G Model

PRP-51411; No. of Pages 8 ARTICLE IN PRESS
Pathology – Research and Practice xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Pathology – Research and Practice
journal homepage: www.elsevier.com/locate/prp

Original Article

A mutation spectrum that includes GNAS, KRAS and TP53
may be shared by mucinous neoplasms of the appendix
Kieko Hara a , Tsuyoshi Saito a,∗ , Takuo Hayashi a , Alkam Yimit a , Michiko Takahashi a ,
Keiko Mitani a , Makoto Takahashi b , Takashi Yao a
a
Department of Human Pathology, Juntendo University School of Medicine, Japan
b
Department of Coloproctological Surgery, Juntendo University School of Medicine, Japan

a r t i c l e i n f o a b s t r a c t

Article history: Appendiceal mucinous tumors (AMTs) are classified as low-grade appendiceal mucinous neoplasms
Received 6 March 2015 (LAMNs) or mucinous adenocarcinomas (MACs), although their carcinogenesis is not well understood. As
Received in revised form 27 April 2015 somatic activating mutations of GNAS are considered to be characteristic of LAMNs while TP53 mutations
Accepted 3 June 2015
have been shown to be specific to MACs, MACs are unlikely to result from transformation of LAMNs. How-
ever, emerging evidence also shows the presence of GNAS mutations in MACs. We examined 16 AMTs
Keywords:
(11 LAMNs and 5 MACs) for genetic alterations of GNAS, KRAS, BRAF, TP53, CTNNB1, and TERT promoter in
Appendiceal mucinous neoplasm
order to elucidate the possibility of a shared genetic background in the two tumor types. Extensive histo-
TP53
GNAS
logical examination revealed the presence of a low-grade component in all cases of MAC. GNAS mutations
KRAS were detected in two LAMNs and in one MAC, although the GNAS mutation in this MAC was a nonsense
Mismatch repair gene mutation (Q227X) expected not to be activating mutation. TP53 mutations were detected in three LAMNs;
Mutation they were frequently detected in MACs. KRAS mutations were detected in three LAMNs and three MACs,
and CTNNB1 mutations were detected in two LAMNs. KRAS mutation and activating mutation of GNAS
occurred exclusively in AMTs. BRAF and TERT mutations were not detected. Overexpression of p53 was
observed in only two MACs, and p53 immunostaining clearly discriminated the high-grade lesion from a
low-grade component in one. These findings suggest that p53 overexpression plays an important role in
the carcinogenesis of AMTs and that, in addition to mutations of GNAS, KRAS and TP53 alterations might
be shared by AMTs, thus providing evidence for the possible progression of LAMNs to MAC.
© 2015 Elsevier GmbH. All rights reserved.

1. Introduction becomes increasingly fibrotic and hyalinized, and the appendix
may become transformed into a fibrotic cyst that is lined by
The classification and diagnosis of appendiceal mucinous attenuated neoplastic mucinous epithelium [2]. Rarely, the neo-
tumors (AMTs) has been controversial for several decades. The plastic epithelium directly abuts the hyalinized cyst wall [2]. In
latest classification of AMTs by the World Health Organization contrast, MACs demonstrate destructive invasion of the appen-
(WHO) is based on the classification of Misdraji et al., which was diceal wall, high-grade cytological atypia, or complex epithelial
devised by reviewing 107 AMTs and classifying them as low-grade proliferation [1]. However, there may be difficulties in differentiat-
appendiceal mucinous neoplasms (LAMNs) or mucinous adenocar- ing LAMNs from MACs, because structural and cytological atypia
cinomas (MACs) according to their architectural and cytological of tumors sometimes varies within a single lesion. In practice,
features [1]. LAMNs are characterized by the replacement of normal we frequently encounter MACs containing high-grade atypia
appendiceal mucosa with a villiform, undulating, or flat mucinous together with residual luminal mucinous tumor that resembles
epithelial proliferation [2]. Frequently, the wall of the appendix LAMNs.
The molecular basis for the development of AMTs remains
unclear. It has been shown that KRAS is frequently mutated in the
majority of LAMNs and MACs [3,4], whereas GNAS mutation is only
∗ Corresponding author at: Department of Human Pathology, Juntendo University
observed in LAMNs [5]. Overexpression of p53 is reported to be
School of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo, Japan. Tel.: +81 3 3813 3111;
fax: +81 3 3813 3428. rare in appendiceal tumors [4,6], although KRAS mutation and p53
E-mail address: tysaitou@juntendo.ac.jp (T. Saito). overexpression can be seen in half of pseudomyxoma peritonei

http://dx.doi.org/10.1016/j.prp.2015.06.004
0344-0338/© 2015 Elsevier GmbH. All rights reserved.

Please cite this article in press as: K. Hara, et al., A mutation spectrum that includes GNAS, KRAS and TP53 may be shared by mucinous
neoplasms of the appendix, Pathol. – Res. Pract (2015), http://dx.doi.org/10.1016/j.prp.2015.06.004

KRAS. Materials and methods instability is rare in appendiceal carcinoma.1016/j. high-grade cytologi- order to better understand the underlying molecular pathogene.2. microsatellite 2. TERT promoter mutations were into two groups based upon their architectural complexity and reported to be very rare in gastrointestinal stromal tumors [15]. On the other hand.prp. How. (A) and (B) represent high power magnification of low-grade component and high-grade component of Case#15. accompanied by a low-grade component that resembles low-grade appendiceal mucinous neoplasms (LAMNs.2015. the two components are clearly demarcated.G Model PRP-51411. The Wnt University Hospital..org/10. Mutations in the TERT promoter were recently identified in several tumors [11.doi. in destructive invasion of the appendiceal wall. there has so far been no report of TERT promoter mutations complexity (villiform. Tumorous glands with a complex structure and high nucleo/cytoplasmic ratio (left side) are shown. and small pap- in AMTs. The clinicopathological colorectal carcinogenesis. and TY). nuclear stratification. A mutation spectrum that includes GNAS. obtained from their primary sites. records of the 16 patients were reviewed. – Res. and TERT promoter in LAMNs and MACs. KRAS and TP53 may be shared by mucinous neoplasms of the appendix.06. Hara et al.14].004 . we examined genetic alterations of GNAS. Pathol. prominent Please cite this article in press as: K. were classified as MACs if they demonstrated any of the following: BRAF. et al. illary excrescences) were classified as LAMNs (Fig. Pathological evaluation age (12%) of nuclear ␤-catenin expression [10]. and hypermethyl- ation is not a mechanism for genetic instability in these tumors 2. flat epithelial proliferation. http://dx. Tumors In this study.1. did not find mutations of the TERT promoter in cytological atypia (nucleomegaly. No. Hara. (PMP) cases of appendiceal origin [7]. marked nuclear membrane irregularities. 1. of Pages 8 ARTICLE IN PRESS 2 K. (C) Destructive invasion of mucinous adenocarcinoma. respectively. All tumor samples were rectal carcinoma express nuclear ␤-catenin. rare an analysis of 22 cases of colorectal adenocarcinoma [16]. 2. and approximately 90% of cases of colo. (B) Mucinous adenocarcinoma (MAC) shows high-grade cytological atypia and complex epithelial proliferation (×400). degree of cytological atypia. TS. nuclei. 1A). / Pathology – Research and Practice xxx (2015) xxx–xxx Fig. mitotic figures. vesicular sis/carcinogenesis of AMTs. TP53. although it has been shown that MACs show a lower percent. Tokyo. Irregular glands invade from the lumen (asterisk) into the appendiceal wall. This study was approved by the the impact of the activation of the Wnt signaling pathway on Ethics Committee of Juntendo University School of Medicine. The AMTs were divided and poor patient survival [13.12]. Furthermore. Histological and immunohistochemical feature of appendiceal mucinous tumor. Tumors that demonstrated low-grade and Killela et al. Pract (2015). and single-cell necrosis) and minimal architectural ever. (D) Histology of mucinous adenocarcinoma (MAC) with a low-grade component (Case#15). Sample preparation [8] although some hyperplastic polyps and sessile serrated ade- nomas of the appendix show decreased expression of MLH1 and Sixteen cases of AMTs that were surgically resected at Juntendo BRAF mutation is more common in serrated polyps [9]. Hematoxylin-and-eosin (H&E)-stained slides were reviewed and were reported to be associated with tumor aggressiveness by four pathologists (KH. Japan were collated from the patholog- signaling pathway that involves ␤-catenin plays a critical role in ical files of the Department of Pathology. TH. right side). cal atypia (extensive full-thickness nuclear stratification. the tumorigenesis of AMTs has not been adequately elucidated. CTNNB1. (A) Low-grade mucinous neoplasm (LAMN) composed of mucinous epithelium with minimal atypia (×400).

Leica microsystems. Immunohistochemistry of MLH1. gin [18. USA). Immunohistochemical analysis mean age of 58 years and ranging from 36 to 86 years. Representative sections that included both tumor tissue and non-tumor tissue were selected for further analysis. The mean age of patients with MAC was 56. MSH2.9%).9 years for patients with LAMNs. and Low-grade components were observed at the edge of the tumor or detected following incubation with the primary antibody overnight the surface of the crypts. USA). Franklin Lakes. and TERT promoter mutations were examined using PCR MSH2. MSH2 (1:50. The immunohis. Please cite this article in press as: K. Primer sequences used in this study (10/16) of cases. In tion Laboratories. In one case (Case#15). LAMN: mean diam- to membranous and/or nuclear expression in epithelial cells. http://dx. atypia smoothly differentiated into the surface crypts with mini- The immunohistochemical expressions of MLH1 and MSH2 mal atypia. in Tris-EDTA buffer (pH 9. No. All of the 16 AMTs showed preserved expression of MLH1 and CTNNB1. 3. Tokyo. Lymph-node metastasis was observed in one out of eight considered to represent positive nuclear staining.6 mm. although an explo- was interpreted as either positive (moderate to strong staining) or ration of regional lymph nodes was not performed in eight of the 16 negative (negative.4. Polymerase chain reaction and mutational analysis Genomic DNA of each case was extracted from tumor-derived 3. although we confirmed that Immunohistochemical staining was performed on 4-␮m-thick bilateral ovaries were intact in all but three cases by intraopera- formalin-fixed. As for MAC cases found to have genetic MACs. Nuclear ␤-catenin accumulation in >5% of tumor cells was of cases. of Pages 8 ARTICLE IN PRESS K. NJ. glands with high-grade atypia were considered as being preserved if there was nuclear stain. Clinicopathological and histological analyses component). Results we exhaustively evaluated all slides of each MAC in order to ascer- tain whether it contained lesions resembling LAMNs (a low-grade 3. High p53 LI over 10% was observed in two cases was microdissected using laser-capture microdissection system of MAC and immunohistochemical staining of p53 discriminated (LMD6500. GNAS. Pleasan.0) for hMLH1 and all cases of MAC contained a focal area of a low-grade component. Four patients (three with LAMNs and one with MAC) devel- cells were evaluated to calculate p53 labeling index (LI). eter = 60. Grostrup. they were from 2 male and 14 female patients. 14/beta-Catenin. Staining of p53 informative cases. USA). comprised 11 LAMNs and 5 MACs. One patient with MAC died of the disease 20 months after surgery. A mutation spectrum that includes GNAS. – Res.org/10. Tumor cases containing less than 1000 cells in the representing section.prp. At least one thousand tumor cases.5% followed by direct sequencing. The tumors were confined within the appendix in 62.1016/j. KRAS. [1].2015. p53 (1:50. In this study. p53 LI was higher in MAC (mean: 22%) compared to LAMN alterations. contained areas with goblet-like mucinous cells/signet ring cells. In addition. ovary at the initial surgery. if present) was 57. weak staining). Nussloch.5% normal.. The remaining three cases were PMP directed against the following human proteins and at the dilutions cases with synchronous mucinous neoplasms of both appendix and indicated: MLH1 (1:50.7 mm). The complete absence of nuclear staining tumor (Fig. A histological re-evaluation revealed that the 16 AMTs La Jolla.2. none of the 5 MACs Germany). PAb1801. Lymphovascular invasion was not observed in any Membranous staining without nuclear expression was considered of the cases.0) for p53 and ␤-catenin. / Pathology – Research and Practice xxx (2015) xxx–xxx 3 Table 1 Sequences of the PCR primers and anticipated product size. The clinicopathological features of the 16 AMTs are summarized in Table 2. Leica Biosystems. and brisk mitotic activity). which was patient with MAC. ent difference between the two types of tumor with regard to tochemical expression of ␤-catenin was evaluated with respect tumor size (MAC: mean diameter = 56. Japan) for further PCR high-grade area from low-grade areas in a case of MAC (Fig. The bottom crypts showing high-grade at 4 ◦ C using an EnVisionTM kit (Dako. Four cases of LAMN and one case of MAC had developed PMP. There was a female predominance in this series. G168-15. TP53. examination to determine from which component the genetic ation (complex papillary fronds and cribriform glandular spaces) alterations were derived. Calbiochem.doi. Diagnostic Biosystems. the extensive review of all available slides revealed that by autoclaving slides. PC57 Rabbit polyclonal. and were considered as appendiceal ori- ton. Hara. BD Transduc.004 . One patient with LAMNs relapsed soon after surgery.06. and ␤-catenin (1:200. Denmark). or complex epithelial prolifer. Hara et al. Pract (2015). Gene Forward primer Reverse primer Product size (bp) GNAS exon 8 ACTGTTTCGGTTGGCTTTGGTGA AGGGACTGGGGTGAATGTCAAGA 189 GNAS exon 9 GACATTCACCCCAGTCCCTCTGG GAACAGCCAAGCCCACAGCA 136 KRAS AGGCCTGCTGAAAATGACTG GGTCCTGCACCAGTAATATGCA 164 BRAF TGCTTGCTCTGATAGGAAAATG CTGATGGGACCCACTCCAT 143 CTNNB1 CCAATCTACTAATGCTAATACTG CTGCATTCTGACTTTCAGTAAGG 310 p53 exon 5 CTCTTCCTACAGTACTCCCCTGC GCCCCAGCTGCTCACCATCGCTA 211 p53 exon 6 GATTGCTCTTAGGTCTGGCCCCTC GGCCACTGACAACCACCCTTAACC 182 p53 exon 7 GCTTGCCACAGGTCTCCCCAAG TGGCAAGTGGCTCCTGAC 188 p53 exon 8 TGGTAATCTACTGGGACGGA GCTTAGTGCTCCCTGGGGGC 134 p53 exon 9 GCCTCTTTCCTAGCACTGCCCAAC CCCAAGACTTAGTACCTGAAGGGTG 102 hTERT promoter AGTGGATTCGCGGGCACAGA CAGCGCTGCCTGAAACTC 235 nucleoli. BRAF. were clearly demarcated from low-grade components within the ing of neoplastic cells. KRAS and TP53 may be shared by mucinous neoplasms of the appendix. There was no appar- was regarded as complete loss of expression.8 years. Pathol. 2A–F). each component of high-grade and low-grade areas (mean: 0. Antigen was retrieved addition. As for the oped distant metastases (of the ovary and/or omentum). CA.19]. being 73% (8/11) for LAMNs and 40% (2/5) for are listed in Table 1. and it lymphocytes. 1A. 2. paraffin-embedded tissue sections using antibodies tive and histological findings. This classification was proposed by Misdraji et al. et al. (Fig.1. CA. Nuclear expression of ␤-catenin was observed in 62.G Model PRP-51411. and non-neoplastic crypt epithelium. of neoplastic cells despite internal control positivity (stromal cells. MSH2 or in citrate buffer (pH 6. with a 2. and later adapted to the WHO classification [17].3. tumor cells in the representative section was evaluated. 1B and C). ˇ-catenin and p53 and non-tumor-derived tissue that was manually microdissected from 10-␮m-thick unstained sections. B and D). all cells were cytologically positive in the ascites of one LAMN patient.

of Pages 8 ARTICLE IN PRESS 4 K. (B) Low-power view of p53 immunohistochemistry clearly demarcated the high-grade and low-grade components. one MAC case with KRAS mutation also harbored a detected. (C and D) Tumor cells have high-grade atypia (C) and show diffuse and strong expression of p53 (D). 4B). the two LAMNs carried mutations of codon 201 15) harbored multiple point mutations in TP53. (E and F) In contrast. Hara.2015. BRAF or TERT promoter mutations were not (Fig. (A) Low-power view shows coexistence of mucinous adenocarcinoma (right) and low-grade component (left). 4C). Pract (2015). Genetic alterations of LAMN and both cases showed nuclear expression of ␤-catenin (Fig.3. Hara et al.004 . 4A). KRAS and TP53 may be shared by mucinous neoplasms of the appendix. CTNNB1 mutations were found in two cases 3. / Pathology – Research and Practice xxx (2015) xxx–xxx Fig. 2. Differential p53 expression in a case of MAC with a low-grade component (Case#15). KRAS R249G in Case#15) was observed only in each high-grade com- mutations were identified in six cases.. – Res. whereas a MAC had a nonsense mutation at codon one of the multiple genetic alterations (G245D in Case#13 and 227 (Q227X.doi. et al. the low-grade component (E) does not express p53 (F) (original magnification: A. In these cases. Fig.1016/j. No. B: ×40.prp. including three LAMNs ponent (Fig. 3A).06. Complete expression loss of p53 (LI: 0%) was observed in 55% (6/11) GNAS mutation expected to be non-activating one. 4C). http://dx.G Model PRP-51411. 3B) expected not to be activating one. A mutation spectrum that includes GNAS. Thus. C–F: ×400).org/10. Mutations in TP53 were detected in three of the 11 LAMNs GNAS mutations were identified in three cases (two LAMNs and three of the five MACs (Fig. Please cite this article in press as: K. vating mutation of GNAS and mutation of KRAS was mutually exclusive in AMTs. (Fig. Pathol. Two MACs (Cases#13 and and one MAC). the acti- for LAMNs and 40% (2/5) for MACs (Table 3).

Regarding the Case# Table 2 latter point. whereas 37% of high-grade MACs without a signet Stage ring cell component carried GNAS mutations [27]. we found that all five cases of MAC had a low-grade ly 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 component. cM0: clinically no 4. expression [31]. Codons 245 and 249 in TP53 are both known as common c1a mutation spot in several tumors. No. KRAS and TP53 may be shared by mucinous neoplasms of the appendix. From the standpoint of cancer genetics. – Res. A higher incidence of activating GNAS mutations Relapse in LAMNs and low-grade mucinous carcinomatosis peritonei has also been reported [26]. Furthermore. Although the frequency was relatively low compared to that in previous studies [5. A mutation spectrum that includes GNAS. but clinically no evidence of lymph node metastasis. Discussion Prognosis Somatic activating mutations of GNAS have been reported in AWD AWD AWD AWD AWD DOD NED NED NED NED NED NED NED NED NED NED several neoplasms. In this study. GNAS mutation was found in a case of MAC (Case#12). while frequent TP53 mutations were pre- Both ovaries. different from those that occurred during the recurrent process of the tumor [30]. GNAS mutations have Follow up been reported in low-grade malignancies. viously identified in MAC [28]. Hara. G245D in Ascites Case#13 and R249G in Case#15 were proven to be derived from the – – – – – – – – – – – high-grade component of each tumor by the LCM based sequence analysis. M: male. in Case#15. A GNAS mutation observed in this peritonei case of MAC where there was simultaneous KRAS mutation was not of the hotspot-type observed at codon 201.06. sug- gesting the possibility that activation of the Wnt signaling pathway contributes in part to the tumorigenesis of LAMNs. Furthermore. MAC MAC MAC MAC MAC Interestingly. and intraductal papillary neoplasms of the pancreas [24] 8 70 59 48 17 25 24 29 25 11 1 127 20 30 8 11 and bile duct [25]. These findings suggest the possible involvement of p53 during the progression of LAMN to MAC. AWD: alive with disease. fibrous dys- plasia [21]. However. Pract (2015). Moreover. intramuscular myxomas [22]. but a nonsense − − − − − − − − − − − + + + + + mutation at codon 227. A recent study demonstrated that 35% of LAMNs harbored GNAS mutations. thereby expected not to be an activating mutation. of Pages 8 ARTICLE IN PRESS K. NED: no evidence of disease. Furthermore. In this study.004 . Nishikawa et al. the incidence in F F F F F F F F F F F F F F MACs is rather higher than a previously reported value of 12% [10]. including colorectal cancer. the number of MAC cases that have Disease free been examined for GNAS mutation to date is too small to enable survival the frequency of GNAS mutation in this tumor to be concluded 8 70 59 48 14 25 24 29 24 11 1 127 4 30 8 11 [5]. Path Diag. Another recent IVA IVB IVC IVC IVC IIIB IIA IIA IIA IIB IIB IIB 0 0 0 report also described a case of high-grade appendiceal mucinous I neoplasm where the tumor contained GNAS mutations within a 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 v low-grade component [26].doi. Tumor size are the first evidence that confirmed co-existence of genetically distinct low-grade and high-grade components within AMTs and (mm) 60 30 41 57 25 95 115 70 30 90 55 95 60 38 40 50 possible transformations of MAC from LAMN within a single tumor. Collectively. nuclear ␤-catenin expression was observed in 63% Sex M M of all AMTs (73% of LAMNs and 40% of MACs). we found GNAS mutations in 2 Pseudomyxoma out of 11 cases of LAMN. Pathol.ovary. two cases of CTNNB1 mutation were LAMNs LAMNs LAMNs LAMNs LAMNs LAMNs LAMNs LAMNs LAMNs LAMNs LAMNs observed in LAMNs that showed nuclear ␤-catenin expression. Among them. Though there is no report that codon 245 and 249 mutants are active [29]. p53 immunohistochemistry clearly discriminated between high-grade and low-grade compo- 4b 4a 4a 4a 4a 4a 4a 4a 4a is is is 2 3 3 3 T nents. Lt.prp. we have recently reported that GNAS mutations occur 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 as an alternative mechanism of Wnt pathway activation in a small Please cite this article in press as: K.2015.ovary. considering the above-mentioned quite different frequency of GNAS mutation in LAMN versus MAC [5]. 2 cases (Cases#13 omemtum Omentum omentum omentum Rt. including appendiceal months tumors. and 15) harbored multiple TP53 mutations. cN0: lymph nodes are not pathologically examined. and villous adenomas of the colon and rectum [23]. DOD: dead of disease.. but 1b 1b 1b 1a c0 c0 c0 c0 c0 c0 c0 c0 c0 c0 c0 M this is the first report in appendiceal tumor [29]. A higher incidence (60%) of loss of ␤-catenin expression in the Age 49 61 36 57 61 73 86 47 46 44 77 60 43 48 54 79 cytoplasmic membrane has also been reported in MAC. neither of these cases harbored a GNAS mutation. From an extensive review of cases in this study. found activating GNAS mutations in 50% of LAMNs but in none of the three examined cases of MAC [5].26]. and thus have been considered as characteris- tic of low-grade tumors. these c0 c0 c0 c0 c0 c0 c0 c0 N 1 0 0 0 0 0 0 0 two cases (Cases#13 and 15) showed high p53 LI of 14% and 95%. such as pituitary adenomas [20].G Model PRP-51411. − − − − − − − − − − − − − + + + MAC is unlikely to be transformed from LAMN. TP53 mutations were found in 3 out of the 11 metastasis site Disseminated/ LAMNs examined here. compared to approximately 10% of LAMNs that showed loss of ␤-catenin evidence of metastasis. Out of 5 MACs. respectively.1016/j. http://dx. Hara et al. / Pathology – Research and Practice xxx (2015) xxx–xxx 5 F: female. et al. these findings Clinicopathological feature of 16 appendiceal mucinous tumors.org/10.

8 + R201H 11 LAMNs + + 0. These be detected by immunohistochemistry.1016/j. S260T 16 MAC + + 1 − High-grade area specific mutations are shown in bold. In this study. Please cite this article in press as: K.. Generally. We suggest that the p53 mutations we detected in noma/carcinoma [6]. E171K G245D. 3. especially LAMNs. subset of gastric adenocarcinomas of fundic gland type that show complete loss of p53 expression may represent loss of p53 func- frequent activation of the Wnt signaling pathway [32]. In this study. it in AMTs. GNAS mutation in a case of low-grade appendiceal mucinous neoplasm (LAMN) (A) and in a case of MAC (B). It was unanticipated that TP53 mutations p53-negative cases do not induce conformational changes that were frequently observed in AMT cases in this study (in 3 of 11 inhibit protein degradation. Hara et al. mulates in the nuclei of tumor cells. resulting in false-negative findings LAMNs and 3 of 5 MACs). Our tumor grade in AMTs [7] and that p53 overexpression in MACs series contains 8 cases with complete loss of p53 expression. MDM2. various false. A mutation spectrum that includes GNAS. Furthermore. Since nonneoplastic was observed in 44. on cell proliferation or cell viability [35].004 . leading to a more stable protein that accu.06. of Pages 8 ARTICLE IN PRESS 6 K. Crosstalk tion caused by TP53 mutations with possible deletion of another between G-protein and Wnt signaling pathways might also occur allele which is not identified in our PCR analysis. these cases with [7]. and do not influence It has been shown that the p53 LI in appendiceal the transcriptional activity of p21/WAF1.G Model PRP-51411.prp. / Pathology – Research and Practice xxx (2015) xxx–xxx Table 3 Results of immunohistochemistry and genetic analysis in 16 appendiceal mucinous tumors. IHC Mutation analysis MLH1 MSH2 p53 LI (%) ␤-catenin nuclear GNAS KRAS BRAF CTNNB1 TP53 hTERT expression expression expression 1 LAMNs + + 0 − C141R 2 LAMNs + + 0 − Q25X 3 LAMNs + + 0 + R201C D184G 4 LAMNs + + 0 + 5 LAMNs + + 0.5 − P250S 6 LAMNs + + 2. et al. Genetic alterations in appendiceal mucinous tumors. – Res. overexpression of p53 conformation of p53. Pract (2015). we encountered five cases of PMP comprising Fig. KRAS and TP53 may be shared by mucinous neoplasms of the appendix. associated with p53 mutation was observed in two cases of MAC. and the incidence of appendiceal tissues show sporadic nuclear immunopositivity of p53 overexpression was significantly higher in high-grade PMP p53 protein in low frequency (about 2%) [34]. in predicts adverse clinical outcomes [31]. No. moters [36]. Hara.2015. A275V 14 MAC + + 0 + 15 MAC + + 95 + G12V R249G.3% of patients with PMP. findings are consistent with the previously reported observation positive and false-negative associations between TP53 mutation that the level of p53 overexpression increases according to the and immunohistochemical status have been reported [33].org/10.2 + T40A 7 LAMNs + + 2 + D30Y T40A 8 LAMNs + + 0 + 9 LAMNs + + 0 + G12S 10 LAMNs + + 6. http://dx.doi. Pathol.5 + 12 MAC + + 0 − Q227X G15D D206G 13 MAC + + 14 − G12D A161V. Overexpression of p53 three of which cases harbored p53 mutations. Case# Path Diag. since we observed a lower frequency has been shown that some p53 mutant variants have no effect of GNAS mutation in LAMNs compared to a previous report [5]. or Bax pro- adenoma/carcinoma is lower than that in colorectal ade. TP53 mutations alter the by immunohistochemistry. the accumulation of p53 can and one of the two patients with MAC died of the disease. However.

and expression of p53. vermiform appendix. Am. Zauber. TERT promoter mutations in familial and sporadic melanoma. Ryk. P. A. although the frequencies of mutation in these Overman. V. [12] C. Note that mutation is seen only in high-grade component. TERT promoter mutations occur frequently in gliomas and a subset of tumors Please cite this article in press as: K.P. da Rocha.195 [Epub ahead of print. L. However. T.S. J. Pathol. especially MAC. Thomas. J. et al.S. Surg.T. Koelsche. Berman. Heidenreich. Eur. These findings are in part consistent with—in part contradictory [7] S. R. occurred in AMTs. F. Pathol. J. only one References case of LAMN harbored a TP53 mutation. High-level microsatellite instability in appendiceal carcinomas. Genetic alterations in appendiceal mucinous tumors. mutational spectra of AMTs [28]. M. The authors declare that there are no conflicts of interest to [16] P. Ogawa. K. Br. 126 (2013) 907–915. Metab. eral Scientific Research from the Ministry of Education.. mutation was shared but GNAS and KRAS mutations exclusively [8] M. Determining the site of origin of In conclusion. H. Yantiss. Cancer 108 (2013) 951–958.G Model PRP-51411. Mansfield. Z.M. Mod. Rachakonda. were identified as the most frequently mutated genes in MACs [28]. A.F. Proc. Acad.J.2014. Balis. Diaz Jr. M. R.S. Hara et al. 15 (2002) 599–605..H. R. Shetty. Marotta. Of our series of 16 AMTs.org/10. Am. Sobin. Weiss. Res. Tavares.prp.. TERT This work was supported. Epithelial neoplasms of the appendix and both KRAS and GNAS mutations [28]. Am. doi. et al. Yantiss. S. 4. KRAS and TP53. High-level microsatellite instability (MSI-high) is found in Pathol. Gastroenterol. Chung. Horn. Panczykowski. An interesting finding in our study is that KRAS with phenotype and prognosis. 37 (2013) 1192–1200. R. R. Bettegowda.F. Royal. disclose. [15] N. A. D. Taggart.J. Matsubara. of Pages 8 ARTICLE IN PRESS K. Sci. – Res. 35 (2011) 1830–1836. TP53 mutation in a case of MAC (C). Misdraji. Genet. mutations are invariably present in low-grade mucinous tumors of the lence of MSI being approximately 3% [8]. Kabbani. P. J. Misdraji. Among 15 LAMNs. Lau. Chu. Jones.K. Taniguchi. J. M. Endocrinol.. 27 (2003) 1089–1103. A. 46 (2011) 869–874. Surg. Further large-series studies are necessary in order to elucidate the et al. P. 180 (2013) 97–103. In contrast.06. Kras mutations and p53 overexpression in pseudomyxoma peritonei: association to—our results. Hosen. Sahm.S. bcl-2.K.G. Sabbath-Solitare. Rachakonda.A. Pathol. Fischer. Gast. Pestana. Mucinous and nonmucinous appendiceal adenocarcinomas: different clinicopathological with the previous report [8]. Hum. KRAS mutation in a case of LAMN (A). Capper. 99 (2014) E754–E765. [1] J.D. Hahn. Distribution of TERT promoter mutations in pediatric and adult tumors of the Funding nervous system. U. Galbincea. KRAS and GNAS Frequent GNAS mutations in low-grade appendiceal mucinous neoplasms. Scapulatempo-Neto. D. J. Campanella. F. A mutation spectrum that includes GNAS. Killela. Emory. LAMNs and MACs might share a mutation spectrum that includes J. [9] R. Acta Neuropathol. our histological and genetic study shows that mucinous adenocarcinoma: an immunohistochemical study of 175 cases. features but similar genetic alterations. B. E.1038/ejhg. Pract (2015). D. D. Pathol. http://dx. CTNNB1 mutation in a case of LAMN (B).T.. C. Pathol. Jiao. I. Surg. Batista. Appendiceal mucinous neoplasms.004 . 31 (2007) 1742–1753. Houlihan. Brito. H. Sports. 134 least 20% of right-sided bowel cancers [8]. Arch. P. Govindarajan. [3] P. Rennert.J. Mori. L.J.A.2015. P.S.H. http://dx. R. A. Surg... promoter mutations are a major indicator of poor outcome in differentiated thyroid carcinomas. Fournier. 959–961. Lab.J. Peixoto.org/10. Am. MSI-high in (2010) 864–870. A. N. S. R. DNA from corresponding non-tumorous tissue showed the wild-type sequence in each case. L. Med. Rashid. Hamilton. C. Odze. Arch. Misdraji. approximately 15% of all colorectal adenocarcinomas and in at [2] J. Celestino. Graeme-Cook. J. Pathol. KRAS and TP53 may be shared by mucinous neoplasms of the appendix. disease recurrence through modification by a common polymorphism. Figl. Sharma. in part.1016/j. Science 339 (2013) of LAMNs. T. (2014). A. apoptosis. Hara. de Verdier.K. Ramanan. 110 (2013) 17426–17431. Science. S.J. Sekine. Luthra.R. No. in addition to their de novo occurrence. A.M. [14] P. of the vermiform appendix. In addition. J.28]. Vinagre..G. J. Loggie. U. J. H. et al. there was no case with MLH1 and MSH2 protein loss. and six LAMNs contained [6] N. Melo. consistent [4] W.. CD44. Fallah. C. J. TERT promoter mutations in bladder cancer affect patient survival and to Takashi Yao). R. TP53 and SMAD4 colorectum: an analysis of cell proliferation. Bishop. Sturm. and that some MACs can arise via transformation [11] S. Japan. et al. S.E. [10] P. C. Surg. Agrawal. A.J. B. [13] M. of four cases of LAMN and one case of MAC. and none of these cases showed p53 overexpression.W. et al. Young. de Conflict of interest Oliveira. Nishikawa. Ki-ras gene appendiceal adenocarcinoma is reported to be rare with the preva. genes were quite lower than the previously reported values [5. Reuss.doi. September 24]. Reitman. Tokyo. T. P. and Culture (#26670286 to Tsuyoshi Saito and #26460428 et al. J. by a Grant-in-Aid for Gen. M. / Pathology – Research and Practice xxx (2015) xxx–xxx 7 Fig.C. mutations were each found in eight cases. Lab. Scand. Natl. A comprehensive study of nondysplastic and dysplastic serrated polyps true mutation spectra in AMTs. B. Carr. Low frequency of TERT promoter mutations in gastrointestinal stromal tumors (GISTs). Appendiceal mucinous neoplasms: a clinicopathologic analysis of 107 cases... et al. Sucker. C. Med. Y. A next-generation sequencing study recently identified the [5] G. Clin. et al. L. Pathol. et al. 126 (2002) 837–841.

Genome Med. Liu. J. 21 (2002) 547–552. 26 (1995) 509–524. [32] R. F. Smardova. G. Zeh. mucinous neoplasms: identification of factors predicting survival and [20] E.. Hum. Clinicopathologic and molecular analysis of disseminated appendiceal Gynaecol. Lanza.1016/j. Differential [21] B. Lee. 60 (2014) [18] B. 207 (2005) 251–259.org/10. Y. T. Yamagishi. Nomura. [31] S. K. Davison. S. (2009) 1102–1112. Kurman. Hara et al. 6 (2014) 43. Proc. [23] M.D. Furukawa. Goldman. Fronza. Mod. Holtzman.H. F. Berisha. Rep. Pract (2015). S. M. Carr. Y. Yajima. M. M. Jablonski.M. Acad. affect survival. – Res.. [34] N. Sekine. J. mutations are common in intraductal papillary neoplasms of the bile duct. Monti.D. sequencing to identify somatic mutations. Matsubara. Shmookler.. Clin. Hing. E. J. O’Donnell. Lee. Choudry. et al. Mitomi. B. Pingpank. of Pages 8 ARTICLE IN PRESS 8 K. Hanzelkova. et al.06. N. lines are non-functional.doi. Diss.H.M. Sugarbaker. et al. C. Mizukami. G. J. http://dx. J. T. F. [36] T. Taramelli. Yost. Parvaiz. P. Singhi. GNAS [22] D. Delaney. P.H. KRAS and TP53 may be shared by mucinous neoplasms of the appendix. Zahn. Holtzman. B. Hum. L. esophageal cancer cell line.S. P. Furihata. Ronnett. Wada. A sensitive protein immunoexpression profiles in appendiceal mucinous neoplasms: a mutation-specific screening technique for GNAS1 mutations in cases of special reference to classification and predictive factors. Nenutil. Pathol.H. Mod. S. et al. Mody.L. Moran.D. No. S.M. 45 (2014) 2488–2496. 25 (2004) 411–414. Nucleic Acids Res. Sobin. Taniguchi.A.B. Yoon. Pavlova. Oncogene 5 (1990) 1059–1061. J. / Pathology – Research and Practice xxx (2015) xxx–xxx derived from cells with low rates of self-renewal. Pathol.A. Y. T. Choudry. J. Oncol. Int. de Abreu. Soussi. TP53 website: an integrative resource centre for the TP53 mutation database prognosis. A. Pai. P. mucin core proteins. 45 (2014) 1737–1743. Kim. T. Tsuda. Odell. Adenocarcinoma of the appendix. Ghosh. Genome-wide mutational landscape of mucinous carcinomatosis peritonei of Molecular and genetic characterization of a non-metastatic human appendiceal origin.D. Y. IRAC Press. Discriminating functional and non-functional p53 in human tumours by p53 Pathol. Fabian. high-grade disseminated appendiceal mucinous neoplasms but does not 110 (2013) 6021–6026. Cecil. J.Tn expressing non-functional mutated p53. Ogawa. K. Z. 22 (2009) 718–724. H. in: WHO Classification [28] X.A. H. Nitta.L. Alakus. Leroy.C. Ahrendt. J. GNAS is frequently mutated in both low-grade and Please cite this article in press as: K. R. Kim. M. B. A new constitutively proposed criteria for a three-tiered assessment of tumor grade. Oncol. Hatori. [35] S. Kim. potential. et al. Omotehara. et al. Shinagawa. T. The clinicopathologic analysis of 30 cases with emphasis on site of origin. and neuroendocrine cell markers in epithelial neoplasm of appendix. Mod. Pathol. H. Y..K. S. Yagihashi. [19] A. Jepsen. S. T. Zhu. pp. Imura. N.A. 1 (2011) 161. C..J. Fournier. F. A.H. Chem. [24] T. M. B. Ahrendt.P.. Davison. Histopathology 50 (2007) 691–704. 22 fibrous dysplasia: the first report of a codon 227 mutation in bone. S. Bi. R. et al. Diss. Eur. Clememti.A. papillary mucinous neoplasms of the pancreas. Idowu. C.D. Lyon. et al. Sakai. S. activating mutation of the Gs protein alpha subunit-gsp oncogene is found in 27 (2014) 1521–1539. Kang.J. L. Itabashi. 1004–1011. GNAS and KRAS Pathol.A. Nakanuma. Presneau. Pipas. GNAS1 mutation as an alternative mechanism of activation of the Wnt/␤-catenin mutations occur more commonly than previously thought in intramuscular signaling pathway in gastric adenocarcinoma of the fundic gland type.J. B. H. Pingpank. Ramalingam. J. Pathol. R.L. T. Gallagher. T. Y. Pseudomyxoma peritonei Zureikat. H. J. Kass. et al. Natl. Bartlett.. [33] R. A mutation spectrum that includes GNAS. Hara. S.. human pituitary tumours. Dai. M. T. R. W. Molecular profiling of appendiceal epithelial tumors using massively parallel 122–128. H. H. [27] A.prp. [25] M. J.. Inga. Hum. Muller. P. Pathol. A. U. E. Kushima. Y.M. T. Yu.. Hum. usually originates from the appendix: a review of the evidence.Y.S. H. of Tumours of the Digestive System. Sci. K. J. Watanabe. 4th edition. Meldolesi. T.O. Yamamoto. and MDM2 immunohistochemistry. [17] N. Pathol.M. R. L. M. J. H. Sci. p53. Ishioka.004 . Kawamata. S. 41 (2013) D962–D969. Idowu.F.2015. et al. 228 (2012) 113–118. Al-Adnani. Yoshida. et al. D. Tanji. myxoma.. Hidaka. S.L. Whole-exome sequencing uncovers frequent GNAS mutations in intraductal Immunohistochemical expressions of cytokeratins. Sato.P. [26] H. Pathol. Leukemia 7 (1993) 1840–1845. The abnormal p53 proteins expressed in CML cell PLoS One 8 (2013) e81706. Malgaretti. P.M. 2010. [30] J. Pathol. Kuboi.H. Sasaki. Peterson.J. Saito. Mukherjee. R.A.E.. Pseudomyxoma peritonei in women: a [29] B. Yamada. 36 (2005) 1217–1225. and relationship to ovarian mucinous tumors of low malignant and TP53 mutant analysis.M.F.G Model PRP-51411. Babicky. et al. Nikiforova. Frequent activating GNAS mutations in villous adenoma of the colorectum.