comlin. Gran parte de la teoria de Darwin se basa encontrar nuevas especies. sucesos de proporciones catastroficas. una obra capaz de hacer pedazos un paradigma. cuando se publico la obra del cientffico escoces James Combinando la historia mediterranea y del oriente medio con Hutton. En esta forma. oceanos y continentes que vemos en la actualidad. a la vida humana. Para explicar los rasgos ffsicos que forman actualmente ala Antes de la publicacion de la obra de Darwin. la idea general es que Contrario a la interpretacion cientffica sobre la edad de la las especies se desarrollan a 10 largo de periodos muy largos y Tierra y a los registros geologicos que se aceptan hoy en dfa. como la expulsion de Adan y Eva del Parafso. catastrofismo se mantuvieron practicamente intactas hasta giosa propuesta por el Obispo Anglicano James Ussher en 1701. Las co-relaciones de Ussher se imprimieron como das como las de Hutton fueron revolucionarias en su epoca. teo- era comlin. La teoria de la Tierra. incluyendo tre en las islas Galapagos.28 El C6digo de Dios Huesos. cuyas rakes se encuentran en la doctrina reli. los rasgos po por la fuerza de Dios durante el periodo de "el principio". activas. Todos los seres vivientes que exis- en observaciones que el hizo mientras estudiaba la vida silves. era el pio". y no como resul- Basandose en sus calculos. que producen fuerza y diversidad en los individuos se preser. raleza continua de estos cambios es 10 que puede ofrecer a los tes. 3' Y sus ideas conrribuyeron a su teoria de la . el Obispo Ussher cre6lo que supuso y su libro. libros y celulas 29 las especies mediante la seleccion natural. esta teorfa wrma que esencialmente no es posible van y se fomentan. al igual que en sus hallazgos de cria. La vi- popular en la actualidad y se Ie reconoce como la teoria del si6n del mundo que se basa en las teorfas del creacionismo y el creacionismo. Ademas. Ussher declaro que el domingo [ado de una linica intervencion divina que ocurrio en el "princi- 23 de octubre del ano 4004. los seguidores del creacionismo buscan en el pasado vista predominante sobre la forma en que nuestro mundo lle. sugiere que nuestro mundo esta era una cronologfa exacta de los sucesos bfblicos desde el pri. La natu- Ussher calcu16las fechas de los sucesos bfblicos mas importan. Este punto de vista sigue siendo nas. y que los procesos continlian hasta el presente. 10 que indicarfa que la Tierra tendrfa una actuaron antiguamente en la historia de nuestro planeta siguen edad de 6000 anos. basandose en esta cronologfa.

Darwin dio a conocer sus descubrimientos junto modernos. En un libro posterior. pieo ancho y vistoso plumaje en los machos) cuando eran en realidad variaciones de la misma familia. como otras formas de observaciones de diversas especies de aves en las Islas Galapa. presentado a la Sociedad Linnean to adicional de restos fosilizados de criaturas similares a animales de Londres. increment61a magni. de que originalmente habfa pensado que eran espedmenes de familias diferentes de pinzones (aves de alas puntiagudas. nos da una idea de la impresi6n que Ie caus6 a nivel lores que actuan como camuflaje y protecei6n. un cientffico que habfa llegado a conclu- tud del misterio que enfrentaba Darwin. aunque mucho mas grandes. evolucion. En un ardculo del que fue co-auror. llegan a ser las caracterfsticas de toda una nueva espeeie.30 El C6digo de Dios Huesos. sobreviviran durante mas tiempo y tendran descendientes te en ese continente. Hoy en dta conocemos eI ciendficos de todo eI mundo. "Estando a bordo del HMS Beagle como naturalista. Estos hechos paredan darme algo de que tambien presentaran las caracterfsticas deseables. La raz6n es que cion geologica entre los habitantes del pasado y del presen. tienen ventajas personal: sobre otros miembros de esa misma especie que no tienen es- tas caracterfsticas. me AI paso del tiempo y de condiciones cambiantes. es el resultado de estos mismos procesos y que la selec- gos. Darwin observ6 una variedad mas existen difereneias en cualquier poblaei6n. Una nota escrita en su diario en 1859."4 duos. Darwin ex- Un elemento central de los hallazgos de Darwin fueron sus presa su creencia de que la humanidad. descendientes que tienen caracterfsticas que apoyan su vida. siones similares. ca. vida. La cuesti6n a Aunque Charles Darwin regres6 de su hist6rico viaje en 1836. lucion y fa seleccion natural. A la lar- luz sobre el origen de la especie. No fue sino hasta su regreso a Londres que se dio cuenta ci6n evolutiva ocurre a 10 largo de extensos periodos. en la que recuerda como picos grandes para comer nueces de gran tamano 0 co- este viaje. . ga. la que Darwin se enfrentaba era c6mo explicar variaciones como dio a conocer publicamente sus descubrimientos 20 afios mas el tamano y la forma del pico en pinzones que se habfan desa. aunque no contaba con evidencia para apo- Utilizando s61idos metodos ciendficos. En El origen de las especies se public6 una versi6n mejores teorfas de su epoca para explicar 10 que habfa descu. tarde. y la rela. Darwin aplic6 las yarlas. con Alfred Wallace. los indi- impresionaron mucho ciertos hechos relacionados con la viduos con caracterfsticas que aseguran su superviveneia triun- distribucion de los habitantes de America del Sur. libros y celulas 31 evoluci6n al proporcionar una explicaci6n para 10 que el vio resultado de su trabajo como las teorfas de seleccion naturaly la durante su famoso viaje en el HMS Beagle de 1831 a 1836. Sus miembros y grande de plantas y animales que ningun cientffico de su epo. La teorfa de fa evo- rrollado aislados de otros en diferentes islas. En esencia. La descendencia del hombre. cambios que en un principio eran unicos en los indivi- como 10 han Hamado nuestros mas grandes filosofos. ese misterio de misterios. estas teorfas simplemente afirman que A 10 largo de su travesfa. completa de la teorta de Darwin que fue muy aclamada por bierto durante su hist6rieo viaje. cola lEvoluci6n 0 adaptaci6n1 larga. El descubrimien. fan sobre los miembros que carecen de elIas.

Esto no significa que no haya ocurrido cierta forma sobrevivir en condiciones de baja temperatura. en realidad no llegan a revelar un Siberia han desarrollado mas carnosidad alrededor de los ojos. Un incremento de grupos humanos se adapten a su entorno son bien conocidas y gl6bulos rojos aumenta la capaddad de la sangre para trans- estan bien documentadas. da a los tejidos. solo es un cambio en su apariencia. Quizas la capacidad de adaptarse. cadas. parece sugerir que nuestros ancestros si cambiaron guen perteneciendo a la especie Homo sapiens sapiens. han trabajado des en el sur de Peru y al Himalaya que se eleva a grandes en las lejanas regiones del Valle Rift en el este de Africa tratan- alturas entre Nepal y el Tibet. Los miembros de dichas tribus han vivido en el rudo en. los Leakey y sus colegas cien- vencia. pasando de po simplemente se ha adaptado a las condiciones del entorno formas de vida menos avanzadas a formas de vida mas sofisti- que su mundo les presenta. existen documentos segun los cuales el les llevan a los estudios realizados por la familia Leakey de cuerpa de quienes viven en las regiones mas elevadas de la Kenia. y al parecer no existe evidencia de que 1 pus de evidencia que se ha compilado a 10 largo de los ultimos alguna vez 10 haran. Durante mas de medio siglo. docu. Su cuer. Invariablemente. ya que las caracteristicas que permiten que los y bajo ·nivel de oxigeno en la atm6sfera. las tribus de las regiones polares en el Artico y para adaptarse a su entorno. proceso evolutivo en 10 relacionado con nuestros origenes y 10 cuallas protege del brillo perpetuo del sol al reflejarse en la nuestra historia. sin embar. Un creciente cor- cie de ser humano. portar oxigeno y tambien la cantidad de oxigeno que se man- y no el proceso de evoluci6n. ahora una creciente evidencia un 30 por ciento a la de quienes viven al nivel del mar. En el aspecto genetico. la busqueda de nues- torno de las regiones polares al menos durante los ultimos diez tros origenes se ha concentrado en una busqueda de eviden- mil afios y se han adaptado a ellas. ciertamente documentan la capacidad de los grupos humanos Por ejemplo. Las cordilleras mas altas del mundo incluyen a los An. 5 sugiere que esposible que no describa en su totalidad fa historia de En general.32 EI C6digo de Dios Huesos. modernos y nuestros ancestros mas lejanos. nieve y el hielo y que dia con dia les espera al salir de su hogar. quienes viven en estas altitudes extremas cam- los or/genes del Hombre 0 pruebe que el Hombre sea resultado de fa bian las funciones de su cuerpo de tal manera que puedan evolucion. progresivamente a 10 largo de grandes periodos. poca humedad de evoluci6n. cias fisicas para encontrar el vinculo entre los seres humanos go. Existen estudios que muestran do de encoptrar los eslabones faltantes en nuestro arbol genea- . que en personas que todo el tiempo viven en altitudes consi- mentado meticulosamente y llevado a cabo de acuerdo a las derables la cantidad de gl6bulos rojos podria exceder hasta en directrices del metodo cientifico. no han evolucionado para convertirse en una nueva espe. estos pueblos si. Aunque se cree que esta caracteristica es una respuesta directa l La evidencia apoya a la evoluci6n1 a su entorno. describa mejor 10 que se ha ob. En ese tiempo. libros y celulas 33 Aunque el trabajo de Darwin estuvo bien pensado. como Tim White y Donald Johanson. las discusiones sobre registros de f6si- De manera similar. 150 afios. Aunque estos estudios y otros similares servado en esos grupos. tierra ha desarrollado caracteristicas que favorecen su supervi. dficos. Teniendo en mente las teorias de Darwin.

la razon por la eual existen estas preguntas. Por ejemplo. La busqueda continua hoy en dia y se han encontrado nu- merosos ejemplos de restos fosilizados que se cree representan diversas etapas en el desarrollo humano en la escala de la evo- 1uci6n. varios equipos internacionales han trabajado entre tierra registros de fosiles que muestran que hemos vivido con esas suelta y granos de polvo para recuperar fragmentos de hueso. pues los nuevos deseubrimientos siguen eambiando las fee has CJue 160. dcscribcll hI cdad tit.6. ~por Figura 2. ~que hizo que eaminaramos ereetos? Dos deseu- caracteristicas humanas. Muchas publicaciones del National brimientos de ftnales del siglo XX podrian empezar a clarificar Geographic han documentado meticulosamente esa busque. puestas a elias podrian deeir sobre nuestra historia. los descubrimientos re- cientes en el este de Africa han incrementado de manera signi- ficativa nuestra comprensi6n de c6mo llegamos de "alIa" hasta "aqui". ~como explicamos los 1950.34 El C6digo de Dios Huesos. Adernas de establecer la fecha aceptada de los origenes de nuestros ancestros a una fecha 4 millones de mos antes de 10 que antiguamente se crda. blecido la fecha aceptada del origen del Hombre como casi seis millones de afios (Nature. 12 de julio de 2001).. la especie humana haya evolucionado gradualmente a traves tas del esqueleto de seres antiquisimos que al parecer tienen del tiempo. que la forma y la capacidad del cerebro del hombre moderno se interpreta a partir de evideneias fosilizadas. Desde que se iniciaron las excavaciones enla decada de mas de primates menos desarroliados.000 a 200. libros y celulas 35 16gico. utensilios de piedra. En los salones de clase de todo el mundo se habla de estos antiquisimos ejemplos de hominidos y por 10 comun se les denomina "el hombre de Cro-Mafi6n" y "el hombre de Neanderthal. A pesar de 10 impresionantes que son estos hallazgos y otros similares. y en algunos casos han hecho que el misterio de nuestro pasado se haga mas profun- do. los descubrimientos de finales del siglo XX han dado origen a nuevas preguntas. yen ocasiones secciones comple.Ilucstros allccstrlls mas antiguos. Este resumen es aproxima- permaneci6 virtualmente sin cambios durante los ultimos do. y 10 que las res- da que ha tenido lugar a 10 largo de medio siglo y que ha esta. formas de vida durante los mismos periodos? Suponiendo que dientes.1. . y de 10 mucho que contribuyen al conocimiento de nuestros origenes. si el proceso de cambio es constante.000 afios? Si nos desarrollamos a partir de for.1: Una eronologia de nuesttos aneesttos ampliamente aeeptada. Una versi6n de la secuencia aceptada del desarrollo humano se muestra en la Figura 2.

etcetera. se gliedad ya se habia determinado mediante el carbono. Junto con colegas de Rusia y . se ha convertido en un elemento Vital en je evolutivo y nuestros origenes. un total de 48. los resulta- mentos de ADN para determinar la paternidad. 10 Aunque en teoda. ese grado de preservac16n cen estar ausentes en nuestros genes.36 El C6digo de Dios Huesos. Se ha revelado un misterio adicional a partir del descubri- En el afio 2000. el anaIisis de escenarios de crimenes y en estudios forenses. total de s610 46! Aunque parece que nos falta todo un juego de Suecia. Normalmente. En el inte- los tribunales de mas alto nivel en la actualldad. Los seres humanos tienen 23 pares. por segunda vez en la his. como los rna 2 de los seres humanos es muy similar y de hecho I . El excepcional estado del cuerpo del nifio es en si una ~is­ Un analisis mas meticuloso de los cromosomas que pare- toria y un misterio. la ciencia de la comparaci6n genetica cubrimiento de Watson y Crick.9 los investigadores del Centro de Investigaci6n Humana de . el estudio descubri6 que la po- de el color de los ojos y el cabello. es decir. se aphcaron al . Des- implicaciones de este informe. los ciendficos analizaron el ADN del cuerpo de un cromosomas cuando se nos compara con nuestros parientes infante Neanderthal excepcionalmente bien preservado que se mas cercanos. para identificar dos de hecho estan planteando mas preguntas y abriendo la personas desaparecidas y sefialar vinculos entre un indiv~duo y puerta a un territorio "prohibido" en 10 relativo a nuestro lina- un crimen espedfico. los procesos metab61icos. jlo que da un el de seres humanos modernos. En un informe publicado en la prestigiosa revista Natu- tamafio del cerebro./ instrucciones biol6gicas que determinan la estructura 6sea. la. Este inusual estado de preservaci6n fue 10 que permiti6 la comparaci6n del ADN James Watson y Francis Crick establecieron el primer mapa de un nifio de treinta mil afios de antigliedad con el de seres que describe el bloque de construcci6n de la vida en 1953. hasta el genero y las tenden- sibilidad de un vinculo genetico entre el Neanderthal y los se- cias a ciertas condiciones de salud y enfermedad. muestra que el cromoso- ocurre s610 en restos en que los tejidos se congelan. abri6 la puerta a toda una nueva ciencia que identifica a los Aunque los cientfficos todavia estan bajo el impacto de las individuos basandose en caracteristicas geneticas unicas. los c6digos res humanos modernos era remoto. A partir del des- tal". Los estudios sugieren que que determinan la apariencia y funciones de nuestro cuerpo "el hombre moderno en realidad no desciende del Neander- estan en el plano de nuestro c6digo genetico. libros y celulas 37 El misterio gene-tico que se encuentran en las regiones polares. ! de cromosomas. cuyos resultados ~on recono~idos en de cromosomas que distinguen una especie de otra. tienen 24 pares la Universidad de Glasgow describieron su investigaci6n com. ciencia 'de comparar seg- deberia resolver el problema de nuestros origenes. un estudio comparativo de nuestros mapas ge- descubri6 en una cueva de piedra caliza en el norte del Caucaso. Los re. 10 que les da su carac- parando material genetico de nuestros posibles ancestros con '" ter unico. Tambien fue la primera vez en que este tipo Gracias al ahora famoso modelo de la helice doble y los patro- de pruebas pudieron llevarse a cabo en un cuerpo cuya anti- nes de informaci6n contenidos en la molecula de ADN. las mismas tecnicas que se utilizan en ese miento del c6digo genetico en 10 relacionado con el numero tipo de investigaciones. rior de los cromosomas de cada miembro de la especie hay estudio de los odgenes del hombre. humanos actuales. como los simios y monos. el toria. primates superiores. ' neticos revela un detalle interesante.

definiendo mas a fondo nuestro lugar en el universo y creado una mezcla genetica de ese tipo. no es pro. investigaci6n agrega algo a 10 que sabemos sobre nosotros mis- bable que procesos naturales 0 cruzas de epocas antiguas hayan mos. h umano totalmente moderno y completamente desarrollado. Hans Reck. 13 Investigaciones adicionales sobre los tan poco durante un periodo tan grande? mapas geneticos de los primates indican que este "cromosoma Aunque este tipo de hallazgos a la larga planteen mas pre- humano 2 dividido" tambien es comun al gorila y al orangu. libros y celulas 39 "corresponde" alos cromosomas 12 y 13 del chirppance. el Dr.000 anos. anteriores de primates. cada etapa de la ran. para la teoria convencional de la evoluci6n: Si . ison muy similares! Si el proceso evolutivo esta ocu- si estuvieran combinados (fundidos) en un trozo unico y mas rriendo. contemporaneo de Louis como la densidad de los huesos y nuestra capacidad de derra. Ademas de estos mis. encon. Evidencias adicionales en 10 rela- terios del cromosoma 2. sudar y tener una cabellera en lugar de un pelaje que posteriormente revelaria los 'ejemplos mas antiguos de res- 15 que cubra todo nuestro cuerpo. entre las especies. como Homo sapiens. dan credibilidad a los estudios genes del ser humano y los del chimpance parecen ser casi geneticos y sugieren que aunque quizas compartamos el ADN identicas. plantea 160. datan de hace mas estratos donde se encuentran restos mas antiguos.38 EI C6digo de Dios Huesos. ~entonces por que aparentemente hemos cambiado grande de ADN. con formas de vida menos evolucionadas. Debido a estas diferencias en los cromosomas. da credibilidad a esta teoria. desarrollado de una manera unica e inesperada. Una compara. fosilizados del Homo sapiens mas antiguo. Trabajando en el Desfiladero al mismo tiempo fomenta la controversia ante quienes propo.Africa mar lagrimas. somos una especie unica. En un informe ci6n entre las caracteristicas de los primates y los humanos. como derno. En la revista britanica Nature (12 de octubre de 2003). el Dr. ll . existen crecientes evidencias que sugieren que. y aunque no son identicos al ser humano mo.I dientes a etapas mas lejanas en la escala evolutiva. Lakey. se que se excav6 de las mismas formaciones geol6gicas en que se public6 un articulo que revela el descubrimiento de craneos cncontraron el "Hombre de Pekin" yel "Hombre de Java". con nuestra dido en nuestro pasado distante pata producir tales cambios propia linea de tiempo genetica. tal vez nos hemos cubrimientos plantean esta pregunta: ~Que pudo haber suce. La ubicaci6n fisica de un esqueleto moderno en los mis- trados en la regi6n media de Awash en Etiopia. Reck descubri6 10 que pareda un esqueleto nen tanto el creacionismo como la teoria de la evoluci6n. en el c6digo fundamental de nuestra vida? Con base en una comparaci6n entre la fisiologia humana y Anomalfas en el registTo de f6siles la de otros primates. Los restos. Oldubai. y [OS similares a los humanos. nuestro papel en la creaci6n. guntas de las que responden en la actualidad. En lugar Ademas' de los estudios de ADN. publicado en 1913. describi6 un hallazgo suyo en la misma zona de . pero invertidas. 14 Ahora estos des. lin problem. varias revistas cientificas han de ser parte de una progresi6n lineal que desciende de formas I' informado de descubrimientos de restos humanos an6malos. varias otras caracteristicas entre los cionado con registros de f6siles. esta teoria adopta el punto de vista de esqueletos totalmente modernos en los mismos estratos de tierra que nos desarrollamos al mismo tiempo que los primates mas en que se encuentranfiJsiles de homfnidos muy antiguos correspon- antiguos en una especie de evoluci6n paralela. 12.

Si en realidad. en condiciones naturales 0 en con- La palabra "teoria" se define como una "suposicion disefiada diciones de laboratorio. se puede suponer razonablemente que 10 que se en. y a un creciente corpus de evidencia que sugiere que tal vez no somos el producto de una escala evolutiva clara. si llegaran de que: a existir.stros oTlgenes materiales carentes de'vida. sugiriendo Slue.40 EI C6digo de Dios Huesos. Agregan datos de material carente de vida. por 10 que se sabe. como las nubes de amoniaco y los bloques de de vinimos? construccion de la clorofila en las plantas y de la hemoglobina en los animales (porfirina) existen en el espacio profundo. ambas paredan dar A partir de estos procedimientos. entonces debemos Aunque existe evidencia muy solida de que ciertos precur- plantear la siguiente pregunta: ~De donde vinieron? ~De don. nunca se ha observado que la vida surja de Combinando [as teoTlas de nue. se puede llegar a la tas. que generalmente se acep. Durante las epocas historicas en que se introdu- una epoca posterior. explicar el origen de la vida. aunque no vemos la creacion espontanea de . el descubri- miento de casos similares 16 siguiere que los hallazgos podrfan • la vida podrfa surgir de manera espontanea a partir estar mostrando algo mucho mas significativo. Aunque las dos brotan de observaciones sensa- en cuenta la relacion que existe entre ellos. los escepticos de esa epoca sugirieron que los esque. Las preguntas primordiales sobre la evolucion en 10 que mera vez. modernos habitaron la Tierra simuldneamente con los que se han considerado sus ancestros primitivos. tas a revision a medida que se revelan nuevos datos. jeron el creacionismo y el evolucionismo. Como los estratos mas profundos se deposita. seres humanos tado de fuerzas evolutivas que actuan solas. las fuentes de informacion humanos mas primitivos. Los evolucionistas abordan esta ironia para analizar 0 explicar la naturaleza de fenomenos espedfi. Es obvio que en 10 que concierne tanto al crea- drfan que haber vivido y muerto en el mismo periodo que cionismo como al evolucionismo. explicaciones razonables basadas en la informacion que se te- tan como un metodo de fechar objetos enterrados tomando nia disponible. ciertamente podrfan explicar el misterio. I sores de la vida. Son las ideas estrato posteriormente. fecha son precisamente eso: teorfas. una teorfa solo puede ser tan buena como la informacion conclusion de que los esqueletos de apariencia moderna ten. como la que • las caracterfsticas que nos hacen unicos son el resul- se ve en los pinzones de Darwin. Aunque tales condiciones. Si este es el caso. no pueden ~oexistir en el cos". Las teorfas de como la creacion y la evolucion podrfan mismo periodo. concierne a los origenes humanos brotan de dos suposicio- letos modernos habian sido arrastrados 0 depositados en ese nes que son de importancia clave para la teorfa. libros y celulas 41 una forma de vida desciende de otra. en que se basa. no podrfan haber se siguen desarrollando. 10 que deja las interpretaciones abier- evolucionado en una epoca posterior. que se han propuesto hasta la ron antes. Cuando el relato del hallazgo de Reck se publico por pri. Cada una esta disefiada cuentra en ellos es mas antiguo que cualquier cosa que se para explicar la evidencia que se observa desde una perspectiva encuentre en estratos menos profundos que se formaron en muy distinta.

10 que hace que su aparicion cionismo de que una fuerza especial. ce ser nuestra mejor explicaci6n del misterio y milagro de la tos en 10 que se refiere a los relatos en sL vida. Como en el caso de la teoria evolutiva. incorpora el punto de vista del crea- vido durante el mismo periodo. las condiciones de las que ha surgido la vida. a partir del cual el Obispo Ussher hizo sus dlculos tambien ca la cual infunde vida en los elementos de la creacion. . si las especies en realidad evolu. Tal teorfa esperariamos ver en los fosiles es una progresion lineal de una hfbrida sobre la creaciOn toma en cuenta las observaciones de la forma de vida a la siguiente. ano 345 de nuestra era. cia convencional reconoce en la actualidad. Ademas. la teoria de la creacion ha estado reple. que supera 10 que la cien- como progresion lineal sea poco probable.18 la version canonica del texto biblico parece haber una fuerza que supera las propiedades de la qufmi. es responsable de De manera similar. una teoria aseveraciones. tros origenes. parecer. Por el momento. conceptos clave de ambas teorfas ofrece una mejor explicacion tarse a traves del tiempo. pudieron estar presentes en cierta epoca en el pasado y luego estan fisicamente incompletos. libros y celulas 43 vida en la actualidad. de que somos parte de algo mayor. En lugar de eso. El hecho es que ningun ser que viva en la actualidad obser- teoria. AI mismo tiempo que reconoce las evidencias fisicas que se han descubierto hasta la fecha. grandes periodos. estas! es la mejor respuesta disponible para explicar cierto fenome- preocupaciones brotan de las suposiciones en que se basa la no. que los procesos geologicos en efecto ocurren a 10 largo de tes se crda habian evolucionado de otras parecen haber convi. tambien permite el sentido Los mejores eruditos de nuestros tiempos estan de acuerdo intuitivo. AI estaba incompleta. lucion ofrecen informacion util sobre la naturaleza de nues- Como se menciono antes. que comparten la mayoria de los pueblos del mun- en que a pesar de los buenos que son nuestros registros bfbli. y tanto del creacionismo como de la teoria de la evoluci6n pare- • los registros biblicos sobre la creacion estan comple. esta fuerza no se explica en las teorias de la epoca de Aunque tanto la teoria del creacionismo como la de la evo- Darwin ni en la sabiduria convencional de nuestros dias. Despues de que en el siglo IV haberse destruido debido al desarrollo de la vida en SL 17 se eliminaron al menos 45 libros del Antiguo y del Nuevo Incluso cuando las condiciones de temperatura.42 El C6digo de Dios Huesos. entonces una posibilidad que de las evidencias que se han observado hasta la fecha. los del Obispo Ussher. humedad Testamento por ordenes del Emperador Constantino. y de poner en movimiento ta de preocupaciones relacionadas con la exactitud de los dlcu. en lugar de adap. una teoria combinada que incorpora elementos • los registros biblicos sobre la creacion son exactos. podrfamos descubrir que una combinacion de los cionan con caracteristicas geneticas nuevas. de sus Fuentes y de la rigidez de sus Cuando no se cuenta con observacion directa. el desarrollo que teoria evolutiva. do. las condiciones para ese tipo de proceso cos como documentos de sucesos tradicionales e historicos. que dicen que nuestro mundo es antiguo y muestran los registros en los fosiles sugieren que especies que an. 10 que incluye estas ideas: v6 directamente el momenta en que se inici6la creacion. la chispa que vemos como "vida". en el y elementos quimicos sean favorables para la vida esponranea.

lontinua y se desenvuelve. En ellibro de texto universitario Chemistry. el enfoque de este libro describira mas a vaci6n. nos ha llevado a una sable de tal despliegue de poder. una sensa- tendrfan que haberse satisfecho para ponerla en marcha". la vida parece haber nidad.den de magnitud aun mayor: un lenguaje alfabeti- . realizada con un prop6sito.. nuestra busqueda.de s~gl~s de misterio. elementos quimicos que se combinan. el origen de la vida parece casi un que esta definici6n podrfa.. nuestra existencia es un misterio que y a encontrarle un mayor significado a nuestra vida. libros y celulas 45 Vida pOT designio conclusiones con respecto a que fuerza 0 fuerzas adicionales podrfa atribuirse la complejidad de la vida. y tor responsable del grade de especializaci6n que vemos en los llue qUlzaS somos capaces de todo 10 que alguna vez hemos 6rganos y tejidos. describir un aspecto de mtlagro en cierto sentido. equipado con patr6n de comportamiento que los sistemas quimicos exhiben to~o el ~onocimiento disponible en este momento. sabidurfa y visi6n? AI res.21 ci6n de que falta algo. bien pensados y perfectamente cronometrados? ~De una ac- AIgunas de las mentes mas brillantes de nuestros tiempos ci6n de creaci6n intencional? sospechan ahora que ademas de un periodo muy largo y de Si como 10 sugieren las tradiciones mas antiguas de la huma- los procesos naturales que se reconocen.' dt·n que existe como fundamento de toda vida. Incluso para el ciendfico mas esceptico. con el beneficio de los extraor- al azar a traves de los e6nes? ~O somos algo mas? ~Sera posible dinari~s avances de la ciencia y de los metodos experimenta- que en realidad seamos el resultado. la definici6~ de sobre la posibilidad de que la vida haya surgido de una serie de "vida" desde el punto de vista de la quimica es: "La vida es un sucesos al azar. y confieso esto libremente".2o Con esa obser- IIlalidad es obvio.' Iravesi~. Matter. Sm Importar que palabras utilicemos para descri- muchisimo tiempo. cuando se Ie pregunt6 a Francis Crick Universe [La qutmica. ~Somos simplemente el producto de Charles Darwin hizo sus observaciones en la decada de 1830. de una 'serie de sucesos les. podemos decir con certeza razonable que improbabilidad de que la selecci6n natural fuera el unico fac- somos ~as de 10 que nadie se ha atrevido a imaginar jamas. nos deja con una sensaci6n de vado. plantear la siguiente pregunta: ~Quien 0 quejuerza es respon- Iratando de dar respuesta a esa pregunta. entonces tambien debemos ' pregunta: ~Quienes somos? Como especie. and the De manera similar. de hecho. pareceda absur. que en la ac- do en alto grado. con todos sus mecanismos ini- lorp~S de evidencia sugiere que la fuerza de una inteligencia mitables para ajustar el foco a diferentes distancias. derramamiento de sangre yex- ponder a esta pregunta tal vez podrfamos. Este capitulo empez6 con la gua. un creciente diciendo: "Suponer que el ojo. Darwin nos da libertad para llegar a nuestras propias 'ondo un or.44 El C6digo de Dios Huesos. Ademas del grado de or- haberse formado mediante selecci6n natural. empezar a darle sentido a nuestro mundo Illmos en la actualidad. s610 po- cuando alcanzan cierto tipo de nivel de complejidad". la vida humana es el resultado de una acci6n muy anti- 'illfgido a partir de un designio. siendo tantas las condiciones que la exitencia. por primera vez en p~oraclOn. el sefial6: "un hombre honesto. pudiera \upenor subyace nuestra existencia. En El origen de las especies. Darwin mismo mencion6 la Por el momento. fa materia y el universoJ. Sefial6 como ejemplo la complejidad del ojo \ofiado. Cnck lleg6 a conclusiones similares. evolucionan y cambian Despues de mas de cien afios.19 Aun- dr~a declf que hoy en dia.

Un En la actualidad tenemos las poblaciones mas numerosas de mensaje descubierto en el interior de la quimica de cada cuer- nuestra historia. formamos ejercitos y nos movemos a toda velocidad cias. seria una serral de naturaleza tan universal. tan poderoso y tan personal que no vida en forma dramatica e inesperada. Ese principio podria ofrecer un tan IQue significarfa descubrir necesario criterio de esperanza. 46 El C6digo de Dios Huesos. encontrar que lamentamos la perdida de nuestras antiguas Ese descubrimiento se convertiria. el revelar que el nombre de Dios superior es 10 que sugiere la presencia de una inteligencia mas esta en el interior de toda vida proporcionaria nueva evidencia grande como fuente de nuestra existencia. enojo y ftnalmente aceptacion. que podria con la ciencia mas avanzada que se cree ha existido. podriamos interior de cada celula de nuestro cuerpo. po. rechazo. mental de nuestra existencia. compartiendo nuestro mundo como una familia. Tal vez asimilariamos pudiera negarse? Abriendonos camino entre las diferencias ex. Tomando trascender cualquier diferencia del pasado.ivir en un mun. Este orden En el mejor de los casos. de que estamos aqui con un proposito. 0 las creen- milias. antiguo nombre de Dios en el interior del codigo de la vida. si creacion intencional nos invitaria a reemplazar nuestro siste- tuvieramos la certeza de que nuestra existencia brota de un ma actual de creencias por otro que incorporara el conoci- Creador cuyo nombre esta literalmente escrito en clave en el miento que acabamos de descubrir. sin importar la religion. esta noticia en etapas. la raza. naciones y religiones. impacto. cl codigo ha esperado . las etapas de una perdida: seres humanos y nuestra relacion con nuestro mundo. En un sentido solo podemos imaginar 10 diferente que seria nuestra vida y la ' muy real. en cuenta las diftcultades que enfrentamos al v. Nue signiftcaria encontrar un principio que to. tro ser desde cI dra de nuestros orfgenes. al menos. un mensaje mentamos cuando recibimos una noticia que cambia nuestra uniftcador tan profundo. que asimilamos la perdida de un ser querido. Estudios recientes sugieren que el impacto de un descubri- do como este. en el hito de creencias a medida que deftnimos nuestro papel en la crea- una nueva era que dejara en claro nuestra mutua relacion como cion. negacion. EI asombroso descubrimiento que se presenta a continua- un nombre que la ciencia del siglo XX ya ha conftrmado. la naturaleza universal del conocimiento tocaria nuestras vidas. Aun. educamos fa. que un mensaje de este tipo no podria identiftcar con preci. De hecho. codificado en el elemento funda- que es responsable de nuestra creacion no se limita a una com. se cion describe precisa~ente un principio de unidad de este tipo: sumaria al creciente corpus de evidencias que sugieren que 10 el nombre antiguo de Dios. de manera muy similar a la forma en ternas que nos dividen como familias. el estilo de vida. el conocimiento de que somos el resultado de una forma tan diferente en que construiriamos nuestro mundo. libros y celulas 47 co codiftcado como los elementos de la vida en $1. En este tipo de circunstancias. miento de ese tipo podria ser similar al impacto que experi- cara la vida de cada ser humano en el mundo actual. con ellas construimos naciones. y no como la diversidad que nos fortalece. en una epoca en la que nues- un mensaje de "Dios"? tras diferencias a menudo se interpretan como la razon que nos separa. Oculto en 10 profundo de nues- binacion forruita de sustancias qufmicas y a la evolucion. nos ofrecen un indicio de la profundidad con que este tipo de sion quien es el Dios de la creacion.

el ADN. enfrentemos a opciones futuras en 10 social. • El descubrimiento de la quimica de la vida. 10 tec- prendernos descubrir que el secreta que compartimos con Dios no16gico y 10 cientifico. En cada una de ellas parece faltar algo. • Uno de los descubridores de la estructura del ADN sugiere que el hecho de que todos los factores estu- vieran en ellugar y el tiempo adecuados. una fuerza que aun no se ha explicado. y la clave para la paz y la supervivencia. pudo haber tenido un papel clave en el origen de la vida. nuestra relaci6n con un poder superior cuando nos tro interior. que combinan elementos de la evoluci6n y el creacionismo. • Las teorias hibridas de la cread6n. libros y celulas 49 el momenta en que nuestra busqueda nos lleve a yiajar a nues. es un c6digo antiguo en un idioma universal que ofrece un principio sin precedente para la unidad de los hombres. a la esencia de toda vida.48 El C6digo de Dios Huesos. Quizas no deberia sor. sugie- ren que un factor adicional. tener la clave para la paz de nuestro mundo y para nuestra supervivencia. debemos repensar . RESUMEN DEL CAPITULO 2 • Por si solas. Ante tal mensaje. es practicamente un milagro. y con la vida da un nuevo significado a nuestro tiempo y a la • Descubrir "quienes" somos podria finalmente con- presencia de otros seres humanos como nosotros. y de que la vida surgiera por casualidad. • Las tradiciones de la antigiiedad sugieren que la cla- ve de los misterios mas profundos de la humanidad. las teorias de la evoluci6n y el creacionis- mo son inadecuadas para explicar los hechos que con- sideramos fueron nuestro pasado. podrian en- contrarse en el mayor logro de la creaci6n de Dios: la vida en s1.

.

Capitulo Tres

DE LOS LIBRaS PERDIDOS
DE LA CREACION:
Los poderes del clelo
en cuerpos de la Tierra

S e cree que las estadisticas de poblaei6n de los censos del
ano 2000 son las mas exactas de la historia, e indican que
compartimos nuestro mundo con aproximadamente 6.2 bi-
Ilones de seres humanos. De ese numero, casi el 95 por ciento,
l'S decir 5.9 billones de personas, creen en la existeneia de un

Ser Supremo de eierta descripci6n. Mas de la mitad de esas
personas se refieren a el como "Dios". Estas y otras estadisticas
\imilares indican que en nuestros dias la pregunta tal vez no
\l'a si creemos 0 no que Dios existe, sino que es exactamente 10

que esta presencia significa en nuestra vida.

C6mo encontrarle sentido a un poder superior
Aunque durante mucho tiempo la espiritualidad ha tenido
1111 papel en la evoluci6n de las familias, las comunidades y

El C6digo de Dios De los libros perdidos de la creaci6n 55
54
las naciones. Nuestro futuro podda no depender. de nuestra En respuesta, Ellie se pregunta en voz alta si nuestro sentido
capacidad para reconocer que no somos simplemente una com- de Dios brota de una "necesidad" de afiadir significado a nues-
binacion fortuita de moleculas al azar. Desde mediados del tra vida. Despues de un momenta de silencio, Palmer respon-
siglo XX, el tema de nuestra busqueda de una inteligencia de con las mismas palabras que Ellie habla escuchado de su
superior se ha expresado en el arte, la literatura y las peHculas padre siendo muy joven, muchos afios antes de la muerte de
a nivel mundial. En 1998, la peHcula Contacto, que se basa su padre. Pareceria un desperdicio de espacio sijUiramos los unicos.
en el libro de Carl Sagan del mismo nombre, presenta dos En muchos aspectos, la tension espiritual entre la Dra.
perspectivas distintas de nuestra relacion con un poder supe- Arroway y Palmer Ross describe la polaridad de nuestros pun-
rior, 10 cual refleja el dilema actual entre la ciencia y la re- tas de v~sta en la actualidad. Palmer ve su experiencia de un
poder superior con los ojos de alguien entrenado en la reli-
ligion.
AI principio de la pelicula, la protagonista, la Dra. Ellie gion, que interpreta su sentimiento como la presencia de
Arroway, se encuentra en la ubicacion. perfecta para dedicarse "Dios". La pasion de Ellie por la ciencia, estimulada por su
a la pasion de su vida: la investigacion ciendfica que busca padre desde su infancia, f~rja su sentido de una inteligencia
inteligencia mas alIa de la Tierra. Sentada en el borde del ra- superior como una probabilidad estadlstica de que exista vida
dio-telescopio mas grande del mundo, el Aricebo que se loca- en otros mundos. Ambos puntos de vista reconocen la sensa-
liza en las montafias de Puerto Rico, ella Ie describe al teologo cion de una presencia universal, una fuerza que la ciencia aun
y escritar Palmer Ross las posibilidades de que exista vida inte- no ha definido. Ambos des<;:ubren que, en el mejor de los c~­
ligente en otros sitios del universo. Ella comenta que unica- 50S, una prueba absoluta de tal presencia es esquiva y que fi-

mente en esta galaxia hay mas de 400 billones de estrellas. Si nalmente debe experimentarse para comprenderse. La
solo una fraccion de ellas tuvieran planetas, una fraccion de revelacion de Ellie es el resultado de su odisea al ser transpor-
esos planetas tuvieran vida, y una fraccion de los planetas don- tada en el espacio tiempo, regresando sin una evidencia de su
de hay vida tuviera vida inteligente, jexistidan millones de ci- experiencia con otros seres que pueda compartir. La revelacion
de Palmer brota de su fe como una fuerza que no puede mos-
vilizaciones!
Contemplando el cielo nocturno, y luego midndose a los trarle a nadie mas, y que el nunca ha vista.
ojos, desde perspectivas muy distintas, ambos sienten que no Aunque 10 mas probable es que exista una inteligencia su-
estamos solos. Desde la perspectiva de Palmer, la creencia en perior en el universo, por el momenta parecemos estar solos.
un poder superior, compartida por muchos, es nuestra expe- Es en nuestra sensacion de "soledad", a pesar de que ahora
riencia colectiva de la presencia de Dios. Mas tarde, en un (enemos la poblacion mas grande de la historia del mundo,
momenta de conversacion Intima, el confiesa que su creencia que la ironIa de no saber quienes somos adquiere un significa-
en ese poder es algo que supera su capacidad de explicarlo in- do aun mayor. Aunque la ciencia entra valientemente al siglo
telectualmente. Simplemente "existe". XXI, en un nivel intimo todavia necesitamos entender con
precision como lIegamos a existir.

56 E1 C6digo de Dios
De los libros perdidos de 1a creaci6n 57
Claves antiguas sobre ell/principio" la antigiiedad describieron las visiones y revelaciones que les
A pesar de 10 buena que parece ser nuestra ciencia, las mentes ayudaron a encontrarle sentido a su vida. En ese vocabulario
mas privilegiadas de nuestros d{as admiten que nuestra com- por ejemplo, las "dimensiones" se describen como "cielos'"
prension actual es incompleta. A pesar de la daridad del codi- mientras que las fuerzas de la naturaleza se transforman e~
go genetico, las ecuaciones de Einstein sobre la energ{a y la "~ngeles" de.l Sol, del Viento, de la Tierra y del Aire; y la capa-
materia, la maravilla de la comunicacion por Internet, existen Cldad conSClente del individuo se capta como "el aliento de
huecos que siguen sin llenarse en nuestra vision ciendfica de la Dios".
creacion. Citando una observacion comun: Cuanto mas des- A 10 largo de la historia han existido rumores sobre conoci-
cubrimos, mas comprendemos 10 poco que sabemos. mie~tos.que preservan tales experiencias visionarias, cuya Fuente
AI mismo tiempo, es posible que la respuesta a nuestra se dice data de la epoca de nuestros inicios. Mediante el estu-
pregunta sobre "como empezo todo" ya exista de una manera! dio de nuestras antiguas leyendas, es comun descubrir un fun-
que ha sobrevivido a las pruebas del hombr~ y la naturaleza. damento basado en hechos a partir del cual se crearon esos
Encerrados en vasijas de barro y enterrados bajo siglos de are- re~atos y mitos, algunos de los cuales han persistido durante
nas del desierto, los codigos escritos de nuestro pasado po- mIles de afios.
drian tener tambien los registros mas completos sobre nuestros ~l descubrimiento de la ciudad de Troya por Heinrich
origenes. Ademas, podriamos descubrir que los rastros de le- Schhemann en 1870, por ejemplo, se baso en su creencia de
tras escritas y los pergaminos a punto de desmoronarse que que La Iliada, la obra clasica de Homero, era un relato real
preservan nuestra historia, tambien contengan el secreta de de h~chos historicos. Utilizando La Iliada como mapa verbal,
nuestras capacidades y nuestro destino. As! como los poblado- Schhemann siguio las pistas del texto y logro uno de los ha-
res de Norteamerica describieron su experiencia inicial con el I llazgos arqueologicos mas grandes del siglo XIX. Otros ejem-
ferrocarril diciendo que era un "caballo de hierro", la clave es pios de descubrimientos que fueron el resultado directo del
reconocer que los secretos de nuestro pasado se han registrado estudio e i~v~stigacion de leyendas y mitos antiguos, induyen
como los pensamientos y las ideas de otras epocas. e1 descubnmlento de Machu Pichu, la Ciudad Perdida de los
En el vocabulario de su tiempo, nuestros ancestros descri- Incas, por Hiram Bingham en 1911, Y el descubrimiento
bieron como recibieron respuestas a las mismas preguntas que ~el Area de Noe en el Monte Ararat en Turqu{a a finales del
nosotros nos hacemos hoy en db, cuestionando nuestro ori- slglo XX.
gen, el significado de la vida y como sobrevivir a los sufrimien-
tos del mundo. Antes de que se popularizara el vocabulario El Lihro de Aa'J'n que se habra perdido:
para describir otras dimensiones y los hologramas cuanticos t Sabidurfa de ange.les en el mundo del hombre
los principios para explicar los misterios de la creacion ya exis-
Como en e1 caso de la ciudad de Troya, los persistentes rumo-
dan. Con las unicas palabras que ellos sabfan, los eruditos de
res sobre un antiguo Iibro de sabidur{a presentado a Adan y

tomadas del Libro de Addn. de recibir ellibro de los secretos. el Rabino Adam Tzaddik utiliz6 una "pregunta en Los libros perdidos de la Biblia sueiios" para pedir que se Ie guiara y asi poder realizar este acto final de bondad antes de dejar este mundo. ellibro. vivia un rabino que. el hijo del Rabino fue testigo de sentido a sus simbolos. Gracias a de seis individuos: Adan. sino existencia persistieron hasta el siglo XVIII. el misterio de esta leyenda nunca se ha resuelto. Jose. A traves continua con la descripci6n de c6mo el hijo del Rabino de la forma. sus enseiianzas. La leyenda evitaba que las paginas se copiaran 0 se reprodujeran. s610 podian entenderlo quienes Una noche. El siglo :xx fue testigo del hallazgo de algunos de los registros presada con sencillez. que mas Torah. Moises.. ex.! fue conocido como Baal Shem Tov. ellibro lleg6 a manos de Israel ben Eliezer. s610 vio un resplandor que emanaba del cuerpo del pro- Addn se han desvanecido al paso del tiempo. Israel ben Eliezer lom6n. que contienen textos bre continuara? Mas tarde esa noche. era: ~a quien deberia entregar el Libro de \ mas significativos e intrigantes de la historia humana. Entre Addn antes de su muerte para garantizar que la verdad del hom. Esta fue la ultima ocasi6n en que se mencion6 el Li- estaba Israel ben Eliezar. Para proteger el contenido del libro y judios. evitar que se Ie diera mal uso. Su pregunta. El resplandor no era producto de un incendio. Dice la leyel'l:da que para todos los de. AI sentir que se acercaba el fin de sus dias. un milagro que Ie corrobor6 que Israel era en realidad digno mas poseer este libro careda de significado. los secretos de encontr6 a Israel que vivia en un granero. fue despenaclo de su suefio b!blicos perdidos y la traducci6n de miles de tablas sumerias. y cualquier inten. En esta embargo. . Se cueva encontr6 el unico ejemplar del Libro de Addn.58 El C6digo de Dios De los libros perdidos de la creaci6n 59 Eva cuando estuvieron en el Jardin del Eden. el Libro de Addn s610 habia sido propiedad ' seo de su padre y entreg6 a Israel este libro mistico. sabia de su existencia. los tonos y las cualidades del texto. los pergaminos del Mar Muerro. Se dice que en esa de la inspiraci6n que Israel recibia alleer las palabras de la epoca. debiera a que de una vela hubiera incendiado la paja del gra- Aunque los detalles del libro conocido como Libro de nero. donde se desvelaba la creaci6n y de los origenes de la humanidad estaban ocultos leyendo las palabras de la Torah. es decir: Maestro del Santo La leyenda cuenta que en una poblaci6n cercana a donde Nombre. Sin dos muchos patriarcas y matriarcas de la antigiiedad. pre- to de hacer mal uso de su contenido acarreaba la desgracia a ocupado por la posibilidad de que la intensidad de la luz se sus vidas. tarde fue conocido como el padre del Judaismo Chassidut. aunque no tenia bro de Addn en la literatura abierta. indica que esta y guiado a una cueva en Tierra Santa donde estaban sepulta- leyenda podria en realidad basarse en un suceso hist6rico. ellos. que sus El Rabino Ie pidi6 a su hijo que localizara al joven Israel letras estaban impregnadas de una sustancia misteriosa que ben Eliezer y Ie entregara ellibro personalmente. dice que s610 ha existido un ejemplar de este libro. la Sagrada Escritura de los en las propias letras. al investigar la Fuente de un resplandor que tenian una madurez espiritual que les permitiera encontrar venia de atras de la puerta. el hijo del Rabino cumpli6 el ultimo de- Hasta entonces. los rumores de su pia Israel. Josue ben Nun y Sa. AI mirar por la ventana. AI dia siguiente.

pues las traducciones son el siglos de obras religiosas dispersas en un solo documento que resultado del trabajo de diferentes interpretes que trabajaron tuviera sentido para la gente de esa epoca. cirian llegaria a ser el fundamento de una de las religiones sia Cristiana en el siglo IV mas importantes del mundo y que mas de la tercera parte de Los eruditos reconocen abiertamente las ediciones de los la poblaci6n mundialllegada a considerarlo ellibro mas sa- textos cristianos antiguos yel hecho de que se haya eliminado grado? material de ellos. sin deraci6n la colecci6n indefinida de parabolas. tambien esten incompletos. Quiza una de l'scribir una persona que aun viviera". no existe una compilaci6n que contenga to- Concilio de Nicea. grupos de traducciones que han estado disponi- registros hist6ricos.eran parte de de Enoch. por que eligi6 traducir sente se basa en una comprensi6n incompleta de nuestro pa. se han recuperado muchos de los libros tablecer la doctrina de la Iglesia en el afio 325 de nuestra era. el respondi6: "Porque tenia la esperanza de que es- principios cientificos. Existen. Concilio de Nicea. Ese fue eI caso del Libro Nicea. se han tra- Bajo la direcci6n del Emperador Romano. gunt6 a Wake. El resultado evidencia de que la cadena de conocimiento que une la sabi. can diferentes idiomas a 10 largo de los siglos. \igue con nosotros hoy en dia. escondido 0 redactado de A partir de las cartas que nos dejaron los miembros del otra manera. de nuestras practicas moo. ensefianzas y embargo. de nuestro pasado se han eliminado. bles de vez en cuando. la Santa Biblia. De los libros perdidos de la creaci6n 61 60 El C6digo de Dios de textos gn6sticos y del Nuevo Testamento que . los ducido y se han puesto a disposici6n del publico en general. En afios recientes. a manos de un grupo que se reuni6 para es. el misterio de nuestra identidad se ha confundi.3 ~C6mo podrian saber las mayores interrupciones en nuestra cadena de conocimien. toS escritos tendrian una aceptaci6n mas general y con menos giosas y hechos hist6ricos. Constantino. como una compilaci6n de libros perdi- 4 sentados eran redundantes yestaban mal escritos. con versiones dos de la Biblia que se public6 a principios del siglo XX. el Concilio continuaci6n se pre~enta una lista parcial de los libros que encontr6 que los textos eran tan misticos. que algo que pudiera servimos de ellos. los miembros del Concilio de Nicea que ellibro que produ- to fue resultado de la edici6n de la Biblia realizada por la Igle. A superpuestas y relatos repetidos. obispos. y representa uno de los libros duria antigua con nuestro mundo moderno en realidad se ha mas poderosos y controvertidos de la historia de nuestro mun- interrumpido en mas de una ocasi6n. do aun .icas. Existe cada vez mayor mend6 que se retiraran al menos 45 documentos. se enfrentaron a la tarea de transformar dos los textos en su orden original. el clero y los historiadores que formaron parte del Por 10 que yo se. Por ejemplo cuando se Ie pre- Como gran parte de la manera en que vemos nuestro pre. es claro que las ediciones originales se hi- ' mas. 2 que se eliminaron en las ediciones del siglo IV. Cada vez que los textos do. no deberia sorprendernos que muchos de nuestros pocaneas. que sus miembros sabemos fueron eliminados en las ediciones del Concilio de creyeron que no ten{an valor prcktico. muchos de los libros que les fueron pre. cieron con buena intenci6n. . el Concilio reco- la Biblioteca Nag Hammadi en Egipto. Arzobispo de Canterbury. En algunos casos. ideas reli. al igual q·ue la forma en que nos prejuicios entre todo tipo de personas. Como resultado de sus esfuerzos. Tomando en consi. y publicar esos textos antiguos en lugar de sus obras contem- sado.

Emanual Tov. el acceso a la Biblioteca del Mar Muerto La Historia de Ahikar Neftali se limitaba a un equipo de s610 ocho eruditos. se reconstruyeron mas de 22. proclam6: "se dara acceso libre e incondi- gua biblioteca oculta en unas cuevas cercanas a la costa del donal a t~das las fotograffas de los Manuscritos del Mar Muer- . cobre y papiro. anterior fueron representa 900 rollos que revelan la versi6n original de libros relegados a la oscuridad despues de haber sido retirados. algunos dramaticamente diferentes a los textos que El segundo libro de Adan y Eva Levi encontramos en 1alIaB'bl'" . la biblioteca de documen- Pablo y Seneca El Credo de los Ap6stoles tos que se tom6 de once cuevas cercanas al Mar Muerto cons- Nicodemo I de Clemente tituye el tesoro mas significativo de textos biblicos que se ha Magnesianos II de Clemente descubierto hasta la fecha. Visiones actualidad como libros que se "perdieron" durante las edicio- Filadelfia II de Hermas. Isaias.000 frag- mentos de manuscritos en pergamino. el contenido de los Asher Benjamin pergaminos se dio a conocer al publico en la decada de 1990. 62 El C6digo de Dios De los libros perdidos de la creaci6n 63 Cartas de Herodes y Pilatos Ilnfancia Mar Muerto: Los pergaminos del Mar Muerto. Esta es una lista parcial de Biblical Archeological Review [Publicacion Bfblica ArqueolOgi- textos que normalmente se reservan para los eruditos.5 El Libro de Enoch luda La recuperaci6n. y las pala- nos otros no 10 fueron. cal coment6 la importancia de este hallazgo. compilaci6n y publicaci6n Los Salmos de Salom6n Isacar de los manuscritos ha sido terna de grandes controversias desde Las Odas de Salom6n Zebulum el momenta en que se descubrieron. 10 que Aunque muchos de los libros de la lista. Maria Bernabe Entre 1946 y 1956. de los manuscritos. 0 documentos de apoyo. Incluso en la ultima EI Cuarto Libro de los Macabeos Dan decada del siglo XX. diciendo: "Mas de 200 manuscritos biblicos estaban ocultos en las cuevas de El primer libro de Adan y Eva Sime6n Qumram. Este hallazgo Tralianos II Infancia es fuente de muchas controversias. Como resul- El Testamento de Ruben Gad tado de presiones politicas y academicas. editor de la revista pionera cundarios. traducci6n. en no- Podrfa decirse que uno de ios hallazgos arqueol6gicos mas sig. En 1991. Los siguientes libros se consideran se. Aunque segun algunos eruditos todavia se Pablo y Tecla III de Hermas. bras de Moises. algu. A su vez. jefe del equipo oficial nificativos del ultimo siglo fue el descubrimiento de una anti. viembre del mismo ano. del Antiguo Testamento como el Genesis. la Biblioteca Huntington del sur de California re- Fragmentos de una Sabidurfa Superior cibi6 un juego completo de fotografias de los manuscritos y anunci6 que se darian a conocer al publico. Similitudes podrian encontrar mas pergaminos. 6rdenes nes del siglo IV. Hershel Shanks. pues varios de los docu- Romanos Efesios mentos que se descubrieron en las cuevas se reconocen en la Policarpo I de Hermas.

es posible que estas De los angeles del delo: dos bibliotecas ofrezcan la vision mas completa del mundo lnstrumentos de muerte y e[ origen de [a guerra antiguo y de las tradiciones del cristianismo primitivo que se han tenido hasta la fecha. or eruditos respetados como Ireneo. t Ii l! r nu)i n drib Ilu ar linic d In h n . . Sherman a traves del cristal. [Fotograffa to- de que el hallazgo se autentificara y se registrara en el museD el mada por Melissa E. los manuscritos que se conservan. estan muy bien preservados y ofrecen datos pristinos y en oca. y nadie esta seguro de cuantos otros manuscritos fueron destruidos al Figura 3. Las revelaciones de esta sabiduria han "ntre los documentos mas importantes y misteriosos que se sido de gran utilidad para llenar huecos y dar sentido a puntos h n recuperado en los Ultimos 200 mos. esta colec- cion. an sentido a nuestro mundo moderno. se encontro otra biblioteca de la sabiduria de la antigiiedad. se mencionan para ilustrar el hecho de que I y I o.7 Cuando se les considera en conjunto. No obstante. Egipto. Clemente de AIejan- tos en su totalidad. pues eso se ~enciona en comentarios cristianos escri- Aunque esta breve explicacion no les hace justicia a estos tex. se nos da nueva informacion sobre el misterio I la Iglesia Catolica sendan un gran aprecio por el Libro de relacionado con algunas de nuestras creencias mas apreciadas. en el segundo siglo de nuestra era. que consta de 12 manuscritos completos y ocho paginas de un decimo tercer documento. habian caido en el olvido principios universales que siones sorprendentes sobre las tradiciones gnosticas y cristia. AI tener la historia 1 se habia perdido. antes descubrieron en la Biblioteca de Hag Hammadi. no coherentes en la escritura tradicional. una biblioteca que y~ ha empezado a cambiar nues- tra manera de pensar sobre el cristianismo prirnitivo.6 Dos afios antes del descubrimiento de los Manuscritos del Mar Muerto.I p rd r to do urn nt • y ) i n simi) r I infl r. nas de la antigiiedad. Por ejemplo. Antes de que las autoridades en el Cairo se dieran cuenta de ello. I hi. conocidos como la Biblioteca de Nag Hammadi. {/loch. Ahora se conservan en el Museo Coptico del Cairo. pasa~on por muchas manos. inc1uyendo manuscritos que nunca antes se habian dado a conocer". Es obvio que los primeros historiadores mas completa. macion. esta el Libro de Enoch.1: Dos paginas del texto gn6stico "perdido" del Evangelio de Tomas.64 El C6digo de Dios De los libros perdidos de la creaci6n 65 to. cerca del rio Nilo. El manuscrito esta escrito en griego y es uno de los textos que se utilizarse para encender hogueras y otros usos similares. dos he~manos encontraron una coleccion de manuscritos enterrados en una vasija cerca de la aldea de Nag Hammadi. En di- ciembre de 1945.] 4 de octubre de 1946. Egipto.

cosas secretas que se hacen en los cielos". Los seres humanos caredan de la ma- este profeta del Antiguo Testamento no se aceptaron en el ca. palabras de poderes con prudencia.66 El C6digo de Dios De los libros perdidos de la creaci6n 67 'Ia literatura sagrada. y me completamente abiertos". su morada esd en eI cielo". y que el hombre posteriormente hizo mal uso Tertuliano afirma: "Como Enoch ha hablado en la misma es. para la matanza". Enoch describe c6mo los secretos del cielo final mente los antiguos profetas. 10 Se entreg6 una copia de este ma. Ahi vi la nube que permaneci6 alterado. escribe que las palabras de su padre se pronunciaron mientras "Ahi tambien. mencion6: "Entre los objetos que en. y se Ie non hebreo. como tos de las plantas y las hierbas.16 . Enoch describe las razones del deterioro de la huma. Ademas de estas revelaciones perturbadoras. vulgaron. Enoch habla con claridad de su expe. 8 De manera espedfica. se Ie edificamos es de inspiraci6n divina'. da a conocer a Enoch c6mo se Ie revelaron al hombre los secre- rna credibilidad que a otros documentos de la escritura.. 15 nidad y la Fuente de sus sufrimientos. Enoch describe como ciertos ange.. el escudo y la espada EI Libro de Enoch empieza con un relato en el que el profe. En respuesta a su critura en que habl6 el Sefior. sobre la Tierra antes de la creaci6n del mundo". con los ojos pago y el trueno. mis ojos contemplaron los secretos del relam- Enoch contemplaba una "visi6n en los cielos . la alquimia. y han revelado los secretos a La primera menci6n del texto de Enoch en tiempos mo. y dio a conocer al mundo todas las de las profedas de Enoch". Bruce. de la escritura y de los Libros de Isaias y el de los Salmos. y describe como el angel Azazyel "ensefi6 todo tipo tregue a la biblioteca en Paris. donde fue re-descu.. Enoch menciona angeles espedficos y los secretos que di- un explorador escoces. durez para aplicar el conocimiento con responsabilidad. los hijos de los hombres y los han seducido para que cometan demos. ahi percibi ellugar de donde salen.. que el angel Gadrel "revel6 a los hijos de los hombres los ins- bierta y traducida por Richard Lawrence en 1821. queel y Matusalen con. aunque sature del polvo de la Tierra. trumentos de la muerte. la cota de malla.. Enoch termina esta porci6n de su visi6n diciendo: les divulgaron los secretos de la creaci6n ala humanidad antes "La sabiduria no encontr6 un lugar en la tierra donde pudiera de que nuestra especie alcanzara la sabidurla para usar tales vivir.14 ta dicta la historia oculta de la raza humana a su hijo Matusa. "La sabiduria fue a riencia con una extrafia precisi6n. II En un estado de alerta. estaba un ejemplar magnifico de iniquidad sobre la tierra. por 10 tanto. dellenguaje. Haciendo una distinci6n entre el conocimiento y la sabi- templaron en su tiempo.9 descendido del cielo a la Tierra. 12 afios. Matusalen mostr6 la Fuente de la belleza de los misterios de la creaci6n. de ellos enfocandolos a la guerra y al poder. lllorada".. vivir entre los hijos de los hombres. y 'toda la escritura que pueda petici6n de que se Ie mostrara "todo 10 que esra oculto". despues de haber estado perdido durante casi 1500 el pecado". no rechazaremos nada de permite a Enoch conocer los nombres de los "angeles que han 10 que nos pertenece". 13 Continua diciendo nuscrito a la Bodleian Library de Oxford. a Enoch se Ie len. pero no consigui6 una De manera espedfica. fue cuando James Bruce 10 descubri6 en 1773. Aparte de las referencias vagas y duria que se produce al aplicar el conocimiento en nuestra generales que al parecer siempre acompafian a las visiones de vida. tal como Ie fue revelada por el angel de la paz. y reconoce que aunque las. se perdieron en el dominio del hombre. son de inspiraci6n divina y se les debe dar la mis.

antes de que hubiera alcanzado la sabidu. la formacion de la Tierra y finalmente. se nos entrega una comprension profunda de la creacion del Libros como el Haggadah. pero tan sutil. vivid por siempre" . secretos que ya eran an- al hombre para que sea la union de ambos. algunos de los registros mas completos y detallados hombre. mientras que los angeles del amor y la justicia esta. Cuentan con una historia cialmente. las investigaciones mas antiguas sobre miento hebreo es una coleccion de escritos misticos conocidos nuestro pasado colectivo revelan un punto de vista que es muy colectivamente como la Cabala. .68 El C6digo de Dios De los libros perdidos de la creaci6n 69 Los poderes del delo en cuerpos de la Tierra claro en sus traducciones: Nuestros ancestros vieron nuestra relacion con Dios. que incluso hoy en dia la muerte. Gracias allegado de enormes templos. como enos las escribieron hace cinco milenios.18 mejor ciencia de nuestros tiempos ha tenido que esforzarse Segun textos gnosticos y textos que no son parte de los para captar su significado y sus implicaciones. que subyace nuestra existencia.. y aun poder a una sola especie al revelarle los secretos combinados podemos leer las palabras escritas por los eruditos hebreos tal del cielo y la Tierra. representan solo una muestra universo. Al combinar las cualidades de los angeles y este libro no logra definir con precision quien 0 que es Dios. Tal. el hecho de otorgar al hombre aun mas secretos del cielo. En esos secretos habia un conoci- peque. eran las implicaciones y consecuencias de otorgar cuyo origen puede rastrearse hasta de mas de 5000 ailos. Sus escritos no nos hacen dudar de la magnitud del papel que partiera con la Tierra. piramides misterio- cion hebrea. el origen de de un tema que esta presente en todos los relatos antiguos de nuestros cuerpos. pero si evita el pecado. describe como el hombre "reune en si cualidades sas. de modo que cuando tiguos en epocas remotas. ria para aplicar tales conocimientos con responsabilidad. sobre nuestros origenes se preservaron en ellenguaje y las tra- ban a favor del plan de Dios. Aunque el descubrimiento que se describe en detalle en de informacion. que incluso antes de que el conocimiento del cielo se com. con el cosmos y entre nosotros mismos de El descubrimiento y traduccion de textos adicionales sugiere forma muy distinta a la que prevalece hoy en dia en el mundo. En esas palabras. fue un tema de gran controversia en el consejo de Dios El misterioso Sepher Yetzirah: en el cielo. cuando se comporte como una bestia. Ie sobrevenga la miento tan universal. los miembros de las del cielo y de la Tierra". a la raza humana ya se Ie habia otorgado describe las evidencias modernas de una inteligencia eterna una categoria sin precedente a los ojos de los angeles de Dios. _ canones. El texto de Haggadah continua: "No todos los an. El Libro de la Creaci6n geles tenian la misma opinion". Algo que les preocupaba espe. los angeles de los cielos cuestionaron el elIos cretan que tiene Dios en nuestro mundo y en nuestra hecho de que la humanidad estllviera lista para recibir ese tipo vida. 19 10 que describe como los angeles de la verdad y de la paz se oponian ala creacion del Al parecer. diciones de los antiguos hebreos. 17 Ademas el texto revela la razon que sociedades de la antigiiedad dedicaban su vida a preservar y tllVO Dios para crear nuestra especie. el comentario del Libro de Haggadah de la tradi.vez la Fuente mas difundida del conoci- la creacion. extensas bibliotecas y textos misticos. diciendo "Yo [Dios] crean~ comunicar los secretos de la creacion. Por ejemplo. Ademas. un cuerpo material.

el tres libros. . En general. Cuando se toman en cuenta todas las combinaciones de Los principios que contiene el Sepher Yetzirah pudieron ha. letras y se arreglan grcificamente formando un drculo.. Es en este periodo cuando el nombre de este mientos profundos sobre el mensaje de nuestras celulas. Todo el texto estci escrito desde la nos espirituales mediante la contemplaci6n. el Sepher Yetzirah se considera si- Con detalles sin paralelo. Aunque se desconoce su origep exacto. Como veremos en el pero se cree que ellibro en si se origino durante el primer siglo capitulo 6.ibala. del primer siglo. en una de estas puertas se nos entregan conoci- de nuestra era. los eru- ditos hebreos tradicionales creen que el texto fue recibido di. hasta la manera en que el resto de las Yetzirah es el aspecto mas antiguo y quizas el mas misterioso letras del alfabeto hebreo dieron forma a "todo 10 que alguna r vez se lOrmo. las primeras un nivel de detalle sin paralelo en otros relatos de la creacion. la Cabala ~s en realidad las obras de Dios paso a paso. Una de las menciones mas Una de las numerosas formas en que se puede interpretar antiguas se atribuye al rabino Yehoshua. quien ' la sabiduda de la C. Hneas que conectan las posibilidades. este conciso texto de solo unas multcineamente como un texto que pertenece a dos de estas 1500 Hneas.. la narracion describe el acto de la Formacion). como el Veda de la I ria" con que esta hecho nuestro mundo.. Estas obras conforman la tradicion informacion. Cada uno de ellos contribuye a la compren. y finalmente al YO. r translOrmar 1as en hermosos ar' b0 1es. como combinaciones precisas de estos elementos y letras. que lleva allectof a los secretos mas profundos de los rei- origen de nuestro cuerpo. esoterica hebrea. mentos del universo. de la humanidad y de la creacion en res en cada capitulo. enfoque que asumen al relatar sus secretos: teorico. 22 el ' umverso se desenvue1ve ante nuestros OJos . se cree que las obras mas impor. ofrece una vivida descripcion de los sucesos que categorias. Por 10 general. El Sepher Yetzirah iden- que no existe evidencia directa que apoye esta afirmacion).21 Midrash (Libro de la Iluminacion). y el Sepher Yetzirah (Libro A traves del Sepher Yetzirah. creador de Dios con niveles de detalle progresivamente mayo- sion general de Dios. meditativo. A partir de estos tantes de la Cabala son el Zohar (Libro del Resplandor). El primer capitulo empieza afir- una coleccion de obras. mimero (Sephar) y comunicacion (Sippur). y el origen de algunas de ellas se per. versiones del Sepher Yetzirah tenddan una antigtiedad de 3800 el Sepher Yetzirah ofrece instrucciones precisas sobre la forma anos. libro se menciona par primera vez. magico y . De ser asi.20 . tifica estas Hneas como 231 "puertas". mando que nuestro mundo es el resultado de tres tipos de dio desde la antigiiedad. Yetzuah. Ademas. Desde la formacion de los primeros ele- formas distintas pero complementarias.70 El C6digo de Dios De los libros perdidos de la creaci6n 71 Aunque se Ie da un solo nombre. el texto continua: "£1 [Dios] creo Su Universo". Con rectamente por el patriarca Abraham. representados como las letras hebreas del Los historiadores por 10 general reconocen que el Sepher antiguo nombre de Dios. dene perspectiva de lIn observador antiguo que narra d milagro de fuertes Ylnculos con 10 que en ocasiones se denomina "magia" . registrada en tres tomos distintos: texto (Sepher). antigua India. En primer lugar se Ie considera un texto meditati- llevan al nacimiento del cosmos y 10 incluyen. de estas obras. hay 231 ber llegado a nosotros a partir de tradiciones antiquisimas (aun. es clasificar sus obras de acuerdo al declaro: "Puedo tomar calabacitas y calabazas y con el Sepher . 10 cuallas hace contemporcineas a algunos de los textos en que las 22 letras interaccionan entre si para crear la "mate- misticos mas antiguos de otras tradiciones.

de 2500 palabras. un examen mas detallado de este texto misti. La controversia y el misterio que rodea a los odgenes. A History ofGod version se creo originalmente en el siglo XVI y se refino aun [Una historia de Dios}.ciones y tec. un paralelo muy cercano a los descubrimientos de la ciencia En su aclamada traduccion del Sepher Yetzirah. el Rabino Kaplan estudian y practican este aspecto de fa Cabala consideran que sugiere que la razon de tantas variaciones es el secreta que se sus secretos son tan poderosos que los textos nunca se han requiere para preservar las ensenanzas.25 metafora de los misterios de la creacion. siones que concordara con las ensenanzas mas antiguas. los propios cabalistas fueron quie- resume este punto de vista tradicional es Karen Armstrong. Quiza quien mejor Segun el Rabino Kaplan.72 E1 C6digo de Dios De los libros perdidos de 1a creaci6n 73 antigua. el fallecido del siglo XX! rabino Aryeh Kaplan expresa con claridad esta vision dicien. el Gra Rabi Eliahu). como si estuviera escribiendo [Sepher Yetzirah: Libro de fa creacion}.23 Se deda que la creacion y incalCulable de versiones menores. El descubrimiento de un vinculo directo entre los elementos co sugiere que nos ofrece mucho mas que un relato de simbo. afirma que en el Sepher Yetzirah "no se mas en el siglo XVIII. que entre los siglos VI y X. Esta nes. la do: "Esta posicion [de que el Sepher Yetzirah es un texto me. las variaciones que han surgido a 10 largo de los siglos. aunque es interesante. rah es en realidad un relato muy antiguo y muy rico del acto nicas para llevar la sabiduda de sus meditaciones al mundo intencional de la creacion. Existen al tradiciones talmudicas mas antiguas. diciones religiosas y espirituales mas profundas de mas de la . Esta es la version a la que un l1'b ro"24 . Aunque do en cuenta la Version Corta. Toman- veles mas altos de destreza en los misterios hebreos. es ante todo una . nes falsas deliberadamente". Los eruditos reconocen publicado en su totalidad. es fisico. En su novedoso y muy aclamado libro. que tiene unas 1300 palabras. precision y las interpretaciones del Sepher Yetzirah siguen sien- ditativo con fuertes visos de magia] cuenta con el apoyo de las do Fuente de acalorados debates en la actualidad. y Ie revela a quien la practica las instruc. quienes tambien la Version Larga. nes finalmente produjeron un compuesto de las muchas ver- una erudita que es una autoridad en el mundo de las religio. se hizo un intento por limitar el Ademas de preservar las mas antiguas y misteriosas obras poder del Sepher Yetzirah a un pequeno drculo de estudiosos. qUlenes se veian tentados a penetrar en sus mlstenos . paso a paso. el Sepher Yetzirah es sin duda e1 texto que mas "Los lideres de estas escuelas poddan haber publicado versio- controversias ha suscitado. que indican que podia menos cuatro versiones principales del texto y un numero casi utilizarse para crear seres vivos" . demostraba los ni. llamados golem. La vision popular de esta obra es. Sepher Yetzirah: The Book of Creation 26 el mundo a traves dellenguaje . No obstante. y en la actualidad existen fragmentos de estos. si se toman en cuenta todas destruccion de tales seres. que es la base del esfuerzo monumental que relato es atrevidamente simbolico y muestra aDios creando culmino en su libro. dice el rabino. jEl proceso gradual. textos. Los descubrimientos que vinculan el alfabeto gliedad (ver el Capitulo 5) da un nuevo significado a las tra- hebreo con elementos modernos indican que el Sepher Yetzi. responsables de la vida y los idiomas hebreo y arabe de la anti- los y metaforas. "para confundir a crita en prosa es que. de la Cabala. como la Version Gra (llamada asi por el intenta describir el proceso de la creacion en forma realista. vamos a referirnos a 10 largo de este libro. " . .

nues- • A pesar de 10 buena que parece ser la ciencia. mas mistico y mas controvertido. el mundo y nues. existen grandes la- mo Dios. • Casi el 95 por ciento de la poblaci6n mundial cree • El descubrimiento de un vinculo directo entre las en la existencia de un poder superior 0 Ser Supremo. que todavia no hemos reconocido. las guo relato podria verse como una descripci6n precisa de la . tros elementos qu{micos. letras hebreas y los elementos de la vida indica que el de cierta descripci6n. es uno de los mas completos. como los Manuscritos del Mar cientificas de la evoluci6n y el creacionismo que exploramos Muerto y la Biblioteca Nag Hammadi. induyendo las teorias textos y bibliotecas. y la maravilla el Dios de cada una de estas tradiciones es exactamente el mis. las ecuaciones de eruditos biblicos a traves del patriarca Abraham. la com.74 El C6digo de Dios De los libros perdidos de la creaci6n 75 mitad de los habitantes del mundo. Mediante esa comprensi6n. AI serlo. Aunque reconocemos los grandes esfuerzos de la cien- rio e intencional de ese Dios. de la comunicaci6n por Internet. gunas en nuestra visi6n cientifica de la creaci6n. cia para explicar la vida. la creaci6n y el universo. nera en que Dlos us6 las letras de su nombre. • Los eruditos reconocen que mediante ediciones in- cia de Dios en 10 mas fundamental de nuestm c6digo genetico. A tencionales y mediante procesos naturales. La historia que comparten nuestra comprensi6n actual es incompleta. Por medio de esta comprensi6n profunda. ) • El hecho de que en el siglo XX se hayan recuperado ci6n que tal vez son menos completos. es una colecci6n de metciforas que des- criben los procesos de la creaci6n en terminos abs- RESUMEN DEL CAPITULO 3 tractos. . las men. la cadena Aunque el Sephar Yetzirah no es el unico texto que describe de conocimiento que une nuestras tradiciones mas estas relaciones. maci6n que habia estado oculta para los lectores en podemos encontrar las piezas faltantes y unir los numerosos general durante casi dos milenios. en una forma elementos quimicos) para crear el universo. . cada religi6n describe nuestro universo como el acto volunta. para producir el universo. antiguas con el mundo moderno se ha interrumpido prensi6n que se extrae de esta poderosa narraci6n llega a ser un ' en varias ocasiones. marco de referencia para entender los demas relatos de la crea. compartimos la esen. cristianas e isIamicas. tros cuerpos. este anti. relatos de nuestro pasado. A pesar las tradiciones judias. • Los eruditos consideran que el Sepher Yetzirah. Desde esta perspectiva. Aunque su nombre varia de una tradici6n a otra. i •. respuestas a tan grandes misterios ya podrian existir forma en que Dios utiliz6 las letras de su nombre (nuestros dentro de las tradiciones mas antiguas. Mas de la mitad de ellos se antiguo Sepher Yetzirah es un relato preciso de la ma- refieren a este poder como "Dios". . sugiere que Einstein sobre la energia y la materia. reconocida por de la daridad del c6digo genetico. yen ocasiones de manera sorpren- dente. el as- pecto de la Cabala mas antiguo. revela infor- en el Capitulo 2. tes mas privilegiadas de nuestro tiempo admiren que e1 mundo y nuesrros cuerpos.

.

.

aeion. Se deja a los herederos de ese conocimiento el decidir si ese poder 11egaria a ser una bendicion 0 una maldicion. Como sucede a menldo. E110s crdan que ademas de ofrecer la "~abiduria de los cielos" y la clave para trascender los sufrimientos de la vida. la capacidad de tender un puente entre el cielo y la Tierra tambien tenia el poder de destruir rado aque110 por 10 que la humanidad se ha esforzado y ha lagrado. A traves de este conocimiento. los eruditos de la antigiiedad vieron tales secretos como una espada de dos mos. hayamos dejado algo arras? ~Ser!a po- . Capftu[o Cuatro EL CREADOR DEL UNIVERSO: En pa[abras de otras epocas E ncerrada en textos misteriosos. la tradicion de la antigiiedad sugiere que en ella se nos est<l ofreciend) la identidad de nuestro Creador y el conoci- miento que forma un puente entre el mundo espiritual y el material. desde las hogueras en las que se quemaba madera hasta homos de microondas. ~Seria posiSle que a 10 largo de nuestro avance como civili- . se nos da el poder para sanar nu::stro cuerpo y traer paz a nuestra vida. como el Sepher Yetzirah..

Para apoyar tales afirmaciones. diciendo: "Fue Dios quien creo al hombre con agua".. ' idioma. "4 Asi. tiempo. 10. las relaciones suciles que menciona una tradicion se pierden de la humanidad se atribuye al hecho de que Dios utilizo Ull. mas cercanas a la vida.tiguos de la crea"'. 'la palabra na del. por ejemplo. empez6 un proceso en el que empezaron a surgir formal mente. lI11pregna . e1 Quran agrega algo a las descripciones hecho de recuperar esos textos antiguos. luego un cumulo de carne. La descripcion afirma que del polvo se tra nuestra existencia estuvieran enterradas en los registros mas formo "un pequeno germen de vida. No existe en estos idiomas una palabra con el significa- . A traves de . ra en que se inicio nuestra "existencia" en este mundo. La cion estan las descripciones del origen del hombre. 2 Sin embargo. Ahora. A traves de los matices de la cultura. en combinacion con el . historia de Adan. descripci6n mas basica de los odgenes del hombre. tal vez Aunque al parecer estas dos descripciones estan en conflicto. la respuesta por 10 general es que esran Indicios compartidos de un pasado comun hechos de los mismos materiales que forman al mundo: mine- rales. luego un grumo 0 coagu- antiguos de nuestro pasado? De ser asi. de Adan proporcionando detalles sobre la forma en que el "pol- ria de los cielos a nuestro alcance por primera vez en mucho vo" se convirti6 en carne. nos refiere al relato biblico de la creacion en el Genesis. agua y aire.' versi6n original preserve una idea con una sola palabra. nuestra tarea es comprender los mensajes que De manera similar. El Genesis. por ejem-' cion humana en unas cuantas palabras: plo. el nacimiento. completo en su hechura pero mientos de la ciencia y la tecnologia.82 EI C6digo de Dios El creador del universo 83 sible que las claves para sobrevivir a las mayores ?-menazas con. en otro punto del Quran. podemos' sonas en las tradiciones hebreas y cristianas. En la primera descripcion. a menudo se Entre los temas recurrentes en los relatos aq. relata el milagro de la crea- I tradiciones orales del Midrash y la antigua Cabala. entonces los descubri. han puesto la sabidu. proporciona la entresacar destellos de los recuerdos mas antiguos de la mane. mismo significado creo a la humanidad con elementos naturales: "Te creamos con. Aunque es posible que la fluido. mcomp 1eto. En ingles (y otros idiomas modernos). LisJ cnganosamente simple en su forma. Ie preguntamos a alguien de que se hicieron los primeros seres humanos en la Tierra. en las tradiciones occidemales. el Santo Quran dice que Di~' Palabras diferentes.. Los versos revelan que despues del origen de Adan como "pol. cuando se traducen a otro idioma. 1 En terminos muy similares. 110 exista una traduccion exacta para esa palabra en el nuevo un analisis mas profundo de los versos resuelve el misterio.l toda vida. ("I concepto de energ{a vital se ha pasado por alto hist6rica- vo". describen como el Creador les pidio a sus angeles "que lei ((El Senorformo al hombre delpolvo de la tierra': 5 trajeran polvo de las cuatro regiones de la Tierra para con esc polvo crear al hombre". que compareen mas de dos billones de per- indicios comunes que se entretejen en estos relatos. cuando nos dejaron quienes nos antecedieron. existen momentos en que polvo". "polvo" es parte de una secuencia mayor que describe !mIna describe el campo vivieme de la energia que rodea e los sucesos que llevaron a la primera manifestaci6n de vida.. la historia de que Adan se origi-' En el sanscrito de la antigiiedad.

Aunque la Fuente de las formas mas tradicionales de la al- l'. Levitico. La primera porcion del Antiguo Testamento Cris. guo a idiomas como el ingles se oscurezcan los matices de los ~egUn la leyenda. clara. terminarla la maldi- En hebreo. Una traduccion muy literal dirla que Adan es la persona. .de su creacion. no tie- humano se formo como se formaron los elementos de la Tie- nen una relacion directa con la idea original. que se deriva de la raiz adamah. l~ . AI m'lsmo tiempo. En su forma mas sencilla. por si mismas. rra. A traves de esas sutilezas del len- blando de sistemas vivientes. 0 Combinando la palabra vida para indicar que estamos ha- el s:r h~~ano "de la tierra". ITIlstenos . antiguo 0 "biblico".6 adamah sea tambien la palabra hebrea que significa "tierra". Cabala y los elementos . de la . el primer hom- Como hemos notado en traducciones inglesas. co- . debemos derive de adamah. la creencia comlin es que esta antigua 7 que indica una relacion mucho mas directa y personal entre Ad:in y nuestro mundo. . la matena de una a otra forma.uim. Exodo. se nos muestra que el hombre y la Tierra com- un campo de energia que brota del interior del propio sistema. la La descripcion del primer ser humano en el Genesis es otro l~ea d: que estuvieramos formados de los elementos mas sen- ejemplo de la manera en que esas sutilezas se pierden en la c~llos" ~l polvo de la tierra". la tradicion hebrea afirma que un creados de "polvo". 10 . La tradi. eI mentos naturales. Nlimeros y Deuteronomio < mr~e como una filosofia de la naturaleza. plO.84 El C6digo de Dios El creador del universo 85 do preciso de prana.o. nos permite reconocer. Es interesante que del Sefiar".ia n~ ~s. la alquimia podria defi- como Genesis. la relacion . Es posible que al traducir el hebreo anti. 0 transmutar.sabidurfa de estas "inspiradas artes". Para transmitir ese concept. la TIerra fueron revelados originalmente a Adan.: el hebreo fimrse c~mo el uso de esa filosofia para cambiar. de la comprension humana . parten un ongen comlin. basico . EI hecho de que la palabra Adan se l JenCla se 1ll1C16 con la legendaria FIgura egipcia de Toth. se tiene como resultado la frase "fuerza vital". tiano se deriva de los cinco primeros Iibros de la Tora. la frase que la sustituye: jUerza Relatos de secretos prohibidos vital. Aunque la defi- nicion de las dos palabras en forma independiente no tiene De Aclan a Hermes: relacion con la palabra prana. QUl'za' las t ra d'lClOnes . mas ~n~Iguas que describen esta relacion son las de la antigua cion hebrea declara que Moises recibiolos libros que conocemos a~qutmta. bre de nuestra especie. Aunque esta descripcion es adecuada en a~gel ~eciblO a Adan en la puerta del Eden y 10 instruyo en los terminos generales.' ~esponsa~l~ . angel prometlO que cuando la humanidad hubiera dominado tros odgenes se preserve mejor en la version original. pues nos dice que estamos hechos de ele. la sutil ener- gia de los sistemas vivientes. en ellenguaje de su tiempo. los secretos de la alquimia del cielo y de sucesos clave que se describen en la Tora. ha permanecido como un princi- traduccion. T~mbien podrfa de- hace casi 3500 afios. ~asta el nacimiento de la biologia molecular en el siglo XX. es posible que la descripcion precisa de nues. de hecho nos muestra que el primer ser arreglarnoslas utilizando palabras que. AI describir el proceso mismo que fue biblica entre la humanidad y la Tierra nos describe como seres . la palabra que significa hombre es ''Adan'' CIOn del fruto prohibido yel hombre podr(a regresai al "Jardin (ADM). en nuestro idioma. yla palabra jUerza que implica guaJe onglll~l.

la ley y la medicina en el antiguo Egipto. muchos de los su descendiente. yToth se transformo ponsables del nacimiento de las estrellas y del comportamien- en el maestro griego de los principios hermeticos. rodeado de partes disecadas de cuerpos productos que nos sean utiles: la quimica moderna. Se cree que ambas son las claves para' : creaci6n y 10 que estas relaciones de rakes tan profundas signi- redimir a la humanidad de la "caida" que ocurri6 al inicio de : hcan en nuestra vida. Varias tradiciones / para cambiar la forma de la materia ya existente. iguallo de abajo". 8 Conforme los grie. la filosofia de la alquimia de la antigiie. nuestra historia. yen gos absorbieron los conocimientos de los egipcios. Hermes Tris-' to de los atomos. 5610 en los ultimos anos del siglo XX se con- ba. las ciencias que han evolucionado a partir de ellas en la Se dice que la sabiduria de los secretos de Toth se registr6 i actualidad. Hasta hace poco. en una habitaci6n fria y sin ventanas. la .• ciones modernas. Desde la perspectiva tanto de la alquimia como de la astro- tos alquimicos de la naturaleza. La segunda es el estudio de los cuerpos celestes • do ahora a reconocer la interrelaci6n de los elementos de la conocida como astrologta.stros antiguos de las primeras ciencias Para algunos. se sugiere que la ciencia de la i pueden ver. combinando hermeticas. incluyendo a la quimica. En lo~ muros de los nuestra comprensi6n inicial de la naturaleza y las ciencias templos y en los papiros se Ie representa con el cuerpo de un modernas. las tradicio-i gran medida ignor6 los campos de energia sutil que son res- nes de la alquimia tambien continuaron. como la fisica cuantica. Ademas de haber intro. por ejemplo. 10 que podemos "ver". como la medicina homeopatica que se basa en los '( los elementos para producir metales mas fuertes y menos pesa- principios de "10 similar trata a 10 similar" y "como 10 de arri-i dos. el aire y el agua Reg. descubrimientos recientes sugie- avances que separan a Egipto de otras civilizaciones de su epo-: ren que las sutiles relaciones que originalmente se describieron ca se atribuyen ala sabiduria de Toth. logia. la palabra alquimia trae a la mente laimagen del En el nivel mas basico. tradici6n mistica sugiere que Toth tambien divulg610s secre. en las profundidades de binar los elementos de la Tierra para dar forma a nuevos un castillo medieval.". y que son de inspiraci6n divina. La alquimia del fuego. que trabaja dad se parece mucho a nuestra practica actual de alterar y com.86 EI C6digo de Dios EI creador del universo 87 nocido tambien como Tehuti y Djehuti. I en los aspectos fisicos de su estudio. Aunque la alquimia en si ha sido reemplazada por hombre y la cabeza de un ibis de pico largo. en ellenguaje de la alquimia pudieron perderse en sus traduc- ducido la escritura. Es claro de animales y de recipientes en los que hierven liquidos miste- que el conocimiento de los alquimistas sirvi6 de vinculo entre riosos. Aunque la ciencia ha comprobado ser eficaz megistus (que significa "nacido tres veces"). cada una se concentr6 que se conocen como las Tablas Esmeralda. mago barbado de una epoca oscura de la historia. Esra visi6n es eI resultado de la forma en que eI cine y . la fisica y la astronomia. '( sideraron seriamente las cualidades de elementos que no se A partir de estas leyendas. alquimia es una de las dos ciencias mas antiguas que conoce " las ciencias modernas. continuan hasta nuestros dias. AI reconocer los efectos de campos "invisibles". estan empezan- la humanidad. en 42 libros que mas tarde se incorporaron a textos distintos estan incompletas. la quimica.

Hijo y Espiri- mitir la sabiduria que posdan. AI carecer de vocabu~l \'lluilibrio" en diferentes visiones del mundo. es decir. el "Fue. los eruditos.88 El C6digo de Dios El creador del universo 89 i las novelas modernas han representado a los alquimistas. en Roma yen Grecia. Si pudieramos "traducir" las ideas mas sim.os escribas . I. los animales de las culturas indigenas que represen- 1 sabiduria antigua.. un a la Tierra. Fuego.1). El ''Agua'' Aunque en las primeras descripciones se identificaban tres con recibir. Muchas tradiciones comparten un fundamento de estas tres propiedades: la "positiva".: un solo principio segtin el cual todo nuestro mundo. Y el ''Aire'' con el ('lcmentos. bien conocidos para quieries estudian las tradicione$ Figura 4. al igual valentes en la quimica modema. que ya en su epoca era una tu Santo. Utili.. las "nubes de la probabilidad" que La creaci6n como una tri logfa "stan reemplazando a gran velocidad a las particulas imagina- En ellenguaje de la era de la alquimia. la l'xplicita ell tradiciones akjuimicas posteriores. el Aire y el Agua a sus equi". titiles de combinar los productos de la naturaleza que se utili-" zaron en las tradiciones mas antiguas y bien establecidas de la! historia. 10 "negativo" y el sagradas. En general. labIa menClona las tradiciones nativas de los Andes). el Aire y el Agua. zando trilogias de elementos para describir la creaci6n. podemos encontrar registros que describen formas. al cielo y a las criaturas que hay en medio Oa pIes de la alquimia sobre el Fuego. son el Fuego. de la alquimia hicieron 10 que pudieron para preservar y trans~: Esto incluye la tradicion cristiana del Padre. 'Iue los fundamentos de la fisica del siglo XX: el proton. 0 con el aspecto "masculino". se menciona en forma el "hijo". de pergaminos preparados meticulosamente y de tra-\ diciones orales. quienes entendian el orden natural de nuestro mun- (II) siempre intuyeron la existencia de un cuarto elemento se- importantfsimo equilibrio neutral que esta en medio. Aire y Agua' lias del pasado. A partir de tablillas de arcilla. (Ver la actualidad. lario ciendfico para describir este conocimiento. 0 con el aspecto "femenino". de los muros de los! templos. '''livo. el elec- rnOlO y el neutron. negativo y neutral) que se relaciona con los protones. II lS electrones y los neutrones go" se equipara con dar. que afirma 0 proyecta. la base de los estudios alquimicos empez6 con:.\ I 'igura 4. ~que secretos nos reveladan. los babilonios y los caldeos. hemos aprendido que los fundamentos de la alquimia fueron conocidos por los fenicios. al igual que en Oriente.1: Ejemp10s que representan 10 "positivo". El elemento faltante. Aunque descubrimientos recientes en el ahora las antiguas f6rmulas? (ampo de la fisica cuantica estan cambiando nuestro punto de . siguen presentando la trilogia de atributos (po- representaban los extremos de polaridad y equilibrio.ista sobre el atomo en si. la Tierra. y todo 10: que hay en el. ITelo. esta hecho de tres elementos ~encillos: Esos ele.: mentos. En la:: "negativa" que atrae 0 recibe. y en el centro la "neutral".

con el fin de evitar el mal uso de su poder. Me refiero a partiendo algo mas preciso? Las evidencias qu~ se. en. Nue poddan estar diciend~? . . . tramos un vinculo directo con los principios de la naturaleza tonces la clave de los conocimientos profundos que mas poder en la alquimia tradicional. lles de la "primera ciencia" permanecen ocultos para todos.. parte de esa creaci6n. La ciencia mfstica de la Cabala los antiguos esenios.~ A 10 largo del Sepher Yetzirah aparecen frases entrelazadas la Tierra y de nuestras celulas. Los alquimistas creian que comprender c6mo sur.s. la Slml. encon- conocimiento moderno y la sabiduda de la antigliedad.re han compr~. embargo. Los versos describen las inte- jVistas con los ojos del analisis ciendfico ~e nuestros dias). 5i aceptamos la PO~I~lhdad de que misterio durante la Edad Media. los principios que ci6n. fa quzmzca real. el significado de los simbolos litud que existe entre los relatos mejor establecl~o. l~s antlguo~ a~qUlmlstas. ren que en el vocabulario de su epoca. con referencias tipo alquimista. AI las antiguas f6rmulas del agua. Por claridad. los deta- nuestros ancestros estaban tratando ~e transrnltlr una podero. Incluso hoy en dia. val de laciencia. que tal vez es el registro mas completo de los odgenes de la creaci6n y nuestra relaci6n con nuestro Creador. tros.de nuestros que forman el centro de la alquimia tradicional se envolvi6 en odgenes no puede negarse. racciones mas antiguas del fuego. represen- tando a estos elementos con las letras del alfabeto hebreo. Para preservar los secretos Aunque los detalles de estas visiones del mundo obvlam~n~e de la "ciencia mas antigua" en una epoca en que ese conoci- son antiguas y su vocabulario pertenece a otras.Nuestros precursores cientlficos simplemente nos estaban dl. En estas antiguas descripciones. el aire y los minerales forman.presentan ~n la porci6n de la Cabala que describe al universo utilizando las 10 que queda de este capitulo y en los dos ~lgUlentes. sa ensefianza a sus descendientes. y la primera clave para interpretar nos dadan poddan existir en una forma que todavia no hemos el mensaje que esta en el interior de nuestras celulas. el angel del Sol. s~gle­ combinaciones precisas de las letras hebreas: el Sepher Yetzirah. utilizaremos el termino alquimia tradicionalpara angel del Viento. estaban describiendo la estructura preClsa. i los fundamentan son menos obvios. estan bien documentados y estan disponibles. excepto para aquellos que estan directamente involucrados en la tradici6n. sin ~iendo que el calor.~ bado ser sorprendentemente exactas! 51 asumlmos que las dl-· describir la uni6n entre el cielo y la Tierra. reconocido. de . . Aunque los misterios de la alquimia tradicional gi6 el cuarto elemento era la clave para comprender la crea. el fueg~ y el al. se nos incluye como ferencias de lenguaje es 10 unico que se interpone entre el .90 EI C6digo de Dios EI creador del universo 91 anteriores al cristianismo de los Manuscritos del·Mar Muerto. miento Ie costaba la vida a la gente. describieron estas cuatro fue~a~ como "angeles" y los nombraron de acuerdo a esa descnpcl6n: El . . la vida y la inmortalidad. Vnos dos mil afios antes de la alquimia tradicional.. 10 que nos incluye a noso. el angel del Agua y el angel describir 10 que a menudo se considera como la forma medie- de la Tierra. unaforma de alquimia attn mds antigua nos ofrece 10 nuestros cuerpos y rodo 10 que vemos? ~O tal vez estaban com. epocas. la gente del futuro para ellos. el aire y el agua. el Hquido.

10 que nos incluye a noso. Incluso hoy en dfa. estan bien documentados y estan disponibles. AI las antiguas f6rmulas del agua. Si aceptamos la poslblhdad de que lles de la "primera dendi' permanecen ocultos para todos. racciones mas antiguas del fuego. encon- ferencias de lenguaje es 10 unico que se interpone entre el tramos un vinculo directo con los principios de la naturaleza conocimiento moderno y la sabiduda de la aritigliedad. sin . describieron estas cuatro fue~a~ como Por claridad. . represen- iVistas con los ojos del analisis ciendfico ~e nuestros dias. tros. los annguos alqUlmlstas estaban describiendo la estructura precisa. ~que poddan estar diciend~? Vnos dos mil afios antes de la alquimia tradicional. unaforma de alquimia aun mds antigua nos ofrece 10 que tal vez es el registro mas completo de los odgenes de la nuestros cuerpos y todo 10 que vemos? ~O tal vez estaban com- creaci6n y nuestra relaci6n con nuestro Creador. los principios que ci6n. utilizaremos el termino alquimia tradicional para "angeles" y los nombraron de acuerdo a esa descnpc16n: £1 describir 10 que a menudo se considera como la forma medie- angel del Viento. ' excepto para aquellos que estan directamente involucrados en la tradici6n. la Slml.s. el significado de los sfmbolos que forman el centro de la alquimia tradicional se envolvi6 en litud que existe entre los relatos mejor estableci~o.de nuestros misterio durante la Edad Media. el fuego y el aue han compro. tando a estos elementos con las letras del alfabeto hebreo. se nos incluye como bado ser sorprendentemente exactas! Si asumimos que las di. la vida y la inmortalidad. nos dadan poddan existir en una forma que todavia no hemos . Aunque los misterios de la alquimia tradidonal gi6 el cuarto elemento era la clave para comprender la crea. reconocido. La ciencia mfstica de la Cabala los antiguos esenios. Los versos describen las inte- la Tierra y de nuestras celulas. el angel del Sol. con el fin de evitar el mal uso de su poder. " parte de esa creaci6n. Para preservar los secretos de la "ciencia mas antigua" en una epoca en que ese conoci- Aunque los detalles de estas visiones del mundo obviam~n~e son antiguas y su vocabulario pertenece a otras epocas.. el Hquido. Los alquimistas crdan que comprender c6mo sur. s~gle­ combinaciones precisas de las letras hebreas: el Sepher Yetzirah. el angel del Agua y el angel de la Tierra. en. nuestros ancestros estaban tratando de transrriitir una podero- sa ensefianza a sus descendientes.90 El C6digo de Dios E1 creador del universo 91 anteriores al cristianismo de los Manuscritos del Mar Muerto. . el aire y los minerales forman embargo. fa quimica real. Me refiero a partiendo algo mas preciso? Las evidencias qu~ se. En estas antiguas descripciones. describir la uni6n entre el cielo y la Tierra. presentan ~n la porci6n de la Cabala que describe al universo utilizando las 10 que queda de este capitulo y en los dos ~lgUlentes. i los fundamentan son menos obvios. la gente del futuro para elIos. miento Ie costaba la vida a la gente. el aire y el agua. ' en la alquimia tradicional. . y la primera clave para interpretar tonces la clave de los conocimientos profundos que mas poder cl mensaje que esta en el interior de nuestras celulas. los deta- odgenes no puede negarse. ren que en el vocabulario de su epoca. de A 10 largo del Sepher Yetzirah aparecen frases entrelazadas con referencias tipo alquimista.Nuestros precursores cientfficos simplemente nos estaban dl- ~iendo que el calor. val de la ciencia.

2). Sorprendentemente. mientras que el cuarto y el quinto.92 El C6digo de Dios El creador del universo 93 El Arbol de la Vida: Un plano del Universo La narraci6n del Sepher Yetzirah empieza con una descripci6n de los diez mundos. las Ma. que definen la relaci6n entre las fuerzas de la creaci6n. representan las cualidades de discernimiento y miseri- cordia. A partir de este arbol. y al cual nosotros podemos aspirar en nuestra vida. las teorias mas re- cientes de la creaci6n tambien mencionan que nuestro univer- so se compone de al menos diez dominios de energia. Mem (M) y Shin (Sh). Gevurah y I Hesed. y se colocan de tal manera que ' forman el familiar modelo del Arbol de la Vida (ver la Figura' 4. Cada Sefirot representa un atributo particular con el que Dios cre6 el universo. este libro se con- centrara en las primeras tres. Por ejemplo. de este mundo como los dicz Sefirot (scgun Halcvi). las ensefianzas de l~ Cabala ofrecen significado y relevancia dentro del contexto de nuestra vida .' cotidiana.• Hokhmah se ejemplifican en los principios de la comprensi6n y la sabiduria.2: El 'Antigua arbol hebreo de la vida' que muestra los atributos en la creaci6n. Aun- que cada una de las demas letras (19) del alfabeto est:l impregnada de su propio poder y significado. La clave esra en las tres pri- meras letras que Dios us6 para crear el universo y que en el alfabeto hebreo se conocen como las Fundamentales. yen ellugar especial que tienen Figura 4. 0 Sefirot. Binah y .( se representan como esferas.9 . diez dimensiones. el segundo y tercer Sefirot. jEstos mundos sutiles de hecho son necesarios para explicar las observaciones de la fisica cuantica! Los Sefirot . I dres 0 las Letras Madres: Alef(A). El segundo capitulo del texto presenta la primera conexi6n clara~ntre la naturaleza mistica del Arbol de la Vida y algo mas concreto en nuestro mundo.

y las implicaciones pio el caos y el vado. aire y agua. de inmediato con los elementos de la creaci6n que se conocen en la alquimia: fuego. cada afirmaci6n detalla el ele- gen del misterio de la creaci6n. 12 Las tres letras fu ndamentales. My Sh. el texto continua rior al prineipio. Y tste es el aliento santo. 14 esencia de la propia Cabala. el . es necesario sefialar la sabiduda que es la elias (las letras) y se eonvirtieron en polvo.94 El C6digo de Dios El creador del universo 95 En terminos bastante claros. el di. utilizando los elementos que representan las " con un grado de claridad que deja pocas dudas con respecto a letras hebreas. del eual emanan el Fuego. En la manera en que se definen el principio y elperiodo ante. A. declarando que el. el aire y o la primera luz. la enfermedad y la salud. Asl estd dad de la existencia". los pnmeros cuatro Sephirot. A. Y hay un aliento en eada uno de e!los. ptolos cuatropuntos eardinales (alientos) del cielo: Este. Despues del Principio. La deja en claro su relaci6n con el universo y mas alia: voz del aliento y el habla. la relaci6n entre las Letras Madres y los elementos: Letras Madres. Ie encontramos significado al misterio de las tres. Y Sh. Cuatro: Fuego que procede del agua. el primer aliento Una vez que se establecen los atributos del fuego. Como dijo Halevi: 11 "Las relacio-' 4. y a sus ministros con de la Vida son tan amplios que al parecer se han aplicado a una:' flamas de fuego. Con t4 Dios gravo y es- nes que se presentan el en Arbol de la Vida subyacen la totali·: 1 eulpiO el Trono de Gloriay todos los ejereitos de 10 alto. universo puede continuar. hasta la fisica de la creaci6n. el texto declara que a traves ment~s que forman el universo. los estudiosos de la Cabala interpretan esto como una descripci6n del momento de la creaci6n. Las Tres Madres se relacionan mento al eual se Ie da vida. identifica los elementos. n.. y el acto de usarlos para el milagro de nuestro lector en una travesia alquimica en la que se derivan los de. se guia al ' en su lugar. desde las razones del matrimonio. 1O 3. fuego "16 tradici6n. Vt-rtiO agua en de este enunciado. a partir de los cuales se ereo todo. Despues de estas descripciones iniciales. Con t4 Diosgravoy escul- seereto oculto y mlstieo. Tres: Agua queprocede del aliento: Con ella. y tambien como la primera sustancia de la el agua. M. el Sepher Yetzirah usa el Arbol de la . En el mismo contexto que 1.13 el Aliento y el Agua. agua.' 1 vorcio. Norte y Sur. Los conceptos que se ofrecen en el Arbol eserito: hizo a sus dngeles eon alientos.HI gravo y escul- Pare entender el misterio de A." Por universo son aire. Vida como una metafora de la creaci6n. En unas cuantas frases. la arcilla y elpantano. eomo estd eserito. son un gran 2.. My Sh.os: Aliento queproeede de aliento. y s6lo de estas letras. Diez Sephirot de Nada: Uno es el aliento del Dios viviente. A traves de los demas Sephirot. En la siguiente descripci6n de de estas letras. 15 infinidad de temas. el texto dedara que los bloques de construcci6n estan que se form6 todo 10 demas. puede encontrarse el ori. una sola frase de amplio significado Bendito y bendecido es el nombre de la vida de los mundos. . "Tres Madres. en el primer Sephirot representa el ''Aliento del Dios Viviente. Oeste.

My Sh son mas que simples simbolos de los elementos de la naturaleza.-erso.. los alquimistas y los obradores de milagros de la fundidad del conocimiento que poseian los autores del texto. asi como con la creacion de los angeles de la naturaleza Instiruto de Cardiologia Mid America de Kansas City.• aparentemente milagrosas. El poder de la oracion para lograr la sanacion. labras que conodan. fue primero necesario comprender El hizo de Shin el rey que gobierna elfUego. se nos explica que A. das. Aqui tambien encontramos la dave que aliento" se convierte en el elemento agua yen el angel del agua. habia poca necesidad de este tipo de informacion. nadores. estas descripciones testifican la pro-. sus antigua que todavia no se ha identificado. I go. AI: como aplicar los antiguos principios de la naturaleza a sus vi:- carecer de un lenguaje cientifico. fuego y en el angel del Sol. la dave para comprender las fuerzas del uni. . y se preocupaban mas por un lenguaje que sigue teniendo significado en la actualidad. para diseliar cada una de estas tecnologias El hizo de Mem el rey que gobierna el agua 18••.. aldeas y sus comunidades se beneficiaran de ella. ofrece un ejemplo perfecto un paralelo muy cercano con la alquimia tradicional de la Edad de esta distincion. antiguedad se preocupaban menos por entender por que nues- al igual que su gran capacidad para transmitir 10 que sabian en . Como no estaban tratando de mejorar la naturaleza. sin embar- En terminos que han sobrevivido ante las pruebas del tiem. Desde influir en las pautas del dima y crear formas nuevas de materia.. De manera similar. "19 por que funcionan los procesos naturales. un fenome- truccion del universo! no que la ciencia moderna y la medicina occidental estan em- Esta descripcion de los primeros actos de la creacion tiene pezando a explorar con seriedad. Aqui el "Aliento de Dios" se convierte en aire y en el en dos grupos antes de ser sometidos a los procedimientos . el "agua que proviene del reglas de la creacion. y los versos Gran parte de la tecnologia de nuestros dias se basa en modifi- nos muestran como el conocimiento y el poder de cada letra es car procesos que historicamente se han dejado a la naturaleza. ha- mitieron la sabiduria que heredaron de una Fuente aun mas bia poca necesidad de diseccionarla para que sus familias. Desde la perspectiva de nuestros antepasados. . En un estudio piloto llevado a cabo en el Media. hasta la ingenieria genetica en el campo de las plantas ('El hizo de La letra Alefel rey que gobierna el alient/ 7•. Los sa- po y de las traducciones.96 El C6dige de Dies El creador del universe 97 Arbol de la Vida define los limites del Universo de Dios y las angel del viento.. parece que los antiguos trans. describieron nada menos que la cons.. tro mundo funciona como 10 hace. Tomando en cuenta estos vinculos.. surge esta pregunta: ~Que une a estas letras antiguas de la crea- El surgir de las Tres Madres cion con la quimica de la ciencia moderna? Despues de estos pasajes. iCon las unicas pa. y las enfermedades. 990 descrita por los Esenios unos 500 alios antes del nacimiento pacientes con diversas af<ycciones cardiacas serias se dividieron de Jesus.. Se les Pasando del "por quell al"como" describe como una forma de "alquimia verbal". une a las tres Letras Madres con los elementos modernos de mientras que el "fuego que proviene del agua" se convierte en nuestro mundo fisico y con el milagro de la vida.

22 Los resultados de este estudio recibie-" investigacion cooperativa de mayor magnitud del ultimo si- ron publicidad lIegando a los titulares de los periodicos a nivel glo: el Ana Geofisico Internacional (IGY. Como ya. El Dr. que no es a)"f. No obstante) el estudio A finales del siglo XX. El investigador en d ad ".23 La h·lstona ' reve1ar que el conocimiento sin pre- . velocidad de nuestra capacidad para reunir conocimientos di- Para el asombro de los investigadores que lIevaron a cabo ciendo: "El conocimiento humano se esta duplicando cada 10 las pruebas) los individuos que estaban en el grupo que recibi6 anos. La ciencia moder- na demuestra que) de hecho) nuestra atmosfera nos nutre con La ciencia confirma un modelo antiguo: el elemento invisible que da vida a cada celula de nuestro cuer- Se consideran de nuevo po: el oxfgeno. Anteriormente. En la ultima decada [de 1987 a 1997] se ha generado mas oraciones experimentaron beneficios estadfsticamente calculables conocimiento cientffico que en toda la historia de la humani- en su proceso de curacion y recuperacion. Medico de la Universidad de Georgetown y en la Universidad. Interpretaciones posteriores los tiene. de nuestra atmosfera que se llevo a cabo durante el IGY revelO der de dar forma a la naturaleza. i la Tierra de una manera en que nunca antes se habia hecho ni Aunque estas investigaciones son interesantes) muchas dei.21 Un grupo el desarrollo de las computadoras y el almacenamiento de da- recibio tratamientos relacionados con la oracion de manos de tos) en una sola generacion hemos reunido cantidades sin pre- cinco voluntarios que trabajaban con ellos diariamente) mien.'! En los textos de la alquimia de la antiguedad) el elemento saben que la oracion tiene resultados) no se preguntan por que Aire nuncase define con claridad. suponen que se refiere al aire que respiramos.98 El C6digo de Dios El creador del universo 99 medicos 0 cirugias que se les habian prescrit~. de las siglas en in- nacional y han motivado estudios posteriores en el Centro!.' Durante un periodo de 18 meses) de julio de 1957 a di- de Harvard) en un esfuerzo por comprender con precision por": ciembre de 1958) 67 naciones participaron en un proyecto que el grupo que recibio oraciones tuvo muchos mejores re-'l unico para documentar la composicion y el proceso natural de sultados. Por tanto) al correlacionar la alquimia de la el airel el agua y el fuego antigiiedad con la quimica moderna) supusimos que el oxigeno es el equivalente al Aire de la alquimia. gles: International Geophysical Year). la concentra. los descubrimientos nos dieron el po. Michiu Kaku describe la fantastica tras que el otro grupo no 10 recibio. Con mente poco oxlgeno presence en d aire que respiramos! . que ellos tienen para compartir ese poder con otros. po d na jefe del proyecto declaro: "Las pacientes por quienes se rezo cedente que ahora se tiene sobre la Tierra empezo con la respondieron mejor". Ya aceptaron el poder de la oracion y la capacidad! mas sofisticada de nuestro tiempo. Lo ironico es que precisamente estos las personas que habitualmente incorporan la oracion en SUi f datos modernos son los que ahora nos permiten tender un vida todos los dias podrian sentir que este tipo de estudios no : puente entre los principios de la antigua alquimia y la ciencia es necesario. 24 se ha vuelto a hacer. cedente de datos. Aunque el oxigeno es indudablemente el ele- cion de la ciencia habia estado ante todo en recopilar mento del aire que mas necesitamos para vivir) jhay relativa- informacion que explicara nuestros cuerpos y el mundo.

termine.25 jla mayor parte del contenido de cada respi. los fuegos que han consumido ma- un elemento primordial de la creacion. los estudios de la NASA indican quimia. Si adoptamos el mismo del fuego solar son dos elementos primordiales. A final de cuentas. sos micro-minerales. do de los elementos que componen el cuerpo ardiente que esta carse a los elementos modernos que corresponden al fuego. (el argon. 26 (Aunque la f6rmula indica que hay dos . el bioxi. que el agua esta bajo el dominio del elemento invisible llama. al aire y al agua como elementos qufmicos reconocidos por la mientras que el porcentaje restante incluye hidr6geno y diver. en ellenguaje de su tiempo.100 El C6digo de Dios El creador del universo 101 Un 78 por ciento de nuestra atmosfera se compone de otro atomos de hidrogeno por cada atomo de oxigeno. referencias al elemento que produce la fuente de do oxigeno. agua y a la Tierra de la alquimia. carbon y otros combustibles que se han utilizado a 10 estuvieran diciendo. mos que las referencias antiguas al agua son una clave que re- do de carbono y algunos microelementos constituyen el resto presenta al elemento oxigeno. oxigeno (mas 0 menos un 88. cana es una enorme maquina celestial que quema una canti- rfos y corrientes de agua de la Tierra. considere- senta el21 por ciento de nuestra atmosfera. Estudios recientes confirmaron que el combustible drogeno por cada atomo de oxigeno. ~es posible que nos ' dera. A partir de estos descubrimientos. alto en la composicion). En los terminos Fahrenheit!). 27 elemento fisico. Para nuestros propositos. partes de nuestro mundo esta hecha de un 85. ciencia moderna (ver la Figura 4. Siguiendo la l6gica que se aplica a los elementos de la al- Basandose en porcentajes. supondremos que ese es el caso y veremos ~ dande nos lleva los avances tecnologicos han hecho posible un analisis detalla- esta correlacian. son de hecho. En la ultima mitad del siglo XX.3). largo de la historia. 10 que explica el porcentaje mas Aunque los estudios del IGY revelaron que el oxigeno repre.89 por ciento de agua pura). to. quizas agua es una palabra clave que describe otro por ciento de helio. Una Hnea similar de razonamiento podrfa apli. al en el centro de nuestro sistema solar. esta formula nos dice que en los oceanos. que se libera en su interior. de nuestro aire). que el nitro.I Por 10 general se cree que las referencias alquimicas al fue- racion que sostiene la vida es nitrogeno! go representan la energia que es la fuente original de todo fuego: Cuando los antiguos alquimistas identificaron al aire como el Sol. lagos.8 por ciento de ahora es posible traducir las antiquisimas referencias al fuego. los atomos elemento que se combina con eloxigeno para estabilizar el aire. Consta de punto de vista de que el aire es una palabra clave que significa aproximadamente un 71 por ciento de hidrogeno y un 27.1 hidrog<::no. son posibles debido a la energia del Sol geno es la sustancia a la que se referfan? Para nuestro proposi. . podemos asumir que las referencias antiguas al fuego. el centro del Sol (jse cree que llegan a 27 millones de grados diante la formula de todos conocida: H 2 0. dad limitada de gases y que 10 hara hasta que su dotacion se mento y en el agua de nuestro cuerpo. El agua que cubre aproximadamente dos terceras todo fuego: el hidr6geno. hay dos atomos de hi. La ciencia considera que nuestra estrella mas cer- mas sencillos. El calor que sentimos en un calido dia de verano se debe El agua que representa mas de dos terceras partes de la ante todo a las temperaturas inimaginables que se generan en superficie de nuestro planeta se describe quimicamente me. de oxigeno son mas grandes. en el firma. en la lluvia.

ahora podemos relacionar la ciencia moderna con la Cabala. antigua y mas completa de nuestros orfgenes revela respuestas nuevas y asombrosas a preguntas que no era posible contestar en el pasado! Mediante estudios como los del IGY. el Sepher Yetzi- que el aluminio no se encuentre en nuestro cuerpo en absolu. En esas tradiciones. • Un tema comlin en los relatos antiguos sobre el ori- oceanos. aun. tro elementos. el hidrogeno y el oxigeno. Si estas correlaciones son exactas. Es interesante mistico Libro Hebreo de la Creaci6n.102 El C6digo de Dios El creador del universo 103 que en ocasiones 10 absorbemos del entorno como un produc- to secundario de la industria y la contaminaci6n.' los principios de la alquimia que llevan a la creaci6n ca. tambien forman mas' del 99 por ciento de nuestro cuerpo! • Los secretos de nuestra creaci6n y nuestra capacidad A partir de estos estudios unicamente podemos llegar ala!' para transmutar las circunstancias de la vida (tender conclusion de que en realidad estamos hechos "de la tierra'~ un puente entre el cielo y la Tierra) se preservan me- (ver "Palabras diferentes. los elementos carbono nuestro mundo y nuestros cuerpos estan hechos de y nitrogeno toman el lugar del silicio y el aluminio que se los elementos: fuego. Este libro puede conseguirse en la actualidad y. Claro que existen diferencias entre el cuerpo humano y l~: tigiiedad. Toda vida viene del mas significativo es el descubrimiento de que dos de esos cua. agua y aire. De los elementos restantes. jUna nueva interpretaci6n de la descripci6n mas Figura 4. en su totalidad. entonces los relatos que se han preservado como fabulas de la alquimia y tradiciones de la Cabala empiezan a asumir un significado mas profundo. mismo significado" en la pagina 79"1 diante las tradiciones ocultas de la alquimia de la an- 80). iAlgo mucho:: vo" 0 de la "arcilla" de la Tierra.. Silicio. ahora sabemos que son relativamente pocos los elementos que forman la corteza RESUMEN DEL CAPITULO 4 externa de la Tierra. rah. ' mismo polvo. solo se encuentra en cantidades muy pequenas y por 10 del universo y a los orfgenes de la humanidad en el tanto se Ie identifica como un microelemento. to como un elemento que se presente en forma natural. 10 que incluye las capas que estan bajo los. ofrece una descripci6n detaIlada se- . aunque el • Tambien encontramos una descripci6n detallada de silicio es una parte importante de nuestra constituci6n qufmi. En nuestro cuerpo. Habiendo establecido un vinculo directo entre las descrip- ciones antiguas de nuestro cuerpo y sus equivalentes en la qui- mica moderna. hidrogeno y aluminio forman mas gen de la humanidad es que fuimos creados del "pol- del 90 por ciento de la composicion de esta capa.3: Traducciones modernas de los antiguos elementos de la creaci6n. oxigeno. encuentra en la tierra. las claves indican que corteza del planeta.

respeetivamenteo . revelando que los elementos de la alquimia. nitr6geno y oxigeno. • Nuevo descubrimiento: La ciencia moderna eonfirma los patrones antiguos. universo y nuestro mundo.104 E1 C6digo de Dios gun la eual un poder superior form6 el. fuego. aire y agua en realidad repre- sentan tres de los elementos mas abundantes en nues- tro euerpo: hidr6geno.

el origen de los alfabetos del mundo. AI mismo tiempo. todavia dependemos de los registros mas antiguos de nuestro pasado para entender quie- nes somos. Estas tl>rmas se agrupan en cuatro categorias que se describen como \ague: . registros preservados como las letras de los alfabe- tos de la antigiiedad. hemos registrado los Sllcesos de nuestras vidas mediante un metodo de escritura 0 la lombinacion de las cuatro posibles formas de escritura. En este tiempo. el uso dellenguaje escrito ha tenido un papel cada vez mas im- portante en la preservacion y transmision de datos a otros en d presente y en el futuro. y los lenguajes subsecuentes. permanece como uno de los mayores misterios sin resolver de nuestros tiempos.! En los 40. Capftu[o Cinco EL DESCUBRIMIENTO: Cuando [as [etras se convlerten en elementos E n una epoca en que el ritmo del conocimiento humano se esta duplicando cada diez aiios y la maquinaria puede reducirse al tamaiio de los atomos.000 aiios de la historia del hombre moderno.

Sin embargo. y por 10 tanto pudieron preservar datos espedficos Letras y alfabetos: para las generaciones futuras. la simple imagen de una explosion estelar en de los casos. es- que estan detds de las palabras de nuestra escritura moderna. esta pintado en un penasco de arenisca que sobresale • signos de palabras en el acantilado. lenguajes y los alfabetos que los representan. Se cree que la necesidad de registrar las extremo. las palabras formadas por las letras de la parte inferior de un acantilado del Canon Chaco en Nuevo lIll alfabeto solo son un sfmbolo del suceso 0 de la experiencia Mexico. como la hora del A traves de los sfmbolos. bras) y los silabogramas (signos silabicos) conservan un nivel que los pensamientos que estan detras de los sistemas de escri. es mediante grupos de sfmbolos que representan sonidos espe- grafta. que narran. mayor de detalle que la pictograffa de la antigiiedad. transmitir y preservar' catalizador que llevo a nuestros antepasados a crear numerosos para su uso futuro. por 10 general representan conceptos am. Imp/leitos m los slmb%s de las letras hay muchos . El metodo mas preciso para registrar informacion escrita Las formas mas sencillas de imagenes pictoricas. Este fenomeno fue visible a plena luz del • signos que representan sflabas individuales dfa en America del Norte. Es el sobre un suceso que se va a registrar. los animales y las condiciones de vida de la epo- necesidades de determinados pueblos en epocas espedficas de ca.108 EI C6digo de Dios EI descubrimiento 109 • imagenes pictoricas tro de la explosion de una supernova en el ano 1054 de nues- tra era. y sus rastros son todavfa visibles • alfabetos completos para los astronomos en 10 que se conoce como la Nebulosa del Cangrejo. 2 sofisticado al paso del tiempo. \ tas formas de escritura son capaces de preservar mayor cantidad Mas bien. Aunque el uso de alfabetos complejos es la forma de comuni. dfa. por ejemplo. ni los efectos del fenomeno dos de complejidad para representarse y ha respondido a las en la gente. como la fecha exacta en que Sfmbolos de una real1dad mas profunda ocurrio. Simplemente registra el hecho de que ocurrio una explo- la historia. que se cree es el regis. sin proporcionar el tipo de detalles que dan para producir palabras que preservan informacion de manera mayor significado al suceso que se esta registrando. En un alfabeto. la magnitud del resplandor. sin embargo. esto no implica .. sion. En el otro precisa y significativa. Aunque parece que esta pictograf{a es un registro del suceso en sf. los alfabetos permiten mencionar datos espedficol experiencias que se tienen es exclusivamente humana. Los lenguajes de logogramas (signos que significan pala- cacion que se desarrollo mas recientemente. la picto. no ofrece datos espedficos. EI sfmbolo. AI utili- tura por medio de imagenes sean menos sofisticados que los' zar un sfmbolo para representar toda una sflaba 0 palabra. Induso en el mejor Por ejemplo. dficos. son solo los sfmbolos en sf 10 que se ha vuelto mas de informacion con respecto a los sucesos que registran. los alfabetos. cada forma permite diversos gra. los sfmbolos se combinan plios de alto nivel. los astrologos chinos de ese mismo periodo documentaron el suceso a traves de un lenguaje alfabetico mas sofisticado. ilustra el concepto.

"En el Chicago Field Museum". Gracias al poder de sus letras hebreas. Detras de "jLos manuscritos estan aqui en la ciudad!" exclam61a es- critora al final de la entrevista. to. otros estratos men~s obvios. Mas temprano esa misma tarde. . las que se relacionan con los lenguajes de la antiguedad. como fechas. tras forman las palabras y oraciones que almacenan y comuni. nas se dirigian a la exhibici6n de Sue. quizas unos 15 minutos en taxi". pues la mayoria de las perso- idioma. el slgmficado mas ''Algunos''. Sucedi6 que el momento que elegi- mos para nuestra visita para ver los manuscritos coincidi6 con ron el cielo y la Tierra. patriarcas existen claves secretas sobre los mllagros que descn- ben las palabras. filas de personas ya llegaban mas alIa de la entrada. Por ejemplo. . asi como se revel6 un vinculo AI bajar del taxi en medio de un viento helado.Los eru. respondi6. dije. las palabras son estudiado las palabras de los manuscritos extensamente. E[ c6cligo ocu[to de [a [engua hebrea Junto con la incertidumbre de sus OrIgenes. A un lado de la sala .de informaci6n "~En serio?" respondi. 0 est~a­ tos de significado que esta detras de los simbolos de cualquler metros de distancia. "Con trafico. j can la informaci6n. podemos descubnr la Ia inauguraci6n de una exhibici6n de los restos mas completos fuerza del mensaje original del autor. "Quizas podriamos hacer una visita al museo".110 El C6digo de Dios El descubrimiento 111 estratos adicionales. . Cualquier estudio serio que se han encontrado de un Tiranosauro rex. donde estamos ahora?". AI acercarnos a la oficina de boletos. estan aqui para ver a Sue". estos significados. Ambas exhibiciones estaban en el mismo museo. surglO un mlS- terio mas profundo relacionado con los multiples significados En el momento que arribaba el taxi ala puerta del museo. :. ca he visto los Manuscritos del Mar Muerto! Me gustaria ver- los". al igual que un libro guia escrito en clave sobre los secretos de ''Aunque he visto los manuscritos c6pticos en Egipto y he la creaci6n. sefiale las filas de gente.. a unos dellenguaje debe tomar en cuenta los diversos niveles. A myel exterIor. yo habia tenido una entrevista con una escritora de uno de los servicios noti- guajes mas modernos de hoy. primaveral. "Pero muchos probablemente profundo de las palabras revela precisamente como se forma. se confirmaron nuestras sospechas. los simbolos ~ue llama~os letras en realidad tienen un doble prop6sito. "~Que tan lejos esta el museo de revelan relaciones sutiles dentro de las propias palabras. las le. al que se apod6 Sue. Cuando [as [etras son a[go mas que [etras: ficado. . Los eruditos en el campo de la Tora creen que en el interior Eso fue todo. cada uno con niveles mdsprofundos de signi. respondi6 ella. pregunte. . AI estudiar estas relaciones ocultas. la Tora tiene la pecu- liaridad de ser un documento hist6rico escrito a nivel externo. horas y sucesos. "~Estan aqui para ver los manuscritos?". Para quienes entienden la clave.. mas profundo entre "Adan" y "Tierra". jnun- senderos hacia significados aun mas profundos del mismo tex. En unos minutos estabamos en un taxi en de las propias letras que registran las accion~s de Dios y de l~s direccion al museo.n la ~ras~ de la Tora que dice: "Dios cre6 el cielo y la Tierra. llenando ditos reconocen abiertamente que desde los lenguaJes de la las escalinatas de cemento bafiadas con las gotas de una lluvia antiguedad y los lenguajes obsoletos del pasado hasta los len. ciosos nacionales en la cual se incluy6 una larga discusi6n so- bre los Manuscritos del Mar Muerto.

cerca del centro de la sala.na de las versiones mas antiguas del Antiguo Testa- de 10 que estaba contemplando. pude sentir que mi expectaci6n se intensificaba. un escriba desconocido habia dedica. se escribi6 Ahi. el GJdigo de Leningrado. muy posible que en nuestras interpretaciones modernas de es- pues de cierto periodo. temor reverente y misterio en la presencia raban se desvanecieron. nuscnto con las versiones modernas de la misma Biblia. El descubrimiento 113 112 El C6digo de Dios en ese momenta estaban a unos cendmetros de mi cara el principal. A traves del misterio de las letras. te el cual se ha utilizado el lenguaje y a la estabilidad de su do tiempo a registrar palabras de sabiduria que ya eran anti. sabemos con certeza que frente a el. al igual Durante mas de tres milenios. Para minimizar los efectos daninos del calor de las luces. ya no se usan en la actualidad. (era parte del antiguo Libro de Enoch) note que una! el alfabeto ha permanecido igual durante al menos los ultimos ola de calor Henaba mi cuerpo al darme cuenta de la magnitud mil anos. Aun~ue . 10 que creaba i perdido sUtllezas que s6lo podrian conocerse con el uso del un efecto misterioso. d~s. Las marcas de tinta negra que ~ento hebreo.. Esto no ocurre con el alfabeto hebreo. aunque en general las comprendamos. U. Mas aHa de un conoci- do. Cada exhibidor con uno de los delica. gracias al poder de las Caminando a 10 largo de una exhibici6n especialmente di- letras hebreas. se estaban formando grupos mas pequenos a los que olvida~o escriba habia desafiado los limites del tiempo. Es tenian cron6metros que intensificab~n y disminuian la luz des. pues porciones de la sala cambiaban de ' lenguaje. entendi ellenguaje como nunca 10 habia en- trados para controlar la cantidad de personas que iba entran. De inmediato me send atrai-' continuamente durante tres mil anos. AI entrar a la han tenido un lugar unico en el estudio de los lenguajes sagra- sala. como la mano las habia aplicado hada tanto tiempo. en un trozo maltratado de piel de animal. tendido ni 10 he vuelto a entender. cuando traducimos las palabras del antiguo docu- guas cuando el las escribi6. precisamente estas palabras hace miles de anos. iLlegamos justo a tiempo para formar parte del ultimo miento l6gico. Incluso quienes no leen hebreo dicen que tienen una sen- Durante una fracci6n de segundo los siglos que nos sepa. y quizas mas. tas l~nguas.. alfabeto. do hacia un pequeno trozo de pergamino grisaceo en un exhi. de hecho podia sentir que los simbolos formaban grupo del dial un puente entre el pasado yel presente. Aunque con el paso del tiempo han ocurrido cambios en el bidor individual. podemos confiar en que sabemos con preci- formaban cada una de las letras de proporci6n perfecta toda. saci6n de santidad. las letras del alfabeto hebreo que la emoci6n de las personas ami alrededor. se ha utilizado luz a oscuridad en forma alterna. s16n 10 que el autor trat6 de transmitir cuando se escribieron via se aferraban a la superficie del pergamino. iestaban las . significado y usa de algunas letras. Cuando se compara este ma- letras de un mensaje creado por la mana de otro ser humano . iletra por letra! Debido al periodo duran- caminara por esta tierra. en el ~no 1008 de nuestra era. . breve Instante. En'un se permitiria acceso a los manuscritos a intervalos cronome. escuche expresiones de asombro de mis companeros visi. hayamos dos fragmentos tenia un cron6metro diferente. que .otras formas de escritura antigua como los jero- tantes. los hada mas de dos milenios! Casi 200 anos antes de que JesUs textos son identicos. ghficos egipclOs y la escritura cuneiforme de los sumerios son los bulbos que iluminaban cada fragmento de los manuscritos ' miles de anos mas antiguos. mento escnto en hebreo. senada. AI estar de pie.

el texto en clave describe coJ invisibles que desafian a la ciencia actual. las vocales que for- lenguajes actuales. el diccionario ingles American Heritage El Sepher Yetzirah atribuye un poder enorme a las fuerzas i sugiere que "cualquier actividad. pues tiene resultados precisos que tos han considerado esta afirmaci6n como una metafora que:' pueden repetirse a partir de operaciones espedficas entre le- simboliza el poder de Dios como la fuente de la creaci6n. es gematria revela las relaciones ocultas y los niveles de significa. 6 Como los textos hebreos de la antigiie- vimos en el capitulo anterior. No se escri- particular es en si un misterio. quizas ninguno de . dad son la Fuente de los conceptos clave que se presentan en mentos quimicos y el lenguaje maS antiguo que se conoce y. las correlaci<. el ambito de este libro. y yeS de la correspondencia entre las letras y los numeros. como los campos precisi6n c6mo y por quien fue creada nuestra especie. ofrecen una perspec-' pectiva de las palabras hebreas. con el bn de asignar a cada palabra el significado apro- simplemente leer las palabras en S1.mes entre los ele~. cada letra de cada alfabeto siempre tiene u. vale la pena hacer notar que incluso el En epocas mas recientes. Tal vez al final descubriremos tiva poderosa de esta afirmaci6n. Entre las multiples formas en que podemos definir a la guo hebreo. tiene un significado mas ricos ocultos en cada letra de sus alfabetos. y contiene una inrrodujeron a su forma escrita utilizando PUlltOS y simbolos .' man las palabras que pueden pronunciarse se implicaban en la vinculo con un valor numtrico muy especfjico. y afirma que a partir de la forma de las. 3 Desde el punto de vista de la historia. los erudi-: derarse una ciencia antigua. la al mismo tiempo una ciencia. lltit conocer el contexto de 10 que se escribi6 antes de traducir- do mas profundos que normalmente se pasarian por alto aI 10. ampliamente aceptada. y tal vez de los origenes de la. Como. morfogenicos y los efectos cuanticos. el estudio de la gematria puede consi- se formaria". El estudio de es-' forma en que se usaban las palabras.~ profundo debido a las claves relacionadas con los alfabetos de estos sistemas numericos se haya documentado tan extensa. exploraremos la ciencia de la gematria desde la pers- que se ha utilizado mas continuamente. tras. Hist6ricamente. frases 'f palabras.114 El C6digo de Dios El descubrirniento 115 de estas letras. 7 La ciencia de las letras como numeros Breve intToducci6n al alfabeto hebreo Aunque la raz6n original del significado oculto de una letra en Ellenguaje hebreo es un lenguaje de consonantes. Debido a esta peculiaridad. fusi6n de influencias griegas y latinas. disciplina 0 estudio metodo- del alfabeto hebreo. este libro. A tra. "ciencia" hoy en dia. Tomando en cuenta esta definici6n letras en si Dios "describi6 todo 10 que se form6 y todo 10 que... que estas rdaciones resuelven el misterio de las fuerzas sutiles e vida misma. Aunque este terna rebasa piado. ci6n de pasajes de la Biblia escritos en el hebreo sea un arte. donde se deriva.. a partir de las inscripciones mas be como se pronuncia y por 10 general las vocales se omiten antiguas de la escritura cuneiforme de los sumerios hasta 101 Jel texto por completo. 16gico"5 es una ciencia. 10 que hace que la traduc- tas relaciones se conoce hist6ricamente como gematria. Aunque muchos idiomas tiene~ valores nume-. las vocales del alfabeto hebreo se alfabeto ingles que es relativamente reciente. 4 mente ni se haya aplicado con tanta frecuencia como el anti. En su totalidad.

ellugar que conocemos como el cie- como "Gran Alef"). se usan en la ac. con el numero 2 y as£ } sucesivamente.palabra. ofrece una comprensi6n sin precedente y quizas un con- suelo que nos es muy necesario en relaci6n con el misterio La mejor forma de ilustrar la profundidad de los significados entre el cido. se da allenguaje el poder de un significado externo obvio y el de un significado interno oculto. Sin embargo. be sin las vocales como N. guiente anilisis tornado de la obra de uno de los eruditos he- breos mas reconocidos de nuestro tiempo. .. gieren que el alma que esta en el interior de cada uno de noso- 100 hasta lIegar al 1000. el valor numerico "oculto" que se relaciona con cada letra. que se representa con una versi6ni tras sigue . se relaciona con el . hasta lIegar a la letra Yod (~) y al numero 10. Kaf('~) tiene el valor numerico de 20. como las palabras La palabra hebrea para alma es "NeShaMaH". Asi. ---~-------. conocidos como puntos vocdlicos. y a cada letra se Ie asigna un sonido y un numero en particular. Lamed (~) el valor!i numerico de 30. La primera letra del alfabeto. la Tierra y el alma humana. Bet (~). No obstante.1: Letras primarias del conjunto de letras hebreas que muestran rio continua con multiplos de 100. Por tradici6n. el Rabino Benjamin El significado oculto del alma y del cielo Blech. Yla siguientei letra. (ii).. en tradiciones mas antiguas de la Cabala. A partir de alii. Jh. la segunda letra. El si- se relacionan con elIas hist6ricamente.~ tualidad para garantizar la pronunciaci6n correcta y por 10 tanto el significado adecuado de cada letra y palabra. que se escri- hebreas para alma y cielo. Este conjunto adicional de letras es de 10. La Figura 5. ------"" 116 El C6digo de Dios El descubrimiento 117 que se ponen debajo de ciertas letras en una . Alef(N).1 ilustra las letras del directo que existe entre las palabras como valores numericos. Y termina con la letra Tau. y su relaci6n con la vida y la muerte. el alfabeto hebreo prima- Figura 5.iviendo despues de la muerte. alfabeto hebreo primario y los valores numericos ocultos que se descubre esta relaci6n en forma espedfica y grifica. e1 Casi a mvel universal.8 ocultos de las palabras es usar un ejemplo. tos religiosos yespirituales. esta relaci6n s6lo se implica a traves de escri- especial importancia cuando se explora el significado mas pro. nuestras creencias mas preciadas su- alfabeto se extiende aun mas con incrementos adicionales de . al revelarse el vinculo fundo de los textos hebreos. ~') yal numero 100. y asi sucesivamente hasta lIegar a la letra KUf. cuando regresa a los mas grande de la primera letra del alfabeto. Despues la secuencia continua en mUltiplos d~ 10. que tiene el valor de 400. My H Al asignarles los d>digos . Estos simbolos. El alfabeto hebreo primario consta de 22letras.: numero 1. Alef (conocida ' reinos que son su origen.

y la Tierra. segun la ge- La suma de estos valores individuales produce un nuevQ matria. al polvo de la tierra. Para comprender con precision como d:' reino de los cielos se relaciona con el 395 del alma. mientras que nuestras almas y el cielo ya mos una relacion directa y tal vez sorprendente entre las dos son uno. "Dios creo el cielo y la Tierra" como 50 + 300 + 40 + 5 = 395 dos ambitos de experiencia distintos pero relacionados. Sin tomar en cuenta el significado 10 siguiente: que una cultura 0 sociedad les haya asignado. . Los numeros: e[ lenguaje de la creaci6n jexactamente el mismo valor numlrico que tiene la palabra alma! Una de las reglas de la ciencia de la gematria es que dos En su historica obra. Y al final de nuestra 300 40 10 40 vida. la relacion nu- merica va directamente al verdadero significado que esta de- N Sh M H eras de las letras.. AI sumar los numeros de la palabra cielo tenemos 395. jMas aHa de una obvia similitud casual. el cielo y la Tierra que se han unido en nuestro cuerpo. sus valores numericos son identicos! Por 10 tanto. "9 consonantes. y este numero no~< dos ambitos. y terrenales. un matrimonio entre el cielo (el espfritu 0 alma) permite explorar una relacion que no es obvia en la forma al. 5 regresan a sus respectivas moradas.. 395 es "alma". las cualidades de ambos ambi- H Sh M Y M tos se mezclan en una sola existencia. Los textos describen a la humanidad como un puente entre estos En terminos numericos. Tal relacion se demuestra claramente con las 50 300 40 5 palabras alma y cielo. aplicamos. fabetica de las palabras. El codigo numerico Qculto .118 El C6digo de Dios El descubrimiento 119 numericos que se presentaron en la seccion anterior. Yo [Dios} creare En hebreo. Nuestros cuerpos regresan AI representar cada letra con su valor numerico. Esta perspectiva de la vida y la rnuerte ofrece un sen- palabras: tido tangible de por que la experiencia de la muerte no signifi- ca el final de nuestra existencia... ''La humanidad une en sf las cualidades celestiales el mismo proceso a los valores numericos de la palabra cielo. 5 + 300 + 40 + 10 + 40 = 395 nos 10 asegura.. la palabra se escribe asf: ' A 10 largo de nuestra vida. descubri-. el filosofo griego Platon decla- palabras relacionadas numericamence tambien se relacionan ro que la realidad de nuestro mundo s610 puede conocerse . valor combinado de 395. Como sugieren muchas descripciones religiosas tradicio- nales denuestros origenes. tenemos "' en cuanto a su naturaleza. Republica. el cielo y el alma son 10 mismo. cielo se escribe Ha-ShaMaYiM. Solo con l~i al hombre para que sea fa union de ambas.

Se dice do describimos nuestro mundo a traves dellenguaje. lias que se basan en lenguajes de diferentes epocas que describen informacion esta codificada en los libros relativamente breves cxactamente los mismos sucesos? de la Tora no sea muy clara. exista una relacion oculta entre los ori- de nuestro pasado. La importancia de los numeros en el 9.. Hoy en dia. ahora podemos comprender como la Tora en su totalidad puede verse como una vasta colecci6 llunca antes nuestra relacion con el mundo y nuestra relacion de numeros. como el Genio de Vilna. se considera- te. I. cilcontrado un poderoso vinculo entre las letras de las palabras primera palabra hasta la ultima". se entrego en la forma tradicional dellenguaje El poder de comparar como una serie ininterrumpida de 304.. tambien describio esta importantisima relacion ent Il'llccion de toda una seccion de un manuscrito cuya creacion los numeros y el mundo de manera simple y concisa: "To posiblemente requirio meses.805 caracteres. un intento pot AI reconocer este vinculo directo entre las letras de la Tora describir la vida a traves del lenguaje es. se nos revelaron como una serie ininterrum. implica tambien una enorme responsabilidad.. Un error de esta categoria podria causar la des- Platon. tanto los cientificos como los hist': III II tua... Platon sugiere que cuan lexto. 10 que si es claro es que los erudi. podria alte- ra de hacerlo es usando numeros: "Los geometras utili ..120 El C6digo de Dios El descubrimiento 121 verdaderamente a traves de nuestra experiencia. hcbreas y las ideas que transmiten las palabras."IO Pitcigoras. solo se pasaron a las esta dispuesto de acuerdo a numeros. la man'~ que si un escriba comete un error en una palabra. riadores creen que cuando la Tora se revelo por primera vez ' la humanidad. es. y se' A traves de la ciencia del lenguaje y de los numeros."II gcneraciones futuras copias exactas de "£1 Libro" (la Tora). La clave para tender un puente entre la ciencia y la espiri- tos encuentran en sus paginas un significado que va mucho lualidad.lr de manera irrevocable el curso de la historia humana por formas visibles y hablan de elias. que el abismo que se cree existe entre las explicaciones religio- nuestros origenes.IS y cientificas sobre la vida y el Principio sean s610 diferen- pida de numeros! Aunque tal vez fa forma precisa en que esta. 12 £1 erudito del siglo XVIII conocid . l cr el mundo. cuyo trabajo anterior tuvo gran influencia e ~ h. ~Seria posible Se dice que en este codigo numerico se nos dio el mensa' qlIe de manera similar. la paz . Por tanto. Sin embargo. Lo que buscan en realida 'icmpre. hemos hasta el fin de los tiempos esta incluido en la Tora.. . Debido ala responsabilidad de conservar esa precision. A cada letra del idioma se Ie asigna un valor unie ("scritos en clave en sus letras. una abstraccion.\ intolerable. 0 cualquier forma aparentemente distinta de cono- mas alia del mensaje obvio de la palabra escrita. al igual que las claves para nuestro futur~. jentonces I ll'1lguaje contemporaneo de la ciencia actual? ~Seria posible misterios mas profundos relacionados con la curacion. la tarea ya de por si ardua de transcribir el casos. genes de la vida que se describen en los textos hebreos y el Si esta descripcion original de la Tora es correcta.1fabeto hebreo Gracias a la fiabilidad de los textos hebreos y a los secretos innegable. desdel. es ver aquelias realidades que solo se pueden ver en la men ("I error de una sola letra al transcribir los textos. en el mejor de 10 \' 11 uestro mundo. sin pr 'I "manzanas con manzanas/l nunciacion ni vocales. es que todos los puntos de vista deben traducirse . declaro: "Todo 10 que era.

Es obvio se conoce como La Tabla Periodica de los Elementos. Esta tabla facil comparar las dos cifras y responder la pregunta. contribuyo al desarrollo del oeste americano du. y vamos a considerarla el comun denominador que atmosfera. mas estables. leer el mensaje antiguo que aparece codificado como el ADN tualidad. Al distribuir tre los lenguajes de la espiritualidad y de la ciencia dada un1 y organizar estas caracteristicas. Nuevo Mexico y a medida que vemos los relatos mas antiguos de la creacion a Colorado. hasta los densos minerales que forman la Tierra. vinculo comlin que una estos dos mundos. 1a matena . mi estudio a 10 largo de doce afios revela que solo vinculo. Estas cualidades expresa- tiguas y mas profundamente reverenciadas. Hacerlo. mente Tabla PeriOdica (ver el Apendice B). 14 Para 1os propositos de imaginar en el mundo fisico se ha reducido a aproximadamente este libro. son tan escasos que solo apare- teo Por ejemplo" si preguntaramos: "~Que es mas largo. referencias esotericas sobre el Principio asumen un nuevo sig- dubnium (que originalmente se llam6 Nielsbohrium. creamos un comun denominador que nos permite Cada uno de los 118 elementos se dasifica seglin caracte- comparar " manzanas . nos permite tender un puente entre las letras hebreas y los elemen- muchos de los elementos tienen nombres familiares. Entre las muchas posibles caractedsticas que describen cada oculto que estd detrds dellenguaje hebreo ofrece precisamente ese elemento. Antes. los cientificos determinan don- nuevo significado a algunas de nue~tras tradiciones mas an. Otros elementos. la idea de la El descubrimiento: del alfabeto a los elementos "masa" es un concepto simple que nos dice con que facilidad A finales del siglo XX. craves de la lente de estos terminos modernos. uno destaca como un puente entre los cuatro elementos de la vida y el alfabeto hebreo: la cualidad conocida como masa atO- mica. AI transformar la medida de una milla a 5280 pies. Esta dave nos permite sideran los mundos incompatibles de la ciencia y la espiri. La dave para descubrir ese puente es encontrar un .' de "encaja" cada elemento en la tabla. ambas medidas deben convertirse a uni. dsticas que 10 distinguen de otros. encontrar un comlin denominador en-. es ben con nlimeros.. y se presentan mediante una tabla. en el Capitulo 4. y sigue creciendo a De manera similar. descubrimos que . que se 1e mueva. como el elemento 105. tos qulmicos de la creacion. va. Algo emocionante y maravilloso empieza a desenvolverse Por ejemplo. la fiebre de oro en California. Desde los gases invisibles que forman nuestra como masa. de nuestras celulas. la composicion de codo 10 que se podria permlte.122 El C6digo de Dios El descubrimiento 123 al mismo lenguaje antes de poderlos comparar razonablemen. las rante el siglo XIX. medida que se descubren elementos adicionales. y se Ie nificado profundo. y han te. El codigo numeriCa. una cen en condiciones de laboratorio y existen unos cuantos se- milla 0 7920 pies?". ofreceda das numericamente son el vinculo entre los elementos y nuestro el puente que tanto se ha buscado entre 10 que muchos con. 15 nido papeles importantes en la historia de nuestro mundo. propiedades que se descri- ranjas". vamos a referirnos a la masa atomica simplemente 118 elementos. con manzanas» « y no manzanas con na. 13 Aunque su nombre parece muy tecnico. 0 simple- que 7920 pies es mas que una milIa. AI hacerlo. gundos antes de desintegrarse para formar parte de materiales dades del mismo tipo para hacer una comparacion significati. De pronto. cambio en nombre en 1997).' ADN con las letras del alfabeto hebreo.

L't espacio de su creaci6n. se seleccionaron tres le- simplificar los numeros a un solo digito. estas letras se que la masa simple del nitr6geno.2: El valor de la "masa" nos da otra forma de pensar en los anti- entra en acci6n. el aire y el agua.16 valor se calcula como "6" (l + 5 = 6). da del punto decimal al numero de masa tornado de la Tabla<. Establece un comun deno-' .la creaci6n: elf fuego.. AI aplicar los mismos procesos que nos mos". el. · PenG lca.007. Siguiendo los principios de la gematria -que nos permiteri: de las cuales se form6 todo 10 demas. 15. Este valor es 10 que llega a ser traron el significado oculto que comparten las palabras "alma"':i (. Aqui es donde el comun denominador de la mas~.99.{ . encontramos que la t ras y se les dio un lugar de honor y respeto que no se compara masa del hidr6geno. al aire y al agua:! el hidr6geno.( convertirian en el fundamento del nombre de Dios: el mismo se pueden encontrar sumando los numeros enteros ala izquier-· llombre con el que se conoceria a Dios en la Tierra. eran en realidad descripciones de los ele"" i mentos quimicos que hacen posible al fuego. Para el oxigeno.1em Shin] vierte en la masa simple de "5" (l + 4 =: 5). La Figura 5.00 y la del oxigeno. el valor del nitr6geno..' con el de ninguna otra letra del alfabeto.2 resume: estos valores. revelaremos el vinculo entre el hidr6geno.. M.. El mismo proceso revelaJ: "materia" con la que esta hecho nuestro mundo. !'il-. Para revelar el secreto:: que contienen estos tres elementos en la literatura antigua. Esta f6rmula nos presenta una forma nueva para Al combinar las tres Letras Madres. 1. A. Como las letras en si ya se habian minador que nos permite buscar correspondencias para los revelado en el texto externo.J comun denominador que une los conceptos antiguos con los elemen- y "cielo". Sh fucron crcadas primcro. el nitr6geno yel oxigeno. Ademas de ser 1a ya esta representada por el numero 1. < debemos ahora determinar que letras del alfabeto hebreo re~i\ presentan. 14.1~tlOS elementos de "Fuego".rura 5. no necesita simplificaci6n. Dios "sell6" y defini6 pensar en el fuego. .. el aire y agua..124 El C6digo de Dios El descubrirniento 125 las referencias a los elementos alquimicos de. puef. el Sepher Yetzirah declara que. despues de la formaci6n de las 22 letras de la creaci6n a partir las tres letras Madrcs. .. y las puso en su gran nombre. [en eI misterio de las tres madres Alif J. ''Aile'' y ''Agua''. el nitr6ge-4 t ( )S modernos. la respuesta a nuestra pregunta valores numericos ocultos de las letras hebreas. Podriamos expresar esta pregunta en la forma familiar de una prueba de l6gica: El secrete de las Tres Madres Si Como dijimos en el Capitulo 4. "14" se con. sobre el significado oculto ahora se vuelve un asunto de co- rrespondencias. no y el oxigeno y el alfabeto. ' d · 1 : "Eligio tres letras de entre las elementales De manera espedfica.

Hey Y lIav vienen de sus contrapartes Ale[. se hicieron pedazos. se dio nuevo significado a las Y de tOS 1 Padres. se hace una distincion entre la creacion dd ta sobre como las tres Letras Madres de los relatos hebreos Universo de Orden y el universo anterioral nuestro. rnoderna. 18 El signifi. que toda un lin acto conocido como la Rotura de los Recipientes. H. la existencia de un uni- si estas letras son en realidad la "Madre" de la creacion. tenemos la informacion necesaria para responder a la pregun- En la Cabala."17 letras hebreas del Caos. 0 el Orden. y nuestro misterio empieza a tener sentido. V! dici6n. Sh deben convertirse et: Y. para los estudiosos de la Cabala. Debido a esta con- jA. La relaeion que permite la evolueion de A M Sh hacia Y H V A causa de esta condicion. Yod. las letras Ale[. que exisdan antes de los diez Sefirot no podian inte- ractuar. fueron reconstruidos como recipientes nuevos que podfan "Las Tres Madres. 0 reci- entonces pientes. M. El "gran secreto mistico" del Sepher Yetzirah es que las La respuesta a nuestro misterio podria expresarse en un' letras del nombre de Dios (YHV) y las Letras Madres del Uni- solo enunciado: Los eruditos de la Cabala afirman que las trq verso del Caos (AMSh) son iguales. den" como el Universo del Caos. el agua y elfUego. Aunque los flsicos modernos luchan con el dile. y V son las letras del nombre de Dios (YHVH) . 10 que es considera tan sagrada en las tradiciones antiguas. el Uni- Y de elias emanaron el aire. tres Letras Madres (AMSh) y corresponden a elIas. Mem y Shin y ahi fue donde se explicaron por primera vez. En este mundo sin orden. un gran dar y recibir. no obstante. sabre la creacion se comparan con los elementos de la ciencia so del Caos. I. el Univer. que forman el Arbol de la Vida para nuestro mundo.. ahora volumenes. H. Ale[Mem Shin. l cado que respalda a esta respuesta. podria lIenar respectivamente. los elementos. no podian dar ni recibir.126 El C6digo de Dios El descubrimiento 127 y lila de que algo existiera antes del momento de la gran explo- \ion. rnisma de la vida. eran incapaces de sostener la luz que Dios daba. En otras palabras. . Y de elias nacieron los Padres En el Universo del Orden. . Teniendo en cuenta estas relaciones. sus uescen J d'tentes. 0 Tohu. 10 que hada imposible que experimentaran la esencia mediante un proceso que no es visible externamente. verso anterior al tiempo es un hecho que incluso se necesita para comprender las ensefianzas. y La Cabala describe este "tiempo antes del tiempo y el or- si Y. y su experiencia era incompleta. Estos recipientes llegaron a ser los diez Sefirot secreta mistico cubierto y sellado con seis anillos.a que se manifiesta en diferentes ambitos. IJerso de La Rectificacion. Como por- seccion del Sepher Yetzirah describe el secreto de ese vinculo. Representan la misma fuer- letras del nombre de Dios (YHV) de hecho se derivan de las. Mem y Shin. (jones de estos recipientes rotos cayeron en los reinos espiri- ruales. En el Caos nacieron y la fuente de toda creacion.

El fuego. jMas alla de la teoria y la metafora. sino que la relaci6n es tan precisa que no pue' " en un periodo aun mas antiguo. el y. el aire y el agua son los equivalentes antiguos de . 5 y 6. como letras hebreas. ahora com- iUn analisis del c6digo numerico oculto de las letras he. Esta 3. . nitr6geno y oxigeno) y las letras relacionada con el origen del cuarto elemento de la vida. nitr6geno y oxigeno tiene!}. En ellenguaje de su tiempo.3: Los antiguos elementos de la alquimia. E1 C6digo de Dios El descubrimiento 129 128 Letras Madres en el En el alfabeto hebreo. respectivamente. y solo tres. Hidr6geno. es posible vincular directamente las antiguas letras del 2. nuestras correlacio- nes proporcionan un lenguaje que nos permite traducir las des- cripciones mas antiguas de la creaci6n con un grado de precisi6n Figura 5./ prendemos el hecho de que los eruditos anteriores ala Biblia J breas nos revela que no s6lo existe una relaci6n entre las letra . 5 y"6. . para las generaciones que ellos sabian habdan de venir despues de ellos. hay exactamente tres letras.19 Sh A traves de estas sencillas relaciones de la naturaleza "entre Repasando 10 que sabemos: una manzana y otra". (ver la Figura 5.Ii de n e g a r s e ! ' preservaron la sabiduda relacionada con estos conocimientos de la misma manera en que nosotros 10 hacemos hoy en dia en nuestros libros. y sus equivalentes que nunca antes habia sido posible. esos secretos se recono- cen ahora como los detalles (las combinaciones reales de elemen- tos que hoy en dia se reconocen y verifican en la ciencia) que son responsabIes del proceso de la creaci6n y de la vida misma! Ademas de dar credibilidad a estos relatos. ' la tabla. podemos ahora reemplazar los elemen- tos del ADN humano con los elementos correspondientes del 1. Si como sugieren los textos. H y V se transforma V en los numeros 1. todo se creo a partir de tl'Ol'mos YIIVII). nitr6geno y oxigeno. alfabeto hebreo con los elementos de la ciencia moderna.3). H y V que forman el nombre antiguo de Dios (la JJ Sl' lisa tll)S wet's y carbono. muestran que existe un vinculo directo entre los La parte final de nuestro misterio es responder la pregunta cuatro elementos de la vida (hidr6geno. respectivament i relaci6n concreta que es posible verificar nos dice mucho so- los valores numericos de 1. Con s610 ver como corresponden las cifras de hidr6geno. A partir de documentos como el Sepher Yetzirah. Se ha descubierto A M H que el valor oculto de las letras hebreas Y.( alfabeto hebreo. El puente entre las letras y los elementos son los numeros~. bre los conocimientos de nuestros antepasados. Letras Madres en el MundQ del Caos Mundo del Orden cuyos codigos numericos ocultos corresponden exactamente a la masa y simple de los antiguos elementos de la creacion. registraran sus conocimientos sobre los secretos de la creaci6n y los elementos.

ademas de los tr elementos entre si para crear el cuarto elemento. aliento (aire) y agua (hidrogen' Yod Hey Vav nitrogeno y oxigeno) son responsables de toda la creacion q . ent~nces. Como el texto nos jnforma que solo estos tres elementos estaban disponibles para Dios en este momento de la crea- cion. el aire y eI agua. Despues.crev /. a menudo descrita Finalmente. la navaja de Occam mr- para todos excepto para unos cuantos iniciados en el mister': rna que en un mundo ideal. multiplicar. 10 que se conoce como la el cuarto elemento "oculto" siempre estaba implicito. bloques del fuego. se nos dan opciones analiticas muy claras: Debemos su- Soluci6n al misterio del cuarto elemento mar. Para crear miliar de reducir los numeros de dos digitos a un solo dfgito. Combinando estos valores con el mas sencillo de los procesos matematicos.1 su morada. que era tan familiar. Hey y Yay. 5 y 6. el acto de la creacion en S1. M y Sh que se convirtieron en Y. los elementos de fuego. Era . final- un proceso que aun no se ha revelado. . usamos este valor para buscar en la Tabla Periodi- como el "matrimonio" del fuego. Ahora el "12" representa el valor del cuarto elemento. aunque la porcion del codigo relacionado con la Tier nudo limita mejor las posibilidades que el metodo de "intento se revelaba directamente. mediante. la clave de este misterio se revelaba a traves del tex vamos a identificar al cuarto elemento. Para los estudiosos del Seph . se nos dice que la morada del Creador se formo utilizan el numero 12. clave para comprender nuestra relacion con el mundo y. el 3. dos. sllmamos ell + 2 del 12 para producir un nuevo valor. la suma. la Tierra. Cuando estas opciones se presentan. solo esas tres sustancias. A partir de las tres letras que Dios uso para "crear su Uni- "Con estos tres (aliento. Eso se aplica a las posibilidades que poddan lle- Yetzirah. su origen exacto permanecio ocul y error". Ilega a ser la ca nuestro e1emento misterioso. nos quedan sus valores numericos de E't. se produce un nuevo numero Con una simplicidad que es elocuente al igual que pro con propiedades muy distintas a las de los numeros originales: da. 1. vida tambien debe venir de estas Letras Madres. navaja de Occam21 es una manera de elegir cual opcion tiene sustancia de la Tierra. el mundo y nuestr cuerpos. Esto confirma que solos 0 combin . Esta union. la La clave para resolver el misterio del cuarto elemento e "Tierra".. fuego y agua) verso". pues una simple suma en si: revela el valor que resuelve nuestro misterio. A me- recientes. dividir 0 restar los valores numericos de esos A 10 largo de la historia de la alquimia. ser la mejor. Yod. Expresado en forma breve. la solucion mas sencilla tiende a de los secretos de la creacion. el cuarto elemento de l~ mente.20 . siguiendo el proceso que ya nos es tan fa- que tenia que brotar de elementos que ya exisdan. ractuar de una u otra forma. los tres elementos existentes tenian que into. H y V.130 E1 C6digo de Dios E1 descubrimiento 131 A.. el aire y el agua que ya se han mencionad Ir. nuevo elemento. En tradiciones m mas posibilidades de damos las respuestas mas claras. 1 + 5 + 6 = 12 se convierte en la morada del Creador.

5 y 6).4). Como se nos dice que Dios solo tenia fuego. nitro .. H y (1. jnuestros cuerpos no existirfan! Cuando los antiguos registraron el hecho de que estarn hechos de fuego. los qufmicas.' l- to de la vida que nos da solidez.' analisis de materiales y las matematicas de las ecuacion . oxfgeno y carbono.humano limitil. . precisamente 10 que descubriola cien cia del siglo XX. pero elocuente. e1 nueV' 1'1 cuarta letra. Gimel (). describiendo los bloques con que estan cons. microscopios de alto poder. ai y agua para trabajar. debemos aho- rei de inmediato nuestra busqueda a unas cuantas posibilida:'to ra preguntar: ~Que mas dejaron nuestros ancestros que tal vez des.132 El C6digo de Dios El descubrimiento 133 Una breve mirada a la qufmica del cuerpo . S6lo una letra del alfabeto hebreo tie- El valor de la masa del carbono es 12..00. En una epoca anterior al desarrollo de equi sofisticado para realizar pruebas. yes la "Tierra" en la alquimia de la antigiie- posibles elementos que corresponde exactamente con el3 q dad. solo 4 d no hayamos sido capaces de reconocer? En la respuesta a esta ellos representan mas del 99 por ciento del cuerpo humano: pregunta adquiere importancia la ultima porci6n de nuestra hidrogeno. 22 El carbon i. Gimel es el "carbono" en las dencia que el 3 del carbono sea d unico valor entre los II' escrituras hebreas. Quiz~s no es una coin •• Desde la perspectiva numerica. los elementos modernos y 1:1. Sin la presencia de este cuart elemento fisico. tabla. perado. se produjo al combinar las letras del nombre de Dios: Y. esto tiene much mas sentido. en ellenguaje de su ep estaban diciendo que estamos hechos de hidrogeno. agua. y se tradueen a las letras hebreas YHVG en eada eellila truidas todas las celulas humanas.scula. el nitr6geno el oxfgeno y el carbono. la sustancia del carbono es el unico eleme . Aplicando el pr ne el mismo valor numerico que la masa simple del carbono: ceso estandar de simplificar los valores como 1 + 2. (Ver la Figura 5. Desde la perspectiva del Sepher Yetzirah. que ahora se reconocen como gases i coloros e inodoros. no. valor (masa simple) del carbono es 3.'rpo. Figura 5. se produce un resultado ines- das" como un puente entre la alquimia y la qufmica. que se representa con la G mayu. De modo que podemos agilizar nuestra busqueda ex. letras del alfabeto hebreo a su eomun denominador numerieo. dt' nuestro ClIt.1 dt'rtlos del ADN. De los 118 elementos cuya existencia se conoce.4: Al redueir los elementos antiguos. nuestros antepasados revelaron la composici6n elt'mentos alquimieos de la ereaei6n se eonvierten en los elementos mo- nuestros cuerpos. ~Cual es el equivalente del carbono en ellenguaje de las es el unico elemento de este grupo que no se ha tornado e letras hebreas? cuenta.r:' Con la revelaci6n de informaci6n tan precisa. Siguiendo los procedimientos que hemos aplicado en la minando las propiedades del carbono para ver si "son adecu' Liitima secci6n de este capitulo. aire y tierra.

En otras palabras.~ nombre de Dios. YHVG.. y conjuntos de simbolos como alfabetos completos. sigue existiendo un mis- creaci6n. el vinculo entre Aunque ahora tenemos toda la informaci6n necesaria para los elementos modernos y el alfabeto plantea nuevas preguntasi. no obstante. Al mismo tiempo. representan palabras. Estos codigos "ocultos" representan un sig- cuatro letras que tenga significado. signos que representan silabas esten sus letras. las letras de muchos alfabetos partir de esta informaci6n. dt: "manzanas con manzanas.00042 • Algunos de los relatos mas antiguos y completos so- por ciento (1/224 x 100) de que las letras YHVG se configura. A.! precisos. un lenguaje que ha cam- . Como se mencion6 en el Capitulo 5. inada menos que 1 en 234. hay un total de 22\ . . con el alfabeto hebreo.! tras. I RESUMEN DEL CAPITULO 5 letras en el alfabeto hebreo estandar. el o en una combinaci6n de eIlas: imagenes. existe una leve posibilidad de . Estas probabilidades se ex.) . y solo estas cuatro le- de las antiguas letras hebreas. sugieren elocuentemente que algo numerico que nos permite hacer una comparaci6n mas que la "casualidad" y la "coincidencia" es responsable de ese codigo. Esta porci6n espedfica del mensaje de nues'". consta de 4 de las 22 letras posibles. cuando se combinan con con la ciencia moderna es un comun denominador la traducci6n del mensaje. una secuencia de .~ dica que forman el ADN humano! nuestro cuerpo. breo extendido de 28 letras! Aunque estas no son necesaria- • La clave que une los relatos antiguos de la creaci6n mente probabilidades astron6micas.134 El C6digo de Dios El descubrimiento 135 Este paso final para comprender el significado mas profundo': do consideramos que estas cuatro letras. podemos calcular las probabilida-~ estaban tambien relacionadas con valores numericos des de formar al azar. jEsa probabilidad se reduce aun mas a antiguo lenguaje hebreo. ~Por que son tan importantes estas correlaciones? ~Que rerio. equivalen a los unicos cuatro elementos de la Tabla Peri6- mera clave para resolver el misterio del nombre de Dios en'.' nificado mas profundo que esta detds del mensaje presarian como 22 4.256! que transmiten las palabras en s1. ~Precisamente que significa el mensaje? Para resolver ese nos dice el descubrimiento de un mensaje antiguo en nuestro' misterio. • En su forma original. debemos profundizar en la controversia del antiguo mundo moderno? Podemos empezar a contestar estas pregun-:. jEstas probabilidades se amplifican aun mas cuan. bre los origenes de la humanidad estan escritos en el ran asi por casualidad. nos permite ah~ra crear una pri-. tras celulas. este mensaje ocurriera simplemente por casualidad. signos que mensaje que esta en nuestras celulas depende del orden en que. leer el c6digo quimico en el interior de cada celula de nuestro sobre los secretos que nos han dejado los relatos antiguos de la cuerpo como el texto de un mensaje. y la forma en que se revela en las celulas de la tas examinando que tan grandes son las posibilidades de que vida.000 16 por ciento cuando tomamos en cuenta el alfabeto he- biado muy poco en los ultimos dos mil anos. Asi como la" den clasificarse en una de cuatro formas de simbolos oraci6n depende del orden de las palabras que la componen. Estas letras representan et campo de posibilidades a partir del cual podemos unir letras: • Casi todas las formas de comunicaci6n escrita pue- para crear palabras con significado en el idioma.

ahora podemos reemplazarlos col?.256.00042 por ciento.136 El C6digo de Dios • Nuevo descubrimiento: de las 17 caracterfsticas que definen a la Tabla Periodica de los Elementos. 0 sim- piemente la masa. s6lo una corresponde con precisi6n a los valores numericos ocultos dellenguaje hebreo: la masa atomica. • Nuevo descubrimiento: AI determinar la masa simple de los elementos del ADN (hidr6geno. 10 que revela que nuestro ADN puede leerse literalmente como un al- fabeto que puede traducirse y que esta presente en el interior de cada una de nuestra5 celulas. es decir. . se descubre que la "Tierra" es tambien el cuarto elemento de la vida: el carbono. Las proba- bilidades de que estas cuatro letras ocurrieran al azar para crear un mensaje significativo con letras hebreas son 5610 de 1 en 234. Hey. nitr6geno oxf- geno y carbono) al interior de nuestro cuerpo. Vav y Gimel. una minima pro- babilidad del .cuatro letras del alfabe- to hebreo: Yod. • AI resolver el misterio del cuarto elemento de la al- quimia y la Cabala.

orar. AI tratar de entender. yal mismo tiempo nos pre- guntamos c6mo el mismo poder podrfa ser la Fuente de am- bos. Si existe un solo Dios. se nos presentan muchas y variadas descripciones de lanaturaleza del ( :reador. yen ocasiones incluso complacer. renunciar a todo. e incluso matar ell llombre de una presencia que es tan misteriosa que quisie- (amos tener sefiales que validcn su existencia? . a lIll Dios que identificamos mediante los fragmentos desgasta- dos por el tiempo de nuestras tradiciones mas queridas. ~por que existen tantas ideas \obre su naturaleza? ~C6mo podemos justificar el hecho de lkdicar nuestra vida. celebramos nuestros mas hermosos sueiios y lamen- lamos nuestras mayores tragedias. Capltulo Seis EL CODIGO DENTRO DEL CODIGO: En cada ce[u [a de toda vidal esta e[ nombre de Dios E n presencia de quienes aceptan la idea de un solo Crea- dor.

por ejemplo. y Shiva. 4 para conocer a Dios en su totalidad. el poder de la creacion se expresa como tres facetas dei la misma fuerza: Brahma. Cada aspecto trabaja en armonla con los otros dos para perpetuar el cicio de la vida y la muerte y garan- tizar la continuidad del cosmos. el Sefirot de Keter. indlgenas y orientales.2 En su erudita interpretacion de los textos hebreos de 1 con un nombre especifico que indica un atributo de la natura- la antigiiedad. el Dios Viviente. el Dios EL QUE SOY). 10. el creador. el destructor. 5610 10 conocen a traves de sus milagros que se manifiestan como la naturaleza y la vida. Tiene un papel primordial ~i en las antiguas tradiciones hebreas y posteriormente tambien en las cristianas. rifica una forma especifica en que elSer Infinito se manifiesta El primer reino.muchas tradicio- nes nativas. se refieren aDios imposible conocer. y hi Shaddai. se comparte en. Las versiones mas antiguas de la Cabala. el protector. con el nombre de Ayin Sof. En el sagrado Bhagavad-Gita de la cosmologla hindu. Vishnu. Con la elocuencia de un verdadero maestro. Este tema de un solo Creador. en la creaci6n.142 E1 C6digo de Dios E1 c6digo dentro del c6digo 143 presencia. cuyo nombre se vincula con los sucesos que se manifestaron en un momento del tiempo. Quizas la explicacion mas directa de nuestra incapacidad Figura 6. por ejemplo.r. ' Ie habia pedido que transmitiera un mensaje a los israelitas. Halevi continua esta explicacion con ejemplosl leza de Dios (ver la Figura 6. 0 el principio y el fin de la creacion. cada uno es muy diferente y cada uno cla- representar con uno de los muchos nombres mlsticos de Dios. Finalmente. las tradiciones de la Cabala y d hizo esta pregunta: "~Quien dire que me mand6?".1: Equivalencias entre los Seflrot del Arhol de la Vida y los nOffi- bres de Dim can que se relacionan. se encuentre en las pala. Este es til' los qircitos. y los pueblos de la Tierra . el Unico 0 el Eterno. Rry del Univer- precisamente el nombre que Dios Ie dio a Moises cuando elle ro. a quien es .1). 0 la Corona. cada Sefirot del Arbol de la Vida se relaciona Dios". El Sepher Yetzirah se refiere aDios utilizando al menos Halevi describe como reinos enteros de la creacion se pueden (ltroS seis nombres. que significa Inftnito 0 Ser Inftni- 5 AI referirse a los diez Sefirot del mlstico Arbol de la Vida. se relaciona con el nombre EHYEH ASHER EHYEH (SOY Entre los ejemplos de estos nombres tenemos: Yah. el Dios de Israel. supera el concepto de genero y el concepto de un nombre directo. de la Cabala que ilustran la naturaleza de Dios.i bras del maestro contemporaneo de la Cabala. pues Dios S{'phi'f ) {'/zimb dcscribcn las mtdriplcs comhinaciones de ulla . Z'ev ben Shi-'j mon Halevi. 3 resume el misterio de Dios en tres sencillas palabras: "Dios es r Posteriormente.

Aunque el Quran tambien describe-el tre las dos menciones de Ehyeh. asher funciona tema general de estos relatos. sola fuerza que brota de un solo nombre. y continua: "Esto les diras a los israelitas. Empezando en Exodo 3: 14. Dios puso la palabra Asher justo en- Antiguo Testamento. Fundamentando el hecho de compartir en el segundo libro de la Tora. el relato se describe como una la raiz "ser" en primera persona del singular. hace una sola pregunta: "Cuan. el do vaya con los israelitas y les diga 'El Dios de sus padres me hecho de que la palabra aparezca dos veces en la misma ora- ha enviado a vedos'. Dios Ie segunda "sere". neamente "quien". y las posibles traducciones de las te mediante un nombre personal. yal parecer que se usen. el Exodo palabra. los nombres de Dios isldmicos. casos. Estas traducciones han tenido estos resultados: "Ehyeh" cuenta que Moises. dual en que Dios se revela. 10 que equivale a "Ehyeh que Ehyeh". tivo que se refiere a la palabra que 10 precede. Cada una deestas pala- en el Capitulo 9. se registra por primera vez en el tercer capitulo del Exodo. La palabra en si mento en que la tradici6n hebrea afiima que se revel6 el nom. Asher puede significar simulta- revela externamente en la tradici6n islamica. Con estas palabras empieza el misterio y la contro- Soy e[ que Soy versia que ha continuado desde el momento en que se pro- nunci6 hace mas de 3200 anos. la primera podria ser "soy" y la Segun las versiones mas antiguas de los escritos. . f bras son una traducci6n exacta. con el significado de "sere quien sere" 0 "soyel que soy". claro es precisamente el tiempo que se intenta transmitir cuando clara que es el mismo Dios que describieron los amepasados se dice el nombre. y los efeetos de un Dios ofrece las misticas palabras: "EHYEH ASHER EHYEH". es un ejemplo extraordinario del poder dellenguaje hebreo. Como veremos . de Isaac y de Jacob. Ademas. dependiendo de la forma en jud/os y cristianos parecen brotar de fa mismafuente. 0 podrfa tener el mismo tiempo en ambos respondi6 a Moises directamente. Despues de pedirle a Moi. el Dios de Abraham. Las antiguas tradiciones hebreas y cristianas registran al me. s Pero 10 que no es conversaci6n directa entre Moises y Dios. ses. poder que no es posible conocer directamente. "sere" 0 "voy a ser". en la que Dios de. El debate se crea alrededor de la forma aparentemente gra- nos dos momentos en que se dice que Dios se revelaclaramen. Algunos comentarios de la Tora sugieren de Moises. 'Ehyeh me envi6 a ustedes"'. En No hay duda de que la palabra hebrea Ehyeh se deriva de I el milagro de la zarza ardiente. y me pregunten '~c6mo se llama?' ~que les ci6n sugiere que la primera vez podria tener un tiempo distin- voy a decir?"7 to a la segunda. En el caso de Dios revelandole su nombre a Moi- son equivalentes al poder mismo de creaci6n. al igual que esta incertidumbre podria llevar a diferentes traducciones. al parecer el nombrepersonal de Dios no se Sin cambiar la ortografia. En este caso.144 El C6digo de Dios El c6digo dentro del c6digo 145 . sin embargo. "que" 0 "el cual". incluyendo el hecho de que Moises como una forma espedfica de pronombre. mo. De ser as!. que el Dios del padre de Moises. con el significado de "soy". cada una correcta dependiendo de la forma en que se use la ses que transmita un mensaje al Fara6n de Egipto. bre secreta de Dios. las traducciones que mas se aceptan hist6ricamente han El hecho de que Dios haya revelado su nombre a este mundo utilizado la palabra "que". y en el Libro del Exodo del su identidad con Moises. Ambos relatos se preservan palabras que utiliz6. un pronombre refa- recibi6 "La Ley" de manos de Dios en el Monte Sinai. a su vez.

. La traducci6n mas comun en la sagrada escritura es' que se Ie dieron a Moises es en realidad el nombre personal de "SOY AQUELLO QUE SOY". el Dios de sus padres. LO QUE. 1O Aun- que los patriarcas anteriores a Moises conodan el nombre de YHVH. existe y existid. II al nombre personal que Dios Ie revel6 a Moises. revelan otro nombre dado a: En ellenguaje hebreo se nos da una posible indicaci6n de que Moises originalmente: el nombre mistico. YHVH sea una variaci6n antigua del nombre EHYEH.. Versiones mas antiguas del mismo texto. podrian interpretarse go de esfe libra siempre que incorporo palabras hebreas. sin embargo. la . LO QUE.io ala revela. escrito con cuatro letras: ' (Y) n (H) 1(V) n (H): creen que esto se revela precisamente en la forma en que Dios YHVH. entre ellas: "SOY (QUIEN." Jiempre. las palabras que Dios utiliz6 como prefas. Cuando Dios declara que AI leer el idioma hebreo.. durante la epoca del Genesis aparentemente nunca El nombre personal de Dios entendieron que su significado fuera el verdadero nombre del Despues de la revelaci6n inicial de su identidad en el Exodo.. Ie describe su nombre a Moises.'~ Quiero hacer notar que sigo esta forma convencional a 10 lar- ci6n de su nombre. AI referirse a su santo nombre. I Dios se identific6 como "el SENOR". El C6digo de Dios El c6digo dentro del c6digo 147 146 Asi... Tora registra la siguiente declaraci6n que clarifica aun mas el. LO QUE. el nom. este es mi apelativo para la desde los dias de los patriarcas hasta los tiempos de Moises. la palabra hebrea por izquierda. con . "9 Por primera vez. se nos ofrece un acceso directo nombre "dificilmente habia sido mas que un apelativo ha- bitual". Creador. Durante los siglos que pasaron este sera mi nombre por siempre. "SERE (QUIEN. el Dios de Abraham. sis. aun- de diversas maneras. los convencional de omitir las vocales del antiguo hebreo. "Ehyeh-Asher Ehyeh". las letras se leen de derecha a YHVH sera su nombre "por siempre". que sus traducciones se lean de izquierda a derecha. confusi6n relacionada precisamente con cua! de los nombres A SER". se escribe y no en su forma habitual =. LO CUAL) VOY . LO CUAL) " Con las letras del nombre de YHVH empezamos aver la SERE".' eruditos de la Tora sugieren que en las palabras mismas existe bre de Dios se revela como las tres consonantes que quedan de una advertencia inherente sobre su uso. De manera espedfica. Siguiendo la costumbre ~I los pueblos de la Tierra. Sugiere que Dios se identifica Dios. de modo que la palabra YHVH aparece como nr~ =. el eternidad. Las traducciones modernas tanto del texto hebreo como ' de los textos cristianos muestran esto en la afirmaci6n de que ' El inenarrable nombre de Dios . En vista de que se atribuyeron muchos nombres a los di- misterio del nombre personal de Dios: "Les diras esto a los versos aspectos de Dios en el cielo durante la epoca del Gene- israelitas: El Senor. y "VOYA SER (QUIEN. su nombre.) antes de ofrecerle a Moises su nombrepersonal. es posible que do. Asher Ehyeh" (SOY AQUELLO QUE SOY). Aunque Dios se identific6 inicialmente como "Ehyeh- en primer lugar con sus logros (la Fuente de todo 10 que ha existi. sagrado e imposible ' Dios nunca tuvo la intenci6n de que su nombre se dijera entre de proferir verbalmente: YaHWeH. LO CUAL) SOY".. originalmente se supuso que el nombre de YHVH era s610 el Dios de Isaac y el Dios de Jacob me ha enviado a ustedes: : otro aspecto del Dios viviente.

la reflexionar sobre esto. ofre- ferido. los textos he. cuando se adopt6 la Figura 6. Basandose en las dos referencias del exodo. Los eruditos sugi~ren que la Vav ni6n de la mayoda de los eruditos es que en los dias de Moises.2 muestra una mostrarle falta de respeto en cualquier forma era deshonrar a: porci6n de la columnaXXXlII del primer manuscrito de Isaias Dios en la peor manera posible. que susriru- uso oral del nombre original se perdi6 en el pasado.. 12 que falta indica que debe entenderse como algo ocultO. arriba de la segunda oraci6n. el Nom-! narrable nombre de Dios. d puntos en medio de la pagina. del Talmud. YHVH. son exactamente 6823 veces). el comentario agrega: "Ningun hombre letra V se sustituy6 con el sonido de W. aproximadamente 6800 veces (segun algunos: cen evidencia tangible de que la practica de utilizar otra pala- registros. el nombre con el que Dios se identified: en el Exodo fue reemplazado en los textos por un nombr~ sustituto para evitar que se Ie diera mal uso. como el primer texto de Isaias que se descubri6 en 1947. las 680 1\' ocasiones en que se us6 el nombre de Dios. que muestra cuatro practica de usar otra palabra en lugar del nombre de Dios.2: Porci6n del primer manuscrito de Isaias. ] .14 Por tradici6n.' tre los siglos IV y V. Algunas porciones de los Manuscritos del Mar Muerto. Como el nombre revelado a Moises se registr6 original~ mente en el hebreo biblico sin vocales. En algun momento entre la destrucci6n del Segundo Tern'! plo de Jerusalen en el ano 70 de nuestra era y la recopilaci6n. aunque la W no existe " 13 ' debera pronunciar el Nombre d e acuerd 0 a sus 1etras . (l Qisa) . una colecci6n de literatura hebrea compilada en. tenia tanto poder y exigia·· establecido en la epoca en que se crearon estos manuscritos. al advertir: "No usaras tre las Hneas como simbolos que representan el sagrado e ine- mal el nombre de YaHWeH tu Dios" . La opi. Entonces. que pronunciarlo de manera impropia 0 hace aproximadamente 2200 anos. Al ' YHVH se pronunciaba "Ya-wei". }Tn al nombrc de Dios. en el alfabeto hebreo. entonandolo el Dia de la Expiaci6n. La Figura 6. se cambiaron poi Adonai. que ilustra la costumbre de poner cuatro puntos en- fundamento biblico para esta creencia. Se erda que este nom. bra 0 simbolo en lugar del nombre de Dios ya se habia bre en particular era tan sagrado. 16 En la pronunciaci6n.1 7 [Forograffa de John Trevor. bre s610 10 deda el sumo sacerdote duran~e los servicios en el' templo. tanta reverencia. en la actualidad n tenemos forma de saber con precisi6n c6mo se deda el nom bre de YHVH. que significa Sefior 0 por Ha Shem que significa lit< ralmente "el Nombre".148 E1 C6digo de Dios E1 c6digo dentro del c6digo 149 la letra Vav (') en el centro. 1S Aunque su pronunciaci6n correcta se preser- v6 mediante la tradici6n oral del Templo. La Tora eI1 si proporciona un. breos de la antigiiedad se refirieron a Dios con su nombre pre.

Dios . antiguo nombre de Dios. temente. En un esfuerzo Ie dice a Moises claramente: "Yo soy YHVH". la palabra nrfi'l: YHWH (Ver la Figura 6. Por 10 general se piensa que la tor las escribi6 hace mas de dos mil afios. piel de animal y cobre que ori. significativos de la Biblioteca del Mar Muerto. Esa unica Por tanto. Ademas de los Figura 6.3: Ampliacion de uno de los registros mas antiguos de MjrT!. En Exodo 6:2-3.000 fragmentos de papiro. que so- En estos casos. No obstante. 20 (Forograf{a de la Autoridad de mentos que se han catalogado. Isaac y Jacob como 'El Shaddai'. de un atributo. existen otros 3000 frag. espedfico. el fragmento mimero 66 ginalmente se unieron en 10 que se conoce como la Biblioteca de la Cueva IV. con cada letra per- pero no me di a conocer ante ellos con mi nombre YHVH. y preservaron cada linea y cada curva exactamente como su au- no con su nombre personal. por crear un registro tan completo como sea posible. en sus propias palabras. Isaac y Abraham a traves. Anriguedades de Israel). mitad de las religiones del mundo. Estas letras. no puede vincularse de los Manuscritos del Mar Muerto. 19 la atenci6n tanto del erudito como del lector casual. Dios se identifica tan pequefias que no pueden vincularse con ningun documento de nuevo. "Me apared a Abraham. en realidad. son parte del extraordinario descubri- dado despues de su primer encuentro. . s610 queda una palabra. en dos ocasiones en los palabra es el nombre personal que Dios utiliz6 para describirse registros mas antiguos que forman el fundamento de mas de la ante Moises. estos frag- rna que es el mismo Dios que se apareci6 a los patriarcas de mentos. ofrece un apoyo adi- cional al argumento de que YHVH es. traducci6n y publicaci6n de algu- nos de los textos hebreos mas antiguos. el 22. con ningun manuscrito en particular. las letras tienen la expresi6n "El Shaddai" significa "Dios Todopoderoso"18 u' forma inconfundible de una palabra que de inmediato atrae "Omnipotente Todopoderoso". catalogadoscomo "trozos" por los propios eruditos. Despues confir. aclarando el malentendido que pudiera haber que. Son porciones incompletas de Manuscritos que son tarios hebreos describen como "la Deidad". En uno de los diminutos fragmentos. brevivieron a los elementos del tiempo y la naturaleza. Dios ofreci6 un nombre muy espedfico con el cual 10 conocerian los pueblos de este mundo a traves del tiempo. aunque son parte de la biblioteca de los Manuscritos del Mar Muerto. el nombre que fue revelado a Moises hace casi 3500 afios. Israel y explica por que es posible que ellos no conocieran su ofrecen 10 que podria llegar a ser uno de los hallazgos mas nombre en ese tiempo.los eruditos sugieren que Dios se habia identi. ficado ante Jacob." fectamente clara. miento de los Manuscritos del Mar Muerto. traducido y compilado recien. Evidencia pasada del nombre mas antiguo de Dios El reciente descubrimiento. estaba entre los 3000 fragmentos que.150 EI C6digo de Dios EI c6digo dentro del c6digo 151 En el segundo encuentro de Moises con 10 que los comen.3). Esta porcion del texto.

y a pesar de las controver . tres II ros. pero fue mento sobre la ironia de encontrar este nombre intacto entr vuelto a la vida con el uso de una sola palabra. se utilizo la palabra Mah Hah estos documentos religiosos que era de esperarse que aparecie: Bone como una palabra "clave" que la sustituyera. El creo su universo con se preservan en las tradiciones de los Masones. Des. car el relato. dice la leyenda que mientras no pudo recuperarse la palabra cia? ~O es que el nombre se utiliza con tanta frecuencia e t verdadera que tenia ese poder.. el Sbaddai. para poner en movimiento el A falta de una revelacion personal sobre los secretos de la crea. Her. que entre las muchas palabrJ: chos creen que es el nombre mas poderoso y sagrado "bajo el y nombres que se han usado para describir el poder y la preseni Cielo".?J . alto y exaltado. . evidencias que se presentaran mas 'tarde en este capitulo. a pesar de toda duda razonable. recurrimos a los relatos antiguos de este tipo de encuen. Sin embargo. con numeros y con palab ras. el aceptarlo se convierte en un asunto de fe perso- cer tan exactamente como fuera posible el nombre con el qu nal. significado a nuestras vidas y encontrarle sentido a nuestro mundo. r'b . el princi- shel Shanks. que habita en la eternidad bre de YHVH pueden encontrarse en las leyendas y ritos que y santo es su nombre.. C04 pal arquitecto del Rey Salomon. tomando en cuenta los poderes de vida y la presencia en el Monte Sinai se identifico ante Moises. Dios de Israel el Dios Viviente.. Como vimos en el primer capitulo. identificada con cinco nombres. con La base del misterio relacionado con el nombre de Dios es flo. EI misterio que rodea al nombre de Dios ha perdura. ' nacimiento de nuestro universo.descubrimiento d tambien se Ie relacionara con la resurreccion. La verdade- ra a menudo (y sobreviviera)? ~O existe un significado m~ ra palabra de la vida era el inenarrable nombre de Dios: profundo?"21 YHVH. Ademas de la evidencia arqueologica que sugiere que cia de Dios.. que se da al nombre en el Sepher. pueden extraerse mas evidencias a partir de la atencion tetragramaton: YHVH. el nombre de YHVH es de hecho el nombre personal del Crea- do con el que Dios se identifico claramente. los miles de fragmentos.i do y se ha preservado a traves de los sacerdocios.. si no es posible verifi- Antes de escribir El C6digo de Dios. Ese nombre es el.152 El C6digo de Dios El c6digo dentro del c6digo 153 En un articulo relacionado con el descubrimiento. y sociedades secretas de nuestro pasado. Evidencias adicionales del poder que tiene el nom. "~Fue simplemente una coinciden4. ya nuestras interpretaciones de estos relatos para agregar formas de conocer y transmitir informacion. con escrztura. la ortografla. y permanece en la YHYH de los Ejercitos. que fue asesinado. Yetzirah. no es sorprendente que pues de doce alios de investigacion y del . creacion que se atribuyen al Nombre. Sin embargo. En la primera oracion de ese cion."2 Como en todas las leyendas. fue necesario estable"'. sobreviva uno como el nombre personal y prefed. sectas ocultas "Con 32 caminos misticos de Sabiduria grabados YH. actualidad. capitulo se nos dice que Dios creo este Universo mediante tres tros. el Sepher Yetzirah ofre- El poder del "nombre" ce una vision amplia del proceso que usa una fuerza suprema. Entre esos relatos esta la historia de Hiram Abif. la pronunciacion y la vocalizacion del que mu- sias academicas sobre este hecho.· ". dor. editor de la revista BiblicalArcheology Review.

numerica y hablada. es el antiguo nombre de YHVH. sin embargo. El universo a partir de un solo nombre Exodo 15:2. Despues de su: Despues de la introduccion. se nos da 10 que podria ser la indicacion.' do del universo. ~ Aunque las versiones inglesas traducen esta referencia a Dio! El Rabino Kaplan interpreta esta porci6n del Sepher Yetzirah como "El sefior". Debido al resurgimiento del interes en la Cabala. cantidad y comunicacion. que se identifican como escri- YH. con bre de Dios. el texto describe como "Diez boda. En la Tora. fueron los primeros seres de nuestra raza. los expertos en el hebreo biblico aceptan Aunque parece haber acuerdos diversos en los comentarios que el primer nombre que se da al Creador en este enunciado. Adan y Eva modificaron sus nombres para reflejar d' Sefirot a nada". su nombre los prote. reducida a la esencia de! zando tres tipos de informacion. con respecto al nombre con que se revela Dios en la pectivamente. hebreos con respecto al hecho de que YH sea un nombre di- YH. A medida que se formaba cada Sefirot dentro del va- describe en el texto. diciendo que Dios crea su universo con "texto {sepher}. Adan llam6 a su esposa Ishah y el se llam6 Ish. expandiendo su interpreta- historia del matrimonio de Adan y Eva en el Jardin. El textO: cion de los terminos texto. Se ptesenta en l<i de estas tres formas de conocer. el texto describe como la presencia original del nombre a partir del cual se expandi6 YHVH. 0' divina. el Se- gerla contra rodo dafio. leemos "El Sefior (Yah) es mi fuerza y mi poder. existen varios textos excelentes sobre la comprension y aplica- do el nombre de Adan que habfa llevado antes de la crea. El rabino explica mas a fondo las sutilezas mas directa de que Yah es el nombre de Dios. Yod a Ish y He a Ishah. abandonan. res- lector. Dios y observaran sus mandamientos. trajo a la existencia cualidades espedficas: en incorporar el nombre de Dios a su propio nombre: cualidades que se reflejan en todos los elementos de la vida y la creacion.2s que se traduce como "Eterno" . llamada YH. Como se la Vida. diolos parentesis]. 29 Tierra. pher Yetzirah dctalla cl proccso en si con el que Dios lIev6 a . sion restaurada de las Biblias Hebrea y Cristiana. cion de su sabiduria eterna al mundo moderno. Yah.154 EI C6digo de Dios EI c6digo dentro del c6digo 155 Por 10 general. Para los pro- ci6n de Eva. no hay duda de que 10 es.26 El uso de YH en las' ta.i. escrituras tradicionales puede encontrarse hoy en dia en la ver-. desde la perspectiva de la Haggadah y del Sepher Yetzi- rodea a este nombre parece surgir precisamente de la forma en rah. numero y comunicacion de tal esta escrito de tal manera que deja cierta duda en la mente del'" manera que incluyan calidad. el texto hebreo muestra claramente el nom"'. con las letras Yody Hey. pues Dios agrego su propio nombre Yah a los positos de este libro. se crearon los diez reinos del mistico Arbol de cambio que su union habia producido en su interior. Despues de que los diez Sefirot surgieron del vado. En esta primera declaracion que se deriva el nombre. 28 [Las italicas son del auror]. incluso antes de los tiempos de Moises. nos concentraremos en las nombres del hombre y de la mujer. porciones del Sepher Yetzirah que llevan directamente al men- para indicar que mientras caminaran por los senderos de saje vital que esta oculto en cada celula de nuestro cuerpo. Tal vez en realidad haya sido la forma clave del Sepher Yetzirah. 24 La incertidumbre que vino.27 numeros (sephar) y con comunicacion (sippur)" [el autor afia- En la Haggadah. llevo a cabo el acto de la creaci6n utili- tal vez es una forma corta de YHVH.

Con parrafos concisos escritos como prosa.'. periodos de la existencia de la Tierra. se nos muestra el c6digo que nos per- dio nuestro origen 0 sobre cuanto tiempo hemos estado aqui. Durante aproximadamente un cuar- genetico puede traducirse como un lenguaje. Ellas grabo. su sabiduria nos permite' con estos enormes periodos se acerquen siquiera a 10 correeto. IIcraci6n del siglo XX. En terminos cuyo significado es bastante claro. de 1 iya habia transcurrido un 99 por ciento de la vida del planeta un paso mas. habia evidencia de la aparici6n de la formara y todo 10 que alguna vez se forma rd. ' E[ ADN: [a "piedra de Rosetta" de [a vida los versos describen conceptos ampHsimos que van desde eL ~n el plan general del cosmos. Ahora.. el procesode concebir y dar a luz a la debemos primero lograr cierta comprensi6n de la forma en vida humana ha seguido siendo el mismo. cdad del universo yel nacimiento de la raza humana representa- truy6 el universo.: madamente 130 14 cientos de millones de aiios. Cada hora del reloj representaba grandes Las 22 letras. Recuerdo haber visto. 30 raza humana. en el idioma de su epoca nos invitaron a mirar a "nues~ primera evidencia de nuestra especie apareci6 hace s610 con tro interior" para descubrir el conocimiento de nuestra.000 aiios. AI hacerlo. to de mi1l6n de afios.5 cientos de millones de aiios. como el milagro de cada celula hu-. Dentro de nuestro cuerpo. tlempo como especie dentro del periodo de vida del planeta. se ha mana. Para comprender c6mo el c6digo antepasados mas antiguos. las impregno.. se calcula que la Tierra se form6 hace tenian palabras modernas para nombrar las celulas y las mo. .156 El C6digo de Dios El c6digo dentro del c6digo 157 cabo su creaci6n. y que la leculas. se producen J po en que apareci6 esra cobrando fuerza. solo en los ultimos tres las transformo y a partir de ellas formo todo 10 que alguna vez se ': minutos antes de las 12. Aunque los antiguos nQ. Suponiendo que los dlculos relacionados existencia. Gracias a nuevas evi- se replican y se guardan. dencias que apoyan la teoria de la Gran Explosi6n. aproximadamente 4. en un libro de texto universitario.mtes de la aparici6n de nuestros primeros antepasados! Simplemente siguiendo las instrucciones que se han pre- A pesar de la controversia sobre la forma exacta en que se servado desde el pasado. dos en la caratula de un reloj para ilustrar los periodos relati- vos en que aparecieron. hemos existido solo muy poco origen del universo hasta la relaci6n de este universo con nues-. calculado que el nacimiento del universo ocurrio hace aproxi- En la segunda mitad del siglo:XX se caracteriz6 a la mole. 31 Dentro de cula de ADN como un "lenguaje".e vida humana. Aunque continua la controversia sobre 10 que ocurriO exac- tamente antes del momenta de la creaci6n y el principio de la El significado es tan claro que sus implicaciones dejan a la.. mite sustituir los elementos que forman el ADN con letras del· desde el momenta de nuestra aparici6n en la Tierra existe una alfabeto hebreo. las esculpio. sin embargo. hasta la ultima ge- que el ADN trabaja en nuestro cuerpo. parece que el consenso relacionado con el tiem- mente tambaleante. tros cuerpos. cste enorme periodo. siglos mas tarde. hacer que la metafora moderna del ADN como lenguaje. las letras que permitieron el nacimiento del universo. ' . podemos interpretar el lenguaje sola experiencia que siempre hemos compartido con nuestros de la vida y leer su mensaje. la las frases afirman que a traves de estas cuatro letras Dios 'cons.' 160. las peso.

* mas lejanos de nuestra especie cambi6 con el nacimiento de Como ocurre a menudo. cos.158 El C6digo de Dios B c6digo dentro del c6digo 159 iHemos descubierto ell/secreto de la vida"! comprensi6n de la estructura de la doble helice fue 10 que re- solvi6 el misterio del comportamiento genetico que llev6 a En 1978. Los avances:" Casi desde el momento en que se descubri6 el c6digo de la de tecnologias que parecen tan milagrosas empezaron con la vida. Las repercusiones eticas del descubrimiento A partir de entonces. la revista britanica Nature public6 un articulo de.32 Con la publicaci6n de su articulo. Con esto se origin6 la frase bebe de probeta que describe tiempo despues. Aunque el trabajo de Watson y • En 1%2. ~os cientificos y quienes no 10 son han descrito el plano publicaci6n de un solo articulo a mediados del siglo XX. el requisito de uni6n habia "descubierto el secreto de la vida". durante momentos informales Louise Joy Brown. e in"":' Se traduce el alfabeto del AD N cubar ciertas celulas para crear tejidos espedficos. y do fuera del vientre materno. [celulas tomadas del cuerpo en una etapa muy temprana de nifio a su debido tiempo. su bra en eI premio. e hizo alarde de mer ser humano que pudo concebirse fuera del vientre mater- la magnitud de sus descubrimientos... . se abri61a puerta para alterar.000 nifios se han concebi-' de Watson y Crick siguen estando presentes en la actualidad. y nuestra responsabilidad en las primeras eta- a las milagrosas habilidades que nos permiten seleccionar las" pas de la vida huma:la. a las 11 :47 de la despues de un intenso periodo de investigaci6n. mas de 20. de los acidos nudeicos: Una estructura para el acido nudeico apareci6 junto con los lideres de dos empresas que habian rea- deoxyribrose" . Nos permiten con. s~ desarrollo y que pueden transformarse en cualquier otro concepci6n y el embarazo. Como Watson record6 no. se este tipo de concepciones. naci6 Louise en un hospital en Gran Bretafia: el pri-' entr6 al Eagle Pub en Cambridge. cebir la vida con el fin de cultivar celulas especializadas. que se llev6 a cabo en el verano de 2000 sobre temas ciendfi- James Watson y Francis Crick titulado "Estructura molecular. manipular y construir la esencia misma de la vida: la motecula de ADN. la investigaci6n de celulas vastago "stem cells" ro de una mujer que ha sido preparada para llevar y dar a luz ai. Crick dedar6 que gracias a sus esfuerzos. Bill Clinton. Louise Brown. esta linea de exploraci6n ha llevado. el entonces presidente de Estados Unidos. 33 Ese fue el secreto sexual para crear una nueva vida se convirti6 en una opci6n y que llev6 a la tecnologia que hizo posible el nacimiento de dej6 de ser una necesidad. . caracteristicas de los nifios antes de la concepci6n y alterate. Ademas de re-definir el acto de la'. se reflejan en candentes debates sobre temas como la dona- entorno externo temporalmente y luego se les coloca en el ute- cion humana. El 25 de julio de ese afio. Cnck y WilkInS por su trabajo en e1 descubrimiento de la estructura del ADN. Inglaterra. e1 .Premio ~o~e1 de fisiologfa y medicina fue compartido por Crick induia investigaciones de otros dos cient(ficos del King Watson. upo de celula].. en esa fecha. geneuco como un "lenguaje". el vinculo que hemos compartido con los miembros que se les otorgara el premio Nobel en 1962. se les-permite'desarrollarse en un. Francis Crick mafiana. sus caracteristicas despues de la concepci6n. Rosalind Franklin y Maurice Wilkins. En una conferencia de prensa En 1953. Rosalind Franklin murio en 1958 y no se Ie nom- College de Londres.

bases que forman el ADN humano. y al mismo tiempo. Clinton declar6 que el genoma era el "lenguaje con el palabras. Estas combinaciones se vista. . los bloques de construcci6n de la vida son sor. debemos entender el mensaje de la vida. T. bases. A partir de las re~aciones que se han descri. En otras hito. Para revelar el mensaje ducir el primer mapa sobre la manera en que se disponen las de nuestros cuerpos. las mapa de nuestro c6digo genetico y habian abierto la puerta a bases se disponen de cierta manera que formen pares. taban las bases que habian sido identificadas en diferentes si- prendentemente simples. Desde los organismos unicelu. co: la guanina siempre se une a la citosina (G-C) y la adenina A pesar de 10 frecuentes que son este tipo de r~ferencias. se les conoce como las bases del ADN y con- tienen toda la informaci6n que se requiere para producir toda GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA forma de vida que se conoce. series interminables de letras. sin embargo. cada base funciona s6lo con un compafiero espedfi- que Dios habia creado la vida". y cada par contiene las pautas que se com- con la vida en el siglo XXI.rITAATA(. Se trata de las unidades basicas especie. la ya conocida helice doble 35 (ver la quimico de la vida. conocen como genes. TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAA GCATCTTTCAGGGTTGTGCTTCTA lares mas pequefios.TAATA(:GCAT calcula hay en eI cuerpo humano. vada y otra federal.4). AI describir la importancia de este binan cor. timina. ahora considerarse como un lenguaje muy real con un alfabeto El 26 de junio de 2000. el mundo contemp16 asombrado antiguo que es posible traducir.1'(. 36 A continuaci6n se presenta una porci6n del cromo- de la vida: adenina. hasta los cien billones de celulas que se TCTAGAAGGTAGAGCTGTGTCGTTCAATAAAAGTCCTCAAGAGGTTG(. Grupos de genes forman los 23 pares de prensi6n de que toda vida esta formada con combinaciones de informacion vital (cromosomas) que nos hacen unicos como cuatro compuestos quimicos. Figura 6. Es ellenguaje que preserva el el anuncio que hicieron dos empresas competidoras. es obvio que el ADN puede \ que se ha dado a conocer ampliamente en afios recientes. tas populares.TA( :A1'TTTTAAA1'A(.TA<:A(. siempre se une con la timina (A-T). una pri- unico mensaje que trasciende toda diferencia que pudiera lle. AI ilustrar este mapa.1'( ·AA( :AATAA1'TTA1'T<. agradables a la tios de la molecula del ADN humano. Estos pares base conforman el c6digo genetico to ya en este libro. conoci- una nueva era para la ciencia medica y las ciencias relacionadas dos como pares base. otros pares para formar pIanos de vida. soma 1 humano para ilustrar el aspecto de este c6digo: respectivamente).160 E1 C6digo de Dios El c6digo dentro del c6digo 161 lizado uno de los esfuerzos de investigaci6n cooperativa mas de vida se establece a partir de la disposici6n de estas cuatro grandes de la historia: El Proyecto sobre el Genoma Humano. se pro- yectaron en las pantallas de televisi6n y en las paginas de revis- La genialidad del descubrimiento de Watson y Crick se basa. que habian reunido los recursos para pro- gar a separarnos como familia humana.TA1'( . habian producido el primer Mediante un proceso que s6lo se conoce parcialmente.(.34 . La esencia de la investigaci6n genetica se basa en la com. eI c6digo de cada forma (. Gracias a sus esfuerzos conjuntos. ellenguaje del c6digo una escalera en espiral. G y C. En terminos algunas de las cuales constaban de dentos de letras.A< ·TATA( . en su descripci6n de la molecula del ADN en sf. Los pares se colocan fren- muya menudo se usan s6lo en sentido figurado para describir te a frente formando los peldafios de una estructura similar a los bloques de construcci6n de la vida. guanina y citosina (A. Las secuencias. represen- comprensibles.

Como nues- nes revelan ahora que el nombre antiguo de Dios YH existe 'r<) Cf)digo genetico esta formado can combinaciones de las bases del ADN. puetlell (( lI11hinarse l'll 1lI1l'stras cl'llilas. Con estt' pUt'ntt' entre d nombre ('1\ tllll' las lelras YIIV<.5). que) muestra como las bases especificas siempre forman pares entre S1: C can Gy A con T. En base a sus valores correspondientes.5: Las cuatro bases del ADN. Figura 6. ahora es posi- ble revelar todo el misterio y el significado mas amplio del antiguo codigo que esta presente en cada celula de nuestro cuerpo. Figura 6. como la quimica literal de nuestro codigo genetico (las letras 'JlIl' en ocasiones tienen cientos de letras.4: Ilustracion de la estructura de la helice doble del ADN. el oxigeno en la letra hebrea Vav (V) y el carbono en la letra hebrea Gimel (G). . La clave para traducir el codigo del ADN a un lenguaje significativo es aplicar el descubrimiento que transforma ele- mentos en letras. el hidrogeno se transforma en la letra hebrea Yod (Y). t:xisten innumerables formas subrayadas en la Fih'Ura 6. doscientas cuarenta bases forman una porcion del cromosoma 1 humano. se muestra de que elementos estan liechas yel equivalente de cada uno como una letra hebrea. Estas sustitucio.162 E1 C6digo de Dios El c6digo dentro del c6digo 163 de Dios y los elementos de la ciencia moderna. el nitroge- no en la letra hebrea Hry (H).

jAmbos relatos parecen describir J rna H de YHVH con su equivalente quimico. la pnmera letra del nombre de Dios: Yod.s sobre la Gran Explosion sugieren que el hidrogeno fue el tro letras del nombre antiguo de Dios. el Creador estaba presente pero no evidencias de su existencia. A pesar de ser suril. En su res- puesta. Alifevoluciono y se convirtio en el primer elemento con los elementos de la vida da ahora mas significado a la per que :parecio en nuestro universo. esta afirmacion sugiere se Ie puede conocer a traves de sus manifestaciones. incoloros. Ademas. Ie pidieron a Albert Einstein que. . relaci6n con la Fuente de todo 10 que "existe". en forma fisica (Genesis 1:2). el nitrogeno. Con renovado' De hecho. que nos hace muy diferentes a E1. Por tanto.. los primeros capitulos del Genesis relatan que en mente al creador. cada dia y a cada momento se nos muestrani el momento de la creacion. vemos un resultado qu' pnm~r elemento que se formo a partir de la energia liberada a primera vista podria ser inesperado. Vida de los mundos. dijo Einsein. Durante una entrevista. y tambien en cepcion de Einstein. tambien se nos distingue de YHVH con algo como el "Aliento" de Dios. el hidrogeno. h~brea s~rge del vado de la creacion como la Letra Madre que del ultimo siglo percibia la inteligencia que esta detras de nues4f hl~O .poslble el universo: Alef.. no como Dios nuestro mundo no puede percibir con los ojos. Si reemplazamos la ulti en el mstante de la creacion. Las teorias moder- Cuando reemplazamos los elementos modernos con las Clla. se nos muestra que la humani- zar el cien por ciento del nombre personal de Dios con 10 dad fue creada "a imagen" de Dios. al reempla En terminos igualmente claros. . oxigeno y nitrogeno (HNON): jTodos ellos gas nombre de YHVH se revelo como el nombre personal de Dios. en las descripciones mas antiguas de Dios. la afirmacion relacionada con nuestros origenes nos nos dice que es omnipresente y que adopta una forma qu~ recuerda que fuimos creados a imagen de Dios. ise crea una sustancia que es un!' nes se encuentre la clave mas directa para describir nuestra forma de creacion intangible pero muy real! flI. Este es el Santo Aliento. "38 describiera como entendia ella naturaleza de Dios. s6lo ni iguales a ~ios. Era "el espiritu de Dios" [enfasis "Mi comprension de Dios". menciono el hecho de que aunque no vemos directa. El descubrimiento que vincula a esa inteligenci .37 Estas declaraciones llenas de candi~.. '. A traves de un gran "secreto" tro mundo. El Sepher Yetzirah describe ademas como la primera letra dez nos muestran como una de las mentes mas privilegiad~. funda conviecion de que una inteligencia superior se revela e~\ un mundo cognoscible". el mismo elemento! nombre de Dios se convierte en los elementos de hidrogeno El Exodo nos recuerda en terminos muy espedficos que el nitrogeno.164 E1 C6digo de Dios EI c6digo dentro del c6digo 165 En cada ce[u[a de cada vida Diez Sefirot a Nada: Uno es se reve[a e[ c6dlgo el Aliento del Dios Viviente. Tal vez en estas afirmacio- elementos de este mundo. inodoros e invisibles! En otras palabras. mlStlco. na. "viene de la pro~ aiiadido por el autor] 10 que se movia sobre la superficie de la Tierra. s enfasis. El Sepher que aunque mdudablemente compartimos los atributos de Yetzirah describe esta forma no-fisica de la presencia de Dios nuestro Creador.

no somos iguales a Dios. como se mencion6 antes. de interpretarse como "el Eterno". y colocaci6n de una piedra. Por 10 fisica y que explica nuestro canicter unico como especie.6). se llev6 a cabo un antiguo ritual rial" que da color. Un analisis aun mas meticuloso de las letras que forman el nombre de Dios yel cuerpo del hombre clarifica precisamente Figura 6. incluia la orientaci6n elemento que nos hace "reales" en nuestro mundo. el nombre que sefialaba esta piedra angular del Santo Templo de Jerusalen tambien llegada a ser el nombre en el que el Rey Salom6n basada elliderazgo de su pueblo. segun la cual se orientadan todas las demas piedras de ese enorme complejo. Aunque YHVG el nombre de la humanidad. la ultima letra de nuestro nombre es el "mate: santo templo en Jerusalen.40 mado con elementos invisibles. el nombre eterno de Dios. y llegada a ser el fundamento de una tercera parte de las religiones organizadas de la Tierra. como intercambiables. El es parte de todo 10 que ha existi- obvio que aunque compartimos las tres primeras letras qu ' do. La unica letra que nos separa de Dios es tambien gracias a las tradiciones de los masones. Dins nos dice que en cl hidn'>gcno. textura y sonido a nuestro cuerpo. nitr' . el poder de su naci6n. el nombre de Dios se reemplaza con G 10 que esta relaci6n significa para nosotros hoy en dia. en lenguas modernas como el ingles.6: La H de YHVH. Cuenta la leyenda que cuando el Rey Salom6n construy6 su geno y oxigeno. preservado hoy el carbono. el clcmcnto mas principio ni fin y que opera mas alIa de las limitaciones del .166 El C6digo de Dios El c6digo dentro del c6digo 167 Al sustituir los elementos modernos con ~etras antiguas. general. sabor. Simb6- licamente. Esta es la diferencia que nos da una constituci6 refieren a la versi6n corta YH. 39 Cuando se traduce. existe y existira. Ese unico nombre era el tetragramat6n YHVH. Aunque la presencia de Dios es 1 El nombre de Dios en el cuerpo del hombre forma invisible e intangible de los tres gases: hidrogeno. los eruditos aceptan ambos nombres YHVH y YH .: genetico. gar a dudas que YHVH es el nombre de Dios. el nombre YH pue- Esto no indica que Dios sea simplemente un fatuo gas for. representan el 75 por ciento del nombre de nuestro Creado~' la cuarta y ultima letra de nuestro nombre quimico nos separa de Dios (ver la Figura 6. Esto ilustra que aunque compartt las versiones originales de los textos biblicos reconocen sin lu- mos tres de las cuatro letras del nombre personal de Dios en nuestro codi . Mas bien sefiala que a trave$ Aunque los datos espedficos poddan variar segun los tiem- f del nombre que Dios Ie revelo a Moises hace mas de tres mile. la pala- nios fueron posibles el mundo y el fundamento de la vida mis. tambien se posicion es diferente. Este ritual. es abundante en el universo. pos y las culturas. un 25 por ciento de nuestra co. la piedra angular. antes de colocar la primera piedra. Se dice que el rey puso una hoja de pergamino en el interior de la piedra angular en la que el escribi6 un solo nombre. bra eterno implica claramente una existencia que no tiene rna.

En I.o" 10 que es co) reinos alternos de la creaci6n../(.41 Es precisamente este aspecto "etern. Al combinar estas traducciones del mensaje yue esti en nuestras celulas.V: dcntro del CUl·rpO.tlfabeto hebreo. de1 cuerpo. espeCl "e1 lntenor . podemos buscar su significado literal para 10- de la traducci6n literal del ADN como alfabeto. letras (VG) de nuestro nombre en letras hebreas que equivale . tenemos una comprensi6n sin YHVH = el nombre de Dios precedente de nuestra relaci6n con la creaci6n a traves del nom- YHVG = el nombre del Hombre bre de Dios.168 El C6digo de Dios El c6digo dentro del c6digo 169 . describe precisa mente como existe Dios en nuestro cuerpo. el nombre antiguo de Dios. (1e manera mas" f ilea. como se indica en las letras subrayadas. De modo humano YHVG. es importante notar que los c6digos: Figura 6. Tan. ciencia eJe la gematria. el significado en S1 no cambia. Ademas. I tiempo. YI-NG. yue al considerar las letras VG 0 GVen el hombre de la huma- to a traves de las letras secretas de la antigliedad como a trave nidad. que significa "sangre". entre los misterios de la Cabala. Figura 6. las letras GV significan "dentro". relaci6n con Dios a un nuevo nivel. " 42 E ne tr 1as 50 por ciento de los elementos que definen nuestro c6digQ 231 puertas misteriosas de la creaci6n del Sepher Yetzirah. Com.7a: Los elementos de nuestro ADN traducidos como letras del numericos de los alfabetos antiguos no toman en cuenta e~ . Aunque las cualidades relacio- mun tanto en el nombre de Dios YHVH como en el cuerpo nadas con esto varian. GV representa aDM. al ADN (YHVG). La promesa de D10S en el cuerpo del hombre El segundo aspecto de nuestro nombre quimico lleva nuest .7b). las reglas de los c6digos de letras permiten las mismas considera- ciones en cuanto a los valores de las letras. Las dos ultim . • YH: la forma abreviada y aceptada de Ademas. AI reemplazar los elementos del ADN con sus cquivalentes en letras hebreas. orden de las letras. revelamos el mensaje que esta YH (Dios/Eterno) forma fa mitad del nombre de Dios cscrito en el interior de cada celula de nuestro cuerpo (ver la y del nombre que aparece como codigo en nuestras etlulas. se nos mues grar una mayor comprensi6n. es decir la ra1Z del nombre de Adan. 0 partimos la cualidad interminable de nuestro Creador en un. . el orden inverso YHVH/Eterno.43 genetico. ilustran la naturaleza de esta relaci6n. (alterado) de un conjunto de letras a menudo se relaciona con • V(. . tra: que algo de nuestra existencia permanece y es eterno. Asi como 1 + 2 Y 2 + 1 son igual a 3. En ellenguaje hebreo.

se convierte en un mensaje relaci6n con Dios y con la creaci6n. timina. Antes describimos las letras T." geno. . de nucstras cClulas sc traduce literalmcnte como prensic'>n sin precedente de nuestro mundo y de nUl'stros sc. r tro del cuerpo.8). nos ofrecen una com. Una ilustraci6n gnifica de esta sustituci6n mue tra que mediante diversas combinaciones de nuestras cuatr bases de ADN: adenina. Es igualmente claro que las bases d c6digo contienen diversos grados de la presencia de Dios " den 1 tro del cuerpo"44. es posib ' crear la sustancia de la vida a partir del nombre de nuestro cuer' po (ver la Figura 6. p demos ahora ilustrar c6mo el nombre literal de Dios forma eJ mensaje en el interior de nuestros cuerpos: Dios/Eterno del\. Aunque requieren estudios posteriores. "Dios/I ':terno. partir de variadones del nombre de Dios en nuestro cuerpo. A y como abreviaturas de las combinaciones de hidr6geno. Figura 6. AI sustituir estas palabras de nuestro c6digo genetico. puede ayudarnos a sacar varias con- clusiones. en el se nos muestra precisamente c6mo la vida humana se crea' material que forma nuestro c6digo genetico..7b: E1 mensaje que se revela cuando la quimica de nuestras celu~! las se traduce a letras del antiguo hebreo. proceso representa s6lo el principio de un estudio mas ampli que hani posible una comprensi6n mucho mas profunda.8. • Diferentes formas de bases de ADN producen el men- Aunque los vinculos entre ellenguaje y los elementos no saje con diversos grados de repetici6n." . guanina y cistocina. YH.170 £1 C6digo de Dios £1 c6digo dentro del c6digo 171 Traducci6n literal que revela el mensaje: mejantes. 0 que • El 50 por ciento del mensaje que esta en el interior aspecto tendria en realidad esa presencia. La Figura 6. logran definir quien es el Dios de nuestras plegarias. nitr '.8: ilustraci6n grafica del nombre antiguo de Dios. estas correlacion' • Cuando se ve la correlaci6n del c6digo de toda vida abren la puerta a una manera nueva y diferente de ver nuestr' con el alfabeto hebreo. Es obvio que este tipo d que esta en nuestras celulas y que puede traducirse. C. oxigeno y carbona que conforman las bases del AD ' AI reemplazar cada elemento con la letra hebrea equivalent> Figura 6.

mujer. binaciones del nombre original de Dios: YH que sig- do muy real. y por tar que se Ie diera mal uso 0 se Ie deshonrara. "dentro del cuerpo". to del nombre que explica nuestra existencia y que contiene 1" • El mensaje es un recordatorio de que la vida humana promesa de que cada uno de nosotros llegara a ser algo qu .. En un senti1). nitr6geno. esta unida supera las condiciones y limitaciones de nuestra v i d a . el hecho de su y antepasado de nuestra familia global. :1. Aunque no describe como se Esta es la promesa que comparte todo hombre. sugiere la presencia nuestro cuerpo. las letras VG. el fundamento de nuestra existencia se forma co nifica "Eterno". que trasciend. El descubrimiento del nom mentos de nuestro ADN con las letras que represen- bre de Dios en el interior de cada celula de toda vida revela.: espedficamente. binaciones de s6lo cuatro bases de ADN. se revela que la menos. can. se no hidr6geno. RESUMEN DEL CAPITULO 6 • Debido a la. un mensaje al igual que una promesa. se Ie identifica con nombres que describen sus manifestaciones. yel Creador. recuerda nuestra relaci6n con un poder superior y la naturale • Nuevo descubrimiento: AI reemplazar los cuatro ele- za imperecedera de esa relaci6n. Es esta chispa de la creaci6n 1 • Ademas del nombre en S1. y cada base consta de los cuatro elementos basicos de la vida: ElIas tradiciones mas preciadas de la humanidad. • El nombre de YHVH se consider6 tan sagrado en la tradici6n hebrea que aparece 6800 veces en la Tora. . como YH (el Eterno)YH YHYH (YH el Senor). en el resto de los bloques de construcci6n de la vida. como un mensaje vi-' existencia y 10 poco probable que seria que ese men- viente escrito como un c6digo en el interior de cada celula d . por un legado comlin. oX1geno y carbono. • La estructura de toda vida consta de diferentes com- leza eterna de Dios en este mundo. El Shaddai. saje se formara por casualidad. una esencia eterna y sin limite. base de toda vida esta formada por diferentes com- cualquier diferencia que podriamos imponernos. de una inteligencia superior y de una intenci6n rela- cionada con nuestros origenes. aparecen como un c6digo una chispa que claramente comparte al menos el 50 por cien~. ninGi origin6 ese c6digo en nuestras celulas. tanto describe d6nde podemos encontrar la natura. tan sus antiguos nlimeros ocultos. y toda vida en general. que signifi- que textos como el Sepher Yetzirah equiparan con el Creador.naturaleza infinita de la existencia de Dios.172 EI C6digo de Dios EI c6digo dentro del c6digo 173 • ElSa por ciento restante de nuestro c6digo genetico donde se reemplaz6 con nombres sustitutos para evi- se traduce como "en el interior del cuerpo".

T El sl Como apllc' .

.

Las respuestas iniciales han sido desde la incredulidad hasta la curiosidad. Para algunos. el mensaje nos recuerda que somos parte de Oligo que rebasa las diferencias que podrlamos imponernos. la religion. pues confirma a nivel cientIfico 10 que eUos ya sospe- chaban en su coraz6n y experimentaban en la vida. (Como pudimos pasar por alto algo tan importante du- rante tanto tiempo? Para oeros. Capftu[o Siete MENSAJE DEL PRIMER DIA: Como leer el lenguaje de D105 L as reacciones al descubrimiento de los vfnculos que exis- ten entre los alfabetos de la antigliedad y los elementos modernos han sido variadas pero predecibles. la raza. . Siempre hay preguntas y un deseo de saber mas. Por encima de las diferencias de la cultura. la reve1aci6n del nombre de Dios en el interior del c6digo de la vida tiene implicaciones de tal magnitud que se sienten abso- !utamente abrumados. el descubrimiento ofrece un bien recibido des- canso. Uegando al temor reveren- te y al asombro. las activida- des 0 las creencias.

Tal vez en la simpli.. Camina en mi presencia y !lega a ser pcufecro" [el 5uma 26 Suma 24 auror afiadi6 las iralicas). compartimos los atributos del nombre de Dios.. El proceso revelo que prension. 1111('" potencial que eI nombre de Dios nos permite en nuestro cuer. AI cruzar los l1mites tradicionales que definen ellen.. una contracci6n de dos palabras hebreas. nos recuerda que no somos nombre de Dios con la forma en que su presencia se dio a .. EI nombre que se atribuye a este Re<lucido 8 keducJdo ·6 aspecto de Dios es ShaDaY.• H 5 H 5 estuviera ~ompleto (Genesis 17: 1). es un poco menor. po.t. She-amar Day. Dios se si- cido el mensaje. y nuestro nombre como aparece en el c6digo en nUf. 24. 10 que los textos ya revelaron en palabras. el texto revela que durante y 10 Y 10 al acto de la creaci6n.1). cl nombre de Dios es el numero 26. I ro ser Hsico. que ha hablado 10 fj 2. En hebreo. la historia y la religi6n.. sin embargo. de (. 1 En una sola frase.uak·s. (cl ('arbono 0 hi (.1. La suma de 24 La perfecci6n del alma es el valor codificado de 6. Dios. Ellibro del Genesis proporciona algunas de las claves mas poderosas Nombre eMlgo Cuerpo del ser C6digo para comprender nuestro papel en el desrino de nuestra espe. conocet en un momento dado del tiempo: el Dios de la Mise- ricordia. numero que. aunque es similar. La traducci6n de este inci. Cuando aplicamos la gema- esta en el interior de nuestro cuerpo nos muestra el beneficio . y tal vez nos indique la raz6n de que el mundo y nuestra En nuestro mundo de separaciones. Dios detuvo e1 proceso antes de que .imd) no nos pl'rmill'Sl'r i. El descubrimiento de que el nombre de Dios gue identificando como YHVH. la ultima letra se describi6 c6mo los textos de la antigiiedad relacionaron el de nuestro cuerpo fisico. Gimef.Jue tencmos una rclacibn con Dins. Y aplicamos el mismo procedimiento a los visi6n del mundo mas grande e integrada.rura 7. i. YHVG. ¥ J. su nombre personal permanece sin cambio. cimos el estudio de la naturaleza a dencias que aparentemente Como el nombre ShaDaY representa s610 un aspecto de no se relacionan. un mundo en el que redu.' stras n:llIlas. suflciente. se nos muesrra el poder de una do los digitos 2 y 6.. Este valor declara y confirma en a ~Que revela el mensaje que est en el interior de nuestro cuerpo ' numeros.. dijo suficiente.180 El C6diga de Dias Mensaje del primer dia 181 En retrospectiva. detente"..1: Comparaci6n del nombre de Dios como elemento de nunll'll mundo. valores de nuestro ADN. Aunque sobre nuestro papd en la cread6n? En los capItulos anteriores. se nos muesrra el ( :omo nos dice la tradici()n. deDios en tefras Humano (AnN) en Letras de.ruales aDios (ver la Figura 7. existencia en ocasiones parezcan no ser perfectos. 1".. e1 Dios de la Creaci6n. el mensaje riene esa misma sencillez. auol. al codigo numerico del alfabeto hebreo. se han perdido las conexiones y se ha oscure. que podrfan traducirse como "El que I·ij. produce un cidad del c6digo. convertimos las letras de YHVH de unie diversas formas de conocimiento en una sola com. . el c6digo de la vida es siqlple y directo. tria en un capitulo anterior. es decir. V 6 \I 6 dente dice asf: "Yo soy Dios el Creador. y asf sucesivamente. su idioma original. que redujimos a 8 suman- guaje. El c6digo numerico oculto del ADN de la humanidad arroja estas cifras: 10 + 5 + 6 + 3.

Tal vez e1 mayor misterio de nuestra evoluci6n esre medica. de cambiar el nivel bien ha sido la historia de ajustes de la naturaleza: repetidos de nuestras hormonas y alterar el ritmo cardiaco.. en un sentido Matternes hablan de este fenomeno: "La historia de la evolu. se nos dej61a elecci6n de los atributos no flsicos yespiri.isas. las desilusiones de Ia vida 0 de perdonar a aquellos que han nuestro pasado sugiere que hubo muchas curvas en el camino. En terminos modernos. la diversidad de' . Mas ' cidad de mejorar las funciones inmunes. \ nuestra expresi6n del amor. 3• 4 . nos permiten re- En su contribucion a la Edici6n Especial de fa revista Scientific definir 10 que estas experieneias significan en nuestra vida.. Aunque los f6siles encontrados ofreceri " luei6n. Nuestra capacidad de trascender el dano que causan evidencia Hsica de una progresion evolutiva. Esta com- sugieren que nuestra forma flsica ha cambiado muy poco des. importar que sea ese 'algo'. Dios nos dio e1 mandato de cambiar. prension apoya la evidencia fisica re!adonada con nuestra evo- de nuestros inicios. 2. de julio de 2003) Ian Tattersall y Jay Conforme cambiamos nuescra percepcion. traicionado nuestra confianza. por ejemplo. 15 no. de la compasion.." Tales observaciones sugieren que es obvio que ha ocu- tuales que nos permitirian lograr nuestro potencial y alcanzar ' rrido derta forma de evoluci6n fIsica. La capa- ci6n humana no ha sido la lucha lineal de un solo heroe. esto podda aparte entre todos los seres vivos. Nuestra historia biol6gica ha sido ci6n y el metabolismo.2 es claro que antigliedad y el descubrimiento de restos humanos modernos hemos "evolucionado" para llegar a ser mas que los ancestros que ahora se sabe datan de hace 160. sentimien- ros y emociones. esta bien documentada en la literarura ciendfica y graduales". Las cualidades de nuestra la "perfecci6n". y nuestros pode- res de discernimiento que brotan de pensamientos. I risticas que "indudablemente son inusuales" y afiaden: "Sin Aunque como cuerpo estabamos completos en el momento . American (vol. la respira- experimentos de evolucion. Al ordenarle a la humanidad que "llegara a ser espede que han sufrido los mayores cambios podrIan ser los perfecta". Evoluci6n de la esencia A traves de las caracterIsticas de sentimientos y emocio- La historia escrita que se revela en la mayorfade los textos de la:: nes que nos apartan de otras formas de vida. como la forma en y de participar en la tarea de completar el mundo y nuestra' que manejamos la vida y en que nos tratamos unos a otros. en nuestra forma fIsi. Implican en el hecho de que en algun momenta entre esos "sucesos es- que el acto de la creaci6n se detuvo s610 en 10 que concierne a poradicos" adquirimos las caracterfsdcas que nos dan un lugar 10 que llegadamos a ser. muy literal re-definimos tambien a nuestro cuerpo... interpretarse como una dedaraci6n que se rdaciona menos Tattersall y Matterness hablan en su articulo de nuestro con nuestra perfeccion fIsica y que tal vez se re1aciona mas con caracter unico diciendo que el Homo sapiens encarna caracre- las cualidades sutiles a las que aspiramos como seres humanos. con solo cambiar la forma en que nos una hisroria de sucesos esporadicos mas que de incrementos sentimos. se re1aciona con la forma en que en que Dios detuvo el proceso (es decir. ducta.000 afios (Capitulo 2) ~ que nos precedieron hace cientos de miles de mos. interactuamos con e1 mundo externo: tiene que ver con la con- ca).182 El C6digo de Dios Mensaje del primer dfa 183 Las palabras de Genesis 17: 1 son muy prec. esencia: el mandato de ser co-creadores. de evolucionar atributos intangibles que nos hacen unicos.

genes 6nicos en el genoma humano. en el esfuerzo de cooperacion mas grande de su haee ser 10 que somos". prender mejor la naturaleza de nuestra evolucion. Michael Dexter. el terminar el primer mapa genetico revelo una sor- de moleculas que tuvo como resuftado nuestra especie inteli. un destino que solo esni . la formula quimica del cuerpo humano.~. que tro destino de una mayor perfeccion. del primer mapa genetico humano.'. mientos. finaneiola porcion del proyecto que correspondio a Gran Bre- a una letra de distancia del espejo de la imagen de Dios. se anuncio que e1 mapa genetico parece tener menos mas fuerte y el mas apto.' ~ ser "ellogro extraordinario. Venter dijo: "Esto me gros en la historia de la ciencia. Cuando se inicio el proyecto casi dos nuestra familia global fue "creada". como las que encontramos alleer el ADN hu.lna mezcla "casual" genetica. entonces dene sentido que estemos solos en. director de Wellcome Trust. claro el Dr.184 El C6diga de Dias Mensaje del primer dfa 185 Sin embargo. Para asombro de los equipos que informaron los descubri- el cosmos y que nuestra supervivencia realmente se base en el . do el significado implicito en esa relacion? Si creemos que Pero ademas de responder preguntas sobre nuestra naturaleza nuestra familia humana es el resultado de \. estaba el descubrimiento de que nuevas claves.? Dando un paso mas con nes futuras podrian reconocer como uno de los mayores 10- respecto a los hallazgos de su equipo. se a1canzo un hito en 10 que las generacio- solo tenemos una tercera parte". 5 AI comentar mas a fondo la importancia de la creacion Aunque exteriormente reconocemos la posibilidad de nues.. Entre los primeros hallazgos de nuestro papd en la creacion tambien debe cambiar. para deBnir el cuerpo humano. genes que se calcularon originalmente. descubrimos que ' genes de los esperados. se crda que se requerian unos 100. que somos el producto . se completo el tan esperado primer trazo del genoma encontramos en la Tora: "Ahora caminen frente a mi y Ileguen humano. a ser perfectos" podria no ser una observacion sobre nuestra "Trazar el mapa del genoma humano se ha comparado con imperfeceion.\ presa que pocos esperaban. podria " del tiempo y en nuestra lucha por sobrevivir.' decadas antes. que no estan presentes en el raton". comento sobre las implicaciones de estos descubri- lQut nos hare diferentesl mientos: "Nos fue dificil explicar el mecanismo de control [ge- netico] cuando pensabamos que eran 100. gente y compleja.lel Genesis que dase. As1. Dexter especulo que ade- tra relacion con un poder superior.." los humanos solo tienen mas 0 menos una tercera parte de los mano como un lenguaje original. Despues de 20 afios de dice que no es posible que los genes expliquen todo 10 que nos investigacion. entonces el sentido ". presidente de fa empresa que dirigio a podrfamos encontrar que la respuesta a nuestro misterio esta uno de los equipos que trazaron el mapa: "Solo tenemos 300 en el corazon de nuestro mapa genetico. Si por el contrario. Quizas que se informaron en 2001. tana.. AI final" Segun Craig Venter. jefe del grupo norteamericano del El misterio del Genoma Humano: proyecto. 6 Francis Collins. en la historia de la humanidad". pero creo que es mas que eso". la afirmacion de la version <. hayamos olvida. ~es posible que con el paso mas de ser un logro clave en nuestro periodo de vida. sino una invitacion a trascender los retos que llevar al hombre a la luna.000 genes intencional de una inteligencia superior. Ahora En junio de 2001. puedan ayudarnos a com. cumplimos nues.000 genes.11 . de- cada uno de nosotros enfrenta en la vida.

observo dentes e inesperadas. que huesos. En algun punto del trayecto miembros de nuestra especie y con nuestro Creador. los rdatos antiguos nos lando eI rayo en una ubicacion y volviendo a ensamblarlo en .. podrfamos descubrir mismo instante del tiempo sin chocar unos con otros. e[ tiempo. 11 Descubrimientos re~ obvio a primera vista. perc los ge~es solo explican una parte En anos recientes. Venter reitero esta idea cuando se Ie pidio que hablara sobre la imporrancia de estos sorprendentes La fuerza que esta en tow partes. A brado fIsico teorko Stephen Hawking ilustra este punto de 10 largo de siete milenios de historia. pa es 10 que nos aparta de todas las demas formas de vida. vista diciendo: "Lo que hke fue mostrar que es posible que la tuales. nuestras tradiciones religiosas y la Iiteratura sagrada nos forma en que empezo el universo se determine mediante las han aconsejado reconocer que la vida humana es mueho mas leyes de la cienda. 10 Desde los estudios que doeumentan que es posible que mu- Con solo 300 genes que nos separan del raton del campo. cientes en el campo de la ffsica cuantica que esta evoludonan- mentos y gracias a las mentes mas privilegiadas de nuestros ' do a gran velocidad. mueho mas de 10 que es solo indica que Dios no es necesario".' lar de eseneia espiritual que nos une eternamente con otros prensi6n de los organismos vivos. Casi a nive! universal. un estudio de dos deeadas de duracion para trazar el que mendona Hawking y el "Dios" de las tradidones espiri- mapa del eodigo genetieo humano ha llegado precisamente a tuales podrIan de hecho estar relacionados en formas sorpren- la misma conclusion: "Estamos aquI como especie". "porque tenemos una adaptabilidad que llega mas alia refieren predsamente a la misma fuerza! del genoma". solo estamos tualidad basandose en explieaciones sobre los misterios de la empezando a comprender las implicaciones de tales hallazgos. Esta chis- de los descubrimientos que han llevado a las sofisticadas ex. nuestro tamano y nuestras funciones tienen un eomponente genetieo.. al parecer vez es la misma fuerza que haee que nuestro codigo genetico un dato clave se ha pasado por alto. un filamento particu- la creciente sospecha de que todavIa falta algo en nuestra com. chos atomos coexistan exactamente en el mismo lugar y en el ~que nos hace tan diferentes? AI final. podrlamos deseubrir que se Venter.186 El C6digo de Dios Mensaje del primer dia 187 Sin reducir en forma alguna la importancia de los logros dicen que al primer ser de nuestra especie se Ie infundi610 que del Proyecto del Genoma Humano. Der Spiegel. musculo y pdo. vida.12 hasta que la respuesta a esta pregunta es precisamente la clave que el anuncio de fa Universidad Nacional de Australia re1acio- esta en el eorazon de nuestras creendas y tradiciones religiosas nado con la teletransponacion de un rayo de luz (desmante- mas preciadas. iAl final. sugieren ahora que las "leyes de la cienda" tiempos. nuestras pr:kticas espiri. tambien sea diferente. 9 tro mundo moderno ha superado la necesidad de una espiri- Quiza en los primeros anos del siglo XXI. algunos cientffieos han sugerido que nues- del proceso". y responde a [a emoci6n humana portamientos. Esto no prueba que no exista un Dios. sus hallazgos se agregan a se ha descrito como una "chispa" especial. Tal plieaciones de la vida que tenemos en Ia actualidad. En la revista noticiosa alemana. mente se ha olvidado. 0 simple. Ahora. el renom- y de 10 profetieo que es en realidad el comentario de Venter. "Creo que es claro que todos nuestros com.. todo descubrimientos. carne. se ha omitido. con el uso de sofisticados instru.

. se Ie han .. se relacionan de alguna manera. Las implicaciones de una "Pondre en ti mi espiritu. "16 y el Senor YaHWeH declaro: esta fuerza todavia no ha revelado. para el estudio de la fisica. exactos. una vision mas los dentfficos se encontraron repentinamente en el territorio cuidadosa de los textos editados y restaurados de la antigua inexplorado de un mundo donde la lfnea divisoria entre la ' literatura cristiana. das de las traducciones bfblicas. ' mas de vida.: leza" y "Holograma Cwintico". sentido a nuestra misteriosa existencia. el principio de una sola fuerza to- cion. y textos gnosticos "perdidos" que ya se han mencionado. humana y como empez6 a existir. "17 Aunque tales rdatos podrfan ser fuerza tan sutil y siempre presence ofrece daves que posible. Ai reco. Con este poder en mente. se nos ofrecen claves sobre Tal vez d poder de los nombres solo sea el principio de una este misterio como afirmaciones que declaran que "YaHWeH clave rdacionada can la magnitud de los descubrimientos que . En terminos modernos. A este campo de energfa nunca antes reconocido.. derna y las descripciones anriguas de una fuena de cstc tipo.188 El C6digo de Dios Mensaje del primer dia 189 ona)... ofreee indicios adido- denda tradicional y el mundo mfstico de las fuerzas invisibles· nales sobre la esquiva distincion que nos aparta de otras for- ~mffi~cl~. ofrece un muy necesario puente entre la ciencia mo.: dado nombres como "Mente de Dios". En versos que se encuentran en las versiones restaura- refereneias antiguas de Dios. :. y se describe como una fuena 'II "y el hombre lleg6 a ser un alma viviente" que esra en todas partes todo el tiempo. los temas fue obvio que los fundamentos mismos de nuestra vision del . formo al espiritu humano. se nos la salud de nuestros cuerpos. el reconocer da una comprension mas profunda de las surilezas del alma ese campo. desde sustancias subatomicas diminuras hasta las enormes dopoderosa en la base de la vida establece una continuidad y distantes galaxias.' sideracion actual de que una sola fuerza unificadora es la dave gaciones empezaron a implicar que todos los sucesos de la crea... . hebrea y gnostica.~ Ala luz de los nuevos descubrimientos en el campo cuan- des de luz creadas a partir de un progenitor) que reflejan su ' tico. entre los rdatos mas antiguos y mas diversos sobre los orige- nocer la existencia de una forma de energfa antes desconodda.' que describen son extraordinariamente similares a las revela- mundo estaban cambiando en forma dramatica. careeen del tipo de detalles que nos ayudan a darle mente expliquen misterios como atomos que estan en dos luga. '" humano y la chispa de la esencia de Dios que anima a ese tales descripciones parecen sorprendentemente similares a las cuerpo. Una de la primeras c1aves sobre el misterio de nuestro eanicter el Principio y que demuestra una inteligencia que responde a ' unico es la distincion que estos textos haeen entre el euerpo nuestras emociones mas profundas.. "Mente de la Natura-. preserva como los rdatos mas antiguos de la creacion. dones cientfficas de finales del siglo XX. que ha existido desde. comunicacion entre atomos a grandes distandas. ha surgido la disposicion a regresar a la sabiduda que se comportamiento mutuo incluso cuando se les separa a distan. 15 Ai mismo tiempo.. en los res a la vez. nes de la vida.' los lenguajes obviamente pertenecen a otras epocas. Aunque cias de muchas millas. Muy similar a la con- ~Que podrfa explicar tales observaciones? Nuevas investi. Sin embargo.13 y el fenomeno de los "protones gemelos" (dos unida.14 en los ultimos diez anos del siglo XX .

Lo llam6 Adan.. el manuscrito empieza diciendo que. • nuestro "poder del habla". brea y cristiana. ademas de afirmar que la humani- pos modernos. describe con precisi6n que cualidades concentran en el cacaeter unico de nuestra experiencia en la de los angeles del cielo y de las criaturas de la Tierra se unieron Tierra. "ellos crearon a Adan y 10 acostaron. Se cree que data del tercer siglo de nuestra era. Empiezan su narraci6n describiendo la creaci6n de para crear la espede humana. preservamos el recuerdo del pasado y comparti- de Adan. en el Talmud. bajo la direcci6n de Dios. abri610s ojos del cuerpo" . 20 poderosa. creamos las poderosas vibradones que y ese hombre lleg6 a ser un alma viviente. hemos Adan en un texto titulado Creacion del mundo y del hombre heredado cuatro cualidades de los angeles que contribuyen a ajeno a It. ciendo eeo a otros textos gn6sticos que describen la creaci6n • nuestra capacidad de "caminar erectos".190 El C6digo de Dios Mensaje del primer dfa It) I Entre el tesoro de documentos que se reClJperaron en la La humanidad tiene la sabidurfa Biblioteca Nag Hammadi. es una interpretaci6n mistica de los primeros libros fuerza menor que sana nuestro cuerpo mediante una emoci6n del Genesis. • nuestro"intelecto analftieo". nuestras cuerdas vocales. formado. Cuando crearon a Adan.19 darnente a nuestro mundo fisico. y de Adan como un esfuerzo colectivo entre los angeles de los • la "mirada" de nuestros ojos. nuestra naturaleza unica. por ejemplo. descendi6 y vino a vivir dentro de el. en el un alma" ... conocido como La Hipostasis de los que acaba con dudades enteras durante un terremoto. exploraremos los fundamentos de las tradidones he.\ dad fue creada espedficamente como un puente entre los mun- manidad" como una forma de vida ajena a este mundo y se dos del cielo y de Ia Tierra. su euerpo despierra y el se anima. "21 sanan nuestro cuerpo y cambian al mundo. no pudieron introducir no compartimos con ninguna otca forma de vida en la Tierra. EI habla La narraci6n contiene una descripci6n adicional de la crea.. pero no habia en Nuestro "poder del habla" representa un doble poder que el un alma. Con nuestra ci6n de Adan que distingue claramente la esencia viviente del habilidad de "hacer vibrar" el diafragma en nuestro abdomen espiritu de Adan como algo distinto a su cuerpo y separado de y hacer salir la cantidad exacta de aire entre los musculos de eL "Y el Espiritu lleg6. nos permite hacer audibles nuestras vibraciones. 22 Y son: El texto hace una distinci6n inequivoca entre el euerpo de l Adan y el alma que entra en ese cuerpo despues de que se ha . hasta la Arcontes. Los textos Mandeanos distinguen a la "hu. con nues- Para ver con mas claridad 1a naturaleza precisa del espfritu tras palabras. Ademas. por ejemplo. Ha. S610 despues de que se infunde en.18 S610 despues de que "el resplandor de la vida La ciencia ha demostrado que la vibraci6n afecta muy profun- habl6 en el [Adan]. habia un extrafio texto de los de los angeles en cuerpos de Ia TIerra Mandeanos. la unica secta gn6stica que sobrevivi6 hasta tiem- La Haggadah. delos. Desde la magnitud de la fuerza Otro texto gn6stico.Adan la misterio- sa fuerza de la "vida". los efectos son el resultado de la vibraci6n. . De manera espedfica. mos con otros las experiencias que mueven nuestras almas.

3.manera que es exclusiva de nuestra especie. es el poder de nuestro do de "las bestias del campo"23. era fe- bre nuestra actitud mental. Gracias al don de "caminar erectos". lradicionales que identifican a Dios como "EI". ocurre mucho mas que un simple proceso tor afiadi61as idlicas] . de amar u fcmenina. estaba impregnado con una fuerza que. Se dice que con los:' con especial cuidado. la Frase afirma claramente que la Con el don de la "mirada" que nos dieron los angeles. rar las consecuencias de nuestras acciones antes de actuar. "Segregamos el material de desperdicio de nuestro cuerpo". y as! como ojos se nos dieron "ventanas del alma". el pasaje im- . naturaleza de Dios. intentando 2. "Morimos". Desde la perspectiva de"· dos con la naturaleza del alma en sf tambien se encuentren en que la vida es un reflejo de nuestra capacidad consciente.. y de nosotros mismos en una forma que no se ha otorgado a' Tal vez algunos de los detalles mas importantes relaciona- ninguna otra criatura sobre la Tierra. nuestros sentimientos menina. les de Adan sean masculinos. intercambiamos cantidades enormes de informaci6n so. lugar de vivir en un estado perpetuo de reacci6n. cendientes de Adan. los textos ofrecen una narra- nuestra capacidad de "erguirnos" y "elevarnos por encima"i ci6n que describe c6mo era Adan despues de recibir la esencia de las tribulaciones y desaffos con que nos reta la tierra que de Dios como su alma. tenemos la chispa que nos une con nues- hemos tenido la habiJidad de construir nuestro mundo. con el mensaje que transmitimos. podemos conside- 1. "Propagamos nuestra especie". AI describir las cualidades de la chispa de pisamos. Aunque esto no impide que otros aspectos espiritua- y deseos de una . "arreglar" las elecciones que lamentamos. contrario a las interpretaciones odiar. permitiendo la movilidad necesa- ria para llevar a cabo las acciones que consideramos dignas de ' Es obvio que los autores de estos textos crelan que. tambien tenemos cuatro caracteristicas que hemos hereda- incluso decidir si vamos a compartirlas. de nuestras manos y brazos. e' les. cada esencia que se infundi6 en el primer ser de nuestra especie era uno de nosotros tiene el poder de sanar 0 destruir. el texto hace una referencia clara e inequivoca al genero La "mirada de nuestros ojos" es tal vez el mas elocuente de: del alma de la humanidad. Gracias a nuestra postura erecta. En este pasaje se nos dan dos claves importantes sobre la mirar a otros y la forma en que permitimos que orros nos mi. Ella es la imagen de Dios. Con dtulos como Los Angeles y la creaci6n del postura erecta tambien podria verse como una metafora de Hombre y La creaci6n de Addn. Primero. Cuando miramos a' Dios llena el mundo. damos libertad al usa 4. en '.24 de luz y 6ptica.' Para equiJibrar los rasgos que compartimos con los ange- tras creencias con otros utiJizando nuestro poder del habla. se nos dice que el cuerpo de Adm ren. A rraves de la manera en que elegimos para. por su disefio. "intelecto analitico". el alma Hena al cuerpo humano" [el au- alguien a los ojos. como des- dedicarles nuestro tiempo. nuestra la Haggadah. "Comemos y bebemos". de tro Creador de una manera que no compartimos con ninguna expresar nuestras emociones mas profundas y de cuidar de otros' otra especie. nuestra salud. A traves del intelecto. "Pues Dios dio forma a su alma los dones que nos otorgaron los angeles.192 El C6diga de Dias Mensaje del primer dfa 193 Lo que nos permite elegir cuando y c6mo compartir nues. Dios. En segundo lugar.

Hasta la fe- Quid la raz6n de nuestro caracter llnico sea que nuestros cuer. los textos antiguos son muy misterio de 10 que nos hace diferemes permanece oculta den- claros cuando dicen que Dios s610 infundi6 su espfritu perso- tro de la diminuta molecula que contiene el c6digo de la vida nal en la vida humana. con palabras de otras epocas. se nos ofrece la en cada una de las celulas de nuestro cuerpo. Quiza la respuesta al que equivalen al nombre de Dios. La Haggadah apoya esta distinci6n. pero combinada con los pasajes ' que sugiere que pasajes como los de la Haggadah son s610 me- mas antiguos y mas espedficos. taforas del pasado. asumimos el papel de "recipiemes". Con esta distind6n. cha. Aunque toda vida esta hecha de elementos do en el milagro de cada vida humana. Es obvio que esta frase tambien describe el momento de la Si nos aventuramos mas alla de la sabiduria convencional cread6n de la vida humana. contribuye a nuestra compren.27 si6n de la naturaleza del cuerpo y el espfritu por 10 general se No fue sino hasta finales del siglo XX que la cienda moderna limita al pasaje familiar de la version bfblica del Genesis: "El confirm6 que eJ mundo que nos rodea en efecto refleja nues- Senor form6 al hombre del polvo del suelo e insufl6 en sus tros estados emocionales mas profundos. Por otra parte. Dios l Que significa e[ hecho de teneT comparti6 parte de SI mismo al "infundir su aIiento" en nues- el nombre de Dios en nuestro cuerpo? tra especie.a con- en cuya formacion intervino Dios a nivel ffsico y personal. nuestra compren.194 El C6digo de Dios Mensaje del primer dfa 195 plica que la naturaleza femenina de alma de Adap es. igual en todo el universo. A traves del poder misterioso del alma. nuestro c6digo generico podr. El comun deno- oportunidad de mejorar nuestra vida ydejarles un mundo mejor minador de las descripdones amiguas es que a Adan. seguimos teniendo ese pape!. misma: nuestro ADN. Con el primer acto de la creaci6n de la vida humana. veremos que nos presentan una nueva ma- si6n general del car:icter unico de la esenda de nuestra exis. AI hacerlo. un concepto poderoso. En vista de que las traducciones tradidonales de la identifica al mundo que nos rodea como un espejo de nuestra Biblia no cuentan con este nivel de detalle. primero de nuestra especie. dotados de manera unica con el esplritu divino. naturaleza colectiva: "El mundo es un reflejo del hombre". todo el mundo en miniatura". el plos es obvio que el "espiritu" de Dios es una fuerza distinta y cuerpo de cada ser humano se describe como un "microcos- separada que se introdujo en Adan despues de la cread6n de su mos. especificando que el hombre es la llnica criatura bajo el delo Desde esta perspectiva. Aunque estos textos podrfan ser la fuente de cuestionamien. se Ie infundi6 un don que no dene de ninguna otra criatura sobre la Tierra. siderarse una antigua f6rmuJa que define la calidad dd red- . al menos "El Hombre es el unico que fue creado por la mann de en parte. El texto continua diciendo: "Todas las demas criaturas fue- tos sobre el genero de Dios en la Tierra.: nera de comprender 10 que significa llevar el nombre de Dios tenda. identica a la de su Creador. a partir de estos ejem. el texto cuerpo. ron creadas por la palabra de Dios". 28 De nuevo. pues el antiguo secreto de la pos estan disenados espedficamente como recipientes de la creaci6n de este recipiente se ha preservado y se ha transmiti- "chispa" de Dios. · "26 D lOS. se nos narices aliento de vida y result6 el hombre qn ser viviente"..25 ofrece. como el a nuestros descendientes de una manera que no esta al alcance .

AquI en las regiones terrenas • Estamos unidos unos a orros) y a toda vida. aunque logrado.. retos mas grandes de la historia.196 El C6digo de Dios Mensaje del primer dfa 197 piente que es necesario para llevar la esenc~a de Dios. al describir como los recipientes de la luz de Dios (las "vasijas" que se describen en • Estamos aqui "con un prop6sito". dra de toque que nos recuerda que: Expandiendo la descripeion de nuestros cuerpos como estructuras que albergan la esencia de Dios. la manera en que vivimos nuestra vida. las permanece como un sfmbolo viviente e inmutable. En cada momento del dfa. la referenda es mas directa. se han sometido a las ediciones. As! como gir la manera de ser mejores. A rior de nuestras celulas es un recordatorio de nuestro poder y medida que se desenvuelve el misterio de las ensefianzas. . espirituales inferiores de la Tierra. el tema se convierte en una dec1araci6n directa: "Tu "J las que han sido sometidos los textos convencionales. cuerpo del hombre y e1 Espiritu Santo que mora en su inte. Cuando los sucesos de nuestras vidas nos ponen pruebas rior. se hicieron pedazos y cayeron a las regiones de un acto intencionaI de creacion. los textos hebreos. un principio y un fin. referenda se vuelve mas directa. creamos la rituales sefialan que nuestros cuerpos son estructuras constrUl. tambien posee el poder de revelar que nuestras vidas se presenta como una pregunta que se hace a quienes escu. esta .29 En el tercer capItulo tecnologfa que posee el poder de destruir todo 10 que hemos de la Carta a los Corintios. Las palabras chan: "~No saben que son el templo de Dios. tanto los textos can6nicos como los gn6sticos estan de que rebasan la razon. ta a profundizar el misterio aun mas. e1 mensaje del interior de nuescras celu- acuerdo en que s610 la forma humana posee la capacidad de al. El Evang~lio de Juan dice que Una gran ironia de nuestra epoca historica es que la misma Jesus "hab16 del templo de su cuerpo" . una pie- bergar al esplritu de Dios. forma y pudieron comunicar su luz al mundo de los humanos. El men- cuerpo es el templo del Espiritu Santo que estd en ti':31 [El auror saje permanece imaqo. calidad de nuestra vida. las vasijas tomaron nueva nera inextricable. omisiones 0 interpretaciones a rna carta. el mensaje que esta en eI inte- pel como templos que al principio aparecen en forma sud!. solo noso- frases cuyo significado es muy claro. y se les puede juzgar un espacio sagrado. muchas tradiciones esp~­ tros participamos en los sucesos de nuestro mundo. como era el primer dfa de nuestra exis- agreg6 las italicas]. afir- se refieren a nuestro cuerpo como el "templo" que atberga la mamos 0 negamos el don de nuestro caracter unico segun santa esencia de Dios.. Habiendo marcado la distinci6n entre el tencia. A1 enfrentarnos a los En el Nuevo testamento vemos referencias de nuestro pa. • No estamos solos. la Cabala nos invi. y tenemos el discernimiento para ele- das para contener el cielo en el ambito de la Tierra. son una expresion de algo vasto y maravilloso. gnosticos y cristianos como un exito 0 un fracaso. Solo en nuestro mundo los dlas los templos Hsicos se construyen para albergar en su interior tienen prop6sito. y que el esp!ritu que estan en e1 interior de cada una de nuestras celulas nunca de Dios habira en ustedes?"30 En el sexto capitulo de esta mis. de nuestro caracter unico. Con Como una expresi6n del poder de la creacion. de ma- donde conviven las tinieblas y la luz. como resultado el Capitulo 5). .

dieron origen a las primeras celulas vivientes? (0 intervi.esencia de la vida a partir de materia carente de vida nunca se ha docu- Dios. casi un milagro. Francis Crick. la posibilidad de que elementos combinados al qufmicas al azar. no existe una teoda diato que la estfuctura de la celula nunca se entended como sc viable que describa eI origen qu{mico de la vida. hecho. no una fuerza diferente. Suponiendo que algu- Aunque definiciones de la vida de aspecto tan esteril podrian j nos de los factores que apoyan a las formas de vida mas sim- describir 10 que hace la vida. Sir Fred Hoyle. noma y matematica de la Universidad de Cardiff. "Un hombre honesto.' que se calcula dene la Tierra. y sugieren que la vida es el resultado de "sistemas quimicos' El not~ble astr6nomo britanico.198 El C6digo de Dios Mensaje del primer dfa 199 • Compartimos una caractedstica unica: la.32 En una porcion pos. . sedan mas 0 menos de 1 a 1040. y la astro- complejos y organizados que se propagan. en el interior de la "sopa" pristina de la crca. la posibilidad de que esto suce- terior del mismo texto. en Gales. James Watson describe el caracter unieo mundo para formar la vida de nuestros cuerpos? yel misterio de las celulas vivas.000 ceros!). En el Capi. azar produjeran una vida compleja en los 4. De demas seres vivos de la Tierra. origen de la vida parece ser. ple.: la magnitud real de esta imposibilidad. y que En su texto clasico Molecular Biology ofthe Gene 36 {Biolo- desemperro el pape! de organizar las sustancias quimicas del gia molecular delgen}. comento o una casuaIidad? sobre las numerosas y diversas condiciones complejas que de- En el hecho de reconocer las mfnimas posibilidades de que la" berian existir para que apareciera el primer destello de vida. en cierto sentido. el tulo 1. Esta es la cuesti6n: ~Reacciones de la mitad. vida se originara por casualidad. y evolucionan y cambian Chandra Wickramasinghe nos dan un contexto para apreciar en respuesta a modificaciones a largo plazo en el entorno''. que aun no se ha identificado. armado con todo el conocimiento dis- cado del mensaje del interior de nuestras celulas.3' . se vida lleg6 a existir.. los autores profundizan su definicion' diera es pnkticamente nula. es minima. ha sido tema de con. que haberse satisfecho para ponerla en marcha". que recibio el Premio Nobel. ponible a la fecha. de vista de la quimica. crecen. en el mejor de los casos. usan su entorno y se protegen de el.34 En cuanto a do llegar a cierto nivel de complejidad" . la crcaci6n de . se da una definicion de sistemas de vida desde el punto '. podrfamos captar el signifi. los dendficos reconocen que la posibilidad de que la vida surgiera meramente al azar es. calcula que las posibilidades de que una combinacion aleato- El que la vida haya surgido por casualidad 0 mediante una ria de moleculas produjera incluso la forma de vida mas sim- serie intencional de sucesos ordenados. metabolizan.35 Aunque redujeramos esta cifca con un factor aproximadamente 400 arros. ples hayan existido en algun momento del pasado remoto..5 billones de arros cion. solo podrfa decir que. l Es [a vida una eleeci6n mfnima." casualidades y probabilidades. por el momento. "Debemos admitir de inme- En el momento de escribir este libro. y se describe la vida como "un patron de tomando en cuenta las numerosas condiciones que tendrian comportamiento que dertos sistemas qufmicos alcanzan cuan-. no abordan la manera en que la. de tal manera que eso nos aparta de todos los mentado dentificamente en condiciones de laboratorio.000 (ies dedr 1 seguido de troversias desde el nacimiento del metodo ciendfico haee 40.

sino al creador de ese patr6n.. Durante una conversaci6n de ese tipo. producida en la distanda por un Bautista invisible". tres. 0 son restos de una construcci6n intendo- tro cuerpo que desaHa toda explicad6n mediante la sabidurfa nal de epocas remotas? Aunque la soJuci6n a este misterio podria convencional moderna. melodfa misteriosa. tal vez la importancia de este c6digo JIegue a creaci6n. el descubrimiento de orden en el fun- damento de la vida podria considerarse una senal de inteligen- cia en el interior de esa vida. empe. no solo preserva un mensaje especial. mayoria de las macrocelulas que se encuentran en el interior. 'J fuerza de intenci6n aliadimos e1 hecho de que se ha reconoci- Durante entrevistas candidas en sus ultimos alios.37 .. lados. La revelaci6n de que los cuatro EI orden como sefiaI de inteligencia elementos de1a vida representan las letras dave de un alfabeto En la naturaleza. la JnCOl- . Desde el punto de vista hist6rico. 39 de la celula. la presencia de principios matematicos cla- resultado de una "casualidad" en la creaci6n.: mismo mensaje. por resulrado de fa union entre un hombre y una mujer. son AI parecer hay algo relacionado con el proceso que se reali-.200 EI C6digo de Dios Mensaje del primer dfa 201 entiende la estructura de las moleculas de agua 0 de glucosa.: to de la naturaleza.. suglere que son pro- saje en clave que esni en el interior de cada una de nuestraa ducto de un diselio premeditado. EI descubrimiento de 10 que al No s610 permaneceni sin soluci6n la estructura exacta de hi. mencion6 en confian~ La presencia del nombre de Dios. De manera similar. el men. pero mi imaginaci6n no puede dar for celula de la vida. A partir de tales observaciones. es en que se basa la vida.000 imagenes fotografiadas durante la Mi. Aunque las estructuras piramidales de dos. EI misterio de que "Dios sea Uno" la presencia misma de orden se ve en ocasiones como una se- lial de que algo mas grande esta "aHa fuera". muestra con mayor magnitud e1 grado de orden que puede describirse mediante f6rmulas universales. en las 60. La existencia de patrones predecibles y repetibl un mensaje. al igual que el hecho de que ese alfabeto forme inteligencia.. Ja pregunta permanece: (Son produc- za en el interior de la milagrosa f:ibrica de cada celula de nues.. cuatro y cinco podran conocerse vagamenre". Por tanto.f requerir una misi6n con tripulantes humanos que diera una zamos a perdbir 10 poco probable que serIa que fueramos el respuesta definitiva. todos danzamos al rirmo de Un( que el mensaje en SI riene su propio significado.. escrito en dave en cada za: "Veo un patr6n. provoca una controversia que rodavia existe en la actualidad. madre y nuestro padrf!. Si a estos poderosos indicadores de una ejemplo de 10 que queremos decir con la palabra orden. al igual que su sentir sobre el origen de ese ordcnft. el orden se ve a menudo como una selial d. obvias para los expenos. sino que sus ubicadones relativas en ellas s610. celulas adquiere un significado atin mayor. Pm de«i6n 0 por casllalidad. anriqufsimo.' sian Viking a Marte en 1976. ser mayor que el descubrimiento en sf.. parecer eran estructuras artificiales en la superficie del planeta. · estructuras40 clertamente ve en Ias proplas • . nuesrra ejemplo. venimos al mundo como Es precisamente este tipo de orden 10 que se observ6. AIbe t do que cada celula de nuestro cuerpo lleva precisamente el Einstein comparti6 su creencia en un orden que subyace a .38 En nuestra busqueda del sentido de nuesrra vida. ubicadas a 10 largo de zanjas de millas de longitud.

y cuando se suman el4 yel 5 que 10 com. que en hebreo se escribe Av.. (cual es la fuerza invisible que "or- dena" a las celulas que crezcan y se dividan precisamente en . numeros. resulta 10 siguiente: bras madre. el9 es Adan. que puede reducirse a 5. es si el 6vulo y . padre y Addn transformadas a] lenguaje comun de los numeros. uno menos que 9. la siguiente "ecuaci6n" que representa la uni6n del padre y la madre para producir un cuerpo huma. podemos comparar "manzanas con manzanas" y A D M examinar las palabras a un nive! mas profundo. Uno de. 0 se necesita alga mas? La palabra hebrea que significa madre se escribe EM. A v (Ale£) = 1 (Vet/Bet) =2 de Dios. Un proceso similar para de fa perspectiva numerica de Ipocas remotas podrla darnos una la palabra "padre". Con ellenguaje de los resultado una nueva vida dentro del vientre materno. (Aid) = 1 (Dalet) = 4 (Mem) = 40 Como Adan (la humanidad) es el resultado de la uni6n del padre y la madre.dvenimiento de la donaci6n humana. esto combinado de 45. vida humana. y la madre con el 9 de Adan. EI ponen. Con las pala- dficos de cada letra.. no ocurre si sumamos el 3 del padre y el 5 de la madre. sin embargo. dan como resultado el valor que representa a Adan: 9. En el Capitulo 4 se dijo que la palabra hebrea para el· 1 + 2 =3 primer hombre de nuestra especie.202 EI C6digo de Dios Mensaje del primer dia 203 da del ADN que aporta cada uno de sus cuet:pos dene como ': En terminos numericos. resultado de esta simple operaci6n es 8. primero es tambien el espermatozoide son 10 unico que se requiere para crear la • necesario encontrar sus valores ocultos. . no. Este aparente misterio Sf rcsuelve 1 + 4 + 40 45 con un solo pasaje de 1a Tara y con fa visi6n profunda del 4 + 5 9 Rabino Benjamin Blech. M la forma correcta y en el momento preciso para producir un (Alej) = 1 (Mem) = 40 nifio 0 nina saludable? (Quien es exactamente el "Bautista" que mencionaba Einstein como la Fuente de nuestra "melo- AI sumar estos valores individuales se produce el valor combi- dia" c6smiea? Un examen mas cuidadoso d~l nacimiento. padre y su madre. Aplicando los valores numericos espe. es ADM. podemos ahora explorar la relad6n de Adan con su los misterios de la vida que en la accualidad se ha intensificado . esperarfamos que su nombre tuviera un va- AI sl!mar estos valores individuales se produce un nuevo valor lor equivalente a los otros dos combinadas. s610 esta compleca cuando se Ie agrega el valor numerico.41 De manera espedfica. resultado: AI igual que Adan. des- nado de 41. '~dan" (escrita sin la se.. E. AI sumar estos numeros se crea el valor de 3. el valor numerico de Adan. (Son suficientes. gunda voca!) . Sin embargo. Para determinar como se re!acionan el padre con el'.42 tiene este dave.

Aunque muchos investigadores interpre~an los pasajes de + 10 + 6) obrenemos un nuevo valor de 26. El Rabino Blech senala.n detnls de la creaci6n de la propia i Alefse han sometido a estudios completos y ciertamente mere-. Con la familiar elocuencia que caracteriza al poeta William meros. Madre + Padre + Dios = Adan ro para coincidir con el mimero de ''Adan''. Yod (~). Alef es tambien una referenda indirecta y en clave Dios dene un valor numerico. cada Yod recibe el valor de 10. Las razones mas profundas y los: que este completo. Ademas de la union entre las cantidades terrenas que aportan e1 hombre y la mujer. hidrogeno y nitrogeno. mente igual a "Dios". mientras que a Vav se Ie ' Blake. LA ECUACION DE LA VIDA cen una exploracion mas profunda. dos por nuestra cieneia. En la esquina superior dereeha yen la" carbono. de un poder superior. Alef(tt. que to hebreo. por ejemplo. Si sumamos estos valores individuales (10 palabras: .).: rior al heeho. el numero 1 se relaciona con la primera ritu de Dios debe esrar presente en Adan (la humanidad) para letra del alfabeto. mos en e1 Capitulo 4. dos palabras cuyos valores se relaeionan fundo.204 EI C6digo de Dios Mensaje del primer dia 20-. el "material" con inferior izquierda de Alef. que no podemos separarnos. e1 espi- En el alfabeto hebreo. Estas Yod'.' misterio de que a las palabras padre y madre les falte un nume. El al nombre personal y a la presencia de Dios. temas complejos que esta.}. "Dios" es el valor que falta en la ecuaeion de padre y madre C6mo comp[etar [a ecuaci6n de [a vida para que su resultado sea Adan. nos dice en terminos utiliza- escan divididas por la letra inclinada vtw (. se resuelve el misterio: del pasaje que dice "El Senor es Uno". ditos. Para los propositos del. de la presencia resolvemos el misterio. En la forma usual de analizar las letras hebreas como nu. esta es una declaraci6n directa de que el valor numerico . ni apartar en forma separada cada una de las letras que forman a Alif. Si consideramos . AI examinar el origen deAlef. Aunque tal vez el codigo no descri- que es la primera letra del nombre de Dios. Lo que vemos como aromos de ellas se usa dos veces. YHVH! referencias de la Tora son espedficas. Pero en el 1 hay un misterio aun mas pro. tienen tambien una relacion natural. el resume nuestra reIacion con Dios en unas cuantas asigna el valor de 6. el que el eodigo sea la vida nos dice que Dios de hecho formada por la union de dos letras separadas. ba con precision quitn es Dios. jexactamente el las tradiciones antiguas como metaforas. Mas que un mensaje agregado a la vida como algo poste- Como revela e1 Rabino Blech. Ademas de represemar directamente al numero 1 en el alfabe- que el Genesis declara con toda daridad. muy a menudo las mismo valor que dene el amiguo nombre de Dios. Aplicando la regIa de relaciones numericas que explora- de Dios es el 1. a ninguna orra forma de vida en este mundo. Desde esta perspecdva. oxigeno. la antigua letra Ale!esta. "Uno" es literal- Senor es Uno"43 [el autor anadiolas italicas]. "El Senor es nuestro Dios. se eneuentra la letra mas pequenat que se haee la vida. 5 + 3 + 1 = 9 tro analisis. Para algunos eru. limitaremos nues-. es Dios. una de:) existe como nuestro cuerpo.

la simple union de "madre" y "padre" no es suficiente para producir RESUMEN DEL CAPITULO 7 eI nombre de "Adan". aunque compartimos los atributos del nombre de Dios. rior exista un mensaje. AI aceptar la sabiduria de . podrfa verse como la senal de una inteligencia pueda hacer las e1ecciones cotidianas que la acercan mas a la' subyacente. sugieren la presencia de una tos de nuestra vida y las diferencias que alguna vez nos han: inteligencia de mayor magnitud. se nos dice que sencia numerica de Dios. incluyendo a los responsables del descubrimiento del codigo genetico. grado tan alto de orden y el hecho de que en su inte- esta declaracion. no somos iguales aDios. dividido. '. Solo cuando se suma a la ecuacion la pre- • En ellenguaje original de la Tora. "Dios lIeg6 a ser como nosotros. Falta algo. sales. Blake agrega describirse mediante formulas matematicas univer- que Dios existe como la humanidad para que la humanidad. • En la ecuacion hebrea para la vida. . • La aparicion de orden en la naturaleza. perfecci6n del Creador. AI parecer existe una fuerza de la vida que la dencia no ha sido capaz de explicar hasta la fecha. las cifras se equilibran y la Dios detuvo la creaci6n antes de que estuviera com- formula esra completa. nosotros en el". que podrfa Ademas de describir nuestra relaci6n can Dios. pleta y ordeno a la humanidad que "caminara en su presencia y lIegara a ser perfecta" (Genesis 1: 17). • Un analisis de los valores numericos que represen- tan el ADN de nuestras celulas (YHVG) y los va- lores que representan el nombre de Dios (YHVH) revela que. el primero de nuestra especie. • Muchos ciendficos.206 El C6digo de Dios Mensaje del primer d[a 207 "Dios es el hombre y existe en nosotros Y. para~ • El hecho de que el codigo de la vida contenga un que nosotros fueramos como el". Los eruditos sugieren que esta dedaraci6n podrla referir- se menos a nuestra perfeccion como cuerpos y mas al hecho de que la esencia espiritual que esta en el interior de nuestros cuerpos desarrolle su potencial. sugieren que la probabilidad de que la vida haya surgido "por casua- lidad" seria casi un milagro. se nos concede eI poder de trascender los re.

Alimenta a los hambrientos. Alivia e[ dolOT de quienes sufren hambre.. -RABINO BENJAMIN BLECH . "Los pueblos no pelean porque sean malvados.. Ayuda a los n¢cesitados. La guerra se libra ante todo a causa de 10 que es central... Este es el me4io paraevitar la guerra y asegurar [a granbendicion de la pazll.. eI pan...

Capftulo Ocho

lOUE HEMOS APRENDIDO?
Como sobrevivir en nuestro futuro
con las lecciones de nuestro pasado

C on las recientes celebradones de fin de siglo todavfa fres-
cas en nuestra mente, muchos dendficos. organizado-
nes e individuos que se preocupan por la humanidad, est:in
planteando la unica pregunta de la que dependen muchas
otras: ~sobreviviremos orros den afios como especie? De ma-
nera espedfica, ~sobreviviremos otro siglo modificando ge-
[1(~ticamente nuestros alimentos, realzando nuestro cuerpo y
creando industrias que acaban con la vida en los oceanos, rios
v bosques? Quiza 10 mas importante es si nos atreveremos a
conrinuar desatando el aplastante poder de la naturaleza como
cl arma mas letal que se ha conoddo en la historia de la huma-
nidad.
Hasta mediados del siglo XX, no tenia sentido plant('ar
t"sas preguntas. En la actualidad, eso ha cambiado. Como re-
\lIltado de innovaciones ciemlficas que se desarroUaron du-
r.lnte la Segunda GUe'rra Mundial. /0 que' induye las de la fllic:a

212 EI C6digo de Dios lOue hemos aprendido? 213

cuantica, la genetica y la electronica miniaturizada, nuesrras bebederos, y que conrinuaban en los banos 0 en las cafererias,
opciones recnologicas tienen ahora consecuencias que dura-; par 10 general seguian dos escuelas de pensamienro.
ran cienros de anos y a 10 largo de muchas generaciones. Una manera de pensar afirmaba que nuestra capacidad para
La pregunta sobre nuestro futuro se relaciona menos con'; "rorcer" las fuerzas de la naturaleza era en si la licencia para
el desarrollo de estas tecnologias en si, y mas con la sabiduria: explorar esas tecnologias al maximo. En otras palabras, como
necesaria para utilizarlas en nuestra vida. Solo porque rene-, tenemos la capacidad de modificar patrones climaticos y crear
mos la capacidad de modificar los parrones climaticos en vas-' nuevas farmas de materia y de vida, deberiamos hacerlo para
tas regiones de la Tierra y de crear nuevas formas de vida, por: ver hasta donde nos lIeva la tecnologia. Esta linea de 'razona-
ejemplo, itenemos derecho de hacerlo? mienro a menudo lIevo a otro nivel de justificacion que sugie-
re que si no se suponia que deberiamos hacer estas cosas, nunca
habriamos descubierto los secretos que las hicieron posibles.
lOut nos da el derecho de jugar a ser Dios?
Una segunda escuela de pensamienro que era mas conser-
Desde mediados de la decada de 1970 hasra el principio de la', vadora, sugeria que solo porque tengamos la capacidad de di-
decada de 1990, tuve el privilegio de trabajar entre los cienti- senar la vida y la naturaleza, eso no necesariamente significa
ficos e ingenieros mas brillantes desarrollando algo de la rec-,~ que tengamos derecho a ejercer nuestro poder. Para quienes
nologia mas avanzada que se haya registrado en la hisroria. apoyaban esta linea de razonamienro, las fuerzas de la natura-
Para las corporaciones y las universidades, esra fue una epoca leza represenran "Ieyes" sagradas que no deberian manipular-
de gran dinamismo; Esrados Unidos esraba re-definiendo su' se. Argumenraban que disenar a la medida los codigos gem:ticos
dependencia del perroleo extranjero y esraba luchando par".' de nuestros hijos antes de nacer, y ajustar los patrones climati-
conservar su superioridad durante la Guerra Fria y el progra~ cos a nuestras necesidades es "terrirorio vedado", y viola un
ma espacial. No es sorprendente que un periodo de investi"; anriguo y taciro deber sagrado. Aunque no necesariamenre se
gacion ran intensa estuviera acompanado de una profund:J., dice con estas palabras, el cruzar la linea entre usuario y crea-
introspeccion. En un sentido muy real, los cientificos estaban dor, nos coloca en una posicion en la que estamos compitien-
explorando los limites de sus recien descubiertas capacidades do con el poder de Dios.
para alterar la vida y nuestro planera a un nivel que a 10 largo' Enronces la cuestion se relaciona con 10 que nos da el dere-
de la hisroria se Ie habia dejado aDios y a la naturaleza. cho de hacerlo. Este argumento a menudo estuvo acompana-
La responsabilidad que acompana a un poder tan asom- do por la metafora de los numeros en el velodmetro de un
broso fue 10 que encendiolos candentes debates sobre nuestro coche. Solo porque el velodmetro marca velocidades hasta las
derecho etico y moral de utilizar ese tipo de recnologias; deba- , 160 millas por hora, jesto no necesariamenre significa que uno
tes en los que participe con enrusiasmo siempre que tuve opor- deba conducir su vehieulo a tal velocidad!
tunidad. Los argumentos que encendian las discusiones que Quizas es precisamenre esta metafora del velodmetro 10
empezaban frente a maquinas que expenden comida y junro a que ilustra una tercera lfnea de razonamienro. Si eI velodme-

214 El C6diga de Dias tQue hemas aprendida? 215

tro indica que el vehiculo puede viajar a HiD mi!las por hora, , ternas. Por ejemplo, en caso de que un poder hostilliberara un
es muy probable que alguien intente hacerlo en a1gun mo- A- arma biol6gica contra poblaciones que no estaban preparadas,
mento. AI parecer es a1go inherente a la naturaleza humana ipodrfamos crear un cambia interno en nosotros que nos hi-
Ilegar a los limites y !levar las capacidades al extrema. Sin em- ciera inmunes a esa bacteria 0 virus? Como ya existe la tecno-
bargo, la clave es que cuando Ileguemos a estos limites, tam-' logia que se describe en estos escenarios y en muchas otros que
bien tengamos el poder para determinar el tiempo, ellugar y no podrfamos describir can justicia en este libro, el debate no
las condiciones de la prueba que vamos a realizar. se centraba en si esto era a no posible, sino en que se debiera 0
Podriamos encontrar un tramo desierto de carretera con no desarrollar.
buena superficie, en un dia en que el clima es seco y las posibi- Por ejemplo, si re-disefiamos nuestro ADN como respues-
lidades de tener un accidente son minimas. 0 podriamos ac- ta a una amenaza biol6gica cercana, ic6mo afectarfa esa elec-
tuar impulsivamente y poner a prueba los limites del vehfculo ci6n a la habilidad de nuestro cuerpo para protegernos de
en una autopista con mucho tr<ifico, pon,iendonos en peligro y . nuevas amenazas futuras? iCuales son las consecuencias a largo
poniendo en riesgo la vida de DrrOS. En cualquiera de estos plaza de cambiar la f6rmula genetica de poblaciones enteras,
• !
escenarios, se estin poniendo a prueba los limltes. En uno se : una formula que ha requerido de miles de afios para alcanzar
hace con responsabilidad, y en el otro con descuido. Tal vez cI c6digo exitoso que tenemos hoy en dial iEs posible que sin
los mismos principios se aplican a la forma en que Ilegamos darnos cuenta amenacemos la supervivencia de nuestra especie
a los Ifmites de manipular las fuerzas de la creaci6n. ; por ignorar la forma de aplicar 10 que se cree es una medida que
Durante el tiempo en que trabaje en la industria de la de- ;' salvada vidas sin comprender plenamente sus consecuencias?
fensa, no era extrafio que las conversaciones se centraran en el Durante los dias de la Guerra Fda, esta era la clase de pre-
desarrollo de tecnologias relacionadas con armamento. AI final guntas que casi diariamente hadan quienes eran responsables
de la Guerra Fda, cuando los arsenales de las grandes potencias; de hacer realidad ese tipo de posibilidades. Mas de una decada
se estaban reduciendo, estas discusiones invariablemente Ileva- despues del fin de la Guerra Fda, siguen siendo algunas de las
ban a la pregunta sabre que tecnologias reemplazarian a las ar- preguntas mas urgentes a que se enfrentan las sociedades pre-
mas nucleares en el futuro. Se hablaba de poderosos rayos hiser sentes que se basan en la tecnologia, preguntas que deben res-
instalados en la superficie de la tierra que podrian hacerse re- ponderse a medida que continuamos nuestra busqueda en el
botar contra espejos en 6rbita para destruir objetivos en la Tie- rerritorio inexplorado de disefiar la naturaleza y la vida. Hoy
rra, de bombas de neutrones disefiadas para acabar s610 con la en dia, nos encontramos en un mundo en el que hemos con-
vida, dejando los edificios, autom6viles y hogares intactos. Una tiado a la ciencia y a los cientfficos la tarea de guiarnos en
decada antes, hablar de tales escenarios, que en ese momento , nuestro viaje de exploraci6n, un viaje en eI que existen pocas
se abordaban con seriedad, habrfa parecido ciencia ficci6n. I'robabilidades de echar marcha atras. Nuestra esperanza es
Ademas de hablar de armas ofensivas can bases externas, que mientras aprendemos a controlar las fuerzas de fa crea-
en ocasiones tambien se hablaba de tecnologias defensivas in- Lion. sobrevivamos al pwee,,, dt· aprendizaje.

10 que va acompanado de las Carl Sagan. otras civilizaciones hayan tenid La segunda posibilidad es que otras especies inteligentes experiencias similares y se hayan plameado preguntas par hayan cxistido en el pasado. cion en que tenemos la capaddad de utilizar las fuerzas de la. das.. no se han recibido tales senales. cuando sus hijos entran estilo de vida. cada joven debe eneomrarle senti- actualidad. es razonable suponer qu" ya transicion ala edad adulta implica el paso por la adolescen- hayan descubierto los principios universales de la natural ' cia. 0 incluso en " ahora parece nula. o 14 ciemos de millones de anos en la historia del universo$ Esta posibilidad ilustra otra consideracion. como nosotros 10 hemos hecho. estar en peligro de formado diez mil civilizaciones inteligentes en los ultimos 1 cometer los mismos errores y sufrir las mismas eonseeuencias. especulo qu t presiones y responsabilidades que definen a un adulto en nues- podda haber dos razones para la ausencia de tales senales en la tra sociedad. sugirio la posibilidad de que seamos unt do a 10 que Ie esta ocurriendo. es muy logico suponer que se detectadan en la Tierra se aJustes. Debido a evidencia arqueologica que posiblemente civilizaciones inteligentes: lD6nde estan1 no estuvo al alcance de Sagan en su tiempo. De manera muy similar. en la que calcula que es posible que se hay critico de la historia de nuestra especie. los cuerpos de los ni- Hasta la fecha. emonees debemos madurar a traves de ella y que hayan existido tal cantidad de civilizadones inteligentes' llegar a las responsabilidades que tales poderes nos permiten. la transicion marca un periodo de confusion a nes. a la pubertad. durante el periodo colectivo de naturaleza. sobrevivir. y debe haeerlo pronto si quiere de las primeras civilizaciones en alcanzar el punto de la evolu.216 El C6digo de Dios lQue hemos aprendido? 217 Cabe la posibHidad de que existan diez mil nologica". Primero. hayan seguido un camino similar cidas sobre su progreso? ~Es posible que las opciones teen " al nuestro. " nos floreeen hacia la edad adulta. Por estas raz . Como 10 razonable esperar que hayan incorporado esos principios as. esta posibilidad ~Es posible que en algun lugar del cosmos. el astronomo Frank Drake formulola ya famos Si este fuera el caso. En 1961. nuesrra adolescencia ceenologica debemos encontrar una ma- nera de equilibrar eI poder de nuesrros descubrimientos con . el espado y la materia. ~donde estin? Si solo una fraccion de esas diez m:! civilizaci De manera similar a la experiencia universal de los ninos cu- nes hubieran existido en realidad. debemos encontrar la forma de navegar a traves de los que gobiernan el tiempo. astronomo y colega de Drake. entonces podriamos estar en el punto ecuaci6n Drake.' confirmanin los padres de los jovenes. 1 pasado remota de la Tierra. Tambien cambios de nuestra vida y sobrevivir a la transicion. Sagan sugirio que la razon por la logicas de sociedades del pasado remoto hayan tenid' eual no detectamos cvidencias de estas formas de vida avanza- consecuencias tan devastadoras que esas civilizaciones ya n'. A su manera. los cientfficos e investigadores s' Si en realidad estamos viviendo un periodo de adolescen- esran haciendo la pregunta obvia: Si existe la posibilidad d' cia tecnologica. es que no sobrevivieron a su curva de aprendizaje y se existan? destruyeron debido al mal usa de las fuerzas de la naturaleza. Tomando en cuenta esa cifra. nales de comunicacion que fueran evidencia de esas tecnologfaS1 Aparentemente de un dia para otro. y ya no existan. un periodo que el describe como "adolescencia tee.

para muchos jovenes. te cientos de generaciones. e1 efecto invernadero.: nologlas basadas en los genes y la proliferacion de armas que su sensacion de ser indestructibles con frecuencia los lleva a ser pueden haeer inhabitables regiones enteras del planeta duran- descuidados al poner a prueba los limites de la autoridad y de. Ahora. 2 . cos. Desde puberrad es que. EI hecho de que todos esten presentes en el mis- nazas sin precedente a la estabilidad de nuestro mundo natu. nazan a nuestro mundo.: cion del sudo.t de la capa de ozono. rno momento historico. plantea la posibilidad de una amena- ral nubIan la promesa brillante de un nuevo siglo". es obvio que la humanidad Ueva un la razon.' organizaciones. la destruccion describiendo nuestra situacion como algo en que "isi no apren. consideraban que Ia deeada de 1990 fue el pun- se arriesgo demasiado.. y de la manera en que tecno- la analogfa del nino que se transforma en adulto.. Y tambien de manera siempre. Refiriendonos de nuevo a. Junto con sus recien descubiertos poderes. de la Tierra. y que todo' oxigeno en el planeta debido a la deforestacion irresponsable y es un cuerpo viviente]. su periodo de cambios: temas relacionados con proporcionar suficiente alimentacion va acompanado de un sentimiento que podrfa describirse como' y construir economlas viables. durante una eonferen- deracion. cual- quiera de las amenazas que menciona Grof es suficiente para En su informe del ano 2000 sobre el Estado del Mundo. Lo triste es que se cree que ese sentimiento de ser curso destructivo en 10 que se refiere a la supervivencia de nues- invencibles es el factor clave de los accidentes automovilisti. no podremos respirar!"3 el envenenamiento del pIaneton de los oceanos. En junio de 1995. el aire y el agua debido a las industrias.6 Re- Nuestra mayor amenaza fIejando los sentimientos de muchos otros cientlficos. 4 Casi za que es casi inirnaginable. muchos cientificos. 5 Entre los peligros inmediatos que Reflejando la magnitud de la crisis a la que nos enfrenta. la futurista Barbara Marx Hubbard..f menciona Grof estan los relacionados con "Ia contamina- mos como familia global. . to en que termino un cicio y la vieron como una opoftunidad Los paralelos entre la adolescencia de los jovenes y nuestra. nuestra supervivencia es mas que una mera cia en Killarney. dene que ver con nuestra capacidad de· presento un trabajo que reflejaba la preocupacion de muchos reconocer las opciones que afirman 0 niegan la vida en nues-. la posible perdida de demos [que todos estamos relacionados. investigadores y lidad. el indicae Ia presencia de un peligro real para los sistemas vitales Instituto Worldwatch [Vigilantes del Mundo] observo: "Ame.. . de avances cientlficos recientes. e1 psiquiatra pionero Stanislav Grof discusion filosofica. ( naza de desperdicios y accidentes nucleares. para evaluar nuestros erroces al igual que nuestros logros como adolescencia tecnologica ciertamente merecen nuestra consi-· comunidad global. individuos en relacion a las condiciones de deterioro que ame- tro mundo.218 EI C6digo de Dios lQue hemos aprendido? 219 los valores de Ia vida y la naturaleza.. tra especie. un riesgo de la '. la principal causa de muerte entre los jovenes en la actua.~ A finales del siglo XX. y los peligros de aditivos peligrosos en nuestros alimentos y bebidas". debemos hacerlo rapido. Irlanda. Accidentes que se atribuyen al hecllO de que el conductor . las amenazas que se mencionan en el informe brotan similar. conectados. logfas poderosas han entrado sin freno a nuestras vidas. la ame- habla de la urgencia de esta leccion en terminos muy sencillos. hasta la incertidumbre de tee- "invulnerabilidad".

descubramos un factor comlin que las une.' menranea de la lucha antigua y siempre humana con el poder presente ila humanidad representa el mayor peligro para la su. Si las conocemos.~ te con las mismas preguntas y preocupaciones que la Dra.: Este tema no es nuevo en la historia de la humanidad. nar quien representara mejor los valores de los ciudadanos de de escenarios que si no se ponen bajo control. Grof y otros. Por el contrario.1 ron a su periodo de adolescencia tecnologica sin destruirse.220 El C6digo de Dios ~Que hemos aprendido? 221 it En su artIculo cIasico sobre la Busqueda de Inteligencia. y las alteraciones que sin darnos cuenta hacemos al.. Arroway se encuentra siendo cues. entorno natural de nuestro planera. ade- pervivencia de nuestra especie! Tambien es obvio que solo no-' mas de los problemas ambientales que son el resultado de la sotros tenemos el poder de garantizar la supervivencia de nuestra cvoluci6n de la industria. y su uso para respaldar creencias e ideas. describe escenarios po-' \ importante notar que los registros mas antiguos de la civiliza- tencialmente carastroflcos... nuesrras crecientes poblaciones.". la escasez de alimentos ponde con aire pensarivo que les preguntarfa como sobrevivie- y recursos. Aunque la motivaei6n no es un contacto mundo" con otro punto de vista que se basa en los mismos. vivimos bajo la sombra siempre credenre de tec- En una escena que podrfa ser una de las mas profeticas de la nologfas relacionadas con armas que tienen e1 poder de des- peUcula Contacto. nos enfrentamos a una crisis que tal especie y el hecho de que nuestro mundo sea habitable para las vez podria ser mas fundamental para nuestra supervivenda. cada uno de ellos descri. sucesos que estan ocurriendo en nuestro mundo en la actuali- inmediato". "Hay quienes al contemplar nuesrros problemas· se Ie diera la oportunidad de hacerle una sola pregunta a la globales en la Tierra. nues. solucion. Como parte del elIos contribuira. en ellos se nos ofrece una vision mo- Tomando en cuenta esas estadisticas.lc::cr que nuestro phmet.~ 2cual serfa esa pregunta? Despues de una breve pausa. cada uno de': la Tierra en caso de un contacto extraterrestre. que la humanidad todavia esta en su infancia y que l' Arroway presenta ante el panel. extraterrestre. generaciones futuras. fa Ora. la dis..·. civilizacion supuestamente avanzada que ella espera encontrar. Ademas. llegan a la conclusion de. ella res- paridad entre los pobres y los adinerados. gfa han desatado. (Como vamos a sobrevivir a ' d'la creceremos " . tros arsenales nucleares.8 Continua sus observaciones'sobre el "estado del.' proceso de seleccion. dad son evidentes. En la actualidad. nuestros antagonismos nacionales. tal como:.9 algun las capacidades yal inmenso poder que la ciencia y la tecnolo- Es interesante que cuando examinamos muchas de las con. af colapso global de las sociedades. en especial tomando en cuenta nuestra di- diciones que se han identiflcado como nuestras mayores ame-o':" versidad y tantas ideas diferentes sobre el aspecto que debe nazas. Cada una de las situaciones que citan Sagan. como civilizacion estamos luchando precisamen- datos: "Hay orros que creen que nuestros problemas tienen. ' cion humana no nos hablan de milagros y de la belleza de la be a la humanidad como la unica fuente de la amenaza. vida. es obvio que en el'.7 Carl Sagan describe una serie similar~. tionada por un panel internacional de expertos para determi- Extraterrestre (SETI).l s610 sea . se Ie presenta un escenario hipotetico. Este factor tener nuestro mundo? es la humanidad. Es el Instituto Worldwatch. Los parale10s entre este tema de la pelicula Contacto y los que vivimos en un sistema que esta destinado a un colapso'. Junto con los peligros que ahora amenazan al mundo de la naturaleza. cruir la civilizaci6n y h.

perimentado podrla verse como algo que en gran medida no la que algunos induso creen que es posible sobrevivir a ellas~. at menos otras 20 nacio- vista mas alIa de los anaqueles de los centros comerciales y nt's se vieron involucradas en guerras. ha sido ante todo el resultado de nuestra ignorancia en el i da a distinguir con claridad la amenaza de las tragedias pasado con respecto al dano que los combustibles f6sHes y las ambientales.222 El C6digo de Dios lQue hemos aprendido? 223 habitable para las formas de vida mas sencillas durante cientos ~ supermercados de su vecindario e investigado de d6nde vie- de anos.. el final de la Guerra Fda a finales de la de la poblaci6n general no se ha dado cuenta de las consecuen"!'~ decada de 1980 marcO el principio de una paz relativa en el cias que podrfa tener el apoyar a las industrias que acaban can') mundo. La decisi6n de explorar tales tecnologias. la paz relativa era precisamente eso: relativa. Como consumidores. siempre ha habido "personas informadas" que tienen acceso a los peligros de tecnologias especfficas. de nuestros cambiantes puntas de vista sobre el progreso. y la amenaza de las ideas que llevaron a su creaci6n. fue intencional. sino el produeto secundario y la consecuencia crea 10 que indudablemente es la mayor amenaza a nuestra. ha dejado en manos dell' trabajar juntos en la era posterior a la Guerra Fda. los rIos. Por primera vez en casi una generaci6n. la supervivencia hoy en dia. explosiones en plantas quImicas y desechos t6xicos). y aunque es indudable: Ef mundo sigue en guerra que el poder y la ambici6n han tenido un papd importante en la forma en que se aplican las nuevas tecnologfas. fusiones accidentales del nucleo de reac- planeta: los oceanos. y cO. jos los niveles de radiaci6n en las plantas nucleares y asegurar. amenaza de una guerra nuclear pareda desaparecer y el mundo La familia norteamericana promedio que trata de eneon· \ dej6 escapar un suspiro de a1ivio cuando Estados Unidos y Ru- trar eI equilibrio entre dos carreras profesionales. economfa y nuestra relaci6n con el mundo. Aunque . Aunque en gobierno y de la industria la responsabilidad de mantener ba· esa epoca no se libraron "guerras decIaradas" a escala mundial. Ahora que se ha identificado el peligro de los productos que acaban con el medio ambiente. la credente amenaza de armas de efectos masivos sustancias qufmicas pueden causar a nuestro mundo. el vapor y los residuos de las minas y fabricas visible lucha por territorios entre Israel y Palestina en el Oriente no sean un riesgo. pocas personas han Media. juntas de sia crearon nuevas relaciones y exploraron nuevas Eormas de padres de familia y practicas de futbol. ayu- ques. la mayoria· Para muchas personas. a finales de la decada de 1990. el dano que nuestro planeta ha ex- facilidad con la que se justifica su uso en la actualidad. Aunque esta no es una excusa que estando af borde de fa destrucci6n justifique los efectos catastr6ficos que han ocurrido (como La destrucci6n de los sistemas que apoyan la vida en nuestro. 1O Aunque a menudo s610 . la constante nuestros recursos. la precisi6n nen en realidad los productos que les facilitan la vida. y que las predicciones cientfficas y las de las culturas De fa ignorancia a fa intenci6n: antiguas se han validado. los lagos y los bos.Q. derrames de petr6leo. tores. con que se han creado las armas que son resultado de elIas. y la Desde esta perspeetiva. Ademas de la tan se de que el agua. podemos trabajar juntos para cam~ C6mo encontrar nuestro camino biar y "corregir los errores". la atm6sfera.

(. el en el principio de la seguridad preventiva. la seguridad de los Algunos de estos conflictos que han recibido poca aten. Aunque es posible que la Guerra Fda haya ter- cano. cuando las tropas estadounidenses se desplegaban en las .224 El C6digo de Dios lOue hemos aprendido? 225 se les ha llamado "conflictos". la guerra en Sudan entre los capacidad de las armas convencionales y un sofisticado arsenal musulmanes del norte y los cristianos del sur ha causado aproxi. y en el caso de paises como Israel. pan en programas para el desarrollo de armas nucleares. en el continence afri. muchas entre la pobla. . el periodo que muchos percibieron como tiempo IPor que ahora? de paz. China. que se desarroHaron a partir de la dencia de la Guerra Fda tan. Macedonia. Filipinas. Desde guerras civiles y luchas por independencia. hasta purgas etnicas. en realidad ha sido todo menos pacifico. Oriente. India. Kashmir. icomprendia casi 70. perciben contra los intereses nacionales.. desplegadas. Estos conflictos ya han cobrado ha convertido en un factor dominante en la paz mundiaL La millones de vfctimas. En el punto critico de la Guerra Fda. continentes. mientras que otros~: En el contexto de un mundo de este tipo. tros en tiempo de guerra. la busqueda de terroristas se concentro en paises mu. India y Pakistan. Tibet y el Medio siguen estando presentes. sus enemigos. Para 1999. regiones como Unidos.i Corea del Norte esta entre los paIses que activamente partici- liares. Despues de los tratados que se dise- clones • estan presentes " . antiguos y han continuado durante decadas.000 cabezas nu- sulmanes. Hun. las armas Bosnia. de armas nucleares que represento una ventaja para los poderes madamente 1. la tecnologia se son relativamente recientes. Kabul y Tora Bora en Mganistan se volvieron nombres fami. la superviven- cion de los medios noticiosos. ocddentales durante gran parte del siglo pasado. "Los ingredientes de un posible 'choque de civiliza.12 Q' '. estas hostiJidades han tenido momenta de la historia reciente. Chechenia. Samuel P.l . antigua Union Sovit~tica. Kosovo. Indonesia. Inglaterra. y cambio el panorama de la paz mundial de una cleares dispersas en America del Norte.9 millones de vfctimas. que nunca ell eua IqUler Ulza mds . 11 A finales del siglo XX. la amenaza del terrorismo ha concentrado la atencion (naciones que admiten oficialmente que han desarrollado y mundial en paises y ciudades que muchos occidentales nunca acumulado armas nucleares) tenia siete miembros: Estados habian escuchado nombrar antes. al igual que las reservas para reabastecer suminis- tington. Estas estadIsticas inc1ulan armas que estaban activamente En las palabras del profesor de Harvard. en unos cuantos arsenal de armas nucleares creado entre Estados Unidos y la meses. Azerbayan. brotaron de desacuerdos muy : cia misma de su estilo de vida. el mundo parece estar dividi· como resultado los mismos sufrimientos y las mismas victimas do en cuanto a la manera de enfrentarse a las amenazas que se que son el rasgo caracterfstico de las guerras declaradas. ademas de 10 que quedaba de "puntos conflictivos" como minado oficialmente a finales de la decada de 1980.{. Francia. flaron para reducir csa ennrme cantidad de cabezas nucleares. Apoyandose ' siblemente haya otros. Despues de los tragicos sucesos del 11 de septiembre de A finales de la ultima decada. casi la mitad de las guerras que ha caido en manos de quienes estos poderes consideran no declaradas del mundo se libraban . es tecnologia cion civil. se sabIa que el "club nuclear" 200 1. De pronto. Tajikis. Europa y Asia! 13 manera sin precedente en la historia reciente. Rusia. y po- montafias que forman la frontera con Pakistan.

' he pregumado: ".. Aunque despues del final'. (ein en 1949 y que se publico en la revista LiberalJudaism. creciente tension entre paises nucleares vecinos. Ie rra Fna' para destrUlr . Ai bro que describe el mensaje de nuestras celulas?". en proporciones epicas inimaginab1es. yante 1a deci- cosas sorprendentes es que el desarme nuclear potencialmente' sion de utilizarlas para poner en vigor politicas que se basan en se ha detenido". Con 1a sencillez y el rra se declaro ilegal en los Prorocolos de Ginebra de 1925 y candor que Ie eran caracterlsticos. a principios del siglo XXI. Tambien es la Guerra Fda. religiosas y pollticas.. Jorgen Wouters.1 ser piedras!".000 cabezas nucleares. este es el momento apropiado para ofre- nucleares que aun quedan en el mundo actual. con unas 36. la amenaza de: En eI contexro de los arsenales en constante desarrollo y la esos arsenales no puede ignorarse. el arsenal nuclear del planeta e8. Einstein respondio: "No se mas tarde en fa Convencion de Armas Qulmicas [Chemical ~a­ si la Tercera Guerra Mundial se librara algllll dfa. Si alguna vez comentar esta falta de continuidad. ipero puedo pons Convention. Joseph Cirincione.: claro que es virtualmente imposible prepararse y defenderse bargo. a menudo me de la Guerra Fda se inicio la desrruccion de un porcentaje de. como Israel. exploraramos eJ poder de un principio que pudiera unificar las tor del Proyecto de No-Proliferacion del Legado Carnegie para'" diversas ideas emicas. 15 pregunto como pensaba que serian las armas de una tercera Ademas de los arsenales nucleares de las potencias que se guerra mundial en la era nuclear.iPor que ahora? ~Por que ofrecer hoyeste li- armas nucleares. Ante un arsenal global de gie Endowment for International Peace] dedaro: "Una de las . Ultimos 100 anos." cion en que deberlamos hacerlo.17 hoy en dla plantea una decir que 10 que ust"n en la ClI. esta es la genera- la Paz Internacional [Non-Proliferation Project at the Carne. creciente tension entre las porencias mundiales. eer el mensaje de nuestras celulas. el Consejo ha informado que estas cifras no induyen i. armas con un poder destructivo sin precedence. . 16 Aunque la existencia (enemos como civilizacion para asegurarnos de que esas es- de toxinas biolOgicas y agenres quimicos disenados para la gue. el numero creciente de armas qufmicas y bio. pero que se: probable que ya existan otras amenazas en 1a coleecion mun- sabe existen. Con respecto al estado actual de las armas. CWC] de 1993. pecu1aciones nunca se hagan realidad.. el proceso parece haber perdido velocidad.uta van . dial de armamentos que todav{a no se han dado a conocer En una epoca en la que hay cada vez mas diferencias y una publicamente. informo al Noticiero ABC que "las potencias mas importantes " En una entrevista que Alfred Werner Ie hizo a Albert Eins- todavfa poseen mas que suficientes armas nucleares de la Gue. hoy en t' Es obvio que existen las condiciones para una catastrofe dia. aI p Ianeta muc has vecesl> . III . Su respuesta fue un esca10- han enemistado. causada par la guerra y para las muertes que sedan consecuen- aproximadamente la mitad de 10 que era en el punto cdtico de:~ cia de ella. al igual que de la responsabilidad que tendrfa consecuencias a nivel mundial.226 EI C6diga de Dias lQue hemos aprendido? 227 las naciones empezaron a reducir los arsenales que podrIan mayor amenaza de guerra que en cualquier momenta de los haber destruido muchos planetas del tamano de la Tierra. gun el Consejo para la Defensa de Recursos Naturales." nuestras diferencias. 14 Sin em. friante recordatorio del camino peligroso en el que nos encon- logicas se suman a la ya formidable amenaza de guerra que (ramos en la actualidad. Se. Direc. de eada una de las multiples amenazas que se conocen. Es muy los arsenales de paises nucleares no declarados..

el Rey Pandu y el Rey Dhritarash- eliminar civilizaciones enteras de la faz de la Tierra.s en una encru~. Lecciones de nuestro pasado si6n de la tecnologia. un conflicto en cualquier lugar del mun". es una obra literaria sin religiosas e ideas poliricas. gar a ser una gran ironIa de la historia humana. ' tra. entonces hoy en dfa podriamos estar contemplan.~ con conseeuencias ran devastadoras. Tambien podria giosas y las guerras econ6micas. y una cijada peligrosa como civilizaci6n global. china 0 europea el retroceder del bord del conflieto global. victoria real. EI Mahabharata. tambien haya marcado historia. incIuyendo la perdida de el futuro de nuestra especie depende ahora de la habilidad co"'! innumerables vidas. si6n americana. y tambien la Biblia Hindu. estamo. de una dvilizaci6n avanzada que data de antes de la historia. ser la descripd6n de una guerra con tecnologia tan avanzada y rezean. algu. sin importar 10 justas que pa~. Ya no es una deci~ nueva oportunidad para elegir un nuevo resultado. jmucho antes de epocas en que la nos de los registros mas antiguos de nuestro pasado detall ' hisroria tradicional registra la existencia de grandes eivilizado- precisameme un escenario de ese tipo.. A causa de la globalizaei6n y de la difu. que aeeptar el relato como en formas que haee s610 un cuarto de siglo habdan sido imp<>-' un hecho hist6rico seria casi impensable.000 versos y e1 cerna central del poema epico es propia destrucci6n con el uso de armas que rienen el poder d ' una lucha entre dos reyes. considera an6mala en los estudios tradicionales. muestra indi': yel principio de la ultima gran era del mundo. no hubo una Teniendo tecnolog{as que pueden incapacitar a los ejerci. mos en e1 poema epico hindu ha captado el interes de historia- .000 aiios. Aunque el relato anti- sibles. causar destrozos en la base misma de la vida.. Si escos hechos La descripci6n de armas y t:kticas de guerra que eneomra- ocurrieron. Un credente corpus de evidencia arqueo16gica que el fin del ultimo cicIo de la cosmologia hindu. En 10 que podrfa lIe. que se ha Hamada el poema epico nadonal A medida que las naciones de la Tierra adoptan creenci de la India. las guerras civiles. un credent ' El relato se escribi6 originalmente en el antiguo lenguaje corpus de evidenda sugiere que esta tal vez no es la primer " sanscrito. rusa.> do debe eva1uarse en terminos mundiales. las guerras reli . que describe el Mahabharata. EI predo que pagaron las sociedades en guerra tos mas capaces. los lHtimos rastros de hechos hist6ricos reales. Vivimos en esa cios de que al menos algunos de los documentos podrfan ser era actualmente. tuvo como resultado una des- destruir dudades y naciones y acabar con poblaciones emerasii trued6n de proporciones biblicas. guo describe sobrevivienres de la ultima batalla. redueen el potencial de regiones y continentes entero.228 El C6digQ de Dics ZQue hemos aprendido? 229 En los primeros anos del siglo XXI. Contiene aproximada- vez que la humanidad se ha enfrentado ala posibilidad de s' mente 100. el DvuparaJuga. el tiempo de Kali Yuga. haee de 8000 a 10. paralelo en cuanto a su extensi6n y su tema. do la experiencia moderna de una lecci6n muy antigua. la esterilidad de la tierra y la destrucd6n lectiva para superar nuestras diferencias. y la batalla que aca nes y tecnologia sofisticada! Es interesante que la ultima bata- con dos vastos imperios en una epoca antes del inicio de 1 lla que se describe en el Mahabharata. que termin6 en una gran batalla que pudo haber ocurrido Aunque no se reeonoce en la historia eonvencional. haee de 2500 a 3000 anos.

el texto describe el horci" buye la devastaci6n que result6 de ella a una lucha entre el ble destino de los seres humanos atrapados en la senda de t bien y el mal y a la lucha de la humanidad por alcanzar destruccion. es de ciendficos. en 1945 la primera bomba nuclear que se useS en la d mal usa que hideron de ella fueron totalmente dcsrruidas"... al dones en el pasado que conodan la energia at6mica. civilizaci6n avanzada haber ascendido en la escala de la evo- . incluyendo las de los nativos gi6n. de America del Norte y los Dzyan del Tibet. No obstante. y que par detonarse.24 tras de sf. " 23 luei6n tecnol6gica miles de afios antes del inicio de la historia Si la tecnologia que se describe aqui y sus efectos fueran convencional. e1 relampago de hierro. Despues de la detonaci6n exitosa de la Tierra y de roda la vida que las habitaba. Detalles adidonales describen c6mo "las vasijas se rompiatt incluyendo las que se construyen para la guerra? (Podrfa una sin causa. en tiempos recientes. En una enorme re'''. t'ntender el poder que podda desatarse del atomo. "La Tierra temblo. EI pelo y las uiias se les cayeron". hasta que se introdujeron armas at6micas en el mundo a las preguntas. Los defantes ardieron en llamas. los animales cayeron al suelo y murieron. 19 El impacto tuvo como reo. comento: "Creo que han existido civiJiUl- inconcebible como efecto de una sola arma. desarrolla en los valles cercanos a 10 que en la actualidad e La relaci6n en~re la catastrofica batalla del Mahabharata y Delhi. firiendose al papd de creador y destructor que tiene el Dios sultado "una columna incandescente de humo y fuego. Hasta hace poco. . India. esnin empezando a considerar con seriedad es- decir. arma.230 El COdigo de Dios lQue hemos aprendido? 231 dores y generales en e1 pasado. t hindu Shiva. ramente al Bhagavad-Gira. pia destruccion? viamente se trata de un arma que no se parece a nada de 10 que. la magnitud de la'.. primera bomba at6mica del mundo en el campo de pruebas introduce y se descarga en la batalla. Las aves. S .l' . eI Hsico Robert Oppenheimer cit6 direc- "arma desconocida.~ remoto. Ya en 1909. hayan existido en la Tierra tecnologfas nucleares. yo el destructor de los mundos". virti6 en una realidad moderna. describen una 2 vian. ob. perturbadas.000 soles. epoca de gran destrucci6n en nuestro pasado.. los versos del Mahabharata detallan el uso de u el poder de la devastaci6n nuclear no ha pasado sin ser notada arma que causa la total destrucci6n de grandes reglones de'. Esas mismas descripc~ones estan guerra. El arma misteriosa. y las criaturas que vivian en elias tambien murieron".. y un credente numero segun se sabe haya existido en ninguna epoca de la historia. un solo proyecti).."2o da del poema epico al contemplar la furia de la explosion: ''Aho- Los versos describen la rotal devastaci6n qu~ el arma dej ra he muerto. la posibilidad de una catastrofe de tal magnitud se con- ahora captando la atencion de cientificos e investigadores. Las aguas hell. vleron bl ancas. volaban en drculos y se vol~. (Serfa posible que en un periodo de nuestro pasado imposible reconocerlos. una porci6n del Mahabharata.. Un creciente corpus de evidencia. Re- con todo el poder del universo". . el flsico destrucci6n que se describe en los versos del Mahabharata era Frederick Soddy. se Ie describe como un: de Trinidad en 1945. "Los cadaveres estaban tan quemados que e roder. Oppenheimer cit6 la declaracion de Shiva toma- brillante como 10. s610 para desintegrarse en las ruinas de su pro- relatos exactos de 10 que ocurri6 hace muchlsimo tiempo. cuando los ciendficos empezaban a medlados del siglo XX. algunas orras culturas antiguas.. Cada una atri- En los Ultimos sucesos de la batalla.. quemada por el terrible calor d Es interesante que ademas del poema epico de la India.

d arque610go ruso A. al igual que grandes un area de aproximadamente tres millas cuadradas (a modo de areas cerradas que se cree eran banos pilblicos 0 rituales. ron en las escalinaras grupos de esqueletos en posturas que miles de anos. Cuando placas de vidrio. comparaci6n. deberiamos ver hoy en dia evidencias de la destrucci6n: conocer la historia de Harappa y Mohenjo Daro.26 qui . y por que sus esque1eros estan tan inractos? ~Que circuns- 1500 antes de nuestra era. Yposteriormente. Investigaciones posteriores revelaron que la ceniza cubda rriente y sistemas cerrados de drenaje. AI hacer las 1920. los trabajado- los hallazgos mas elocuentes se escan excavando cerca del le~.z9 ~Que les paso a estas perso- rrollo organizado en esa region a las invasiones arias en el and. Aunque por todo el mundo se han recibido inform ! Tal vez el mayor misterio que nos dejan las ciudades anti- de descubrimientos an6malos como cumbres de montafias qu~ guas es par que se olvidaron. excavaciones preparatorias a la construccion de un complejo Ilevo a cabo mas excavaciones. en 1946. res encontraron varios esqueletos humanos contorsionados y gendario sitio de la batalla que se describe en el Mahabharat/4 en posturas extranas. Aunque . con una sofisticaci6.' cubrimientos de Wheeler podrian darnos cierro indicio. Con el descubrimiento de dos cillo:'': tancias impidieron que los animales salvajes. dos de las manos. esa fecha se fijd saqueadores movieran los cuerpos despues de su muerte? en el ano 3000 antes de nuestra era. arena de antiguos desiertos fusionada como grand. descubrieron una gruesa capa de ceniza dad siguiendo un plano cuadrado definido par avenidas de 10. traducido ni desdfrado. resultante.. ~Que causo su abandono? Los des- madas. Muchas de las estructuras tenian agua co. En su libro Riddles ofAncient History [Acertijos conoce como Escritura del Valle del Indus. estudios historicos habian vinculado un desa'fl indican que estaban huyendo". s610 contamos con los artefactos fisicos para en la guerra. la excavaci6n lleg6 al nivel de las antiguas calles. el deterioro 0 los dades importantes. los habitantes del japonesa de Hiroshima cubri6 aproximadamente cuatro mi- Indus utilizaban una forma de escritura ahora oIvidada que se lias cuadradas). se encontra- sabia que rribus n6madas habian habitado esa zona durant . habitacional. los arque610gos empezaron . Los informes sobre otras excavaciones en el del rio Indus.232 El C6digo de Dios lQue hemos aprendido? 233 Si en realidad una civilizaci6n antigua poseyq Ia ciencia y la. y de hecho Ia usQj dejaron tras de si. Gorbovsky dice . nas. algo que no deberia haber estado alIi. AI no poder leer 10 que sus habitantes tecnologia para dominar el poder del aromo. como si algun desastre inesperado los hubie- excavar los resros de una civilizaci6n desconocida en el vall ra sorprendido. Ade. Estas revelaron un centro urba.27' 28 S'lr M' ortlmer Wh eel' et. excav6 la anti~ tos que recibieron menos publicidad de esqueleros similares gua ciudad de Mohenjo Daro por primera vez en la decada encontrados cerca de la ciudad actual de Delhi.ti. y antiguos esqueleros radioactivos. area describen los hallazgos: "En algunos sitios. { Tal vez la respuesta a estas preguntas este en descubrimien- El arque610go bridnico Sir John Marshall. 3D metros de ancho.. en el norte de la India y Pakistan. Harappa y Mohenjo Daro. que nunca se ha tit' fa historia antigual. En una zona en la que ya que no se ve en muchas de las dudades y aldeas de nuestrO$i se habia detectado un nilmero alarmante de casos de cancer y dias. la zona de devastacion mas grande en la ciudad mas del diseno avanzado de las ciudades. radiactiva bajo la superflcie de la tierra. Los arquitecros de Mohenjo Daro construyeron su ciu: defectos congenitos. algunos de ellos todav{a estaban torna- A principios del siglo XX. los trabajadores informaron haber encontrado no excepcionalmente bien planificado.

por un ejercito que crcia que si no salfa victorioso creciente corpus de evidencia que indica que algo sucedi6 haee: de la batalla perderia su civilizaci6n y su estilo de vida. nes futuras podrfan leer sabre nuestra epoca en un poema epi- (Los descubrimientos de Wheeler. La Fuente de la hemos seguido la senda de autodestrucci6n y hemos acabado. reconocer un principio unico que tras- sas y politicas. Si como humanidad.' perdbimos nuestra diversidad. y las universal del hecho de 'IUt' (. pasado. exacro de sucesos hist6ricos.· greso dividan al mundo de manera aparentememe irreconcilia- mayor que el que deberia haber tenido a causa de radiaci6n. ble? Al considerar el poder destructivo de los arsenales nucleara. La naturalcza dad entre los valores cristianos. que en el siglo XXI.· que plantean para nosotros esos restos. co al igual que en una comprensi6n espiritual. naturaH 31 (Que podrCa explicar estoS hallazgos "an6malos" de. hebreos y musulmanes. (es posible que esas difereneias Heven al mundo cienda nuesrras diferencias. La pr6xima vez po- esos efectos y los hallazgos en estos sidos antiguos.. usada como ulti- lizado un estudio espedfico. y las comparaciones inevitables. Sf convierte en un elemento estraregi- las diferencias entre el capitalismo y el socialismo. las Al alinearse las naciones una contra otra debido a antiguas religiones y las creencias. Y8\i brotan los problemas mundiales hoy en dia.. los parale"". unificando a personas de todas las a otro conflicto global en nuestra epoca? ~Permitiremos que creencias y profesiones. La historia ha demostrado que en el Fragor del conflicto. Cuando com"i En ocasiones se pasa por alto la simplicidad del origen de binamos la evidencia tangible de hoy con los escritos del pasado" 10 que parecen ser los muchos y complejos temas de donde surge en nuestra mente una pregunta. ( valares y creencias profundamente arraigadas. e1 Es obvio que todavfa debe llevarse a cabo mucha investiga:-: "pader" a menudo se convierte en una justificaci6n para el usa ci6n adicional en este sitio y otros similares. timos el riesgo de no encantrar la respuesta a esa pregunta? alios antes del tiempo de Jesus de Nazareth? '. las generacio- civilizaci6n desapareci6.' de cualquier medio que se considere necesario para proteger podremos confirmar los hallazgos y desentraliar los secretos. A partir de ella. Si en la mucho tiempo que tuvO efeetos tan devastadores que toda una.' defamos no ser tan afortunados. la diversi. quimicos y biol6gicos que hay en el mundo. los son claros. • 234 El C6digo de Dios lQue hemos aprendido? 235 que se encontr6 al menos un esqueleto hum.: ta es la historia de una paderosa arma letal. ~podemos permi- una civilizaci6n que Ueg6 a la cumbre y luego pereci6 casi 2000. ~estamos. Marshall y otros reve. co sobre la gran guerra del siglo XXI. Si la literatura de la India es de hecho un registro da y de su incapacidad para sobrevivir a su "adolescencia. linajes y creencias religio. Incluso sin haberse rea. justificada por creendas Ian la evidencia y las repercusiones de una civilizaci6n avanza-! similares. La mayoria de los conflictos en peligro de cometer de nuevo e1 mismo error? actuales se basan en diferencias entre los pueblos. estos hallazgos contribuyen a un I mo recurso. es luchas relacionadas con territorios. Con la similitud entre. mayor amenaza a nuestra supervivenda es la forma en que con toda una civilizaci6n por el mal uso del poder. las razas. Algo real 0 que puede percibirse.ano en esa zona· perspectivas conflictivas sobre 10 que significa la palabra p'" icon un nivel de radioactividad aproximadamente 50 veces. entonces la humanidad ha expc· tecno16gica"? Los efectos de una explosi6n nuclear estan muy. y dificilmente sobrevivi6 a elIas. rimentado las consecuendas de esta manera de pensar en d bien documentados en la actualidad. EI Mahabha".'1 nornbre de Dios se manifiesre en .{ actualidad se manifestara un escenario similar.

- - - -........ ~

236 El C6digo de Dios lQue hemos aprendido? 237

las celulas de nuestro cuetpo podtia lIegat a St;t el fundamento agrado. Los diarios de los colonizadores de Jamestown, Virgi-
de ese ptincipio. nia, que fue el primer asentamiento permanente de europeos
en America del Norte, atribuyen su supervivencia al devasta-
Mas aUa de nuestras diferencias: dor inviemo de 1607 a 1608, un inviemo para el que no es-
Supervivencia a traves de la unidad taban preparados, a los consejos y el apoyo de los nativos que
los ayudaron.
La histotia y las experiencias de quienes nos han ptecedido
Sin embargo, pronto fue obvio que los dos estilos de vida
pueden en ocasiones ser nuestros mejores maestros en 10 que
eran incompatibles; el estilo de vida de los nativos nunca podria
concieme a como procedet cuando enttemos al tettitorio inex-
sobrevivir a la vision del mundo de los europeos. Para las co-
plorado de las ideas nuevas. Aunque los tiempos han cambia-
munidades indigenas que habian equilibrado con exito las ne-
do y ahora contamos con factores de ciencia y tecnologia que
cesidades de la vida diaria con los ciclos de la naturaleza durante
nuestros antepasados no podian siquiera imaginar hace 100
cientos de afios, la sola idea de que la tierra pudiera reclamarse
afios, en muchos aspectos los principios de enfrentar los cam-
como propia era tan inconcebible como la idea de la propie-
bios son los mismos.
dad del aire que los rodeaba y de la lIuvia de los cielos. Como
Ya sea que hablemos de las comunidades de nativos de Norte
el concepto de que la naturaleza podia "poseerse" era tan ilogi-
America que trataban de preservar su estilo de vida en el siglo
ca, muchos nativos no tomaron en serio la amenaza que repre-
XVII, 0 de nuestra familia global que trata de sobrevivir a las '
sentaban los colonos europeos. Simplemente no entendian 10
amenazas del siglo XXI, en los niveles mas basicos, la expe-
que les estaba pasando a ellos y a su cultura.
riencia es la misma: estamos hablando de homar la vida. Una .
No obstante, un pufiado de Iideres de esas tribus empezo a
de las mayores lecciones de la historia nos ha ensefiado que fa uni- ,
comprender gradualmente la naturaleza de la inminente ame-
dad y fa cooperaci6n ofrecen una mayor oportunidad de supervi- '.
naza. Aunque es posible que estos visionarios no comprendie-
vencia de fa que alguna vezpodria lograrse mediante competencias
ran plenamente las intenciones de los colonos que lIegaban a
y conflictos.
sus tiettas, si reconodan que las diversas tribus tenian que co-
operar y unificar su voz para preservar su estilo de vida 0 se
DURANTE LA COLONlZACr6N DE AMERICA DEL NORTE por los '
perdetia para siempre. jSabian que su supervivencia depende-
europeos, las comunidades indigenas que habian sido indife-
ria de su habilidad para hacer eso! Pero lamentablemente, cuan-
rentes y en ocasiones hostiles hacia sus vecinos, vislumbraron
do los Iideres fueron testigos de las consecuencias de que sus
muy bien la necesidad de superar sus dificultades. Cuando los
comunidades no fueran capaces de unificarse, organizarse y
primeros exploradores y colonizadores lIegaron a las ~ostas de
:lctuar, ya era demasiado tarde.
10 que en la actualidad es el noreste de Estados Umdos, las
Quiza uno de los ejemplos mas desgattadores de esa lec-
tribus y las familias que habian vivido en esas zonas durante
cion de unificaci6n para el mayor bien, son los relatos de la
muchas generaciones, par 10 general los recibieron de buen
tribll Narragansett y de SII Iider eI Jefe Miantonomo. El jefe

238 El C6digo de Dias lQue heroos aprendido? 239

reconoci6 que la amenaza que representaba la calonizaci6n de . 10 ejecutaron, siendo los ingleses los testigos que confirmaron
Norteamerica iba mas alIa de los miembros de su tribu, y se . el castigo.
extendfa a las tribus vecinas, con las cuales 5U tribu habfa teni· . Este relaro ilustra la urgente necesidad de hacer a un lado
do conflictos y tensiones en el pasado. Se puso en contacto nuestras diferencias individuales y unificarnos ante una ame-
con los pueblos Mohawk y propuso una alianza para crear 10.' naza comtin. Aunque no existe garantia de que el genocidio de
que el historiador Ian K. Steele ha Hamado "un movimientG' aproximadamente 20 millones de nativos norteamericanos pu-
unificado de resi5tencia amerindia" 32 Se dice que en 1642, el diera haher sido diferente, existe la posibilidad de que un es-
jefe dijo: fuerzo combinado de los nativos durante los primeros alios de
la colonizacion habrla marcado una diferencia en cuanto a fa
forma en que esta se llev6 a cabo. Es includable que fa coloni-
Debemos ser uno como los ingleses, de 10 contrario desapare-
zaci6n de America del Norte se hahda realizado, a pesar de
ceremos dentro de poco, pues como ustedes saben, nues-
los esfuerzos a favor de los habitames originates. La ola de des-
tros padres tenian muchos ciervos y pides, miestros campos
contento que invadi6 a Europa en el siglo XVII y la tecnologia
y bosques estaban Henos de ciervos y de pavos, y nuestros
que permiti6la colonizaci6n del "Nuevo Mundo", gener6 un
lagos Henos de peces yaves. Pero estos ingleses, al apoderar-
dinamismo que no habrfa sido posible detener.
se de nuesrra tierra, cortan los pastos can sus guadanas y los
Sin embargo, la forma en que ocurrio y se desarro1l6 po-
arboles con sus hachas; sus vacas y caballos comen el pasta
drfa haher sido orra si se hubiera tornado en cuenta la pre-
y sus cerdos echan a perder las playas donde viven nuestras
sencia de los 50,000 habirantes nativos de Virginia en 1607.
almejas. Nos vamos a morir de hambre [el aurar anadi61as
Respaldados por la fuerza de su numerosa pohlaci6n, de su
italicas].33
conocimiento sobre como sobrevivir en la tierra "nueva", y con
eI poder de una sola voz, es posible que los pueblos nativos
Desafortunadamente, otra leccion de Ia hisroria nos mues··i., hubieran persuadido a los colonos a trabajar con elIos y no
tra como los esfuerzos bienintencionados en un area de la vid contra eIlos, en cuama a la forma en que se lIev6 a cabo la co-
no siempre resuelven los problemas en orras areas. Durante 1..) lonizacion.
guerra entre las trihus que se estaba librando al mismo tiempoi Debido a luchas entre las tribus ya diferencias de opinion,
que los indios perdfan su estilo de vida ante los europeos, el de vala res y de metas, no se formo a tiempo una voz unificada.
Jefe Miantonomo fue capturado por miemhros de la trihu. Para cuando las tribus de America del Norte se dieron cuenta
Mohegan quienes 10 pusieron bajo la custodia de los ingleses.· de 10 que Ie estaba ocurriendo a su estilo de vida, estaban tan
como "rebelde". Pero como este problema no estaba dentro de debilitados par enfermedades introducidas par los europeos,
la jurisdicci6n de las Colonias Brininicas, los ingleses pensa- como la viruela, y tan ahrumados por armas avanzadas como
ron que no tenfan derecho legal para juzgar 5U caso. Como rifles y artilleria (al igual que por los caballos, carretas y fuer-
soluci6n. pusieron al jefe en manos de la Trihu Unca. quienes tes), que 10 unico que pudieron hacer fue resistir.

240 El C6digo de Dias lQue heroas aprendida? 241

Aqui la clave es que al no ser capaces de sobreponerse a sus , La naturafeza:
diferencias locales y unificarse en nombre del bien comun, los': Modelo de unidad y cooperaci6n
habitantes originales de Norteamerica perdieron 10 que ama-;
Aunque la teoria de la evoluci6n en s1 ha sido objeto de fuertes
ban y consideraban valioso: su cultura, la tierra que habian"
criticas, las observaciones hechas por Darwin al desarrollar su
servido durante cientos de generaciones, y finalmente, gran:
reoria se han converddo en ejemplos dasicos de estudios sobre
parte de su estilo de vida. Aunque ya muy tarde, la realidad de;
el comportamiento social. Aunque las espeeies son diferentes,
esta tragedia se reconoce en la actualidad. Ahora se esta restau":ll ,
los prineipios son similares en los insecros, los animales y los
rando 10 que aun queda de este estilo de vida tan vasto y anti..:,
humanos. A diferencia de la conclusi6n que Darwin parece
guo, y se esta preservando en los territorios mas pristinos, rudoS:,
haber sacado sabre la fuerza y la supervivencia en Elorigen de
y hermosos que rodavia quedan en Norteamerica. Ademas, un;
las especies, sus obras posteriores describieran estrategias de su-
creciente numero de personas que no estan satisfechas con las::
pervivencia basadas en la unidad y la cooperaci6n mas que en
formas convencionales de medicina, de culto y de estilo dc<
"la supervivencia del mas apto". En su siguiente libra, La des-
vida, se estan acercando a las eostumbres antiguas considera"';
cendencia del hombre, Darwin resumi6 estas observaciones di-
das sagradas por los primeros habitantes de America.
ciendo: "Las comunidades que indufan el mayor numero de
La historia del Jefe Miantonomo y la eolonizacion inicial,.
miembros simpatizantes floredan mejor y tenlan mayor des-
de Estados Unidos es s610 una de muehas historias que po-~ '''34
cendenCla .
drian eontarse. La raz6n para ofreeer este ejemplo en particu..,
A principios del siglo XX, el naturalista ruso Peter Kropo-
lar es que ilustra en forma grafica una poderosa lecci6n d~
tkin refono las ultimas obras de Darwin con sus observacio-
supervivencia de la que podemos aprender hoy. La lecci6n es
nes, ilustrando como habia encontrado que la cooperaci6n y
simplemente esta: Para la supervivencia de su grupo, a lasi~
la unidad eran las claves del exiro y la supervivencia de una
familias, comunidades y naciones les conviene ver mas alia'
especie. En su libra Ayuda mutua: un factor de evolution, Kro-
de las diferencias que amenazan su estilo de vida y trabajar~
porkin describe con elocuenda los beneficios que experimenra
en cooperaci6n para superar aquello que amenaza su exis.-',.
el reino de los insectos debido ala capaeidad instintiva de las
tenela. ,
hormigas para vivir en sociedades de cooperaci6n, no de com-
El mismo principio podria apliearse a mayor escala a todo ,
petenCla.
el planeta. Aunque esta observaci6n podria parecer obvia a nivel'
intuitivo, la historia esta llena de ejemplos en los que no sc Sus maravillosos nidos, sus construcciones, superiores en
reconoci6 este principio tan fundamental de supervivencia. camano relativo a las del hombre; sus caminos pavimenta-
Ademas de que pareee apoyarse en el sentido comun, vemos· dos y sus galerias subtemi.neas abovedadasi sus espaciosos
evideneia directa del poder de la unidad y la cooperaci6n en salones y graneros; sus campos de cultivo, sus metodos de
ejemplos tornados de otras especies. cosechar y "cuhiv.u" sl'millas; sus rnetodos racionales para

se nos muestra. necesitamos saber que el resultado vale peras. el desarrollo mas alto de inteligencia y de orga- ciales para criar a los afidos que Linneaus describe pintores. Kohn Escuela de Teologia de St. Rusia en 1993.. es cero. para aplicar una estrategia de este tipo. futuristas y visionarios mas brillan- Tienen mas oportunidades de sobrevivir. animo e inteligencia superior. Antes de cambiar vieran a la naturaleza como el modelo de las sociedades pr6s. John Swomley. y finalmente su Posteriormente en el mismo discurso. lecciones de la naturaleza. poddan a la larga guiarnos a al eliminar la competencia mediante ayuda mutua y apoyo un modelo a seguir para nuestra propia supervivencia. cooperacion y su- prospera. Competir· siempre es des- tando la evidencia presentada por Krop<?tkin y orros. primavera de 1990).242 El C6digo de Dios laue hemos aprendido? 243 cuidar de sus huevecillos y larvas y de con~truir nidos espe:" pectivas dases. 13 pena y que tenemos algo a que aspirar.. describiendo cla- dcan en todas las etapas de su vida laboriosa.. Ci. de pruebas para experimentos sobre unidad. afirma que la coopera-! pervivencia entre los insectos y los animales. A partir de las don es "el factor clave en la evolucion y en la supervivencia" . Se crean mejores condiciones~ madas del mundo que nos rodea. el salon de clase. tcS de nuestros tiempos han especulado sobre 10 que logra- . En un articulo publicado en febrero de 2000. Swomley tructivo" (Noetic Sciences Review. debe tomar- En el discurso introductorio del Simposio sobre Aspecro'! se en cuenta otro factor que existe en nuestro mundo y no esta Humanisticos y Desarrollo Regional... Swomley cita a: que la unidad y la cooperacion son venrajosas para los seres Kropotkin. nuestro estilo de vida. los que siempre estan en guerra unos con orros. Sin mutuo". 35 ramente 10 que reveiaron sus investigaciones sobre el grade de competencia que es benefico para los grupos. quien dice que la competencia dentro de una es. Logan dto la obra valentia. que nos conviene encontrar formas padficas y de cooperaci6n en cualquier entorno.37 embargo. vivientes. Ronald Logan. preguntamos a la naturaleza: '~quienes son los mas aptos. nizadon corporal". y alcanzan en sus res. 0 los que se apo- Un futuro en el que podamos creer Yan entre sf?'. el campo de juego. Estas estrategias. corroboradas por el tiempo y to- pede "siempre dafia a la especie. En una referenda directa a Kropotkin. de inmediato vemos que los animales que ad- quieren habitos de ayuda mutua son sin duda los mas aptos. deja en claro! Ilego a esta conclusion: "La cantidad ideal de competencia. en Kansas City. Se reconoce ampliamente que la naturaleza es un terreno competencia es mas que un simple beneficio de una sociedad. sin lugar a dudas. de Alfie Kohn (No Contest: The Case Against Competition (Sin dades son el resultado natural de la ayuda mutua que prac. declar6: "Si Ie. que se llevo a cabo e~ presente en el mundo animaL Como individuos y como espe- Birobidzhan. Paul. profesor emerito de etica social en la' lizar 400 estudios sobre la cooperaci6n y la competencia. co-presidente d cie.39 afirma que la razon de insistir eh la cooperacion mas que en la. por 10 general debemos saber "a donde vamos" y 10 que simposio.36. todas estas cuali. la para construir las sociedades globales de nuestro futuro. el centro de trabajo. pugna: el argumento contra la competenciaJ). presento el fundamento para que los participantel podemos esperar cuando lleguemos alIi. De manera sendlla y directa.. familia. Algunos de los ciendficos. Despues de ana- EI Dr. 38 camente como "las vacas de las hormigas".

244 El C6digo de Dios lQue hemos aprendido? 245

damos como especie si continuaramos al ritmo ~ctual de avance la naturaleza como Fuentes de energia. Clasifica eI grade de
tecnologico ininterrumpido durante decadas 0 induso siglos. tales logros en un amplio esquema que se basa en tres niveles
Aunque cada vision es diferente, todos pronostican una que eillama civilizaciones Tipo I, Tipo II y Tipo III. 40 Las ca-
epoca en que las condiciones que han causado los mayores racreristicas clave que identifican cada ripo de civilizaci6n se
sufrimientos a la humanidad sean solo recuerdos del pasado.' basan en la cantidad de energia que consumen y la Fuente de
Ven un mundo en desarrollo donde las enfermedades se han su energia. La diferenda en el consumo de energia de cada
eliminado, donde los periodos de vida se miden en dentos de tipo es aproximadamente diez billones de veces mas que el
afios, y donde incluso la inmortalidad es posible. Nos yen evo~' nivel anterior, y esa diferencia puede "superarse" en periodos
ludonando para convertirnos en una especie interplanecaria t relativamente COrtos.
galactica, donde los viajes espaciales, los viajes en el tiemp En este esquema sencillo y directo, Kardashev contempla
y tecnologia al estilo de Star Trek son habiruales. Casi a niv : civilizadones que) desde una perspectiva global, superan su
universal, estos futuristas consideran los aspectos mas oscuro . adolescenda tecno16gica, las guerras y las inevitables diferen-
del mundo como obstaculos temporales, escalones que deben: cias, de tal manera que no se destruyan a sf mismas durante
subirse y que nos llevan a la epoca que enos han vislumbrado. largos periodos. Esos enormes lapsos de tiempo permiten la
En su libro Visiones, Michio Kaku describe su perspecti longevidad de las civilizaciones cuya duraci6n podria medirse
de 10 que nuestro futuro podria ofrecernos como planeta. en periodos de miles de ailos, no de dentos de afios.
partir de las entrevistas que hizo a mas de 150 cientIficos Kardashev describe el primer nivel de progreso como civi-
diferentes campos a 10 largo de un pedodo de diez ailos, Kaklt lizaci6n Tipo 1. La caracterlstica que la define es que han do-
describe una era de posibilidades que parece tan fanrastica q minado los poderes de la naturaleza y toman su energia del
es casi demasiado buena para ser verdad. AI mismo tiempoi planeta mismo. Utilizando el oceano, el viento y las tecnolo-
advierte que un fururo de suministros ilimitados de energia gias de las profundidades de 1a tierra, trascienden las Iimitado-
de inmortalidad, de cooperacion global y de viajes en "worJllil nes de los combustibles derivados de f6siles y los riesgos y
holes" [un tipo de estructura que algunos dentificos creen quO peligros de las economias impulsadas por energia nuclear. Los
podria existir, y que conecta partes del espacio y tiempo q1.Dl:' vastos suministros de energia que estan disponibles para la ci-
normalmente no estan conectadas}, solo es posible si sobrevi ' vilizaci6n Tipo I eliminan la necesidad de competir 0 de pe-
vimos ala presente crisis de las economfas basadas en combus.. lear en guerras debido a fuentes limitadas de combustibles. AI
tibles extra£dos de fosiles y a la tendenda a usar la tecnologla mismo tiempo, su teenologia haee que la energia para las ne-
para nuestra destruccion. cesidades basicas de la vida este ampliamente disponible para
Para propordonar un marco de referencia sobre como sc una poblaci6n que se supone esta en crecimiento.
desenvolveria ese futuro, Kaku habla del intento del astr6no- Las civilizaeiones Tipo 1I se caracrerizan por su capaddad
mo ruso, Nikolai Kardashev, de dasificar el desarrollo de las para llegar mas alia de su propio planeta y tomar energ{a del
civilizaciones por su capacidad para dominae los elementos de sol mas eereano. Habiendo logrado periodos de vida mas lar-

El C6digo de Dios lOw~ hemos aprendido? 247
246

gos, los requerimienros de energfa de las civilizaciones Tipo II . La clave para alcanzar tales niveles de avance
los obligarin a salir del planeta en busca de suministros nuevos es vivir a traves del presente.
e ilimitados de energfa. Dominar la energfa de su sol requeri- . Debemos sobrevivir a nuestra curva de aprendizaje
ria tecnologfas mas sofisticadas que la de colectar pasivamenre y encontrar la manera de superar las diftrencias
sus rayos, como 10 hacemos hoy en dfa. Algunos teoricos su- , que nos han separado en el pasado.
gieren que como eivilizaci6n Tipo II, viajariamos activamenre
al sol con colectores que reflejan cantidades masivas de radia- Dentro de este esquema de dasificaci6n, la humanidad tiene
cion solar a eiertos lugares de la Tierra, disefiados para conver- que alcanzar al menos el primer nivel, ila civilizaci6n Tipo I!
tirla en energfa utilizable. Basandonos en las condiciones de nuestro mundo yen el de-
Enrre los benefieios que disfrutaria una eivilizaei6n Tipo, sarrollo de la ciencia y la tecnologfa. a principios del siglo XXI
II, Kaku describe un mundo que ya no es vulnerable anre las. se nos dasifica como una civilizaci6n Tipo O. Todavfa tenemos
fuerzas de la naturaleza. Con la tecnologfiJ. para regular el di. combustibles derivados de f6siles, cuyo uso amenaza a nues-
rna y hacer ajustes planetarios, la longevidad de esa eiviliza- tro medio ambiente. Al mismo tiempo, el hecho de poseer
ci6n permitida que se llevaran a cabo preparativos que' estos combustibles ha definido ala poblaci6n de nuestro mundo
involucraran eidos planetarios que duradan siglos. como los que "tienen" y los que "no tienen", y ha justificado
Los avances mas sofisticados que se describen en el esque.. todo tipo de conflictos a 10 largo de gran parte de la era indus-
rna de dasificaci6n de Kardashev son los de las eivilizaciones: trializada.
Tipo III. Habiendo avanzado mas alia del tipo de energfa qu .. Una caracteristica de las civilizaciones Tipo 0 es su incapa-
se toma del propio sol, una eivilizaei6n Tipo III se expande e cidad para unir sus conocimientos colectivos formando una
su busqueda de energfa haeia otras estrellas, y quizas induso" sabiduda que beneficie a la especie como tal. Como 10 expresa
llegue al material de que esta hecha la galaxia en sf, al expan. Kaku: "En la Tierra, todavfa somos una civilizaci6n Tipo 0:
dirse y convertirse en una civilizaei6n galactica. En la visi6n d todavfa estamos irremediablemenre fracturados en naciones
Kaku, la eieneia de una civilizaei6n Tipo III podda indusCJ pendencieras y celosas, y profundamente divididos segun
dominar la evasiva energla Planck, 10 que permitida la apertu..; posturas raciales. religiosas y nacionales". 41 Como un rayo de
ra del espacioltiempo para crear vfas corras enrre las estrellas y esperanza, identifica una tendencia adieional que se esta cons-
galaxias mediante wormholes. Tanto la vida como la civiliza-' rruyendo en nuestro tiempo. AI enfrentarnos a guerras civiles,
ci6n sedan inmortales, habiendo superado las limitaciones del <'micas y religiosas, estamos dependiendo cada vez mas unos
deterioro "natural" y la posibilidad de que fen6menos "al azar" de otras mediante la globalizaei6n de las economfas mundia-
puedan destruirlos. A pesar de 10 fanrasticos que parecen hoy les. EI cita la formaci6n de organizaciones comerciales, como
estos escenarios, muchos cientfficos, investigadores y visiona- la Uni6n Europea, como evidencia de esta tendencia.
rios creen que tales tecnologfas y futuros no s610 son posibles. iA d6nde nos lIevar:!n estas tendencias? En un senrido muy
sino que son nuestro destino. leal, la respuesta a esa pre~unta se est:! creando en este mo-

248 El C6digo de Dios
lQue hemos aprendido? 249
memo, a medida que buscamos nuevas forma;> de salvar nues-'
za a traves de armas y tecnologia, sin emender plena-
tras diferencias y unir nuestras creencias sobre el aspecto que
mente las consecuencias de hacerlo.
debeda tener nuestro mundo.
• La ecuacion de Drake calcula que se podrian haber
Si los logros de los ultimos 200 afros son una indicacion
desarrollado unas 10,000 civilizaciones inteligemes
10 que es posible para nuestra especie, emonces el futuro cier~
a 10 largo de la historia de nuestro universo, que se
tamente tiene una promesa que en la actualidad muchos sol··
extiende de 13 a 14 mil millones de afros. Muchos
pueden imaginar en sus suefros. La clave para superar los sufri::
se preguntan: iDonde escan esas civilizaciones? Carl
miemos y las tragedias que parecen prevalecer, es que debem,
Sagan especulo que tal vez no hayan sobrevivido a su
vivir 10 suficieme para construir el mundo que tantos han vis~
adolescencia tecnologica.
lumbrado. Debemos sobrevivir a 10 que tal vez es el periodo d
mayores cambios que nuestra especie haya experimentado ja • iIndican los descubrimientos arqueologicos de una
mas. Debemos cooperar y salvar nuestras .diferencias. Dentr gran ciudad que data de hace ocho mil a doce mil
de cada celula viviente de cada vida se preserva el mensaje q afros, que existio en la Tierra una civilizacion avan-
nos da una razon para creer en nuestro futuro, y la clave p zada antes de que se iniciara la historia? iLos restos
salvar las diferencias que haran posible esas civilizaciones de esqueletos humanos radiactivos, vasijas derretidas
turas. y arena fundida y convertida en vidrio apoya la teo-
Quizas la aurora y visionaria Jean Houston describe mej ria de que esta civilizacion se destruyo con armas ato-
la magnitud de nuestra epoca historica. AI hablar del grade micas, como 10 sugiere la gran batalla descrita en el
los cambios que enfrentamos en la actualidad y 10 que pod antiguo poema epico hindu, el Mahabharata? De ser
mos esperar para el futuro, Houston nos dice con la elocue .1 asi, iestamos cometiendo los mismos errores?
cia que se ha convertido en la caractedstica de su ohra: ,,' • Con al menos 20 guerras civiles, religiosas y poJ(ti-
unieo esperado es 10 inesperado. Todo 10 que era, ya no es' cas en marcha hoy en dia, la "paz" que siguio a la
todo 10 que no es esta empezando a ser. Nuestra era es una Guerra Fda ha sido solo una paz relativa. La tension
de cambios cuanticos, probablememe es la era que mas ha d global y los arsenales cada vez mas grandes de armas
truido y reconstruido en la historia del mundo. Y nosot de efectos masivos hacen que un conflicto planeta-
somos quienes debemos seguir adelante" Y rio de resultados catastroficos sea mas probable aho-
ra que en ningun momento en los ultimos cien afros.

RESUMEN DEL CAPITULO 8 • Ejemplos de las tradiciones de los nativos america-
nos y observaciones de la naturaleza muestran c1ara-
• Con el fin del milenio todavia fresco en la memoria, mente que la unidad y la cooperacion ofrecen una
los ciemificos se preguntan si sobreviviremos 0 no mejor posibilidad de sllpervivencia que la compe-
otros cien afros desatando los poderes de la naturale- tencia y la agresion, La unidad y la cooperacion se

'< ·is\Salcli!:.. . '.:. " '~ 1.'. La dave para Se nOs~~eL1'~ delpensamiento llegar a esa epoca es que nosotros. £1 mensaje de nuestras celulas ofrece una razon para creer que tal unidad es po- sible. 'r~ . .f"-. '". .pIN~~. ! :.250 El C6digo de Dias consideran ahora vencajas estrategicas. como civilizaci6n.~d~OSI '" prensi6n cienclfica y espiritual que sedan necesarias ._.' .'" '{.::: .q'IJlo~ .)~-. -.~tra5 manos. al·igual que verdades espirituales." ':. para hacerlo. Y~O~~5 con citi.'. cinco ded~'.. • Los futuristas vislumbran una epoca en nuestro fu- turo no muy distance en la que la enfermedad y eI 1I~~:~~1l0S con. ""'''. . sufrimiento actual sea cosa del pasado.: ' . ~ '0. ":y~~Vi'<tt~'nt. sobrevivamos 10 suficiente como para lograr la com.h. ·NQAl?~·~M~~. ~. r ' ~..

plan de mayores dimensiones. Capttu[o Nueve EL CODIGO DE DIOS: Una razon para creer S ~.'dad". muchedumbre. en toda . aSI . aunque algunas veces . van tan coneentrados en sus diligencias. ' iempre me han fascinado las multitudes. Sin embargo. es facil imaginarse que tales experiencias juegan un papel menos axiomarico en un . 0 en la persona que camina a su lado. del caos organizado de tantos individuos. que por 10 general no se perca- . eada uno inmerso >en los asuntos de su propia existencia. cada una de las per- r sonas es el producto de todo el dolor y la rragedia personal. tan de la realidad de los que los rodean. Prevalece una sensaci6n. en sus reuniones.pras 0 los que simplemente se trasladan de un lado a orro. que con frecuencia se describe como "electrici- . y que s610 se presenta cuando cientos 0 miles de perso- nas se reunen en eI mismo lugar y al mismo tiempo. En medio . desde los conciertos y los restaurantes. hasta .las salas de sesiones y los patios de reereo. los separa s610' una minima distancia. Aquellos que andan de com- .

los partidos finales del Super monia que perdurara. dad que se deriva de sucesos afortunados. I Desde los esrragos que ocasiono el Huracan Andres y las en comunidades independientes. en 1a de muchas generaciones futuras. . su cultura. los mula precisamente esta pregunta a los partidpantes.sucesos que modiflquen la vida y que puedan moldear de ma- En debates informales durante seminarios 0 conferencias. a muchas personas en el pasado y que pudiera ofrecer una ar.ran vividas en la mente de esta generacion y con coda probabi- reunen. en un solo dla se unie- Durante la segunda mitad del siglo XX.'olvidar 1a imagen de esas personas de coda condicion y de di- da a debido a una meta comun. placenteros entre personas que eran absoluros desconocidos. versas nacionalidades. canada momentos de regocijo y una razan para disfrutar una experiencia compartida. han dado los mayores extremos en cuanto a sequ{as. se tuvo la impre. ~que verdad podria revelarse que pudiera tener . de orgullo de los oficiales de la policia y de los bomberos. su religion y su . como en alguna tragedia comparri. ya que en los ultimos 100 afios se . es cuando nos dad de Oklahoma y la explosion del reactor sovietico de Cher- viene a la mente una sola pregunra: "~Que se necesitaria para nobil. for. . las que nos han propor- mento? . en nuestra memoria pero que tambien proporcionaron algu- da?" De la misma manera que un himno nacionallleva a las nas de las mejores oportunidades de colaboracian. mas que Experiencias que unen '. bien hemos podido experimentar un sentimiento de solidari- un efeeto semejante? ~Que Frase podria enunciarse que tuviera . los aeropuerros masivos que se han convertido do. Se dieron eventos el poder de trascender las creencias que tal vez hayan separado . ram- estado social. La res. que de repente.'cuerpo cubier~o par una capa de pavorosas cenizas grises? sivo de acontecimientos catasrroficos. 0 mientras nos sentamos en inundaciones de Europa Oriental. cuando pensamos en personas que se . experiencia personal y en una perspectiva historica. tas. .1 .254 El C6digo de Dios EI C6digo de Dios 255 como del exico y el jubilo que los eondujo allugar en don. Con mayor frecuencia. . ~Quien puede necesidad de solidarizarse. par 10 general descubrimos que es en respuesta a una Jidad. estos momentos han sido con frecuencia irrupciones efimeras de entusiasmo. Esta conjetura se con. . Sin embargo. En cuanto Las imagenes del 11 de septiembre del 2001 permanece- a recuerdos recientes. Sin duda alguna. personas mas alIa de sus diferencias. algunos ocasionados por (Quien puede olvidar las emociones encontradas de horror y el hombre y orros por efectos naturales.' participantes consideran las tragedias como oportunidades mas puesta mas frecuente es una que se fundamenta en una propicias para lograr la unidad. Bowl y las competencias Olfmpicas. inundaeiones e incendios. los baza. durante el mismo lapso de tiempo. ron para escapar vacilantes de los edificios ardientes con el sion de que nuesrra familia universal padecio un numero exce.como las bodas de la realeza. tormen- de comparten un breve momento en el tiempo. as! como los peores desastres AI deambular por los mercados exoticos del Peru. mucho despues de transcurrido el mo. entraban a los mismos edificios una y otra vez para salvaI' . 'nera legltima el curso de la historia. que firma de manera estadistica. . fueron codas tragedias que dejaron una marca indeleble reunir a toda esa gente en un momento de unidad comparti. hasta las bombas de la ciu- un cafe al aire libre en casi cualquier ciudad. industriales y ambientales que hasta ahora se hayan registra- res del Cairo.

estos confesaron que el fuerte ::comprueba en el momenta del suceso. los prestadores de servicios. : "~Que se necesitaria?" En realidad me estoy preguntando.de captar nuestra atenci6n en un dad a traves de la tragedia. Necesitaria penetrar dia. los alga mucho mas profunda y actuaron. La experiencia di. erizar el vello de en que actuaron. para que otros pudieran Desde esta perspectiva. tambien fuimos testigos de 10 mejor del En estas y en otras ocasiones semejantes. . Aunque los inciden. respon. arriesgaron permanente la vida de las personas. se les pregunto10 que pasaba por su mente en el momenta '. . pro. estaban tra. sin vacHar ni por un instante. 'de un "sf" de aprobacion que saliera desde las entrafias y que Cuando en conferencias de prensa posteriores a la trage. Es como si surgiera una "fusion" no de la ciudad de Nueva York. no era infrecuente que aquellos a los que se nuestro cuello y sacar Iagrimas de nuestros ojos. "<que Ademas de 10 que dichos sucesos nos revelaron acerca de . de nuestra especie. rado par salvar vidas. cada uno de nosotros venia de un sentimiento surrealista y en ocasiones hasta "mis. :sahemos que . desde sus emranas. tambitn nos ensefiaron alga : que pudiera despertarnos a todos a una mayor percepcion de acerca de nosotros como seres humanos.." la fuena que despiertan en nuestro 'momento dado y que pudiera guiar nuestro corazon y nuestra interior. En ejemplos incontables de herolsmo de. tan tico" de una fuerza poderosa que los impeHa desde 10 profundo : personal y tan autentica que no pudiera ignorarse.magnitud pudiera sucederles a los que se encuentran en lIll recta de otro ser humano que estaba necesitado 1es hablaba . es el significado de fa genero humano. Precisarfa de su ser. trascendiera nuestras rutinas cotidianas. para sacar al mayor numero de personas de entre los es alga mas que un simple espfriw de colaboracion con los escomhros de 10 que habia sido el orgullo del perfil urba. isolo porque les rendian honores por sus esfuenos sobrehumanos. individuos preocupados por los demas. solidaridad y determinacion? <Que se necesitaria para poder ir res son los catalizadores que nos agrupan en prototipos de "uni. 256 El C6digo de Dias El C6digo de Dios 257 otros. Cualquiera que sea el catalizador. mente a una nueva realidad de colaboracion y paz que enaltez- humeantes. s610 para desaparecer y esfumarse en el infierno subse. mas aHa del mero hecho . 10 que cambia de manera sinteresado. necesitarla compartir una vivencia que fuera tan profunda. fa experiencia les desperro De pronto. Dejando a un lado 1a 16gica que par norma cuente? general los apartar{a del peligro. en un bazar 0 en un cafe en donde se planteara 1. otros integrantes del rescate. impulso de fortaleza que arras percibian como heroismo. tJivencia.' hasta e1 mismo meollo de nuestra esencia.s algo fidedigno! Si una experiencia de dicha dieran que no les «qued6 otra alternariva". con frecuencia expresan que su fortaleza seuntes. mas que los sucesos en sf. cuando me formula la pregunta VIVlf. en un contraste de almas que sabcn que juntas. aeropuerro. su vida. i. Los que han trabajado lado a lado en un esfuerzo desespe- bajando lado a lado can los equipos de rescate y can los tran. Durante las entrevistas que se tllvieron can los . En ese dia. vivencia podria compartirse por un gran numero de personas nosotros mismos como sociedad. los banqueros.1 ~- . ca la vida?" Y esa respuesta debe vincularse a 1a vivencia que se sobrevivientes de esos instantes. viene de algo mas aHa de los despojos de edificios . . . chefs de restaurantes y los vendedores ambulantes. son capaces de lograr alga mu- desolado con los horrores que resultaron de la peor expresi6n cho mas grande de 10 que un individuo pudicra obtener solo.

mas aHa de las crisis amenazadoras de una teeno- Gracias a Ia experieneia personal de permitirnos comparrir logfa inconrrolable. hemos otorgado a la riqueza. que nuestra disposi. dad..el exito de algun miembro de nues- padre.y supervivencia para los demas. Es el sentimiento axiomatico de dicha Somos una familia -can roda probabilidad unica en su es- experiencia.podrIa mantenerse ftrme en eI entendimiento de descubre la forma de superar la enfermedad. . como ble para orres que no estuvieran tan eerca.l tic E . h. la su relaci6n con un poder superior. la experiencia de uno de sus miembros indi- contramos una razon para creer que somas parte de alga mas ca la posibilidad de que a todos les pueda suceder 10 mismo en grande y (enemas la fuena para lograr que nuestro mundo sea otra oeasion. podrian mirar a los ojas a aquellos '. Cada miembro representa un potencial para la diferente. que se hayan registrado en la hisroria. Debido a esra sensacion. ni toleraron y quiza induso les pareee haber poca comroversia: Los indieadores dominanres desagradaron en el pasado. percibirnos uno a otro a la luz de fronteras. prevalece una tendeneia sobre Ia que tal vez nunca comprendieron. educadar. allegado. de una enferme- dad. hacia la cerreza de que valemos mas que el precio que dad: la oponunidad de percibir nuestro mundo y.. que a no sec que cambiemos la forma de pensar qw: no. estamos en la rraynlnll. De la misma manera. la puerta se abre sin desconfiar ni titubear. una posibilidad mayor. EI mensaje que viene del interior rconducido a estas condiciones. a la tecnologia y a las que es aun mas importante. en.I cion de permitir que ocuna. Al adoptar esa mentalidad tecnologia de Ia negaci6n de la vida y el odio. la imolerancia. la raza . de la pobreza que sobreviene a alglin pueblo. una familia. fa algo que tal vez nunca habfan vista antes: la certeza concrera 'familia humana confronta los mayores retos de supervivencia de su minisrerio camun en un plan de mayores dimensiones. . en un momento dado. direcra y profundamente personal. cada campesino y miembro de una tribu. demuestran que en la actualidad. Algunas de las mentes Tal vez sea menos significativo saber de forma precisa ha. II poder del momento ·sociedad 0 naei6n. . empleada publico. toda hombre y cada mujer -cada abrero. Cada vez que uno de nosotros o la religi6n. sin importar ellegado. ta. au. . tal vez 10 . Aunque existen muchos remas en los que los Hderes mun- roestima y honorabilidad. Aunque esta posibilidad pueda pareeer muy remo- . 10 que subsiste pecie dentro de la vasta extension de la ereaci6n. esa experiencia les permirirfa ver de un cambio planetaria. que los rodean. totalidad.para que orros puedan proseguir.258 El C6digo de Dios El C6digo de Dios 259 misma pregunta. los extremos tragicos de una hambruna. de una guerra. 5i estan presentes aquellos a los que diales no concuerdan. con un nuevo sentimiento de conftanza. sieven de testimo- En el precisa insrante en que se da dicha experiencia de testi. de una guerra mundial y de la enferme- dicho momento. Como en mueho mas alIa del momenta.na otra ocasion.j nio de que orros pueden padecer tragedias semejantes en algu- monio de vida que proviene del mensaje de nuestras relulas. mas brillantes'de nuestro tiempo estan de aeuerdo al al1rm:lr cia donde nos conduce dicho momenta. ':tra familia tambien se convierte en un ejemplo de superaci6 n cada guerrero y cada sacerdore. de nuestras celulas dene la capacidad de eondueirnos. nos estariamos dando una gran oportuni.. cualquier familia. entonees esa experiencia tambi~n serfa posi.

EI Poder de un Mensa. tenemos. el descubrimienro de seres inte1igentes fuera del -afios para una sola comunicaci6n! Debido al numero impo- ambito de la Tierra. dan otros 300 anos antes de que se pudiera redbir nuestra impacto que podria tener sobre nuestras actitudes y sobre la : transmisi6n.l" de la senal por si misma podrfa tener beneficios que afectaran de de haber adquirido una tecnologfa. . especulo respecto al . la senal habrla viajado una distan- hemos conremplado las estrellas y hemos reflexionado sobre la cia tan eoorme. iden.260 EI C6digo de Dias El C6digo de Dios 261 una colisi6n con la cacastrofe. la detecci6n . -de recibir una senal de esta naturaleza nos manifestarfa qUl' la Mis adelante Sagan cement6 que aun cuando decidieramos civilizaci6n de origen habia sobrevivido a su evoluci6n [l'UIl I no contestar a una transmision extra-terrestre..'nente de estrellas en nuestra galaxia. Esto significa que antes la primera Frase expres6: ''A traves de rada nuestra hisroria. aEi nm') . . 10 mas probable es que tifieD la busqueda de otras formas de vida como parte de una 'nuestro primer mensaje vendria de alguna parte mds distante curiosidad que es tan antigua como la humanidad misma. una transmisi6n desde la profun- ahora nos enfrentamos con la amenaza tangible de una guerra _didad del espacio vendria de una civilizacion mucho mas anti- global. ilo que haria un lapse total de tiempo de 600 sociedad. pensantes en e1 "3 cosmos-. existan otros seres que conremplen y se mara. : Sin embargo. Con toda probabilidad. "Un solo mensaje del espacio". ellos habrfan dominado las COnsCUIl'1H i. los ciendficos opinan que la distancia promedio cosas mas importantes que hacer!" entre elIas es de alrededor de 300 afios luz. Las comunicaciones equivalentes a las transmisiones de los cuales amenaza eI futuro de nuestra especie. cer una pista respecto a la subsistencia de nuestra trayectoria quemas climatologicos que ya esran afectando nuestra capaci. Si suponemos que todavfa existen otras en que rendimos homenaje a Dios.16gica. el s610 hecho VI'11 en como nosotros -companeros . transcurri- Carl Sagan.de llegar a nuestro mundo. por eI color de nuestra piel 0 por la forma tros y los planetas. desde la perspectiva de Sagan. antes de su muerte en 1996. '. De sec'asi. Si pudieramos de- 'tectar una senal de una estrella cercana. puntas de vista de la sociedad en general. por radio se desplazan a la velocidad de la luz y roman muchf- co el llegar a exterminarnos unos a otros por diferencias de simo tiempo para recorrer las enormes distancias entre los as- nuestros ancestros. Mas aHa de una diados de siglo respecto a un colapso de nuestros ecosistemas.e Si despues decidieramos responder a la senal.no es logi. En su conocida disertaci6n SETI 2 . Sin duda alguna «jtenemos -. gua y presuntamente mas evolucionada de la que ahora En presencia de tales problemas de gran escala -cada uno . sin destruirse a s! nmlllO" forma directa la direcci6n de la investigaci6n cientffica y los ': en el proceso.. En "que la de nuestro vecino mas cercano. dC1IIll" . -casi imposible! cie sino que . recibidamos 300 anos despues de que se envi6.. simple respuesta al cuestionamiento referente a si estamos 0 la diseminaci6n de una diversidad de virus que son inmunes a no solos. civilizaciones. tecnol6gica.. dad para produeir cosechas vitales para nuestra manutencion. Sagan sugiri6 que dicho descubrimiento podria ofre- cualquier terapia medicinal acreditada y los cambios de es. esto significarfa que la . jque cualquier conversaci6n significativa serfa posibilidad de que el genera humano no sea unico en su espe. Ademis de la amenaza de me.

precisamente dicho efecto. reconocible y proveniente de una Fuente que se bable. i sorprendente. 262 El C6digo de Dios EI C6digo de Dios 263 tcaria que es posible sobrevivir a una adolescencia tecno16gi. pudiera tener un impacto tan fuette sabre nuestra familia terraquea. hacia las familias y las comunidades en las que se Ilevaron cia que se comparte es 10 que enciende el mas alto sentimiento a cabo los estudios. como es el Proyecto '. Aunque la reacci6n del conductor a estos estudios no flle za de la presencia de Dios que sederiva de una busqueda mul. Si en lugar de recibir el mensaje simb61ico de una para las oraciones de paz. ~podrfa acaso I que confirman que cuando un ciecto numero de personas 10- el mensaje tangible del nombre de Dios desde el interior de . do. nuestra enrrevista. par el telefono: "iExcelente entrevista."4 Por afiadidura. anunci6: "jPermanezcan con nosotros! jRe- gresaremos despues del resumen de noticias que se da al termi- IContactol . no de la hora!" Escuche la interferencia ya conocida de la escatica Sin perder de vista la especulaci6n de Sagan. tco mundo y el poder que tiene ese campo como conducto tro mundo. la magnitud de una experien. la voz fuerte del moderador se escuch6 10 que conocemos acerca del significado de descubrir seres in. imagina El tiempo perfecto 10 que podria significar si la seoal fuera reveladora. jun mensa- je que se pudiera interpretar! El conductor del programa.> que dijo enseguida me caus6 escalofdos."Si esto es verdad.pez6 por compactir su opini6n de que nosotros. 5 humano. 1<. somos el producro de una gran inteligencia antigua. "entonees ell algunOl L . al mensaje que esti dentro de cada . Si definimos "contacto" como fa formulaci6n de un men- ca. . de unidad entre personas de diferentes antecedentes. podrfa tener el potencial de producir I humana. de la transmisi6n del radio y el "sonido agudo" que indicaba utilizaramos los privilegios de recibir una sefial extraterrestre que estibamos fuera del aire unos instances durance la ince- con un mensaje de otro tipo? <Que pasaria si aplicaramos todo . EIlI- tinacional y a traves de muchas decadas. COIlIO espl'l:ie del Genoma Humano. saje viable. es bastante factible que "el futuro de fa civilizaci6n origina mas alIa de nuestro mundo. al lIegar a la segunda mitad de . ~que sucederia si . el nombre minutos previos. erea a traves de sentimientos de paz unificados) se ha compro- semejante? . entonces el descubrimien- humana dependa de la recepci6n y decodificaci6n de mensa. Sagan indica que aunque no es rouy pro.bado que el efecro se extiende mas alIa del grupo que esd aran- Como denotan los estudios. con un efecto . De pronco. rrupci6n. Gregg. jbien podria considerarse como un contacto! Si el simple hecho de recibir una sefi<J. Acababa de compartir los escudios sefial electr6nica desde 10 profundo del espacio. irresistible! jEmpezamos can el pie derecho!" Durante los 30 celuia de nuestro cuerpo? En un sentido innegable. to del antiguo nombre de Dios dentra del c6digo genetico jes interestelares". el tema de nuestra discusi6n fue la prueba de Dios en nuestras celulas viene de fueca de este mundo y al ciendfica de un campo conciente unificado que envuelve nues- mismo tiempo tiene un fundamento firme como algo de nues." razon6 en voz alta. es un material teligentes en otros mundos. La certe. . gra 10 que se denomina "emoci6n coherence" (como el que se nuestro cuerpo producir una experiencia anaIoga.

Esa noche. continuo: "Creo mos pronto!" senti que era predsamente 10 que necesitaba para que algun dia encontraremos esa prueba y se convertini en una animarme en ese momenta de mi vida. jSUS palabras me tomaron totalmente desprevenido! El Opino que. de for. que ahora es el tiempo perfecto para compactir el mensaje que zo el siguiente segmento del programa.. El hecho de que se formulara la pregunta tambien sugiere "En diez segundos estaremos de nuevo al aire". es decir. Para mr. el hecho de que se huhiera formulado. Gregg? ~Crees que es. Apenas dandose trarlo. con frecuen- de exactamente esa prueba! Mi mente daba vueltas mienrras : cia decimos con precision las palabras correctas. Es tado conciente comparrido.. cada uno hombre al otro lado de )a lfnea telef6nica no tenia forma de de nosotros trabajamos juntos de esta manera. dijo. era como si. en cuesti6n de que el director del programa habfa descrito y que nos daba segundos despues de formular la pregunra.264 EI C6digo de Dios EI C6digo de Dios 265 parte de nuestro pasado esa inteligencia debi6 habet dejado La que el entrevistador no podia saber era que yo habra evidencia de su existencia. "accidenres". es probable que existan muy po. y comen. ca nos hubieramos imaginado.para recordarnos que somos parte en si. el tono y el razon para dejar de luchar unos con otros. como especie. AI escuchar las palabras "jsolo espero que la encontre- un poco de tiempo para respirar entre frases. . En algun lugar de este mundo debe llegado a un punto en mi invesrigacion que era basrante frus- haber una senal que es inconfundible -'la tarjera de presenta.• siglo mas sanguinario" en el registro de la historia humana. nosotros somos los unicos responsa- ma conjunra. cion de Eric Hobsbawm que indic6 que el siglo XX era "el Si en realidad estamos rodos vinculados a traves de un es. aunque el entrevisrador debido a actos intencionales de violenda y al descuido del habIa hecho la pregunta a nivel personal. una razon para creer que era posible tener paz en nuestro mun- mas la voz del conductor del programa. . habfa empezado a dudar sobre mi enfoque para encon- de algo mas grande que nosotros mismos". hecho de sec honestos en nuestras conversaciones. Las estadisticas que transmiti en el Capitulo 1 sobre perdi- No obstante. nuestra concienda colectiva hubiera formulado hIes de la perdida de muchos de nuestros semejanres. iSolo espero que la apremio de su voz resono como una suplica y sus comentarios encontremos pronto! (Tu que piensas. aun que la que se origina por los efectos de desasrres naturale. mi dilema se esfumo. Nunca tuve la OPOftU. al escuchar una vez . unos meses despues para seguir adelante y es- d. nidad de contestar a la pregunta y nunca se volvio a formular. bienesrar de l~s demas. . iesdbamos pidiendo ayuda! :. hay en nuestras dlulas. Sin embargo. en el momento discurrfa la forma en que iba a contestar su pregunta con ho. Desde esta perspectiva. Por el simple saber que durante 11 anos iYo habia estado a la busqueda . trante. adecuado y los orros nos pueden escuchar en formas que nun- nestidad sin traicionar mi decisi6n de no discutir mis des. en especial sorprendente advertir que las estadisticas esclare- cos secretos en nuestro mundo y con roda certeza menos cen 10 que muchas personas ya sospechaban. represeman un testamento lobrego de la asevera- de este relato. es la clave " das de vida. me inspiraron. do. en un nivel inconsciente y silencioso. mayor la pregunta para todos. Aunque no habia cuestionado la existenda del c6digo cion' de nuestro Creador. escuche como "no- cuhrimienros sino hasta haber concluido el trabajo y poder sotros" nos pedfamos que encontraramos la clase de prueba comparrirlo con responsabilidad. en alguna parte?" cribir este libro.

. continmibamos recibiendo las notieias can la mis. La conver. Tal vez sea precisamente porque todavfa esra por verse dicho La naturaleza y el esrilo de presentaeion que se requiere nive! de cambia a gran escala. Desde entonees. ra reeibirse hoy en dia de los medios de comunicaci6n! Sin vas que se reforzaban can ilustraciones grafkas impresionantes embargo. Hasta las insinuacio- revelara de forma rutinaria. eI mensaje se podrfa perder como nes de la eficacia del sexo y del tabu requieren hoy en dfa un sucedio can el grito de "viene e1 "lobo' en la fabula. rna inrensidad. el publico en general. 5i vivieramos en un tiempo en el que Ia informacion mas que unos instantes.1 1. profunda y la opoftunidad para hacer algo al r('spt'< Ill. de nuestras celulas. . lia global. A pocas horas de los primeros reportes. As1 pueda darse tal cambio en una proporcion significativa? iMi como los norteamericanos se tornaron insensibles ante las es- respuesta es un sf categoricot Ademis de ser posible.11(')11 mientras buscabamos volver a la "normalidad" en nuestra vida . que se presentaba mental en la forma en que nos percibimos a nosorros n I i. trajo consigo una secuela que tal pueda lograr un cambio que consoIide la vida y contribuya a i vez no se esperaba. punm de arranque. Un coroJario importante de los acontecimientos de! 11 de Puesro que el950/0 de nuesrra familia global cree en la exis- septiembre. ante nuestros ojos. mayor grade de impaeto. hace que este " oporrunidad de 'un cambio significativo. el tener conodmienro del mensaje que esra dCllu"O y los temas musicales compuestos can sumo cuidado que acre. . 5implemente' prepara el escenario al proporcionar 1111. se volvieron tambien rutina en nuestra vida. se ha insensibili- mundo desde hace por 10 menos cuatro siglos. con frecuenda se me pide corrtpartir mi I nueva crisis. za que Ilevamos dentro un mensaje de esa supremada. se nos ane. £1 tOS de Vietnam. revertir la tendencia a la crueldad que ha dominado nuestro En diversos gradas. ha excedido todo aqueHo a 10 que que sacude los cimientos de nuestras creencias esenciales se escabamos acostumbrados en el pasado. un mensaje que mueva a rodos los miembros de nuestra fami- midad" es mayor que nuestras diferencias. Durante los dfas y los meses que siguieron.266 EI C6digo de Dios El C6digo de Dios 267 y por las enfermedades. Al enfrentar estos recordatorios funes.\llll}\. para sobresalir en la programacion gencia de tamas situaciones actuales que de forma individual " cotidiana. ya de par s1 reealcado. a traves del pader de sea el momento perfecto para descubrir que nuestra "unifor. como 5i cada dfa que empezaba trajera una tOS de nuestro pasado. no garantiza que se de un cambio fllmb centaban eI drama. que ahora sea la oportunidad en nuestros dias para absorber nuestra atencion durante algo perfecta. la fuerza implacable de esa co- opinion sobre Ia posibilidad de que un poco de informacion bertura de alta tecnolog1a. fue la constante intensidad con que los medios tencia de un poder superior. el hecho de saber con tanta certe- de comunicacion informaron las consecuencias desastrosas de .fctimas de la guerra durante los acontecimien- esta magnitud de cambio se puede lograr y es necesaria. ibien la tragedia. algunos sucesos notidosos que deblan haber mensaje de un Dios Eterno denteo de nuestras celulas ibien exigido nuestra cabal atencion antes de la rragedia del 11 de puede ser el catalizador que inicie dicho cambio! septiembre. opino que tadisticas de las v. ~Es posible que zado ante los reportes impresionantes de guerra y de terror. Es denrro de este contexto que se presenra la representan una amenaza para nuestro futuro. podrfa rivalizar con la transmision mas importante que pudi~­ go con un nuevo formato de periodismo: los repones televisi. h till cotidiana.

300 metros. el cambio de clima y brado a los empujones. congelados instantaneamenre . esta hr{'\'(' \'1\11.4H graron. los habitantes de la Tierra en esa epoca fueron testigos de te de que una poderosa experiencia de unidad. implica.000 afios. A partir de este tipo de historias. que indican que tambien ocu- rrieron cambios climaticos de gran magnitud. 10 que equivale a traumas de proporcio- El cambia parece ser una parte fundamental de la naturaleza nes inimaginables. un viaje que nos llevada a una altura de 17. sobrevivienres. En la primavera de 1998. otros han requeri- lidad para responder al cambio. en 10 que creo es la dave para hacer cambios significativos que ti6 en el Polo Norte. tambiin hemos sido testigos de fusiones cultura- bios en diversos grados. comunicaci6n para explicarlo. La breve historia de nuestra especie esca llena de cam- i dominaci6n. En respuesta.' . magnetica! En unas cuantas horasI y futuro colectivo. llegando casi a 90. cuando el Polo Norte magnetico ~. Me habia yo aeostum- con el ultimo bocado todavia en fa boca. durante los ultimos 500 mos hemos experimentado la tura rivalizaban entre si. A juzgar por los {Una especle en la que hay "bondad" restos de mamuts prehist6ricos. porciones de la Tierra que antes habian : mucho espado. ocurrieron muy . La dave es la propia naturaleza personas que no tenlan una cienda apropiada ni medios de . la conquista y la esdavizaci6n de concinenres y poblaciones enteras. Aunque las cifras de fa humedad y la It'lllpn. haee aproximadamente 10.000 ron y se llenaron de humedad. Junto con la historia de la expansi6n y la humana. humana. 10 que es un ejemplo de nuestra habi- una ligera adaptacion a nuevas actirudes.& rales. todavia nos preguntamos que evidencia exis- dias. Existen evidencias. yal parecer 10 10- . das. capaces de adaptamos a condiciones inespera- Por ejemplo. son parte de una travesia con otras personas en lugares sin dptdo. el tir6n casi no se notaha. Nuestros antepasados ruvieron pies sobre el nivel del mar. y el cambio que un cambio de 180 grados.: tro del Tibet. horas en Nepai. como datos precedentes de arboles y f6siles. Para aeostumbrar a nuestros ClIt:r- que adaptarse dpidamente para sobrevivir. 'oeu- ~ Illversi6n rn'0 una extrana . pos a tales extremos. Somos una especie de do un pensamiento ripido e innovador solo para sobrevivir. Aunque algunos solo han neeesitado les. pudiera aceptarse a gran escala. religiosas y raciales. teniamos programada una estancia tit. tuve el honor de tenido un dima benigno y fertil sufrieron sequias. . me baso de la Tierra se convirti6 en el Polo Sur. borde de la autodestrucci6n. mienrras : organizar una peregrinaci6n de 23 dfas alas monrafias del cen- que zonas que siempre habian sido aridas y desiertas se enfria- . y el Polo Sur se convir- . choques y encuentros cercanos que el p. es obvio que el cambio es nuest:~s antepasados experimentaron un grade de cambio que una parte importante de 10 que somos. apoyen la vida en un mundo que en ocasiones parece estar al S610 podemos imaginar 10 que este fen6meno significo para . AI principio.268 El Codigo de Dios EI C6digo de Dios 269 Una especie que cambia exploraci6n. que tiene una altitud de aproximadalllt'lllt' Ademas de los efecros catastr6ficos de los fen6menos natu- 1. De pronto. La evidencia geolo- dispuestos a hacer 10 que sea necesario para garantizar nuestro gica suglere que cerca del final de la epoca Pleistocena. Ojala tambien estemos e: easll~pensableen el mundo modemo.rofundo congelamiento que 10 acompafi6. No obstante..0000 12.

y con un solo movimiemo bido al dlido viento que barria las baldosas de la plaza. Sin decir una palabra. Mire por debajo de su cintura donde de.1. intrincados diseiios que formaban el marco de las puertas y Me llev6 un momento encontrarle sentido a 10 que con.l . Habiendome acostumbrado a la enorme pobre- enrender el fuerte acento paquistani de nuestro gUla en medio za que habiamos visto en 165 ultimos dias. mis expectativas y mis estaba preparado para ver 10 que vi. mano abierta. con la intensa mirada de un hombre que se vela muy anciano y Con una palma todavia en el sudo para equilibrarse. estaba. Con la misma mano. Esta. Me aleje de el instintivamel1£e. Por alguna raz6n. movi6 el dinero hacia mt con su gos mechones de cabello cano que no dejaban de moverse de. y estaba viendo. Send que el ya habfa logrado III 'pl!" .. manchada y oscurecida por los afios de . y se nos dificultaba bre y para mt. das al hombre por mostrarme este lugar tan hermoso. las palmas de sus manos sobre el suelo y se acerc6 a mt Mire hacia la orilla de la plaza. y aunque la tradicionaI ceniza blanca que cubre a los . no 10 hice. mis ojos escudrifiaron entre los comocian.11 It- hacia arriba para ver si alguien mas habra norado 10 que yo las gracias..1. AI volver a dirigir la mirada hacia abajo para darle las gra- das bajo su cuerpo. Tome mi mochila y Ie di el dinero nepales que pude en- si no hubieran sido tan persistentes.270 El C6digo de Dios El COdigo de Dios 271 nos permitiria un aseenso gradual a Ia altiplanicie tibetana. De pronto. se vefan se elevaba cerca de donde esdbamos. pero 5610 estaban los dobleces de una y miles de diminutas figuras humanas esculpidas en la anti- tela sucia que llevaba como taparrabos y que llegaba hasta eI quisima madera. nues- manchas que revelaban el color oscuro de su cuerpo. Fijando la vista para ajustarla ala distan- templaban mis ojos. Busque por el suelo. vi la espalda del hombre a medida que se akj. algo sorprendido por la ex. algunas de elias eran dioses hindues.l. De manera instintiva. que este hombre era un mendigo yesperaba recibir una limos- Yo podria haber ignorado los tironcitos en mis pantalones na. Moviendo la cabeza de izquierda a rodillas. por completo 10 que estaba pasando en el suelo bajo sus ojos. la vista y vi un templo muy anriguo de hermosura singular que hombres santos se aferraba a la humedad de su piel. que se tro grupo no se percat6 de el cuando entramos a la plaza. Casi me indico un edificio que estaba detds de nosotros. bamos de pie con nuestro grupo en el espacio abierto de Ia Era como si 10 que estaba ocurriendo fuera s610 para ese hom- hist6rica Plaza Bharkir de Kaatmandu. r . lenramente perc con flrnl(·. cia. periencia. El blanco brillante de sus ojos miraba a traves de lar. No cuamo a mi poder de discernimiento. ventanas del edificio. cuerpos de los peregrinos y turistas que caminaban en la plaza. En lugar de piernas. . supuse de inmediato de las voces de los vendedores que nos invitaban a sus puestos. Las personas a mi alrededor paredan ignorar nos dada tiempo para imbuirnos en la cultura nepalesa..lh. Levanre desnudo. el hombre puso lentamenre impulsando s~ tabla con ruedas. mire contrar. suelo. Ha- veia aun mas oscuro debido a afios de exponerse al sol de las biamos entrado frente aI musgo verde que cubrfa la fachada de zonas altas. derecha para indicar "no". Lo que sucedi6 despues fue una poderosa lecci6n en hacia abajo para ver eual era la causa de esta distracci6n. empece a distinguir los fantasticos detalles que eran miles berfan estar sus piernas. habfa un trow de madera con rue. Este trow de madera era al parecer su unico medio de 10. Aunque pense en seguirIo pal. Mis ojos se encontraron SUPOSlClones. el ya no uso. el cuyo rostro de escasa barba apenas si llegaba a la altura de mis hombre rechaz6 mi oferta.

una especie en fa que podrfa describirse como <tel mal encarnado". y me senti bien al saber que existfa un hombre as! enteros de mod~ que Heven a cabo sus complots. y que obviamente no tenia piernas y poseia percibidas. el hombre de Ia tabla solo queria compactir una dores aspectos de nuestra naruraleza. y estaba segura de que este momento ha. mas. comunidades 0 naciones. Usando su carisma para seducir ejen:iros encontrado. Las circunstancias. A pesar de no tener nada. En nuestro esta. eeniza de su euerpo y fa mirada de sus ojos. No s610 no de guerreros y sobreviviemes. por necesidad. Mas tarde ese dfa pense en ese hombre y me Jack el destripador 0 Ted Bundy. compasion y una actirud de atencion AI principio habia juzgado al hombre. como 10 habia demostrado el hombre de la tabla. tambien somos una especie que se han vuelto tan comunes en todo el mundo. ya sean reales 0 que 10 cuidara. (nuestro gu{a nos habia dicho que no 10 momentos cuando somos testigos de los peores y mas aterra- hicieramos). parte de su mundo conmigo. ataca- acercado a mi no para pedirme algo. es en esos util a este mendigo. pueden provocar nuestra y la tabla bajo su cuerpo. . Cuando se nos Ileva a los extre- queria una limosna. otras naciones e incluso contra Sli de esos sentimientos tan poderosos. He hombre me habia dado mucho mas en ese dia que su simple aprendido que este tipo de experieneias breves a menudo son accion de sefialar un edificio. En cada sociedad. En ese momento recibi la leccion: Aqui estaba un hombre nuestra naruraleza bisica yvolvernos violentos cuando se tram que muy probablemente no tenia clonde vivir ni una familia de proteger y de sobrevivir. en la que hay bondad. iSe me acerco para dar! mos circunstancias que parecen estar fuera de nuestro controL Mientras mi mente habia supuesto algo y pasaba a traves de . leeciones poderosas. En raras oeasiones. 0 que aborreeemos. hay estadfsticas que la verdadera esencia de la naturaleza humana.parecen refutar nuestra bondad. que creemos nos amenazan como individuos.) . siemo que somas una especie bia sido una de eHas. Hayen dia. pues hay individuos que se do mas basico. Gracias a 10 que sucedi6 despues cidades contra otras razas. categoria de los mendigos que por 10 regular piden limosna y AI mismo tiempo. AI nivel mas fundamental. Empece a eon5ide. su vida.272 El C6digo de Dios EI C6digo de Dios 273 habia propuesto 0 de 10 eontrario no se habrfa alejado. genre como que hay bondad. poniendolo en la hacia otros. En otras oeasiones. el olor a munidades y vecindarios que en otras aspectos respetan la vida. somos fundamen. vislumbre un ejemplo de 10 que creo es existen excepciones. como muy poco ademas del taparrabos que llevaba atado ala cintura familias. me di cuenta de que este propio pueblo. AI vivir las peores pesadillas como la realidad de estamos en una lueha por la supervivencia. ese terror ha asumido una IlUCV. se habia violencia. Extrafiaba su barba. tales individuos han llegado a pucs- rar 10 diferente que seria mi mundo 5i nunea nos hubieramos [OS de enorme poder. por mera desesperaci6n. tenemos el poder. la capacidad y la volumad para superar d. que causan estragos en co- di cuenta de que 10 extrafiaba. que se esta abusando de nosotros. siempre En ese momento. cometen at ro- "all a fuera" en alguna parte. libres de los esrorbos que nos hacen creer incIinan hacia las earacteristicas mas oscuras que rechazamos y que somos necesitados. ese hombre rechazo el dinero que Ie ofre. casi todas las generaciones han experimentado el terror talmente una especie bondadosa y generosa. y eso era todo 10 que queria. Como en todi generafizaci6n sobre las personas. Sin importar cuaI sea la rawn por la que traicionamos 10 que todo tipo de torpezas debatiendo si era adecuado dade algo se ha considerado nuestra "bondad" fundamental.

alimento. callejeros en los bazares de Luxor.. existe un cerna comtin que he encontra. su vida: paz. y si se nos da la oportunidad. y que nuestra especie puede ser "maravillosa nuestras etlulas para sembrar un cambio realy duradero en nues. evolucionando a partir de individuos y de grupos Egipto. la naturaleza y la vida dia. y observ6 "posibilidades maravillosas y cuentemente el sentido de nuestra benevolencia: "La bondad . eS comtin ver que 1II1 'I"I . y nuestro cardeter escribi6 que la humanidad "tiene una naturaleza superior" como fundamental de bondad. huracanes y terrorismo. el forma trasciende a la materia". encontramos formas de Por fortuna. honrando los aspectos bondadosos de nuestra especie. hasta son pocos y se presentan esporadicamenre. darle una buena vida a sus familias. los esrudios de Maslow 10 llevaron a creer que "Ia genre sentimiento similar cuando escribi6: "La inclinaci6n ala bon. es to que abre fa puerta al mensaje de parte de su esencia. 0.. ~' es decente en el fonda". los alimentos. los "Slodaban Milosevics" y ser felices en cualquier circunstancia que nos enconrremos. Incluso teniendo de la especie trasciende a fa bondad del individuo. que proponfan a la lujuria. . uno de los grandes psic610gos del siglo : XX. basica. daciones. naturaleza humana. resguardo. los Cruzados Crisdanos hasta las recientes tragedias de illllll ria. impresa profundamente en la naturaleza del hom. .rtida. se dedic6 exclusivamente al eSludio de la El erudito del siglo XIII. . se distingui6 en primer lugar por su trabajo en el campo del comportamiento social de los primates. Desde las remotas aldeas y monasterios en las montafias de . del Tibet y de America del Sur. 6 Cuatrocientos alios despwSs. los "Adolf Hiders". za. todos en general parecen estar buscando 10 mismo en tfficas muestran que si no existen condiciones que nos impul. como la " colegas como Sigmund Freud. abismos inescrutables" en nuestra existenda.9 tra vida. . Des- las organizaciones terroristas son la excepd6n y no la regIa. expres6 do. las mentes privilegiadas en posiciones de poder tecnol6gico y Un credente corpus de evidencias antiguas. nuestra "bondad" fundamental se En rni experiencia al viajar a cada continente de la Tierra. y una mejor comprensi6n preferimos vivir en paz siendo considerados unos con otros y " de su lugar en la creaci6n. a partir de su propia naturaleza humana y bioI6gica". "7 Nuestro cardcter unico como especie. sin embargo. Norte. En sus tiltimos N uestra verdadera naturaIeza : aDos. " haee evidente en innumerables ejemplos que demuestran el exeepto la And. hasta los vendedores de escasos recursos y convirtiendose en organizaciones inter. salud y la oportunidad de sen a actuar como animales. . Europa y las poblaciones rurales de Australia y America del nuestra especie. dad permaneci6 finne hasta los tiltimos d{as de su vida. 8 Su fe inquebrantable en nuestra bon- dad esra. al igual que a 10 largo de nacionales bien financiadas. estadista y naruralista. egofsmo. poder de esta cualidad en nuestra vida.'. que 10 que somas por naturaleza. Como individuos y como familias. Francis Bacon expreso un .274 El C6digo de Dios EI C6dlgo de Dios 275 dimensi6n. cuando bre. Abraham Maslow. y la agresi6n como los rasgos de nuestra naturaleza el fi16sofo. ~' politico. Mas alia de las ilusiones. la gente parece ser basicamente "buena" par naturale- mos en circunstancias extremas. sin embargo. de los mendigos sin hogar y la gente que trabaja la tierra. eruditas y cien. Mas que simplemente do entre las personas can quienes he tenido eI privilegio de : un fen6meno modemo. desde el herolsmo en las batallas dl' compartir el tiempo. Santo Tomas de Aquino. podrian ilustrar mas 10 que hace. Esos momentos de tinieblas para .

los ofieiales deeidieron tomar la vida de Kadir rapidamente en lugar de dejarla morir aho. La naturaleza nos muestra que para pasar de un nivel de orden gada. y en Bloques de construcci6n para e[ cambio un momento de desesperaeion. y de perras. En ailos recientes. las de las autoridades que trataron de salvar a una elefanta cau. dad de la rragedia. Ha. ciertas regiones de Europa experimen. vida animal. EI hecho es que. Americana. mientras eHa era presa del panieo y se agitaba violenramenre en el agua. tables y en el humo roxieo. 10 a otro se requiere un periodo de caos entee ellos. habrla sido aceptable y ciertamente justificado ante la enocmi- tiva de ahogarse en su jaula en la ciudad de Praga. de caos podria "verse como "la tormenta antes de la calma". Durante la semana. algo en su interior rrascendi6 toda 16gica y actua. en las horas y dlas que si- les de las montailas. los ofieiales trabajaron intensa. se organizo un proyecto al y preocupaciones que (enemos acerca de nosotros mismos. que en pre. Algo en nuestra naturaleza fundamental considero desperdieios calan sobre elIos. colapso de una pauta existente y del caos resultanre. cubrieron la norieia se enterneeieron hasta las Ia. este periodo a esa opci6n. De todas las imagenes que contemple en guieron alII de septiembre. Ante circunsrancias que amena. cuando montafias de agua y mos. los trabajadores dedicaran su energia a sal. 0 del despido de un em-' . vislumbre el ( ticos fueron rescatados. los animales domes- mania y la Republica Checa. mada Kadir. a proteger sus hogares y sus familias. Ya ron a favor de Kadir. gatos e incluso hamsters que alguicll zan a uno de nuestros semejanres. 276 El C6digo de Dios EJ C6digo de Dios 277 humana cia su vida par otro. Tomando prestada la me- varse. Los reporteros que taron las Iluvias mas fuertes y las peores inundaciones del si. y ciertamente aceptable. Manhattan buscando animales domesticos que hubieran En agosto de 2002. Yo esraba dirigiendo un viaje en eI sur de Peru cuando sarisfaccion de quienes arriesgaron su vida en edificios ines- lluvias torrenciales devastaban sitios hisr6ricos en Austria. muy a menudo un insrinro rescata de una casa en llamas. La gente iba de casa en casa actuarnos. Ale. rrumbando y en casas que se habian incendiado en el Bajo (ra especie y hacia eI reino animal. caos de la devastaci6n que llegaba via satelite a los aparatos de moviendo la cola 0 gimiendo suavemente en respuesta al television que solo captaban una estaeion en los hoteles cura. en los edificios de apartamenros y hoteles que se esraban de- gada en nuestra naturaleza que 10 extendemos mas alIa de nues. Una vez mas. basico de preservar la vida se vuelve mas fuerte que los miedos Despues del 11 de sepriembre. una nueva pauta y un orden mayor. no 10 hici- Arriesgando su propia vida. aceptable arriesgar la vida humana en un esfuerzo por salvar la mente para liberar a esra elefanta de la India de 35 ailos. se riene sencia de tal caos. A partir del Habrfa sido mas faeil. Al final. deshidratados y vivos. aceptar la perdida de vidas ani- ese tiempo. Uno poc uno. se han transmitido sea que estemos hablando del caos del divorcio que precede a rdatos similares sobre caballos en las zonas inundadas del Oesre la felieidad de un nuevo matrimonio. arriesgando su peopia vida. contacto humano. sus esfuerzos fallaron. Este instineo parece estar tan profundamente arrai. y que no se dio mucha publicidad. las mas poderosas desde mi punta de vista fueron males como consecuencia de una carastfofe de tal magnitud. quedado abandonados en medio del caos. hambrientos. Pero al enfrentarse tMora popular de "ta calma antes de la toementa".grimas ante la glo. como especie.

dos de los factores necesarios ficio va precedido de un periodo de cambio inestable. hacen que el que siempre esd. Las estadisticas muestran que la que apoye la vida. nuestro sistema actual de creencias debe 'mitad de la poblaci6n norteamericana tiene sobrepeso clfni- experimentar el desorden del caos para restablecer 10 que es .. cada bene. ha reemplazado al orden.nos no se sorprende al ver los resultados de este tipo de esrud il . tambores. campanas. La historia muestra que nuestra disposici6n a cambiar es uso de sonidos. Debemos estar dispuestos a cambiar. Este para que un dato marque una diferencia significativa en nues- principia se ilustra daramente en 10 que parece ser una de las tro mundo. Para sanar las creencias que nos han hecho pensar que . .. el cambia alcohol. 'La finna de Dios: una raz6n para creer De manera muy similar. "sananda" se trastornan y se introducen en un caDs. La idea es que la "vida" tiene un plano inherente de salud. I sonas no estan dispuestas a hacer los camhios q lie plld. En este marco de referencia. los prejuicios. se consideran los principales es una forma de caos que daramente es parte de nuestra natu. Antes se esra.. Simplemente desaparece y el re- sultado es que la persona "sana". presente. incluso cuando pareee que e1 caDs. y el habito de fumar. el ejercicio. pues la salud es el plano basico de la ~bio que estamos a punto de hacer puede lograrse. ·2. de hacer el cambia en nuestra vida.. se necesitan tres elementos: · biarse con relativa facilidad.. EI C6digo de Dios 279 pleo que lleva a toda una nueva carrera profesional. La mayoria de los norreamerica· . en forma de enfermedad. Como la enfermedad no tiene un plano basko. pn 3.'la naci6n.En meses recientes. revistas cientifieas y de otros tipos han que amenazan nuestra existencia son una "enfermedad" que descrito 10 que en la actualidad se considera una epidemia en no tiene un plano bisko. el verdad en nuestras vidas.111 i t m . en el mundo mas amplio de los pa- trones. los juicios y la intolerancia . Illih h. inherente a nuestra naturaleza.mos una sefial de que es posible Hevado a cabo! "encontrarse" y restablecerse. ya estan presentes: form as mas mfsticas pero eficaces de cambie entre algunos pueblos nativos: el sanar al cuerpo y a la mente mediante el · 1.l . Induso teniendo conocimientos mlly daros. Las crecientes amenazas a nuestra existencia.. no puede . prospecto de un cambio valga la pena. Como sociedades. . Debemos creer que vale la pena haeer el cambio. gongs. . 1. necesitamos una raz6n para creer que el cam- cuentran y se restablecen. II Faetores en el estilo de vida. ·su causa! 2. como la dieta.. 278 EI C6digo de Dios . ya sea como individuos 0 Cuando el sonide se detiene. aunque rodos elIas son habitos que pueden cam- nuestras diferencias son imolerables. Desde esta perspectiva. Debemos creer que el cambia es posible. los sutiles patrones de vida del individuo que EI orro elemento necesario es tambien el mas obvio. las creencias.co. Con un usa preciso de dnticos. jNecesita- vida. tonos y cantos. ·Yeste tipo de noticias: jYa saben que tienen sobrepeso y nul n 1. Para que ocurra un cambio duradero Estados Unidos: la obesidad. los patrones saludables se en. sonajas. factores que contribuyen a esta plaga que se extiende por toda raIeza.

de que e1 nombre de Dios esra en e1 interior de tro camino evolutivo. i. han abierro la puerra a mundos de cambio y de y para ofrecernos una razon para confiar en nosotros mismos. iLa dave de nuestra supervivencia es fies mas saludables. se romo en te de la forma en que nos idendficamos exteriormenre. (mico como individuos. del presente y del rna manera. las realidades vivie (por ejernplo. d Como especie. mundo cambiante. futuro. EJ C6digo de Dios 281 tribuir a su longevidad. Como nacian. pero en una EI ejemplo de una obesidad nacional ilustra una de las ma. La naruraleza nos ensefla que nUt:S(f'.280 El C6digo de Dios . creencias y estilos de vida son par- ver las bacterias con las lupas que habra fabricado. del sufrimiento y la crueldad han creado dudas sabre la mane- 10 de vida). descubren la razon para mos. pena un cambio. que es invisible a los ojos. Hasta que Copernico pre- senta evidencias de que la Tierra gira alrededor del Sol y no el Sol alrededor de la Tierra. esre ripo de evidencia sirve para renovar Histaricamente. hemos Ilegado al momento precario en nues. ofrece una razon sin precedente para creer que vale la cidio y de la opresian global para condenar las po!fticas que los .\ . fundir nueva sabiduria en nuesrra era de cambio. !fnea muy similar. parece que ha llegado el momenro de in- neras en que al pareeer aprendemos. para muchos. Lo que se necesita es precisamenre un carali- apoyan. antes de pader aplicar 10 que hemos aprendidol creer que el cambia es necesario. no habia razan para creer que existian. que debemos reconocer los principios fundamentales de nues- mentar una crisis personal de salud. driamos estar en la entrada de la era en que superemos 1:1 Antes de verlos. aprendemos de la mis. con nuestros semejantes yean el cos- direcramente con su estilo de vida. antes de gran mayorla de la hum anidad cree en la existencia de un po- saber que no 10 queremos! En lugar de e1egir como preferimos der superior de eierta descripcion. nuestro cuerpo. ra en que nos vinculamos can e1 Creador y con nuesrros seme- mas nuestras decisiones "despues del hechd'. . a su calidad de vida y a tener relacio. reaccionamos a 10 que la vida nos muestra. AI menos. EI reconocer que el nombre de Dios esca en el interior Parece que. opciones saludables de nutrici6n y de esri. necesidad de separarnos mediante diferencias. no existia una razon para creer 10 Mas alla de nuestras diferencias contrario. tiene un mensaje que nos pod ria clevar a un ceso a la manera en que las fuerzas de la naturaleza se relacionan sentido mas alto de respeto y tolerancia haeia nuestro (adder con nuestra vida: la epoca que Carl Sagan identifico como . dudas en el poder 9-e la confianza. Lo tci5te es que s610 despues de experi. que a menudo se re1aciona rra relacion con la vida. anreS de reconocer . de las celulas de cada persona. del pasado. En la incerridumbre de un que las personas son mas que sus creencias y e1 color de su piel. brimientos de Copernico y van Leeuwenhoek. adoleseencia tecnologica. las ideas nuevas que se basan salidamente en " nuestra fe en que hay algo "alIa fuera" en 10 que podemos creer. Por eI ceta de su propia expe. . como sociedad global. posibilidades totalmente nuevos. Solo despues de que Antoni van Leeuwenhoek pudo Aunque nuesrras religiones. debe. Tuvimos que experimentar los horrores del geno. y roma. descubren una raz6n para creer. en que estamos aprendiendo a tener ac. james. Estados Unidos ruvo que experimen. Aunque la mas experimentar to que no queremos en nuestra vida. la verdad. Es cierro que en una escala muy diferente a 1a de los descu- riencia. iMuy a menudo. po~ serio el mundo de los microbios. descubrimienro . zador de esra magnitud para transformar la fuerza de nuestras tar la segregacian racial y de dases sociales.

Hey 5 HA 5 mi6 este concepto: "Los problemas que enfrentamos hoy en Oxfgeno Vav' 6 WAW 6 dia no pueden resolverse al mismo nivel de pensamienro que . Carbona Gim. . y la facilidad can la podian cambiar fue 10 que ayud6 a DNA DNA DNA • • 12 su supervlvenCla." Si todos percibieramos el mun. es 10 Dios tenga las mismas letras y el mismo significado implicito. como elementos como tetras hebreas como letras arabes . 10 que permitfa a las palomillas confundirse con el cias.. adoptaron colores que Ies La Figura 9. se descubri6 que el colorido de Abraham. e1 codigo lleva el mismo mensaje de posibilidades y l.'!{)J hebn'{) _)' {irt/bi' rt'- entorno. . las palomillas que se con. y producen d mislJll' oportunidad de cambiar. son los m. a da!IJflJIf 1'1 1J1IJII/O J los arboles en la zona dande fueron Iiberadas para realizar el nombre secreto de Dios en eJ interior de nJif'Jlro (JIl'rpo.282 El C6digo de Dios EI C6digo de Dios 2R3 diversidad. Las alas de las palomillas que vivian en los troncos de vela exacft/mente eI mi. Nitrogeno '. la primera vez que come. Aunque los eruditos re- que nos guie.JYM 3 teniamos cuando los creamos. tal vez no es un accidente que eI nombre de accianes aparentemente sin sentido de miedo y de odio. EI priml'r que no cambiaron e1 color de sus alas tuvieron una vida mas bloque ala izquierda muestra el c6digo de la vida a traves de carta. [ncfllso atilt' fales difi'Tlw- ambiente. por ejemplo. los cbdigos numcrico.'t estudio.1 ilustra como este poderoso vinculo crea Ull permitieron confundirse con su entorno.. que afrece las mayores opoftunidades de supervivencia como incluso en idiomas que parecen apoyar las religiones y crecn- especie. la Tierra: el Judaismo. mcnsajc en ambos idiomas. adoptaron una apariencia similar a la de la corteza de la. De manera muy similar. Figura 9. a craves del patriarca decada de 1950. Pero las palomillas I puente entre estas tradiciones religiosas tan diversas. Aunquc extcrnamente los idiomas SOil tieramos un error podda ser la ultima vez que £uvieramos la difcrcntc. De manera similar. .. volvamos la mirada hacia la naruraleza para cias mas diversas en el mundo actual. . que tanto la tradici6n judia como la En un estudio sobre palomillas que se llev6 a cabo en la islamica tienen una ascendencia comun. 3 . Qu/mica Hebreo Valor' 'kabe Valor do cambiante es 10 que garantizara nuestra supervivencia como " }'It Hidr6gen6 rod -10 10 especie. Valor Combinado 6 6 do precisamente de la misma manera y ruvieramos las mismas soluciones para nuestros problemas. par ejemplo. pues fueron presa bieil de las aves y otros insectos. centraron en un ambiente de rocas.. el cdd{p'o numirim oeliito de 10.. conocen. las diferencias que se han utilizado para justificar Pot 10 tanto. La diversidad resultante de la capacidad de las palomiHas para adap- tarse.rmo lJalor y rel da e. AI hacl.'Sfll' los arboles y eso dificultaba a las aves detectarlas al estar bus.. el Islam yel Crisnanismo.1 a!labf.ismos. De nuevo. ran:za a las tres religiones de mas de la mitad de la pohlaci('ll1 dl' cando alimento. nuestra capacidad para pensar en forma diferente y adaptarnos a las condiciones de nuestro mun. Einstein resu.el. su interpretaci{m de las enseiianzas de Abraham han las alas den tro de la misma especie cambiaba segun el media variado mucho al paso de los siglos. .1: Comparad6n de los elementos de la vida y sus eL)Uivalenles en los alfabctos hcbrco y arabe. En una declaraci6n que ya es famosa.

la presencia del codigo. un profesor de la Universidad Estatal de Ore- Dentro de cada celula de cada cuerpo. taciones. de un plan reberes en la region del Valle M'goun de Marruecos. nitr6geno y carbono. Wolfsugiere que muchas tecnicas modernas tienen de este tipo debia encontrarse en algUn lugar. sin prejuicios ni excepeiones. en Ia colum- lution (ADR)]. Wolf. descubrieron que a Aunque el texto literal del mensaje: "Dios/Eterno en el in- nivel colectivo. un terreno comun para la solucion de nuestras diferencias. Vav y Gimel reconoddo como una ciencia especializada y en evoluci6n. nuestro cuerpo son universales. si no es que durante milenios". Las letras del nombre de Dios en el interior de un artlculo publicado en la revista "International Negotiation". de ADR es a traves de un anlculo sobre conflietos relaciona- Estas relaciones muestran gnificamente algo que ya sentimos a dos con el agua entre pueblos indigenas contempocaneos. que esd. con el mismo mensaje. y"al que esca en eI interior de nuestras celulas. Hey. cada individuo offece un punto de algo sin precedente en su papd de proporcionar una platafor- vista sobre la forma en que eI conflicro podrfa verse si sc resol- ma. l. En nivel intuitivo. el enorme grado de orden que el mensaje im- cidos de vision compartida. e innovadoras para situaciones en las que las soluciones son El mensaje en e1 interior de nuestro ADN dice precisa- volatiles. y trascendiendoellenguaje. 13 En los bloques de en medio y de la Soluci6n Alternativa de Disputas [Alternative Dispute Reso- derecha. Aaron T. tal vel. puede verse en la practica conocida como ejer- codigo genetico. las comunidades antiguas. hoy en dfa como sociedad global. El resultado es obvio. A rraves mas grande. En Un [ugar para comenzar el bloque de en medio. en Sl. 1(. disefiada para crear soluciones nuevas na de "Valor". gracias al codigo en realidad rakes antiguas en las sodedades indigenas. El bloque de la derecha ilustra de nuevo el codigo. el valor de cada letra aparece a su derecha. a pesar de nuestras diferencias.15 bles y verificables. do aceptable para ambos".a la rama de este campo que crece con mas velocidad es la en esta ocasi6n en arabe. esta sospecha se haee parecer los pueblos indigenas las han estado usando durante realidad. para sobrevivir a los retos de su existeneia. Finalmente. 284 El C6digo de Dios El C6digo de Dics 285 los elementos del ADN: hidrogeno. no puede negarse. eI hecho de que eI mensaje existe es fiUy elocuente. las implicaciones enormes. se muestra el mismo c6digo con sus En afios recientes. Qui- (YHVG). encontramos el mismo gon. Uno de los ejemplos mas daros de estes merodos tradicio- Sin importar «quien" 0 "que" creamos que es la fuente de nuestro nales en acci6n. Mas alIa En una situacion similar a la que enfrentamos nosotros de las medforas 0 las ilusiones. Wolf describe estas tecnicas en Sll plica nos dice que hay algo "alIa fuera". el mensaje de nuestro cuerpo es de su vision compartida. define ADR como un numero de enfoques "con los que codigo. el hecho de su existencia es claro. la las partes en conflicro buscan voluntariamente llegar a un acuer- fe y la raza del individuo. Por estas razones. la mejor forma de expresar la meta mente 10 mismo tanto en arabe como en hebreo. repeti- siglos. Esto nos recuerda que investigadon sobre las disputas por agua entre los pueblos bc- somos parte de un panorama mas grande. les convenfa trabajar juntos para resolver los terior del cuerpo" sin duda quedad sujeto a diversas interpre- problemas que amenazaban su futuro. L . Como e1 codigo se basa en valores constantes. y tal vel. 14 Aunque es posible que eI termino Aunque muchas personas han sospechado que un mensaje sea nuevo. eI estudio de la soluci6n de conflictos se ha letras equivalentes en e1 alfabeto hebreo: Yod.

Aunque vislum- el conflicta del momento y las posibilidades de un futuro me. ha sido dificil vislumbrar el parece poco probable. la vision comparridas aplidndolo a una variedad de problemas.i6n paz.' llun If . . do mas profunda. al igual que un pumo de vista sobre 10 que de partida desde el cual empezar y superar su desconfianza y podria pasar si las negociaciones fracasaran. el recuerdo de arroci- 10 que quisieran lograr juntos. una fuerza mas grande q lH. que han eobrado muchisimas vidas. Ademas. AI compartir sus esperanzas y suetlos sobre como serIa una Preeisamenre en tales circunstancias. y un lugar para tes). Aunque sos. Utilizando firma indeleble del mismo Dios. su vision podria usarse para disipar e1 enojo que a eonflicto al parecer interminable. brar un futuro compartido podrla ser dificil en medio de un jor. ambos lados son dades y violencia recientes han creado una sensacion de autores del resultado final y se sienten induidos en el proceso. la genre que ha esrado en la guerra necesita un punto · I..1" It I(". Con base en 10 que dicen frases especificas de las escriwras un futuro colectivo de paz mundial es la esperanza de muchas Cristianas. para reafirmar el punto de tido y pacifico. En esta evidencia unica e inmutable se encuentra cion de costumbres y tradiciones que beneficien a ambas par.'>1 t· n HIlO I. En esta forma. ". I deseonfianza entre los oponentes que deja poco espacio para la Ademas. un pasado comun.mcorrecro. el hak'm (un juez regional que usa una combina. sin mencionar un fururo compar- punta de referencia at eual regresar. se han destruido f. un futuro en comun. el reconocer una idenridad menudo surge euando las partes se encuentran cara a cara. las partes en conflicto crean un puente entre cuerpo podria servir a un bien mucho mayor.286 El C6digo de Dios EI C6digo de Dios 287 viera con exi to. de negarse. El proposito de la empezar a sanar. al mismo tiempo somos testigos de han dejado huerfanos. igruliu· eomun es como pedir algo imposible. Desde los musulmanes y los serbios de Koso- vision es proporcionar un foro que eomribuya a fundamentar vo..1 rll \1I . 17 Con el usa exitoso de las visiones material mismo con que esta hecho nuestro euerpo. Con el ~onocimfenro de una presencia mayor en el y valores comparridos". Pedirles a estas personas que creen la vision de vista com un que hizo que se reunieran en un principio.. raro que las disputas de las tribus del Valle M'goun lleguen a En los primeros atlas de este nuevo siglo.. tipo de conflicto. y comun. muehos de los una autoridad mas alta. conflictos mas violenros. llega allfmite de nuestra sensibilidad. ofrece un hecho que no pue- las visiones.1 \-'U I . la vision compartida se convierte en un i final de un dia sin violencia. impregnado con la tambien como una razon para creer en el proeeso. se El tema de la vision compartida es muy simple y ademas han justifieado con interpretaciones extremas de textos religio- represenra la posibilidad de una experiencia comlin. es muy de un futuro compartido empieza a tener senrido. b lantes d« e correcto e «. "pone la disputa en el contexto mas grande de sus historias empezar. sC' personas en la actualidad. poder de la enfermedad pareee ser mayor que la posibilidad de sola presencia. y podria asumir Ull . En situaciones como esta. Judias 0 Musulmanas. y se han arruinado naciones. sabiendo que cada individuo est<l. hasta los palestinos y judios de Israel. ('x 1. la verdad de una familia. cuando los temperamentas se exaltan y la soluc.. La presencia del nombre de I )im ('11 marauo Asi como la genre pierde confianza en su euerpo cuando el cuerpo permanece como un recordatorio inddchlr.'1milias. Ell ('\1(' ejemplos de odio que son tan fuertes y tienen una desconfian.n '4m- sanar.(Ir t1 ur . el mensaje de nuestro soluci6n positiva. eI mensaje del interior de nuesHas ttlutu za tan profunda y heridas tan graves que vislumbrar un bien podria tener un poder aun mayor..

a solucion del conflicto a menudo va seguida de una ceremonia donde {bamos y 10 que harfamos cuando llegaramos aIla. no puede sobreestimarse. me parecio que la mujer que :. en Nuevo Mexico donde estaban su esposa y sus hijos. levante la vista de los papeles que . Por otra parte. y el orgulIo con el global. cuyos principios se rando de pasar por encima de otros para instalarse en sus nue- basan en el Dios que vive dentro del cuerpo de sus "enemigos" vos asientos antes de que el avion se alejara de la puerta de at igual que en el suyo. Me preguntaba que posibilidadl's hahLi dc' qur . desputs dd tenia en e1 regazo para ver de que se trataba la conmoci6n. deseubrl A medida que las naciones se alejen de los conflictos que que mi fascinacion no se debfa ramo al tema en S1. La eficacia de este tipo de gesto de fuerza que lleve a ironIa del momenta. flicros en el nombre de Dios. Antes de que el avion lograra despegar.. 10 que parece faltar es el poder de una senal externa de . abordaje. Sintiendose relajado en conflicto solo unos dfas 0 semanas antes. mi coneentracion habia esrado en lrCM estaba sentada junto a mi euando aborde el avion tenia un : un puente entre la sabidurfa del pasado y 10 que sab('mos en 1. Empece a pensar en Ia perdon. tros hogares y nuestro estilo de vida. imercam- como en las de Beduinos que describe Wolf en su articulo.I. el mensaje de nuestras celulas dene induso una un oficial de la Fuerza Aerea que regresaba a una base militar mayor posibilidad de unidad para aqueHos que basan sus con. Can este ritual de perdon y Trade Cemer y al Pencagono el 11 de septiembre. y usar Nuestra unica verdad inmutable : esa fuerza para combatir contra aquellos que amenazan nues- Sentado junto a la ventana. la biando cortesfas y describiendo donde hablamos estado. pues de la Guerra Fda. Cuando todo se dijo y se hizo. el ritual s610 se lleva a cabo cuando ambaspartes sienten trabajo y como habfa cambiado despues de los ataques al World que la situaci6n se ha resuelto. terrorismo habia re-definido el papel de los militares. Al : periodo en que trabaje en la industria del espacio aen:o dcs- escuchar trozos de conversacion. 288 El C6digo de Dios EI C6digo de Dios 289 Para los individuos y las naciones que pelean entre ellos amigo que cambiara el asiento con ella.~. En circunstancias despues de nuestra conversaei6n inicial. EI trabajo del oficial era entrar en eontacto con los recursos de las armas militares mas poderosas y con los mejores siste- mas de tecnologfa que se hayan registrado en Ia historia.& amigo con e1 que querfa sentarse en otIa seecion del avion. el hombre guido de una celebracion. que es un ritual publico de perdon se. una conclusion duradera. se cierra toda una sobre las nuevas estrategias de seguridad naeional y como e1 experiencia y la vida se inicia de nuevo. se tiene un nuevo comienzo. ya habfamos inicia- Es interesante que tanto en las comunidades Bereberes do la tipica eonversaci6n que se tiene en los aviones. cuamo se permitio el uso de aparatos eleetronicos. sino ala amenazan el bienesrar de sus ciudadanos y nuestra comunidad pasion de este hombre par 10 que el erda. las batallas empiezan a perder sentido. actualidad para ayudarnos a evitar la necesidad de ('sa gtu" f. El momenta del sulha marca un abrio su computadora laptop y se coneemro en Ia informacion punto culminante en la re1acion entre las partes que estaban que brillaba desde la pantalla de su LCD. que ahordaba sus responsabilidades. y ahora esraban tra- por razones justificadas por sus religiones. empez6 a deseribir su ideales. me encontre junto a en esta forma. AI hablar celebracion. Habra convencido al hombre que estaba sentado junto a Sll ! precisamente. En conocida como sulha.

d conocimienro'de su legado.para usar el tiempo con prudencia para cambiar la manera de rante el resto de nuestro viaje. nosotros lucha por cambiar la manera de pensar que ha lleva- hacienda 10 que haee y que 10 haga tan bien porque yo nunea . empece a darme cuenta de que con esa breve conver.liar".actuar del pasado nos aportan un Comparrimos una carcajada ante la ironia de nuestras vi.que ambos puntas de vista deben coexistir. 5610 existe el "nosotros". guerras y brotaba de un profesionalismo y determinacion personates. Era obvio que este hom. nosotros estamos resolviendo nuestras diferencias y re- Despues de que el oficial describi6 sus nuevas responsabi. era obvio que queriamos 10 mismo para nuestras familias y para el mundo. :. a medida que seguimos descubriendo 10 profun- electrica.. Mientras bajaba yo por la escalera Sin embargo. Estamos viviendo en un periodo de la hisroria en eI "~En serio?". respondi6. y antiguas ideas puestas en acci6n mediante tecnologia moder- del argullo que viene de saber que los esfuerzos que se hacen na. ~y que es 10 que . La que el aportaba a la milicia metodos comprobados de nuestro pasado: batallas. Le exprese mi aprecio por la blos y naciones. "Es interesante. can el fin de resolver los problemas que surgen entre pue- contribuyen a un esfuerzo mayor.290 EI C6digo de Dios El C6dlgo de Dios 291 todo el movimiemo que se habla llevada a cabo para que que. eI oficial y yo habiamos experimentado un reflejo de la . sin embargo. solviendo nuestros problemas en las unicas formas en que sa- lidades. Despues de una breve descripci6n de . . do a la necesidad de tener armas y ejercicos que hagan posible poclda haeer Sil rrabajo". mos juntos el camino que seguiremos para entrar al futuro. Con esc mCll- . nuestra conversaci6n cambi6. desenvuelven los sucesos del mundo. tiempo precioso. y est:ibamos contribu. jEs una manera de pensar tan . dicamas en asientos conriguos hubiera sido "casualidad". mi busqueda de sabiduria para evitar la guerra. la' cuesti6n es si tenemos 0 no la sabidurfa das y continuamos resolviendo los problemas del mundo du. mientras que e1egi- usted haed" pregunc6. la guerra. Aunque las formas de . AI mismo tiempo. nos deseamos buena 'en formas que rodavia no hemos reconocido ni comprendido.Iograr un mundo mejor en la unica forma que entienden. os une en el conocimiento de que cada uno de nosocfOS Ileva cia. bemos como hacedo. damenre que se extienden las rakes de nuestro "arbol fami- saci6n.reconocer esro bien podria ser la clave para sobrevivir la transi- diferente!" "cion. Luego me devolvi6 el cumplido diciendo: de pensar tienen el apoyo de gente buena que trabaja para "Me da gusto que usted este haciendo 10 que hace. . EI nunea podria hacer su trabajo. porque yo . quizas nos a la zona donde se recoge el equipaje. Juntos. otra parte de forma en que abordaba su trabaja: "me cia gUStO que este listed . el se ri6 por La ironia de nuestra epoca historica es que ambas form as s610 un momento. de que estamos trabajando juntos como familia global. no puede haber un "elIos" y un "nosotros" a medida que se a misma historia y la firma del mismo Creador. AI dirigir. Mi conversaci6n con el oficial s610 fortaIeci6 mi creencia yendo a esa meta comun de maneraS muy distintas. Una parte de nosotros conHa en los bre era excelente en su trabaja. Para cuando aterrizamos en pensar que cree que Ia guerra es la solucion de nuestras dife- Albuquerque esa noche. el mensaje de nuestras celllla~ Suponiendo que nos une un campo unificado de conscien. suerre y nos despedimos. hay algo de 10 que podemos estar absolutamente seguros: forma en que parece funcionar la capacidad consciente a una Asi como la "sangre" une a los familiares mas lejanos mediamc escala mucho mayor.

estamos seguros de que. mos confundirlo. hombre. Budista. simple pero poderosa. las enfrentaremos como familia global. el sufrimiento y las . servirla como un poderoso de tal manera que. Shinto. de la manera mas intima imaginable. tiene una habilidad extraordinaria para unificarse en En esta comprension. • En muchos aspectos. una vez que 10 reconozcamos. Mas alia de dasificaciones como Cristiano. . torna a una'causa comtin. negro. cada uno de nosotros ha Sagan sugiri6 que el hecho de detectar un mensaje de llevado la dave de la supervivencia como en mensaje dirigido mas aHa de este mundo. Mis alla de toda duda razonable. Lo que el • (Que se necesitaria para crear una experiencia uni- destino Ie depare a una comunidad. el descubrimiento de un 11lf. Aunque no tragedias han proporcionado 1a mayor oportunidad sepamos can precision que reros enfrentaremos en nuestro fu. el mensaje nos recuerda milia que conocemos. Hist6ricamente. mos antepasados y existimos como hijos del mismo Creador. Como humanos. no podemos "dejar de conocerla". para poblaciones gr<\ndes y diversas para unimos en turo colectivo. estamos intimamente man. ademas de compartir nuestro pla. A > 5610 necesitamos contemplar a las celulas de nuestro cuerpo parrir de ese momento. las lagrimas que derramamos.. Aborigen. Musul- neta. para recordar. podca revelarse el mensaje. cada uno de nosotros comparre el antiguo nombre de Dios en nuestro cuerpo. Judio. mana. para que • En su importantisimo articulo sobre la Busqueda de lleguemos a superar esas pruebas. todo es Dios. el fallecido Carl Durante dentos de generaciones. ya no podemos decir que la ignorancia . las nuestra unidad y la clave de nuestra supervivencia. Este es el poder del mensaje que esra en el interior de nues- atrocidades que han marcado al ultimo siglo. y los producros • La experiencia nos ha mostrado que la humanidad de desecho de la vida. pueblo 0 naci6n. que pudiera eliminar es posible para otros. tambien versal de unidad.'O- 5610 en el descubrimienro y la aceptaci6n de que somos uno saje universal en e1 interior de nuestras celulas po can el mundo. Cada fibra de musculo. sin tragedia. blanco. Nativo. cada RESUMEN DEL CAPITULO 9 cristal de hueso. Una vez que vemos En los momentos en que dudemos de esta inmutable verdad. no podre- factor unificador en la consciencia humana. rajo 0 amarillo. una cosa es cierta: Sin importar cuales sean nues. esra el hilo de momentos de necesidad comtin. . Inteligencia Extraterrestre (SETI). y de la tido de prop6sito? fuerza que solo puede venir de nuestra diversidad. de nuestra pasion para preservar la vida. nuestro pasado y nuestro futuro. tras celulas. compartimos los mis- Una vez que conozcamos la verdad de nuestra familia hu. Hindu. es la razon por la cual justificamos el odio. inmersos en las elecciones de quienes nos rodean. es imposible "dejar de verla" . la evidencia en blanco y negro. tras pruebas. Se requerira cada apice de nuestra sabi- nuestras diferencias y despertamos a un mayor sen- durla colectiva.292 El C6digo de Dios EI C6digo de Dios 293 saje. mujer 0 nino. que somos humanos. Quiza en anticipaci6n al dia en que Ia bus- queda de nuestros origenes nos lleve a la esencia de la vida. la tinica fa.

Iegado y ereeneias nunea han sido poder del mensaje del interior de nuestras ceIu[as. su nombre mas antiguo presente en las eelulas de nuestra especie ofrece un comun denominador sin precedente a partir del eua! resol- ver nuestras diferencias. • Las tradiciones indigenas sabre la soluci6n de con- flictos ofrecen un modelo viable para trascender las diferencias que amenazan nuestra supervivencia como espeCle. La histo- ria humana apoya esta idea. Ha llegado el momento de aeeptar un profundo mensaje de esperanza unifieadorai alga en Io eua! creer. somos eapaees de aetas violentos. 10 unieo que neeesiramos para recordarIa es mi- AI mismo tiempo. • La "firma" de Dios. las fronteras 0 las recnologias que nos dividen.294 El C6digo de Dios El C6digo de Dios 295 drfa producir eI mismo tipo de union entre personas • Como ciudadanos del mundo. • La naturaleza ofrece un modelo de como la unidad y la eooperacion ofrecen una mayor probabilidad de supervivencia que la competencia violenta. Ia hisroria y la ciencia sugieren que somos basiea- mente una especie de "bondad". los legados. Este es el cias en religion. Tal evidencia tangible ram- bien nos da una razon para creer que la paz puede lograrse y que es valiosa. Iigiones. . rar el mensaje que esta en nuestro cuerpo. han seguido hacia el nuevo milenio. l~s ereencias. • Muehos de los problemas que hieieron que se clasifi. aunque en cireuns- taneias extremas. los estilos de vida. somas mas que las re- de diversas culturas yereeneias. como puede verse en los choques culturales en situaciones como la explora- cion de America del Norte. • Ante la evidenda de la "inhumanidad del hombre". En cara al siglo :xx como los "den afios mas sangrien. momentos cuando dudamos de esta verdad inmuta- tos" de Ia historia. muehos sienten que las diferen. tan grandes. hIe.

900 M MYM' 40 Ch ChVN 1000 N NWM 50 A HMZ SIN VALOR 5 SYN 60 (Las Ictras dd alfalWl1l Arabe (jue estan subrayadas cotresponden a los mismos \'alorcs tid lIomhn' til' Dins ell d alfaht·tn Ilehn·Il. " . 30 Tz TzA. R RA 200 O~ WAW § Sh ShYN 300 "z ZA ' 7 T TA 400 '1H. de la tetra Numeriro dela Lelra Numerko . HA 8. ApendiceA EL ORDEN SECRETa DEL ALFABETO ARABE expresado en C6dlgos Numerlcos [Con la autorizaci6n y pot cortesia de David Allen Hulse. HA 5.) . Th ThA 500 IT TA 9 Kh KhA 600 £ ' .]] 'letra Nombre Valor" Letra Nombre' 'Valor .1 ' LAM .0 DAL 4 Q QAF 100 'tl.A AU 1 a OVN 70 iB BA 2 F FA 80 :J ]YM 3 5 SAD 90 . YA 1Q Dh DhAL 700 K KAF 20 D DAD 800 .

~: .298 El C6digo de Dios : : .:. '.:. .ndice B LA TABLA PERIODICA de Elementos . . Ape. ~ . :. i ~.:: ~ .

') (ldd Ovobil yx WillI tllIl) III i i III n !'B'Ll< j<'lIi d" I.d nl. geno.~. Ox{geno y cinco aromos de Carbono. can el simple he- cho de utilizar diferemes arreglos de los mismos cuatro ele- mentos.~~"'-\f Nota: Los cuatroelementos del AnN. OXlgeno y h Carbono en cadauna n ). dos . Nltrogeno. un Oxlgeno y cuatro Carbonos.008 ' Nombre del Elemento Masa At6mica VIIIH I IVB VB VIS EL NUMERO DE ArOMOS DE HIDROCENO. el Ox!- gena.homos de sombreado mas oscuro. IlIhnlll.l' h'llI. se han resaltado con un L a base organica de timina del ADN contiene seis aromos de Hidr6geno.. Las bases resrantes varian en consecuencia y se indican a continuaci6n.n). • NllnlnO de atomm que s(' calcularon de Lebringerr Biochemisuy Tex/- hoof.t6- . dos aromos de Nirr6geno.i IId. 1.: (. . * La citosina se compone de diferentes canridades de exacramente los mismos elemen- tos. tres Nirr6genos. . et Hidr6geno y el Nit.1 Illnl it. Es as! que es posible que se de un numero extraordinario de diversificaciones.300 El C6digo de Dios JA Epfgrafe ApendiceC G. eI Carbone. 1-:1 llr.j de [as cuatTo bases del ADN ""::':'. es decir cinco Hidr6genos.

s610 una vez. como YH ·no siempre garantiza que eI mensaje "dentro del cuerpo" (VG) . eI nombre "Eterno" de Dios como YI I simplenwlHt' existc-. las letras 0 elementos que son responsables de su originalidad.oc. Por ejemplo. sin la cspecificacion dd Illg ar a domk . Para el 66% del la base de citosina.Hura!u.\C dirigl" 0 InHk I. hacemos la observaci6n de que fa presencia del nombre de Dios dentro del c6digo.1 ctem.302 El C6digo de Dios La siguiente tabla ilustra las cuatro bases del ADN y el mimero de atomas para cada elcmento que haee que cada base sea inimitable. podemos observar que . en el primer caso.l dd \. en la citosina. la adenina y la guanina. Ademas.l Il. contenido dentro de esa porci6n del ADN. ·varian en cada base. es el c6digo que complementa el VG que indica "dentro del cuerpo".esra.libo. ApendiceD ILUSTRACION DETALLADA de (os atomos de H 1drogenoj Nltr6genoj Oxfgeno y Carbono en cada una de las bases del ADN que muestra sus equlvalentes como [etras hebreas ·E n la siguiente tabla en la que se muestran la timina. EI . la citosina.. mientras que YH se repite tres veces en la base.

Klare. miemras que en esta base nunea se meneiona la presencia del Eterno dentro del euerpo.. VG (en negritas) indica la'forma en que "La Natu- S. 51. Ph. Fimf' \\'{lfl". I 'j'j')).304 El C6digo de Dios extremo de este e)emplo se puede vet en la adenina.5' 'yyyyY.:.. "A Scourge of Small Arms". a1 menos cinco naciones 0 regiones ocupadas nuestro ADN se descubre que la base de toda vida proviene de mal1CLi estuvieron involucradas en conflictos armados. '. Oxigena '. Website: www. . p. Dfas. .. . .:.1 tI't {i'utlJ {)j WI'lJfWU (:-Jew V. H k. wnn.com. A1 aplicar los valores numericos del alfdbeto Hebreo a los elementos d. 3.' 1. .\' Carp0110f<:Tutc '. " nxm · :!Jf. ~: . 2 ':t'v '.beH-labs.. · GGGGC 2.lIJt!ti: ". Penzias and Wilson's Discovery Is One ofthe Century's Key Advances a~ti~ulo en lInea que induye la biograffa de los investigadores y el H '5 HHHHH signIficado de su descubrimiento. 1999). Su trabajo esta expuesro en las Galerfas Ahava en Boca Rar6n. . Jeffery Boutwell y directa del antit-.:" Nitr6geno'. . Scientific American Gunio 2000).GC .D. (.. 5 . 19. 4.m. 1.ientiji.fl"(" A !-i. IIY/.:: :. aspecto "Etemo" del an.' Notas . cha por Almaliah Gad. Michio Kakll.'1..-¥. :'2' .Y . Odyssey Through Parallel lIni- raleza Eterna" reside dentro del cuerpo.CC gobierno de Israel. Michio Kaku. Michael T. Entre 1998 y 2000. Who Wrote de Bible Code? A Physicist . tigu~'nombre :de Dio~ Probes the Current Controversy (Colorado Springs: WaterBrook Press. . en la que el nombre de Dios ocurre cuatro veces. 1'. V 1 V "C" 5. Adenina (I\) .rayado) indicae1. :~~(stJl. ~. :fj. Randall Ingermanson..lo nombre de Dios. Florida.tt' . Visions: How Science wilt Revolutionize the 21st Century (New York: Anchor Books. Texto tornado de la interpretaci6n artistica de la escritura hebrea he- v:'" . . . Nitfr68eooi ' H 5 '. a1 igual que el emblema de la Guerra de los Seis . p. HHHHH Oxfgeno V 0 "'*"''''*''''''* PRIMERA PARTE Carbona G 5 CCCCG Introducci6n y 5 "Wiyy .rfl/.' .k'.~..¥YYYYY Epfgrafe ·. W .:.(. !X'i.' '.: :G(. 1998). 5. p. 'Hidr6ge~. AIH!l"r Ho' . Gad ha disefiado monedas y medallas para el Gc:. Hidr6gem/ .

erols. remplos y edificios culturales. J. Virginia Cemer for National Security Law. Rummel. 7. ms of the Shoah". 5. Matthew White. 1. volumen 1. website www. 2. Neil Armstrong. Tierra SOil umfi}nnn . Rummel. flleron fllerzas que se han mantenido constantes desdc el ce 1900 (Charlottesville: Transaction Publishers and Rutgers Univ" principio de los {it·mpos. Global Turmoil on the Eve of filch Remsurance Company del 20 de Diciembre de 1999. "War Isn'tThis Century Biggest Killer. ota extraida de un articulo de National Geographic. 4. Website: iY}VW. 14. "Contact. cita extralda del ardculo. Press Kentucky.remember. Eric Hobsbawm. cita de su presentacion The Profet's Confe. A partir del hecho de qlle los proccsos de b 1997).2 millones de tibetanos murieron en las dos Meada:." Website: http://users. London Review vyww. h rtp:llusers.000 monasterios. www. Are We Alond" Florida Today (1999). 4. J. Website: wwvuiber. CapitUlo 2 ta parte de la poblaci6n de la region y quiza no se hayan tornado en 1. "Five Million Forgotten: Non Jewish Victi- 19.sei. por pals y ano de desarrollo. Carl Sagan. Lo anterior representa 1a quin. Resumen de las Naciones Unidas sobre las misiones acrivas a favor de warstatO/htm.coml mwhite28/warstatO/htm.·nJl. 1995) pag 12. Barbara Marx Hubbard. Jonathan Steele. Out of Control. Twentieth Century Atlas. mundiales de bajas de guerra. Website: Website: www. Craig and E.Y.bigear. R. 6. limited (12 de Diciembre de 1999). Capitulo 1 13.org. Hutton hallfi:rll a Stl University ofYirRinia. desastres yatrocidades. Stadistics ofDemocide. alrededor de 187 millones de personas (una ean. The Jews and nian. 1.erols. Out afControl pag. Massacres. 11'''' •k 1I111/i"'mitdl'iilnllU/o . Website: www. Disasters.hrm ." Smithso- ton Univ. G. tics of Casualties. 12.306 El C6digo de Dios Notas 307 6. Para marzo de 2002. Ibidem. das de UNAIDS: The Joint UN Programme on HIV/AIDS. Vease "Historical Body 16.org.445 policlas profesionales y civiles que 6. R. "The Quest For Extraterrestrial Intelligence. en Palm Springs.guardian. 8. e:tad{sti~as se tomaron de un articulo de prensa de la empresa Mu- 3. Matthew White. California. 1998).S dt' largos pcr(odos.orglvoll no2Isagan.org/forgotten/.filleakey.co.kirjasto.uk.IVl. 1997) y de Stefan Korbonski. Website: 'WWW. Informe sobre la epidemia de SIDA con estadisticas globales saca- Febrero de 1998. and Atrocities Be. (New York Hippocrene Books. The Forgotten Hollocaust(Lexing. Se calcula que 1. "The Century that Murdered Peace". representaban 87 naciones. Ibidem. Jones.Lucas. unaids. 2. 21.flatoday. la paz en 2002. Hutton sugiere que las fuerzas que carnbian la correza de la Tierra.2 (Mayo de 1978). Massacres. Website: 21 st Century (New York: Simon and Schuster. Stadistics ofDemocide: Genocide and Mass Murder Sin- tinentes. Se debe consultar en Inter- The Poles in World war Two. Journal (7 de Julio de 1986).com. and Atrocities". Terese Pencak Schwartz. Out ofControl pag. School of Law. Brzezinski. 9.com/mwhite28/ 17. Press. incluyendo volcanes y ellevamamiemo y hundimiento de con- 10. Las estadfsticas de Hobsbawm muestran que 15. 11. contaban con un total de 46. Brzezinski. A Geological Miscellany (New Jersey: Prin- cuenta quienes murieron en prisiones 0 durante la destrucci6n de ceton Untv. siguientes fuentes: Richard C. Richard Leakey. 1982). masacres. EI informe ofidal de los cinco millones de victimas del holocausto que 09 eran de procedencia judia se tomaron de las 20. Vease: "Worldwide Stadis- para finales de siglo. Selected Death Tools for Wars. No. Guardian Un- Count. [Estadisticas tidad que representa mas dell 0% de la poblaci6n del mundo en 1913). Ibidem. Ademas.]. Ibidem.1 Ir. 18.coID. Twentieth Century Atlas. net su artkulo que habla de la busqueda de vida extraterrestre. Rummel. 12.un. que siguieron allevantamiento en 1959." The wan Street rence (Diciembre 2001).] Estas han perdido la vida en las guerras. War and Peace en the 20th Century. fore the 20th Century. Zbigniew Brzezinski. afBooks (Febrero 2002).I: "I pf ill.

970 y 6. de Marzo de 2000. et ai. 14. Gould y N.html.4 millones de afios. R. Tambien se escribe "hombre de Neanderral". nente a 6. estas fechas se sacaron de ca de dos CTomosomas ancestraks en los primates.IJ referencia se puede obtener en Internet: www. 88. 1992). "Molecular Analysis of Neanderthal DNA ouo cientffico escoces. Genbank International Nucleotide Sequence Database. pp.300 metros sabre el nive1 del mar. que se han conservado no s610 las secuencias telometicas. S. ala conclusi6n que ellocus clonado de los cosmids c8. Etiopfa en 1974. Don Lindsay. Long Arm of Human Chromosmoe 2" Human Genetics.490. las ideas de Hutton se popularizaron gracias al trabajo de .B. volumen 128.ip/ -silverichimp/chromosome-12/rop- que existen aldeas que por 10 comun escln habitadas de forma perma.. Esta sencilla Punctuated Equilibrium. Los restos fosilizados del origen del Australopitecus abarcan un perio. 2) que se public6 en julio de 2003. "An Inversion Between Man and Chimpanzee Chro- Mode of Evolution Reconsidered"." Naturevo1404 (30 de Marzo de 2000)." Proceedings of the National Academy of Sciences of the do considerable.ac.lab.uk. . tinuo.gct.560 metros sobre el nivel del mar. Charles Lyell. 12. "Punctuated Equilibria: The Tempo and 15. (voiumen 12. ma 2 humano" [eI autor afiadi6Iasitalicas]. :nH (2-1 dt· Ouuhre dl' 19:11). el Australopitecus anamenis data aproximadamente de 9051-5. Fusion. Igor V. Hopwood and Hans Reck. Una descripci6n y diagrama no ttcnicos de genes identicos win fue puesta a prueba par una alternativa viable conocida com< 1 que se localiZ\ln en el ADN de humanos y chimpances. estos hallazgos indican "Special Edition of Scientific American" [Edici6n especial del cientl. guo de esa raza. 4. no. Propuesta por Niles Eldridge y Stephen J. bien las antiguas secuencias centromericas (0 al menos las alfoides) [el New Look at Human Evolution [Una nueva mirada ala evoluci6n autor aiiadi61as idlicas]. ra dasica: ThePrinciples ofGeology [Los principios de fa geologia]. 3 pp. Website: www. par eI valle en que se descubri6: Neanderthal. En 1830. Leakey. Tanganyinka Territory". 247-9. Aravello. 1859. Ambas fOf.C$. 6.gla.edu. humana]. ArrhurT. antiguos cromosomas de simios sefusionaron para dar origm at cromoso- fue el especimen mas completo del Australopitecus ala fecha. mosomes. La parte de la secuencia de los genes se tom6 de entre 1. no. Se Ie da este nombre 2 (Mayo. A menos que se indique de otra manera. 89. no. Articulo de prensa de la Universidad de Glasgow. Website: www.308 El C6digo de Dios Notas 309 3. "Origin of Human Chromosome 2: An Ancestral telomere-telomere 8. Ovchinnikov et al. Eldridge. from the Nothern Caucasus. "Evidence for an Ancestral Alphoil Domain on the alturas tan elevadas. Neandenthal Infant Sheds Light on Early Human Developmet''' 28 cursos dedicados a preservar y diseminar los descubrimientos de Dar. United States of America m vol. Vol. pag. 1213. la teorIa de la evoluci6n de Dar pance]. cromosomas 12 0 13 corresponden al cro- 5.l-lind- Gould. A continuad6n se incluye un extracto de este articulo: "Como se mas son correctas. 1. no. 115-] 51 . Extraido de "The Galapagos Conservation 11. 4.5. sino tam- fico americana]. [Fideicomiso para la Conservaci6n de las islas Galapagos] rc. en su obra que ahara se conside. Cuando se escribi6 esta ohra.nig. el Australopitecm A continuaci6n se presenta un extracto de este articulo: "Llegamos boisei proviene de 1. pp. Can el apodo de "Lucy". 20 (October 15. Los genes del chimpance. Aunque se sabc ternet: http://sayer. Los parametros para una altitud superior por 10 comun se consideran mosoma 2 humano.colorado. la tcoda sugiere "que en lugar de un movimiento lento y COil saylcreatiQn/inversion. son raras las aldeas ell 13. Alemania. 9. eI especimen mas ami.Qrg.html. "Age of the 01- virtual ('equilibrium').ac. El especimen que fue conoci. supone que eI cromosoma humano 2 se origin6 por fa fUsiOn telomeri- 7. 10. 724_ . la evoluci6n se caracteriza por largos periodos de estatici(bd 16." [Una inversi6n entre cromosomas del hombre y de chim- Por primera vt::Z en mas de un siglo.1 y c29B es la do ampliamente fue el de una joven hembra Australopitecus que se reliquia de una antiguafUsiOn de tewmeros y marca elpunto en qUI! eWs descubri6 cerca de Hadar.1 miUones de afios. win en las islas Galapagos. 'acentuados' por veloces episodios de forml' d(May Bone Beds. pag. Nature. Origen en In- riores a estas se les considera como alturas extremas. J. vol. 1991). nuevas". "Rare Tests on Trust". Charles Darwin. Paleobiology. mientras que el mas joven. a las alturas supc.

cido y presentado por los integrantes del Proyecto C6ptico Gn6stico 24. Karen Armstrong A History of God: The 4000.llla 1\1. sefianzas cristianas. 3.. Francis Crick. pag.ud. a preservar las ensefianzas erernas para futuras generaciones.I. 17. CapitUlo 3 11. pag.l SEGUNDA PARTE fue reformada y definida. 25. pag. Bookshelf. Sepher Yetzirah: The Book 0fC1'(ation. comienza mas 0 menos cuando terminaton los manuscritos del Mal Muerto. pag. 21. ME: Samuel Weiser. paginas iv-v. "Thl" (:l'c:lIion of Adam. AI idemificarse con las ensefianzas tal y como las hablan preservado las generacioncs ameriores. 26.' . Chemistry. James M. pag. 5. pag. Hay una camidad de referencias excelentes de la vida. pag. 15. 1983).88./). Clan:. capItulo XLI. (San Diego: Wizards 21. traducido por Richard Laurance de un manuscrito egipcio de la Bibliotcca Bodleian. xvi. and the Uni. Chemistry. Dickerson and Geis. verso 2. ellibra Book ofAdam [Libra de Adam]. sobreviven hoy como 19. capitulo I. . los gn6stko\ CapitUlo 4 escogicron separarse y honrar la rradici6n original. I. 46.II't' 11.'.310 EI C6digo de Dios Notas 311 17. 9. 5. 100. 216. Ibidem. historia y ense. pag. The Origin of Species. pag.: Hammadi.. el Apocalfpsis Ad4n. The Other Bible:1ncientAlternative Scriptures. 6. 1998) 20. verso 1. pag. 1996). xxv.1 tl·lllll'llli. paginas 239-244.baalshemtov. rfa.. Robinson. and Eduard Cook (California: Harpers San Francisco. verso 1-2.. editado poe Aryeh Kaplan. Ibidem. (York Beach. Ibidem. capItulo LXVIII. La tradiei6n gn6stica se inici6 cuando la doctrina cristian. The Book ofEnoch the Prophet... Website: www. ()UUII. 1993). Hershel Shanks. pag. Frank Crane.Ibidem. Martin Abegg. 1963).Year Quest Judaism. Ibidem. verso 1:1. pag. Knopf. TheMystery andMeaning ofthe Dead Sea Scrolls (New York: Random House.'. Jr.com 16. capitulo IX. 22. Ibidem. 1. de la Biblioteca del Instituto de Antiguedad y Cristiandad.. mont.8. Chistianity and Islam. 1. Benjamin. Ibidem. 1976). (California: Harper San Francisco. verso 7. pag.1('(. Ibidem. Ibidem.1. pag. Ibidem. 12. Baal Shem Tov Foundation. La Biblioteea Nag Hammadi data del siglo IV de nuestra era y 26. 1984). pag. 1 . pag.1" b I!Jl'-\l~1. Ibidem. 9. 23. 1. Sepher Yetzirah. 13. California (Harper San Francisco. Matter. y a libros diflciles de conseguir como El Evangelio de Ma- W. 47. 529. 1981). pag. Darwin.1 'Ill" ILl}. Ibidem. IO. T/Jr O'ha HiM(. 168. en lugar dl' segllil !. 22. pag. Ibidem. The Lost Books ofthe Bible and the Forgotten Books ofEden. Gracias a descubrimiemos como la Biblioecca Nag verse: An Integrated Approach to General Chemistry (Menlo Park. The DeadSea Scrolls traducci6n y comentarios de Michael Wise." p:igina 26. 22. 4. Richard E Dickerson and Irvng Geis. Ibidem. 20.. 1997). pag. pag. editado por Willis Barn- stone. and the Universe. y el Libra de Enoch.13. 11 19. 8. 25. Ibidem. Matter.ll Itl\ de r. (New York: Alfred A. 2.A. capitulo XLII. Las siguientes referendas pertenecen espedalmente a su rdad6n con 14. verso 1. verso I: 1.la ("\1. Lift Itself(New York: Simon and Schuster.1111111. pag. pag. 1990). publicado por The Nag Hammadi Library tradu. pag. SIl\ <. iv.111. The Lost Books ofthe Bible and the Forgotten Books of testamento de la extensa sabidurfa gn6stica y su dedicad6n en cuanto Eden (New York: New American Library. verso 2:2.\[. CA. 85. pag.\nlWLI\ y n l i!t> . capitulo LXIII. vida fueron fuenemente rechazados y finalmeme excluidos de las en- 18.". Crane. l<'ll \' l' 'llkfll. Ibidem. 724. Ibidem. fianzas de Baal Shem Tov y su transici6n a partir de Israel ben Eliezer. verso 5. 77. . vii. 7. 14 18.

cien. capItulo.)(shlli . 1988) CLIIL Website: www. De entre un mimero de referencias a la mano. secci6n 1. pagina 152. pagina 7. verso 5 (Columbus. Visiones. Yen pequefias canridades. La composici6n espedfica de nuestra atm6sfera puede variar debido a historiador romano Kallimachos mencion6 que todo eI conocimien. Ibidem. Ibidem. 10 que induye astronomia. habia sido registrada y almacenada en esa biblioteca. The Torah. En cia y filosofia. "Prayer HeIps Patients Heal. los oceanos y con- mentos que se perdieron wando la 'Gran biblioteca de Alejandrfa' fue tinentes de la Tierra. Se desconoce la ubicaci6n actual de las "Tablas esmeralda de Thoth" y maci6n sobre nuestra atm6sfera y la Tierra. Qabbalist and Rosicrucian SymboLical Philoso- dos de enfermos por quienes se rez6 y aquellos por quienes no se fez6. 4. Los instrumentos a bordo del Explorer. IVzbbalah: Tradition ofHidden Knowledgt' 26. dos Unidos lanz6 su primer satelite. NASA Wehsite: http://imagine. Fue monje franciscano y sus trabajos 10 llevaron a esta conelusi6n: "La ciencia experimental. destruida por el fuego en el afio 48 a. Ibidem. capItulo 22. (Los Angeles: The Philosophical Research Society.c.. . capitulo 2. Website: www. apendice I. verso 7.. Ibidem. OH: Ahmadiyyah 15. Ibidem. d!.cit. se pueden conseguir 5610 podemos asumir que las revelaciones de Thoth se encontraban referencias sobre la NASA. El resultado: el agua tiene un porcentaje aproximado de 88. Sepher Yetzirah. capitulo 4. Hermetic. Ibidem. verso 9. (New York: Union of American Hebrew Congregations. 3. pagina 289. 11. Anjuman Isha'at Islam Lahore. Ibidem. pagina 288.msfc. pagina 6. hidr6geno (71 %) y helio (27. La composici6n del 98% del Sol esta formada a raz6n de. Z' ev ben Shimon Halevi. oXlgeno. 23. demylspace/atmosphere/.000 docu. De 6. pagina 145. factores de temperatura y elevaci6n. revela verdades que el razonamiento de los principios generales nunca 24. ap~ndiee 1. Kaku. 1979). un lugar unico entre los nOID. Sepher Yetzirah. hierro y azufre para eI 12. verso 7. pagina 4. la EI Sefirot rodeado con una l£nea de puntos en la parte inmediata proporci6n es similar. 19. En general. perma.gsfc.nasa. pagina. tajes. pagina 155. Halevi.htm.lInwm/961lJl~.312 El C6digo de Dios Notas 313 Ali.com/prayerhelpsl.11 de hidr6geno. 21.gQv. pagina 648. juntos. apendice 1. Representa. pagina 154. capitulo 2. de oxigeno y 11. Ingeniero Quimico). norama nuevo de la composid6n de la atm6sfera. Ibidem. se Ie considera el al- 22.gov/aca- entre esos documentos. nitr6geno. 7.Ibidem.89 bres de Dios en el Arbol. vcr~o () pagina 289. riar a causa de la temperatura y salinidad (agua dulce y salada). 10. magnesia. A Modern Commentary. 3. Tierra esta compuesta de 78% de Nitr6geno y 21 % de OxIgeno. verso 2. verso 4. pagina 286. capItulo 22.nasa. pagina 648. capitulo 25. En enero de 1958 como parte del Afio Geoffsico Internadonal. Ibidem. pagina 68. los ciendficos obtuvieron un pa- escudiosos consideran que tal vez estaban entre los 532. Esta- ha descubieno" . 286. 1981). el Explorer 1. 27. The Secret Teaching ofAIIAges: An EncyckJpedic Outline Internet se reportan estudios comparativos de recuperaci6n y resulta- ofMasonic. inferior a la corona del Arbol de la Vida. Por media de los de las "Tablas esmeralda de Hermes" que fueron posteriores. phy. editado por W. 16. verso 8. Gunther Plaut.11 14. carbona.appleshearth. silicio. verso 2. 17.hlIJ. porcentaje res t. Ge- 20. secci6n 1. secci6n 5. Roger Bacon (1214-1294. capitulo 1." United Press International (1999). 18. 5. 1a atm6sfera de la [Q de la civilizaci6n griega. verso 54.ycollegiate. Ibidem. Hall.html 9. pagina 705.~l rvl. Website:http://liftoff. pagina 29. quimista "verdadero" de la Europa medieval. Manly P. se conoce como d "Sefirm escojo esta en particular porque muestra c6mo se derivan los porcen- opuesto" del conocimiento.com/ nece sin manifestarse en nuestra experiencia de la creaci6n. eI 25. 1995). a pesar de que se Ie da un lugar en el. noon.l 13. nesis 2:7.lIl({'. versO 2. Aunque la cantidad precisa de oxigeno disuelto en el agua puede va- (New York: Thames and Hudson. medicina. verso 9. IVzbbalah. para reunir infor- 8. la secci6n de "Compasici6n de la atm6sfera".html. Antes de este incendio. verso 5.1 %). pagina 1. cbarteda.

. 2. diametro. pergami. pagina 9. de las ensefianzas del Rabino Yitzchak Ginsburgh. ta- 10. 13. the Past. Third Fdition. 1')')7). Sepher Yetzirah.ttomo relativo a un 3.htm emerito de griego y latin de la Universidad de Londres. mas antiguas que existen. pagina 25. pagina 25. Por ejemplo. consultese eI tratado en dos tomos de Hulse. en La ciencia de la flska. Hay un fonograma que usa este absolutos y ordinarios. Posiblemente d ejemplo mas evidente de la directos entre las antiguas tablas en lenguaje cuneiforme. laun.It' prnpinbdt" dlfnclllc~. mas importante en la hisroria de la escritura". e1 estudio de la gematria podrla set una de las destrezas 1. The American Heritage College Dictionary. El fallecido J. el misterio para precisar The Key ofIt All (Vease la referencia 4 anterior). las evidencias parecen fundas entre palabras y frases ha sido reconocida. The Bible Code (New York: Simon and Schuster. (Aunque por 10 eomun 461. con valores numecicos.imc£ I l l ' . T. la forma de carbona mas 4. Una de las mejores referencias en Internet que conOl- f:kil de reconocer: E " me2 • co. honrada y practica- sugerir que muchas y diversas lenguas del mundo de hoy surgieron de da por dendficos y fil6sofos par igual. 10 que mas anciguos. The Secret ofHebrew l%rdr. incluye ingles. sanscrito. de hccho.} . dinarios avances en su habilidad de preservar detalles hist6ricos por 1982). Hooker.. Aquf la letra "E" es un sfmbolo que representa la fuena de significado. arabe. The Key of It All: An Eneycwpedic Guide to tbe abundante. apendice 1. a 10 largo de dentos. medio del usa de signos siiabicos. yestan de acuerdo en quienes hicieron las tabIas. 1. los rtrminos mam atOmic'a y peso nt6mico se usan de forma intercam- biablc y los valor. se han establecido enlaces que de miles de atios. Aunque los arque6logos han recuperado ejemplos de antiguas formas cuneiforme y tibecano. doceavo de la masa del carbona 12. El usa de gematria para e1 estudio de las rdaciones "ocultas" mas pro- Par el momento y a 10 largo de 5. aceptaci6n y estudio de La gematria se relaciona can la denda mfstica mentos del idioma moderno a partir del griego. verso 4. d idioma cientlfico da un ejemplo de signa silabico. J.n. la constante mace. Sacred Languages and Magical Systems of the World. palabra de la manera en que se dice. eI hebreo ye1 fenkio. 7. Sacred Geometry: Philosophy and Practiet [Filosofla y les como el chino. describe el 8.ull I'. integrales reducidas. donde cada palabra es una silaba. las tradiciones an- guos alfabetos hasta eI punta en que brotaron de arboles lingiilsticos tiguas han rdacionado las lecras de la mayoela de los alfabetos. profesor Website: www.000 afios. COpta. Peso . Rabbi Benjamin Blech. Una vex mas. T. Aquf el slmbolo es una palabra completa y se usa para 12. Existe un buen numero de exceIemes tex[Qs simbolo que se ha convenido quizas en la ecuaci6n matematica mas sabre el cerna. .. hebreo.. MN: Llewellyn Publications. y los funda. ademas de todas la implicaciones que las matematfcas numeros. pagina~ memo se Ie asigna el valor de masa ar6mica. pagina 129. . definition . de la Cabala hebrea. p. griego. De forma casi universal. 1993). "La masa at6mica" se calcula como la masa de un :. matica "pi" (n). nos y pinturas rupestres de tiempos pasados. chino. 1L Ibidem.314 El C6digo de Dios Notas 315 Capitulo 5 6. (London: British Museum. Por ejemplo. representar una relaci6n entre la circunferencia de un drculo y Sll 1997). y la f[Sica relacionan con la energfa. pagina 288. n'bcionados con ~lIos son simibres. David Allen Hulse.lIuh". Book Two: Tbl' En la 'Tabla peri6dica de los elementos' (apendice B). dOnde y cudndo se hicieron los escritos aun permanece. Los idiomas antiguos. (New Jersey: Ja- significado de usar slmbolos para representar sflabas como e1 "avance son Aronson. mas alIa de la simple suma de los valores de letras y de la "energfa". 1991). la letra '1i" es un ejemplo de Los principios de la gematria se pueden explorar a muchos niveIes fonograma. Para obtener mas in- de escritura. formaci6n sabre este rema.\l\Y. si no es una lengua "madre" comun. pagina 10. Haggadah. Robert Lawor. las rakes precisas del arbol en sf siguen siendo incierras.538. ... Hooker.~21 . hicieron extraor- prdctica de fa geometrfa sagradt] (New York: Thames and Hudson.igil1.l 1. Aunque los investigadores han logrado encontrar e1 odgen de anti.orglgematria/gematria. en el idioma ingles. capitulo 4. De hecho.iriner. Michael Drosnin. a cada ele- \¥'estern Mysteries (Paul. 1990). esta patrocinada por el Gal Einai Intitute ofErae/' can informa- Los signos silabicos son sfmbolos que representan la silaba de una ci6n proveniente. The Other Bible. e incluye el uso de valores reducidos.1I{lIlJl<O 'C (New York: llollglllon Mimin {~(lmp. Reading 9.

V. 1 + 0 = 1 14. El nombre se atribuye a William Occam. T. En 10 que respeeta a la qufmica. capftulo 1. un ave que que corresponde al "'1" de Yod: el elemento es nitr6geno." [EI autor afiadio comas para facilitar la lectura. s610 una caractedstica une los elementos mas abundan. Nirr6geno 1') 2. 1. verso 12. pagina 80. sietl! ABUNDANCIA DE LOS ELEMENTOS EN dobles y doee elementos.008 que viaja ala misma veloeidad.llor dl' J.560 18. verso 13. pagina 77. cuan- do preguntamos "eminto" de algo esta presente. y la letra Wlv y oxlgeno (valor de 6). Z.760 60.t6mica.ac.1£ 1>"11" K IONW . Un principia que se usa en la 16gica para tomar una decisi6n de entre posibilidades. R R. Dickerson and Geis. " "Las tres bdsicas son A. pagina 140. 15. varias explicaciones cientificas cuando dos 0 mas posibilidades escln tes del universo con el numero del valor oeulto de la antigua alqui. la brisa no dene ningun efeeto en un tanque militar blindado A. descubrimos una igualdad entre la letra preguntando. se enCOl){fO que Ia letra hchrc. Esa dave es 1a caracteristica de la maso.M. un fi16sofo medie- mia. la ex. las Dobies y los Elementos. S. Website: http:// Electro-negatividad Radio atomico Ionizacion potencial pespmcl. y a menudo se Ie llama principia de la parsimonia. ( '. En general. "Veintidns letras. una base de tres bdsicas. " EL UNIVERSO Y EN EL CUERPO HUMANO "Las sietedobles son E. Tz.. Ibidem. "Materia" se define como algo que acupa espacio y tiene masa. D. Y. y que tan facil En la Tabla Peri6dica hay un elemento espedfico con el valor absoluto puede recibir una influencia a ser detenido. (Cual es 1a masi' de ese alga? Hey y el elemento nitrogeno (valor 5). Q. Sepher Yetzirah. Hidr6geno 92.M. o.1 Oxfgello 4'} 2S. elementos de la Tabla Peri6dica de los Elementos sea uniea.html Densidad Peso at6mieo Masa at6mica Punco de ebullici6n Radio covalente Calor espedfico 22.vub. Usando los prineipios de gematria. En este caso se dice que la maso. A continuaci6n esta la dave de las caraetedsticas que hacen que los 20. el cuerpo humano tiende a comparcir los 16.440 19. encontramos las tres Letras Madres que se el mundo que nos rodea. Sin em- bargo. K. G. Conductividad Calor de evaporad6n Trama orbital Es interesante que cuando se campara la abundancia de los cuatro elementos en el universo. yuela a 14 kil6metros por hom puede reeibir can facilidad la influen. N.670 Vod !'t'Slle!V{" ("I v. el Caractedsticas dave que hacen unico a cada elemento principio establece que "uno siempre debeda escoger la ex. CH. capftulo I. Par ejemplo. grafica inte- Estados de oxidaei6n Calor de fusi6n Termal rior de la portada de la edician en pasta dura..be/asciPRINCI SIMPL. (De Dickerson and Geis. Sepher Yetzirah. AlIi se hace una and the Universe.) distind6n entre las Madres Basicas. del Numero absoluto (valor integral) = 1 tanque es mayor que la del ave.] Element Presencia en todo el universo Cuerpo humano 17. mencionan inmediatamente en el primer capftulo. De las 17 21. se diee que el ave tiene una masa pequefia. pagina 165. En la version de Saa. T. elementos en coneentradones que son mucho mas mareadas que en dia del Sepher Yetzirah. de hecho estamos A traves de un proceso similar.000) elementales son H. val.. en juego. Ibidem. andthe Universe. Sh." "Las doce (Los valores se muestran como atomas par 100.. La "masa" describe la inerda de un objeto en maYimiento.316 El C6digo de Dios Notas 317 definida como una medida de la fuerza con la que el planeta atrae la r) Yod = 10 masa.plicaci6n m:is simple para poner en daro un fen6meno. L. Chemistry Matter.plicadon que re- Numero at6mico Capas at6mieas Punta de fusi6n quiera las minimos modificadones de logiea". Chemistry Matter. Hidrogeno cia de una brisa.

XXIII: Unidell IILl. cleicAcid. D. editado por Gershom Scholem. Sepher Yetzirah. sem6 en el ano 2001 como parte de la serie de tomos de documentos 4. Antiguo Testamento.html ma extraordinaria en la Cueva 1. Halevi. Antiguo Testamento. 1. en una confereneia de prensa de la tran desplegadas las columnas que contienen el texto de Isaiah 38:8 <l Casa Blanca de junia 26 del 2002. comentarios a "My Name YHVH. Standard Edition 30. pagina 426. 27. pagina 88.318 El C6digo de Dios Notas 319 Capitulo 6 rifled Fragments. 1954.1I1l. 34.425. Zohar: The Book ofSplendor. una descrip. The Time Archive.com/time/ 17. pagina 17. verso 2. Antigua Testamento. 26. Watson and F. son los complcmemos de la secuencia al oero lado de la mis- 20. pOt: Nashville: Southern Publising. Kabbalah. Website: www. verso 2. Spaceflight Now (2002). Press 2001). as! como uno de los mas antiguos.15:2. txodo 20:7. Ii mel OO/sdCOtist/watsoncrick. capitulo 2. Exodo 3: 14. pagina 286. Esta fotografla se pre- ciety.Abril del 2002): pagina 6. Antigua Testamento. 31. capitulo I. 25. C.[ ('11 s<'lilido COlllLHi". (New fotografla se presenta par cortesfa de la Universidad de Oxford. la totalidad del genoma humano". Ibidem. capitulo 2. Crick.J. 32. verso 1 pagina 285. Exodo 3:15 poigina 400. Antigua Testamento. Yl que . 1949). Tanakh. Mas alia del akance que se necesiea para enfocar este texeo. es uno de los mejores ejemplos que pude 3.('llo dClcrmin. Qunran Cave 4.time. Aunque este no es el unico caso en que eI nombre antiguo de Dios aparece en 2. paginas 19 ~ 22. pagina 5. The Other Bible. gina 405." 15. para entender el arreglo de las bases en esea helice. A YHVH tambien se Ie conoce como Tetragrammaton. Ibidem. apendice 1. 12. de las bases que avanzan en una direcci6n (formando un lado de la cSLalera). Pike y Andrew C. Haggadah. txod? . [FotografCa de John Trevor. Ibidem. Antiguo Testamento 6:3. pagina 88. Sepher Yetzirah. Halevi. (New York: Doubleday. pagina 9. pagina 100. pagina 32. 8. Discoveries in the Judean Desen XXXIII (England: 1. Plate XIX.Ibidem. pa-gina 5. 28." Nature.ld:ls hase" . :b:odo. EI presidenee Clinton "anuncia que concluy6 d primer estudio sabre EI documemo tiene 8 metros de largo y en esta diapositiva se mues. Plates. "El primer pergamino Isaiah" (1 Qisa). Articulo de prensa de la NASA.. Sepher Yetzirah. 23. fragmento numero 6. es que la secuencia 19. 1985). Kabbalah. {Illl' . pagina 405. Ibidem. 21. comemarios a "Linguistic Excursus on the Namt· 33. pagina 3. Time 100: Scientists and Thinkers-James Watson and YHVH." paginas 424 . que respaldan el contenido de los hallazgos del Mar Mueno. encontrar. 11. nota a. comentarios a "The Divine Name Ehyeh. editado Oxford Univ. ci6n que proviene del idioma griego que literalmente significa "pala. 3:13. Ibidem. Sepher Yetzirah. pagina 70. pagina 488. apendice 1." pa. Sepher Yetzirah. 40:28 de un extrema at otro. Golden Treasury ofBible Stories. The Sriptures. Arthur Whitfield Spaulding. comentarios a "Linguistic Excursus on the Name 9. 1999). Skinner. Roberth Write. York: Schoken Books. "Hubble Reads Age of Universe. la clave 18." pagina 426." pagina 426. Hershel Shanks. pagina IS. The New Jerusalem Bible: The Complete Text ofThe Ancient Canon of 29. un fragmento de pergamino. A Structure for Deoxyribose Nu- bra de cuatro letras". Esta foro muestra una secci6n del pergamino que se preserv6 de for. 14. 7. logy Review (Marzo . Ibidem. Antigua Testamento. Tanakh: The Holy Scriptures (Philadelphia Spaulding Publications So. 22. Dana M. 16. "Publishing Every Last Fragment" Biblical Archaeo- 6. Ibidem. 10.l\'. volumen 171 (Abril 1953) pagina 737. H. Francis Crick. l3.] 35. comentarios a "Hidden" pagina 408. YHVH. Esta 5. 24. Fragmento de un pergamino con el nombre de YHVH.I pie de pagina 4.

Cada base de ADN contiene un grado diferente de "dentro del cuer- numerico. y fa raiz de la palabra que se refiere al primer hombre de nuestra espede. 2000). 1. 37. nu~erico.ecrets ofHebrew WOnis. (Vease tam. en la timina el aspecto de "DiosJEterno" s610 se completa dos En hebreo. The s. cribiendo e1 proceso para combinar cada una de las 22 letras hebreas 39. Watkins. rodas con el mis. editado por Alice Calaprice (Prince. en una secuencia en Ia que no se YHVH. TERCERA PARTE matrfa de esca palabra y de la palabra hebrea para ''Adan'' revela una Capitulo 7 relaci6n interesante y elocuente. pher Yetzirah. que significa "sangre" en hebreo. 1984}. repiten. puerta en c6digo es OM. del mensaje que hay en nuestras dlulas podrla verse como una refe- ten errores en el c6digo es minima debido a esta estructura. dos de nitr6geno. geno. y el VG/GV 3. para crear las 231 posibilidades (Puertas) de la cread6n (Se- 40. Mike Atkinson.) 43. Por tanto. Sepher Yetzirah pagina 15. La ge. pagina 68. capitulo 2. GV se traduce como "espalda". dos de oxfgeno y cinco de carbona. Las siguienres referencias provienen de mis charlas y correspondencia (Adan). Gregg Braden.320 El C6digo de Dios Notas 321 pueden formar un par can otras bases.: Princeton Vniv. Nitr6geno. no hay ninguna diferencia en el orden de las letras he. que significa "dentro del cuerpo". 1 + 0 '" 4 + M '" 40. The Key ofit All Book One: The Eastern Mysteries. De hecho. The Expanded Quotable Einstein. asi como 2 mas 1 cia el mismo resultado que 1 mas 2. N. la posibilidad de que se presen. La suma de los valores de GVes 9 [(. J. 124). Et resto de la base rna tema general.) b'blico en el que GV significa "espina dorsal" (Ezequiel. William Tiller. nos and Prophesy (New York: Harmony Books. por ejemplo. En lugar de avanzar por el tediolio pro. renda a "denero" 0 al "interior de nuestro cuerpo. po". bien el apendice C. A parrir de mi investigaci6n sobre el significado de las letras VG y GV. 187-192. el cuerpo de nuestras especies. Antiguo Testamento. rambien contribu- ceso de escribir en cuantas ocasiones se presenta un elemento en la y6 en el ultimo libro de Israel Regardie. ' con el erudito y aurar David Allan Husle. GV tiene varias traduceiones posibles. Oxf. "espina dorsal" 0 es 5610 el aspecto Y y G del c6digo. EI Sepher Yetzimh. el orden invertido de las ton. CoG. en la base de timina (T) hay seis aromos de hidr6- breas. The &y geno y Carbono escan presentes en cada base de ADN. and Alan de nuesrras celulas describe 10 mismo. Sepher Yetzirah. 36. "Thl' Effects of Emotions on Short term Power Spec- . comentarios a "Linguistic Excursus on the Name con el resto de las letras del alfabeto. pagina 471. 2000) pagina 203. Hulse describe el significado 41. 23:35) 0 en un contexto donde significa "interior del cuerpo" Gob 30:5). pp. (Ver el Apendice D que ilustra este "interior del cuerpo". se refiere a esros ambitos des- 38. 1. 2000). Press. las dos ultimas letta\ D. David Allen Hulse es un reconocido experto en el arre de descifrar una abreviatura de los elementos que se representa por medio de k. System ofMagic {Malasia: Falcon Press. Blech. verso 5. Considerando cada elemento desde la perspectiva de las tetras he- derar que VG en nuestro DNA es 10 mismo que GY. Rollin McCarty. fuMn (A". verso 9. simplemente se indican can las tetras A." pagina 426. Aunque los mismos elementos de Hidr6geno. Third Edition. p. las cuatro bases del ADN son una especie de taquigraffa. debemos consi. Aqui el valor de la 1. breas. es obvio que en las tradiciones de fa Cdbala. (3) + V (6) '" 9]. la relad6n mfstica entre los lenguajes de 1a antigiieciad y su significado tras. veces como VG. The Complete Golden Dawn base. The Isaiah Effiet: Decoding the Lost Science ofPrayer primer hombre de nuestra especie. Cube ofSpace (York Beach: Samuel Weiser. Por ejemplo. cia 45 que se reduce a 9). ADM 42. En relaci6n al orden de las letras hebreas como numeros el establece: "Desde el punta de vista 44." En vista de que cada letra se relaciona con un valor numerico. Hulse ofrece ejemplos de esto en un contexto principia. Este es el mismo valor del nombre que representa al 2. definition de GVNG como 1a Puerta 44 de la Creaci6n. The Amereian Heritage Collage Dictionary. Baja la perspecriva de esta profunda relaci611 revelada por el numero. letras podrfa reladonarse con ambitos de la creaci6n alternos 0 "in- versos". Glen Rein. fa cantidad de of It All Book Two: The ~stern Mysteries y Two Dimensions ftrthe eada elemento es 10 que varia. 22. capilUlo 1.

Sir Fred Hoyle and Chandra Wickramasinghe. . diology. A. 33. 15. Website: www. The Hidden History ofthe Human Race. no. Ihidl'lll.au. Junia 18.htm. 1-2. Lift Itself. 10. Geneva University. pp. 208. Websitt:: Terrestrial Connection (video) (New York: B. 143. "Scientists Conquer User Beam Tdeportation:' Australian BraodLasting 38. 69. Ibidem. Ibidem. 2. 25. Evolution. "Genome Discovery Shocks Scienitsts. Sci-Tech. }'). p. Mike Atkinson. Holy Bible: Authorized King James ~rsion. The Isaiah Effect. Earth and the Red Planet (New York: Crown Publishers. Corintios. 25. Braden. Comunicado de prensa. Ibidem.A. 3: 16. Crick. 1989). A-I. pp. p. citas (New York: Sim~n and Schuster. DHEA and Cortisol. p. Zechariah. capitulo 6. Rollin McCarty. Ju. 1977). and the Universe. p. 14. Ibidem. Website: www.net. 21. Chronicle (February 11. Santa Biblfa. 17. Emotions Hert Variability.p.TIl\' I !V[)mLI'~' of rhl' /1. The Secrets ofHebrew W0rdr. 30. Website: www. p. Hoagland's Mars: Volume IL The Un Breifing. El texto 34. Ibidem. sicsl2000/bec. vol 33. 1006. J. 134. Watson. The Other Bible. Como no pude conseguir un ejemplar en 35. Ibidem. . nia 26. 12: I . and Alan Watkins.322 El C6digo de Dios Notas 323 trum Analysis of Hean Rate Variability. Haggadah. 29. 1992). Ibidem. 13. 2001. New Emotional Self-Management Program on Stress. Ibidem. y filosofia. p. Benjamin. esto se tom6 de una fuente en linea de sus pensamientos. Ibidem. Crcmo and Thompson. vol. The Mars Afystery: The Secret Connection Between www. Genesis 2:7 (Grand Ra- vioral Science. p. 2002. pp. MI: World Publishing. I089~1093. 5. Bob Barrios. 151-170. Blech. M.com. The NewJerusalem Bible.edu/phy- 37. pp. Deborah Roz.from Space ingles. 22. Ibidem.[.. 207-211 and 233-238. Bose-Einstein Condensate Homepage: a new form of matter at the w. Juan. 2001): p. p. p. Ibidem. Ibidem. Choplin. 43.sfgate.ch/entanglemenr. Chemistry." Department of Physics.D. 27. "Creation of the World and Capitulo 8 Alien Man". Ihidem. 14 (Noviembre 15.. 16. 529. 88. 67 7. p. 529. 11.htm. 6. 136. }o.geneva. "Rough Map of Human Genome Completed. 42. 36. 267- DR. The Molecular Biology ofthe Gene (Menlo Park: 12.. p. 40.cnn. 77. verso 19. Ph. 23. Graham Hancock. original esta en aleman. The Isaiah Efficf.com. 1998).c. 31. Matter. 2 (1998): pp. The puters. p. 73-78. Dickerson and Geis. 32. 26. 2:21. p. PhD. 4.1995): pp. Standard Edition. The AmericanJournal ofCar. 23. coldest temperatures in the universe. James D. 41. Ezekiel 36:27. 25. Ibidem. Website: 39. C<lIllIlH'nLny. 89~93. Haggadah. pp. Richard Hoagland. 76. Corporation Online.nobeliefs. Sum- 19. Ibidem. lIon." San Francisco 28. p. Ibidem. The Expanded Quotable Einstein. 119 8." 1'. Ibidem. pids. Tom Abate. 26.colorado. p. Video. p. 1.com/great-quotes. Stephen Hawking citado en la revista Der Spiegel en 1989. no. p. Website: www. "The Impact of a 24. 18. 1100. 121 9." CNNcom Health. www. mary and Anolll~l1om Fvidl'IKl' Related 10 Human Anriquiry. "Geneva Universiry Development in Photon Entanglement for Enhanced Ecryption Security and Quantum Com. 23-27.abc." Integrative Physiological and Beha. Mandean Gnosticism. man.2000. The Other Bible. 1981). Braden.

Stanislav Grof. como la bacteria de Ann-ax. Palm Springs. California. Las 291 episodios de conflictos armados en d mundo entre 1946y 1999. 1999). 4-9. referenda en linea at documento en sf. 138. The Expanded Quotable Einstein. no.1998.2001) pp.S.p.com. Ex. 13.harvard. Web. p. Huntington. 17. 5. y se refieren a la rraducci6n de Charles Berlitz y a Sll libro Mys- term ofForgotten Worlds [Misterios de mundoJ olvidados] (New York: 12. conocida forrnalmente como vival: The Psychological Roots of Human Violence and Greed. ademas de las toxinas bacteriales y virales de botuJismo. 10 14. Harvard Susex Program on 8.org. Stockpiling and Use ofChe- tracto del documento presentado en la Tercera Conferencia mtcal Weapons and Their Destruction [Convencion sobre fa prohibicion. Centers for Disease Con- dieron la vida en accidentes auromovilisticos en los ultimos 10 mos." Time (Abril 19. (mas de 100.\ !I':ldlHCiollt'S S<' plink vn deClfl'llli . La agenda tiene tambh~n una lista detallada de agentes qUImlcos." Los cuadros describen publican pOf secciones. dtas que urilizo son del autor e investigador David Hatcher Chul- Website: www. "The Age of Muslim Wars.000 versos). este tratado internacional rrata el 6. La Convencion de Armas Qulmicas. 15. C~nvention on the Prohibition. Ibidem. duyen agentes nerviosos como el Sarin y el XV. se conduy6 en 1993 y fue firmada por 159 estados en 1995.l lUll!' .members. Qrros [ienen nornbres que rara vez se escuchan y son rieron en la Guerra de Vietnam. dos en el 2001. Los Centros para e1 control y prevenci6n la vida aproximadamente 58. "Major mafio. cen Ilagas como el gas mostaza. durfa Nativa. 17. "When to Jump In: the World's Other Wars. p. Abril [i. Algunos de estos agentes.lbajo de Pratap tido en terminos familiares debido a la amplia cobertura de los lilt' <h:1I1dr Hoy. vol.cmpo. (venenos que producen cancer). yel Bhagabad-Gita es la mas conocida. 18]. ha reunido una cantidad impresionante de evidencia que su- 22. the Ancients (Adventures Unlimited Press. y agentes psicoacrivos como d Agente rence (Didembre 2001). Junio de 1995. 1999).edu/ . "The World's War Machine. podrfan utilizarse como sistemas de transporte. hEmi. Irlanda. Ibidem. 1972). que ha sido investigador y explorador durante mucho 13. Existen varias traducdones del Mahabbaratah.000 soldados. Opportunities. almacenamiento y uso de armas quimicas y su destruccion]. bacterias que producen gangre- threats. dios desputs de su aparici6n en el Servicio Postal de los Estados Uni- moviHsticos durante los ultimos diez afios que los soldados que mu.hsp I chemical. trol and Prevention (DCD)] mendonan al menos 16 susrancias que Fuente: ~Estoy segura? (Programa para la seguridad de conductores representan una amenaza en caso de un ataque bio16gico al pals. 2 (May 1778).aol. Ibidem. 18. In- adolescentes) Website: www. 12. Monty G. "Consciousness Evolution and Planetary Sur.". pero 60. vol. "New Century to Be Marked by Growing nas. Ademas de agentes qulmicos y bio16gicos. Ibidem. Transpersonal sobre d terna de la Espiritualidad. "WorJdwatch Institute CEnero 16. Para quienes se intcn:sen en leer sccciones del texw en sf." ABCNEWS.htm.fas. Debido a su gran ta- 11.!c \11. Childress." Smithso. Samuel P. Director. Doubleday. Ibidem.AmISafe. l hl. Carl Sagan. "The Quest For Extraterrestrial Intelligence.D. CBWArmamenr and Arms Limitation Website: www. M. dre. "Son mas los adolescentes que han perdido la vida en accidentes auto.ss. la Ecologia y la Sabi. una de 16. p.com/CSPmgm(warlist." Newsweek. '! na ~trax.net. 1.000 jovenes per. se han conVt·! I~s mt'jores tradun-iones <piC he encontrado es d tr. produccion. La siguiente es una nian. agentes que produ- 3. glere que en el·pasado han existido formas avanzadas de tecnologla.30. 9. 3. 19. Marshall. Killarney. Center for Systematic Peace. Production.324 El C6digo de Dies Netas 325 2. Comunicado de prensa. tema de tecnologfas nucleares y el desarrollo de misiles que tambien 7. las traducciones por 10 general se Episodes of Political VioUence 1946-1999. de enfermedades en Esrados Unidos [U. p. Jorgen Wouters.worldwatch. Aflotoxi- 4. 2000). cita en el escenario de The Prophet's Confe." En la Guerra de Vietnam perdieron mas difkiles de pronunciar. que induye su libro Technology ofthe Gods: The Incredible Scienm of 15.. no. 10. site: www. 25 (Diciembre. Barbara Marx Hubbard.

396 (1972).html. Technology ofthe Gods..noaa.abob. A. 1921. ciencia de nivel avanzado. Ibidem.. pueden conseguir transcripciones en el Website: www.edufbobklmahalmahbfr. 110. I ')')'l). Gorbovsky. Sir John Marxhal. Schwartz. send que era importante incluirla en el texto. Margareta Casson. "The American Experience: Race for the Superbomb. p. Kaku." Chris- 22. Stuart R. las paginas 446-447. p. 322-330.html#HISTORICAL. Abraham H. no.. Sir Mortimer Wheeler. Ibidem 30." 28. y 481-489 en 34. Website: www. por Arthur O.PBS.bartlehy. M. 25. p.ttl priw!o g/d tit' .htm. 28. Sagan. 21. Porter Sargent Publishers. vol 6. este capitulo en particular. Palm Springs. vol. "Violence: Competition or Cooperation. Ibidem.ncdc. Ibidem 29. 45. "The Riddle of the Sands".l njjei6n dd lihro '!i/tl"trr! fhl' 1~ly(II(!/(!g"y o(Ht'ing (So/m. ccr. 5. 23.326 El C6digo de Dios Notas 327 camente para prop6sitos academicos y de investigaci6n (no comer.gov!oa!reporrs/weather- 27. ejemplo: Giles Wright. primera vez en el Public Broadcasting System en enero de 1999. Ibidem. Lovejoy. Darwin. Data Center. Stearns. Rocks and Minerals no. 20. 14. Riddles ofAncient History (Moscow: Soviet Publishers. que opinan que los escritos antiguo~ raleza humana. Narional Atmospheric and Armopheric Administration (NOAA). Este programa se transmiti6 por del Desarrollo Regional. 6. como Kisari Mohan Ganguli. "The Quest For Extraterrestrial Intelligence. DucentofMan. Mutual Aid: A Factor ofEvolution (Boston. p. Capitulo 9 Chaildress. . Thf! Great Chain ofBeing: A Study ofthe His- Aunque no pude encontrar la fuente original de ~sta afirmaclon. OfGoodnes and Goodness ofNature.libs. Esta cita se tom6 de la obra disica de Francis Bacon sobre la natu- dos. 1902). base Un extracto representativo de estos estudios puede verse en de dato-s sobre el clima y registro sobre incendios. Press. 1994). 1968).: 20. p. se puede consultar en Internet como parte de Ia serie Harvard Classic. MichaelAdas. Ibidem.uga. Steele. 3 (Septiembre 1993).com/3/1/I3. The Indus Civilization (3d ed. 35. Jean Houston.org. tory ofan Itka (Cambridge. MA. cita en el escenario de The Prophet's Conftrence {Confi- de desiertos fundida y transformada en vidrio de alta calidad. 2. Santo Tomas de Aquino. New Scientist Uu- Iio 10. Warpaths: Invasions ofNorth America (Oxford: Oxford 8. Ibidem The Origins ofCivilizations. www. Th~ Interpretation afRadium (1909). www. Vtsiom. Ibidem. 6. pues se Clta con frecuen- cia en libros y an£Culos. Summa Contra Gentiles. 38. pro. tian Ethics Today 26. cial). 3. ProutJournal. Ian K. Peter Kropotkin. p. 33.lslow. 76." escrito. John Swomley. por rencia tkl Profeta} (Diciembre 2001). 329. ey ents.world-mysteries. 1999).-j (Nt·w )'''1 k W'dey. "Ensayos. p. 3. Cirado 1966). (1909-1914). Nobel Prize in Chemistry. pp. Discurso de apertura en eI Simposio sobre los Aspectos Humanisticos ducido y dirigido por Thomas Ort. {Sobre La bondad de la India describen una batalla en la que se usaron armas basadas ell y fa bonJad. Civiles y Morales" (Capitulo XIII). Ibidem. Dr. no. 40.com/pex_6. I. p. MA: Harvard Univ. Peter N. 94. Vol. Ibidem. Frederick Soddy. tk fa naturaleza}. 37. 41. Press. II. 94. 1931). Sigue la linea de otros historiadores respeta. 1 (Fehrero 2000): p. adaptado de la introducci6n del ediror ala [er- Univ. California. National Climatic www. 24. Se han publicado informes de numerosos descubrimientos de arena 42. World Civilizatiom: 4. de rnanera espedfica.html 32. 7. Ibidem. 1936). 26. . 36. Se 39. Website: 31. Ibidem. Mohenho-Daro and the Indus Civilization (Vol.

188-189. Hulse. Ned Leavitt. 10. II (Mayo 24.1 p. a traves de nuestras conversaciones para agregar detalles a la esencia de t'stt' I ihm. 11. voL 13." repored by the Centers for Disease Cantrol. Ibidem.328 El C6digo de Dios 9. y por guiarlo por el mundo editorial.cnn. Book One: The Eas- vida y que se da a conocer a traves de nuestras creaciones. pp. y conftanza. 2001): 1195-1200." journal of the American RECONOCIMIENTOS MedicalAssociation. 286 (Septiembre 12.l\ y dt' 1. "Prague Faces 'Worst Moment. Desde el primer d(a en que consideramos las implicaciones de un mensaje en el c6digo de la vida.l Ll I kg. fue gracias a la dedicacion de expertos en estos campos se cita en este texto se reviso antes de su puhlicaci6n en la revista. Jonathan Wells. 13. 12. and W. This Clas- sical Story of Evolution by Natural Selection Needs Revising". National Center for Chro- nic Disease Prevention and Health Promotion. tu integridad impecable y tu confianza en mt ha sido constante. Serdula. Statistics from A. 2 (Diciembre 2000): pp.1 11 Llllt'LI prn i \.lC(alllC!ltC has pregllntas adeclla- d.l r . The Key to It AU: Book One. la religion y la historia para crear este tion and Implications for International Waters. dicionales de la ciencia. Auguts 14. Ned. 1999): p. by Characteristics. Ibidem. An Encyclopedic Guide to the La chispa de la divinidad que esca en el interior de toda Sacred Languages & Magickal Systems ofthe World. Wolf. Modkad. 2002.com/World. te envio mi aprecio m<is profundo por ayudarme a moldear este descubrimiento y convertirlo en un libra. Ibidem. agradecimientq a todos los que contribuyeran a llevar a feliz 17. "The Continuing Epidemics of Obesity and Diabetes in [he United States." International Nego- tiation.' eX.'» CNN . cias por estar conmigo siempre. Aaron T.1 1. no. EI informe que libra. P ocas veces en la vida tenemos la oportunidad de recono- cer a las personas cuyas contribuciones hacen posibles nuestras logras. Gra- tern Mysteries. Ibidem. David Allen Hulse. tu guia ha sido invaluable.H. Website: www. Dietz. The Key ofIt AI/. 13. vol 5. Stephanie Gunning. 357-373. termino EI codigo de Dios. mi agente literario. "Second Thoughts About Peppered Moths. "Obesity Trends: Prevalence Among U. mi editora y ahora mi amiga. Adults. pp. The Scientist. no. M.com. "Indigenous Approaches to Water Conflict Resolu. espedftcos que ahora puedo compartir mi trabajo con certeza 15. jen ocasiones en formas que ellos ni siquiera supieron! Apendice A Tengo una deuda especial de gratitud con: 1. Aunque fue necesario cruzar las fronteras tra- 14.188-189. jsiemprc h ici'iH.S.1'\ Illcjon'" Opl lllllt''\! . Esta secci6n es mi oportunidad de expresar mi 16. vol.

igracias por ayu. mi trabajo.'ite lihro ftlt'Ll 10 Jlds eX.I" . ofrezco mi mas profunda gratitud por su pa- do de confianza por el que me sienro eternamente agradecido. me send bienvenido en la familia de Hay yendo tus conocimientos sobre idiomas antiguos. gra- mas recientes descubrimientos en eI campo de la evoluci6n y cias pOl' Ia fdi(id~I\. tu buena House. Gracias por tomar el tiempo para escuchar. En verdad eres una experta en tu oficio. mi gran amigo. por tu volunrad de No hubiera yo podido pedir un grupo de personas mas compartir tus descubrimienros con otros. par recodarnos 10 dl' 1I11l'. y tu inruici6n para agradables. sus conocimienros del campo de 1a bio. y sienro que nuestro trabajo juntos todavia no esci apoyar y sugeeir. Ante rodo. yen especial par tU punto de vista artistico.H . nos abre el can mis palabras y mis horarios. Un agradecimiento muyespecial a Katie Williams. y en el momento preciso. mi editora interna. Tu voJuntad de seguir un Hamado que llega desde destreza que imprimes en todo 10 que haces. V pOI III UlIllP. ni un equipo mas dedicado para apoyar este libro. gracias por tu vision y tu fe inamovible en agradecido a ambos par su buena disposici6n a teabajar con. Despues de cinco aftos de interesantes e inespera- migo durante ellargo pedodo en que no se divulg61a natura. yen mis mejores. estoy profundamente y gerente general. Por favor acepta mi sincero agradecimiento por compartir los Al hermosa cspfrilll de nuestro perrito lanudo. sabicluria.330 EI C6digo de Dios Reconocimientos 331 Muchas gracias par tu profesionalismo. Jacqui David Allen Hulse.1 IWI'. de 10 que supones.) haeC'r que l'. Ustedes alienro durante el trabajo de edicion significaron mucho mas encarnan una combinaci6n de mente beillante. (Xlr. Sin saber precisamenre a que estaban contribu. tante y tu fe en mi persistente. responder al primer correo electronico que hizo posible nues. jsin saber siquiera a d6nde nos llevada! A Jill Kramer.'itro pasado. Brillo. Gracias tra amistad. tu amistad ha permanecido cons- precisamente en la forma correcta. nes. Jeannie Llberati.Illlli .1 Unl. Su entusiasmo y profesionalismo son insuperables. pasion por desenrrafiar el Gran Misterio. jfinalmente estamos trabajando en un proyecto! leza de nuestro trabajo. camino para llegar a ser mejores y a crear un mundo mejor.liILIl'1l h\ hOLI. disposicion para trabajar conmigo ha sido un ejemplo del gra. A Melissa. Tus palabras de parar el camino para el siguienre nive! de exploraci6n. riencia que se reflejaron en cada una de nuestras conversacio- logia molecular. qllC\lgllili(. corazon bon. ofrezco mi aprecio en la alegrfa de una sabidurfa que cia poder! sincero y mi mas profunda gratitud.> . muchfsimas gracias por A 10 largo de dos afios despues de nuestra primera reuni6n en guiarme. par la dedicaci6n y to posib1e.l qm' tracs a nuesua vida. Margarete Nielsen y John Thompson. por 10 que me siento oficina como apoyo e inspiraci6n! bendecido y agradecido. tu oferta de revisar este libro me lleg6 mentos. gracias par seguir tu Clark. A completo! 10 largo de lao temporada en que me viste en mis peores mo- Hank Wesselman. por tus opiniones honestas y por los aftos de expe- nuestro hord de Paris. A Reid Tracy. medicina y estadistica me han ayudado a pre. presidente Dr. a su confianza en mi. darme a tomar las complejidades de la ciencia y transformarlas A todas las personas de Hay House. y par tu paciencia regiones que rehasan 1a vision del mundo aceptada. ciencia ante las demandas que crea elHevar a cabo un proyecto jHa sido un honor colaborar contigo en la busqueda de mayor de esta magnitud. dos cambios. Todd Ovakaytis y Mary Kennedy.IC. iY conservo tu hoja de comemarios en mi dadoso y disponibiIidad para compartie.

siento mas aprecio por ustedes con cada ana que pasa. estar abiertos a las posibilidades. Mi mas profundo aprecio y agradecimien. y nos hemos acercado mas como familia que en nin. Un agradecimiento par su amor incansable y por creer en mi. mi gerente favorita (y unica). y a Jerry y Robin Miner de Source Books/Sacred Spaces Productions. fundadores de The Cafe. Darrin Tree Restaurant. Kathalin Walker y a todo el equipo tras bambalinas. Sylvia Braden. convertido en una familia dedicada que me ha ayudado a com- partir mi trabajo por todo el mundo. Aunque mi familia de sangre tras presentaciones en vivo. he aprendi- es pequeila. Mi gratitud par especial par recordarme que todos somos profetas. su bondad ha estado Owens. a Angela. y he escuchado las palabras que me tendida de amor es mayor de 10 que alguna vez imaginamos. fundadores de Prophets Confe- hermosos que me han mantenido fuerte y concentrado a 10 rences. y par induirme en esa vision. apoyo y buena disposici6n para "persistir" de acuerdo a los principios que nos reunieron origi- nal Illt'IHt'. en formas en que ni gracias par su visi6n y dedicaci6n. de Park Productions. Me honta l~ confianza de rodos los que han asistido a nues- gun otro momenta del pasado. Bjarkman y Rae Baskin. Siempre estare agradecido con ustedes. mando mi admiraci6n y agradeci- miento por siempre estar alii.. reunir rantas mentes diversas que trabajan para lograr un mun- A mi madre. i!untos. mando mi agradecimiento por su amor.. de esperanza y de Estoy orgulloso de ser parte del equipo virtual que se ha posibilidades. A. Sharon Kerig. en el momenta justo. todo 10 que aportan a cada dfa de mi vida que va mas aHa de mi mas sincera aprecio y gran respeto por su voluntad de ex- cualquier palabra que pudiera yo escribir en esta pagina. A Tom Park. bres de nuestro mundo cambiante! Gracias a Charlene y a rodos nuestros amigos del Bent Street Para M.332 El C6digo de Dios Reconocimientos 333 de incontables mananas. a 10 largo de los ailos. gracias do mejor. les mando un mont6n de graritud por su destreza para largo de mis viajes y en el proceso de escribir. y a mi hermano. Eric. y par preparar platillos tan A Robin y Cody Johnson. to por siempre atenderme bien. do a escuchar mejer. Gracias a su respuesta. nos hemos vista can mayor biante! frecuencia. A Lauri Willmot. juntos hemos encontrado que nuestra familia ex. a Tony y a todo el fantastko personal del Apple Conference Works y a Carol Simmons. jA rodos. mientras dormfas en la colchoneta de de unir el trabajo y la familia al enfrentarnos a las incertidum- yoga junto a mi escritorio mientras yo escribia. permiten compartir un mensaje de poder. par compartir mi pasi6n y siquiera imaginan. ht'lllos aprendido rOf!lUS llIlt'Vas y neat ivas . presente para mf. De la plorar nuevas fOfmas de trabajar juntos en nuestro mundo cam- libertad que brota de ese apoyo. iY en especial cuando mas se necesita! A medida que nuestra obra llega a las mentes y cora- wnes de un numero creciente de personas.

idera una autoridad en el campo de crear un puente entre la sabiduria de nuestro pasado y la ciencia. . tecno- . ofreciendo soluciones significativas a los reros de nuestro £Iempo. 10 califican para aportar hoy a nuestras vidas el beneficio de antiguas tradiciones perdidas por largo tiempo. Gregg Braden se ha aventurado mas alIa de los lfmites de la ciencia y la espirituali- dad. junto con sus antecedentes en el campo de la ciencia pura. monasterios y tem- plos del pasado. Ante- riormente fue jefe diseftador de sistemas de computo (Martin Marietta Aerospece). ge610go por computadora (Phillips Pe- troleum) y supervisor de operaciones t(~cnicas (Cisco Systems). 10gfa y paz de nuestro futuro. donde ha tratado el tema del pape! de fa espiritualidad en la tecnologIa. Awakening to Zero Point [Despertar en el Punto Cero}. autor de best-sellers del New York Times ha sido orador invitado en conferencias internacionales yen transmisiones especiales en los medios. A partir de su innovadora obra. SOBRE ELAUTOR G regg Braden. hasta su obra pionera Walking Between Two Worlds [Caminar entre dos mundos} y la contro- versia de The !saiah Effect fEt eJecto Isaias}. yahora se Ie con. Sus viajes a remotas aldeas de molltafias.

336 El C6digo de Dias Para mayor informacion.com EI Ciidigo de Dios Gregg Braden EI Ciidigo Jesus John Randolph Price La Conspiraciiin del Grial Lynn Sholes & Joe Moore La Cosrnologia Oculta de la Biblia Gordon Strachan Los Ternplarios.O. Juan Pablo Morales Anguiano Misterios y Secretos de los Tern plarios Lionel & Patricia Fanthorpe . ponerse en contacto con la ofici- na de Gregg en: Wisdom Traditions P. Box 5182 Santa Fe. NM 87502 TITULOS DE ESTA COLECCION 505-424-6892 ssawbraden@aol.