You are on page 1of 15

Page 1

SUPPLEMENTAL MATERIAL

METHODS AND MATERIALS
Reagents
Pre-miR™ miRNA precursor molecules-negative (non-specific) control #1 (AM17110)
and Hsa-miR-181b-5p Pre-miR™ miRNA precursor (PM12442) were ordered from
Ambion. They are small, chemically modified double-stranded RNA molecules designed
to mimic endogenous mature miRNAs. The mature miR-181b sequence is 5’-
AACAUUCAUUGCUGUCGGUGGGU-3’, and its miRBase Accession# is
MIMAT0000257. For in vivo studies, oligomers with the same sequence were
synthesized on a larger scale by Ambion. LipofectamineTM 2000 reagent was from
Invitrogen.
Real-time qPCR
Tissues were homogenized using TissueLyser II (QIAGEN) according to the
manufacture’s instruction. Total RNA was isolated using TRIzol® reagent (Invitrogen)
from homogenized tissues or cells. QuantiTect Reverse Transcription Kit (QIAGEN) was
used to generate cDNA and QuantiFast SYBR Green PCR Kit was used for real-time
qPCR with the Mx3000P Real-time PCR system (Stratagene) following the
manufacturer’s instructions. Primers for mouse VCAM-1, E-selectin, ICAM-1, TNF-α, IL-
1β, and others are listed in Online Table I. To compare importin-α expression, the
standard curve method was used to quantify the absolute copy numbers; subsequently,
relative expression was calculated after normalization with mouse β-actin. To amplify
mature miRNA sequences, TaqMan® MicroRNA Assays hsa-miR-181b (Assay ID
001098), TaqMan® MicroRNA Assays hsa-miR-181a (Assay ID 000480), TaqMan®
MicroRNA Assays hsa-miR-181c (Assay ID 000482), TaqMan® MicroRNA Assays hsa-
miR-146a (Assay ID 000468), RNU6B (Assay ID 001093), U6 snRNA (Assay ID
001973), TaqMan® MicroRNA Reverse Transcription Kit (PN4366596), and TaqMan®
Universal PCR Master Mix No AmpErase® UNG (PN4324018) were used.
Bioluminescence imaging
NGL mice (NF-κB promoter with GFP/luciferase fusion reporter) fully backcrossed into
C57BL/6 as previously reported1 were crossed with homozygous ApoE-deficient mice to
generate ApoE-/-/NGL transgenic mice. ApoE-/-/NGL mice were injected with miR-
181b, miRNA non-specific control, or vehicle twice on two consecutive days followed by
twice a week for 4 weeks and fed a HFD. NGL mice were also injected with vehicle in
the same manner and fed a HFD. After 4 weeks, aortas were carefully excised, kept in
ice-cold 1 x dPBS, and incubated with 1 x dPBS containing 1.5 mg/ml D-luciferin for
bioluminescence imaging using a Xenogen IVIS System 100 (Xenogen Corp.,

frozen sections of aortic roots were stained with: 1) DAPI. including Oil red O staining of the thoracic-abdominal aorta and aortic root and staining for macrophages (Mac-3) and T cells (CD4). and CD4-positive cells were counted manually. and anti-p65 (Abcam). 1 µl of 1 nmol/µl miRNA non-specific control or miR-181b mimics was mixed with 100 µl dPBS (solution 1).3. and the basal portion of the heart and aortic roots were embedded in OCT compound and frozen at -80°C. Immunohistology and characterization of atherosclerotic lesions To induce atherosclerosis. Fluorescence intensity of importin-α3 and nuclear p65 was measured using Image J software. Solution 1 and solution 2 were then mixed with pipetting up and down 100 times. The quantification of VCAM-1 staining was performed as previously described. the 543 nm line of a HeNe543 laser. Serial cryostat sections (6 µm) were prepared using a Lab-Tek tissue processor Leica CM3050. Page 2 Alameda). 2) DAPI. The data were calculated from at least 40 cells for each group . we fed 8-week-old male ApoE-/. Systemic delivery of miR-181b or siRNAs in mice Mice were injected with miR-181b or miRNA non-specific control twice a week for 4 weeks or once a week for 12 weeks through tail vein as previously described.2 In brief. were performed as previously described. Serial images were taken and luminescence was quantitated at the plateau of the luminescent signal (about 40 – 45 min after incubation). or 3) DAPI. followed by corresponding secondary antibodies. 4 In addition. Images were captured by a digital system. Aortas were carefully excised from mice. and anti-importin-α3 (Abcam). rat monoclonal anti-mouse CD31. by two independent observers. Data were analyzed in a blinded fashion. rat monoclonal anti-mouse Mac3. and placed at room temperature for 15 min. Media Cybernetics). immunostaining was performed on the aortic root for expression of VCAM-1 (Santa Cruz). MA and conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. 200 µl per mouse. Injection of negative control siRNA or importin-α5 siRNA was followed by the same procedures except that 2 nmol of siRNA was mixed with 100 µl dPBS for solution 1.5 For immunofluorescence staining.mice a HFD from Research Diets Inc. All protocols concerning animal use were approved by the Institutional Animal Care and Use Committee at Harvard Medical School. rat monoclonal anti-mouse CD31 (Dianova). Boston. and the 633 nm line of a HeNe633 laser. the staining area was measured using computer-assisted image quantification (Image-Pro Plus software. Lesion characterizations. Lipofectamine 2000 (30 µl) was mixed with dPBS (70 µl) by pipetting up and down 50 times (solution 2). the mixture was tail-vein injected into mice using an insulin syringe (1/2 mL). Images were acquired on an upright Carl Zeiss LSM 510 confocal microscope equipped with Plan-Neofluar 40×/1. and rabbit polyclonal anti-p65.3 oil-immersion objective using the 405 nm diode laser. (D12108Ci) for 12 weeks. After incubating at room temperature for 30 min.

femurs were removed from 6 to 11-week old mice. Inc. Bone marrow cells were flushed out using a 27-gauge needle attached to a syringe containing 10 mL culture medium. M1168). Cells were resuspended by gentle pipetting. Bone marrow-derived macrophages were isolated as previously described. Cells were cultured in high glucose DMEM with 10% fetal bovine serum. Total cholesterol was measured using the Infinity™ Cholesterol Reagent (Thermo Scientific) and HDL cholesterol was measured by colorimetric assay using EnzyChrom™ HDL Assay Kit (BioAssay Systems).2 Six-week old ApoE-/. Page 3 with 8 – 10 mice. LLC) according to the manufacturer’s instructions. Intimal RNA isolation from aorta tissue Isolation of intimal RNA from aorta was described as previously reported. Peripheral blood mononuclear cells (PBMCs) were isolated from blood by using LSM® Lymphocyte Separation Medium (MP Biomedicals. C57BL/6 mouse aortic endothelial cells (MAECs) (C57-6052) were purchased from Cell Biologics. LDL cholesterol levels were calculated using the following formula: LDL=Total Cholesterol – HDL Cholesterol – Triglycerides divided by five. For isolation of peritoneal macrophages. mice were injected with 3% thioglycollate medium (3 ml each mouse) into the peritoneum. 4. Lipid profile analysis Triglyceride levels were determined using Infinity™ Triglycerides Liquid Stable Reagent (Thermo Scientific) as described by the protocol. and cultured in endothelial cell medium (Cell Biologics. and 6 weeks before aortic intimal isolation and blood collection. For each mouse. Cholesterol standard. Cells were cultured in RPMI- 1640 medium supplemented with 10% fetal bovine serum. HDL standard were from Pointe Scientific.mice were fed a HFD for 1. and allowed to grown for 3 days before transfection. Cells passaged less than five times were used for all experiments. Cells were plated into 12-well plates at 1 x 106 cells per well and allowed to grow until they were ready for transfection. Inc. passed through a 70 µm filter. and recombinant 10 ng/ml M-CSF. GlutaMAX.. 2 – 5 cells randomly selected from 2 sections were used for quantification.6 Briefly. After 4 days. Cell culture Human umbilical vein endothelial cells (HUVECs) (cc-2159) and human aortic endothelial cells (HAECs) (cc-2535) were obtained from Lonza and cultured in endothelial cell growth medium EGM®-2 (cc-3162). Triglyceride standard. . and spun down at 300 x g for 10 min at 4 °C. cells were harvested and plated on 12-well plates (1x106 cells per well).

respectively. Enrolled subjects were characterized as “coronary artery disease”.000 rpm for 10 min. Plasma was isolated from whole blood at 1500g for 15 minutes at room temperature. Antibody against p65 (sc-372). 0. Page 4 Lipofectamine™ 2000 transfection reagent from Invitrogen was used for transfection. Total RNA was isolated from plasma by using total RNA purification kit from Norgen Biotek Corporation and reverse transcription and real time qPCR was performed as described. Cell debris was removed by centrifugation at 12. following manufacturer’s instructions. 150 mM NaCl. Anonymized plasma samples were generated from blood collected in EDTA-containing tubes obtained from patients at the time of coronary angiography and stored at −80°C. and rabbit polyclonal to SRP1/importin-α5 (ab154399) were purchased from Abcam.5% sodium deoxycholate. Human and mouse plasma samples and real-time qPCR analysis Human plasma samples were obtained from the cardiac catheterization laboratory in accordance with the Institutional Review Board-approved protocol at Brigham and Women’s Hospital. and incubated with the relevant antibodies as indicated. Western blot analysis Cultured cells were harvested and lysed in RIPA buffer (50 mM Tris-HCL pH 7.4. Proteins were visualized by ECL Plus Western blotting detection reagents (RPN2132. A P<0. according to the manufacturer's instruction. goat polyclonal to KPNA4/importin-α3 (ab6039). Written informed consent was obtained from all participants or their appropriate surrogates. or “control” subjects by a group of blinded physicians based on the presence of >70% stenosis on coronary angiogram. Mouse blood was collected via heart puncture and transferred to EDTA-containing tubes. GE Healthcare). Statistical analysis Student t test was used to determine statistical significance between the groups. 1% NP-40. Densitometry scanning of the blots with ImageJ software was used to calculate the abundance of protein. 0. .2 Plasma levels of aspartate and alanine aminotransferases were measured using the VITROS DT60 II Chemistry System from Ortho-Clinical Diagnostics. MiRNAs or siRNAs were transfected at 10 nM or 30 nM concentration. goat polyclonal to KPNA3/importin-α4 (ab6038). transferred to PVDF membranes (Bio-Rad). Lysates were separated by SDS-PAGE gels.05 was considered significant.1% SDS) supplemented with complete protease inhibitor cocktail tablets (Roche). USF-2 (sc-862) were purchased from Santa Cruz Biotechnology. Inc.

Icli B. Lu ML. Esen F. 2003. Kretschmer K. Sakara Y. The Journal of clinical investigation. Han W. Jhaveri KA. 2012. Feinberg MW.284:24914-24924 5. Kruppel-like factor klf10 targets transforming growth factor-beta1 to regulate cd4(+)cd25(-) t cells and t regulatory cells. Chin MT. Wara AK. Wada Y. Hunninghake GM. The Journal of clinical investigation. Sanders J. The role of p21-activated kinase in the initiation of atherosclerosis. Shi GP. 2012. Arutiunov M.176:4995-5005 2. Schwartz MA. Tsimikas S. J Immunol. Libby P. Page 5 Reference 1. Cao Z. Duration and intensity of nf-kappab activity determine the severity of endotoxin-induced acute lung injury. Blackwell TS. Generation of mouse bone marrow-derived macrophages. Microrna-181b regulates nf-kappab-mediated vascular inflammation. Burke JR. Zhang Y. BMC cardiovascular disorders. Feinberg MW. Wara AK. 2012. Yamamoto T. Sadikot RT. Packard RR. Sun X. Subramaniam M.12:55 6. 2006.844:177-181 . Kodama T. Apostolou I. Naito M. Blackwell TS. Icli B. Methods Mol Biol. Debnath P. von Boehmer H. Libby P.111:897-906 4. Deficiency of cathepsin s reduces atherosclerosis in ldl receptor-deficient mice. Kobzik L. Manzanero S. He S. Everhart MB. Polosukhin VV. Vera MP. Sherrill TP. Yull FE. Witztum JL. Chernoff J. Hansson GK. Sun X. Pan JH. Sukhova GK. Christman JW. Spelsberg TC. Stapleton CJ. Belkin N. 2009. The Journal of biological chemistry. Baron RM.122:1973-1990 3.

mice fed a HFD for 1. The expression of circulating miR-181b and miR-146a was detected by qPCR in mouse plasma samples from ApoE-/.miR-181b 120 100 qPCR (%) 80 * 60 40 20 0 1 2 3 4 5 6 High fat diet (weeks) B Mouse plasma . Page 6 Online Figure I A Mouse plasma . Circulating miR-181b and miR-146a in the plasma of ApoE-/. Data show mean ± SEM. 4. The expression of miR-181b (A) or miR-146a (B) was normalized to small RNA U6 expression and com- pared to the expression at 1 week of HFD that was set to a value of one hun- dred or one. P < 0.miR-146a 5 * qPCR (fold change) 4 * 3 2 1 0 1 2 3 4 5 6 High fat diet (weeks) Online Figure I.mice fed a high-fat diet. . or 6 weeks (n=6-8 per group). respectively. *.05.

and T cell mark- ers CD3 and CD4 (D) in the aortic intima. and adventitia. QPCR analysis of EC markers vWF and Tie2 (A). Page 7 Online Figure II A vWF Tie2 B smMHC 150 150 150 qPCR (%) qPCR (%) qPCR (%) 100 100 100 50 50 50 0 0 0 a + a + a + m dia titia im ia im dia itia Inti e n Int Med ntitia Int Me vent M ve ve Ad Ad Ad C D CD68 CD3 CD4 150 150 150 qPCR (%) qPCR (%) qPCR (%) 100 100 100 50 50 50 0 0 0 ge a + ell ima ia + ell tima dia + tia p ha Intim edia titia T c Int Med ntitia Tc In Me nti cr o M ve n Ma ve ve Ad Ad Ad Online Figure II. . macrophage marker CD68 (C). smooth muscle marker smMHC (B). media. Data show mean ± SEM. Characterization of aortic intima. n=3.

**. . P < 0. and PBMCs from ApoE-/.mice. Data show mean ± SEM.01. P < 0. MiR-181b expression in the aortic intima. The expression of miR-181b was normalized to small RNA U6 expression and compared to its expression in aortic intima that was set to a value of one. media/adventitia. #. MiR-181b expression was detected by qPCR (n=5-6 per group).001. Page 8 Online Figure III miR-181b qPCR (fold change) 8 ** 6 # 4 2 0 a s Int im titia BMC ven P /ad dia Me Online Figure III.

Page 9 Online Figure IV A Liver-NF-κB 1000 N. non-significant.mice fed a high-fat diet for 12 weeks and received NS-m (n=5) or 181b-m (n=5). N. A.S.S. Luciferase / m g 800 600 400 200 0 NS-m 181b-m Plasma-ALT B 80 N. Plasma levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) of ApoE-/. AST (Units/L) 300 200 100 0 NS-m 181b-m Online Figure IV.. Data show mean ± SEM. ALT (Units/L) 60 40 20 0 NS-m 181b-m C Plasma-AST 400 N. Luciferase activity (represents NF-κB activity) is shown in livers from ApoE-/- /NGL Tg mice fed a high-fat diet for 12 weeks and received NS-m (n=9) or 181b-m (n=8). .S. Systemic delivery of miR-181b does not lead to changes in liver function. B and C.S.

Data show mean ± SEM. Page 10 Online Figure V Aortic intima .importin-α3 1.mice fed a high-fat diet. 4.5 qPCR (fold change) * 1.mice fed a HFD for 1.0 0. or 6 weeks (n=6-8 per group). .05.0 1 2 3 4 5 6 High fat diet (weeks) Online Figure V. Importin-α3 expression was detected by qPCR in the aortic intima from ApoE-/. *.5 0. The expression of importin-α3 was normalized to β-actin expression and compared to its expression at 1 week of HFD that was set to a value of one. Importin-α3 expression increases in the aortic intima of ApoE-/. P < 0.

S. N. . N.05. Data show mean ± SEM..S.S. 200 200 200 150 150 qPCR (%) 150 qPCR (%) qPCR (%) 100 100 100 50 50 50 0 0 0 -m m -m -m m m S- S- S- 1b 1b 1b N N N 18 18 18 CYLD N. 200 150 qPCR (%) 100 50 0 -m m S- 1b N 18 Online Figure VI.S. *. Page 11 Online Figure VI Prox1 AID NRP1 400 N. n=7-11. qPCR analysis of potential miR-181b target genes in the aortic arch.S. The expression of each gene was normalized to mouse β-actin expression and compared to its expression in mice that received NS-m and was subsequently set to a value of one hundred. N. 250 N. 200 * 300 200 150 qPCR (%) qPCR (%) qPCR (%) 150 200 100 100 100 50 50 0 0 0 -m -m m m m -m S- S- S- 1b 1b 1b N N N 18 18 18 Ptpn22 Ptpn11 DUSP6 N. non-significant.S.S. P < 0.

Western blot analysis of p65 in the nuclear fraction from macrophages transfected with NS-m or 181b-m. MiR-181b does not reduce NF-κB p65 nuclear translocation in macrophages. -m 81b- NS 1 NS 1 . + + LPS p65 USF-2 Online Figure VII. and treated with 100 ng/ml LPS for 90 min. . Page 12 Online Figure VII Nuclear fraction m m -m 81b. .

Consequently. smooth muscle cell. E-selectin. MØ. endothelial cell. Systemic delivery of miR-181b suppresses NF-κB activation in the vascular endothelium by reducing the expression of importin-α3. . and atherosclerotic lesion formation without altering NF-κB activation in leukocytes. EC. Subsequently. and atherosclerotic lesion formation are reduced due to reduced endothelial NF-κB activation. In contrast. MiR-181b inhibits vascular endothelial NF-κB activation. Page 13 Online Figure VIII Lumen Monocyte NF-κBs Importin-α3 miR-181b Importin-α5 IL-1β Adhesion COX-2 T Monocyte molecules T EC EC EC NF-κBs Importin-α5 Importin-α3 miR-181b VCAM-1 E-selectin Monocyte T T Monocyte MØ Leukocyte Foam cell recruitment MØ Inflammation Atherosclerosis SMC SMC SMC Media SMC SMC Online Figure VIII. miR-181b selectively inhibits endothelial NF-κB target gene expression including adhesion molecules VCAM-1. macrophage. importin-α5 is the dominantly expressed importin isoform in leukocytes that mediates NF-κB translocation. T cell. a protein that plays a critical role in NF-κB nuclear translocation. ICAM-1. the influx of lesional macrophages and CD4+ T cells. T. and cytokines TNF-α and IL-1β. SMC. the recruitment of leukocytes into lesions.

Page 14 Online Table I. Primers for Real time qPCR Name Sequence (5' −> 3') mouse VCAM-1 forward: GTTCCAGCGAGGGTCTACC mouse VCAM-1 reverse: AACTCTTGGCAAACATTAGGTGT mouse E-selectin forward: ATGCCTCGCGCTTTCTCTC mouse E-selectin reverse: GTAGTCCCGCTGACAGTATGC mouse ICAM-1 forward: GTGATGCTCAGGTATCCATCCA mouse ICAM-1 reverse: CACAGTTCTCAAAGCACAGCG mouse TNF-alpha forward: CCCTCACACTCAGATCATCTTCT mouse TNF-alpha reverse: GCTACGACGTGGGCTACAG mouse IL-1beta forward: GCAACTGTTCCTGAACTCAACT mouse IL-1beta reverse: ATCTTTTGGGGTCCGTCAACT mouse beta-actin forward: GAAATCGTGCGTGACATCAAAG mouse beta-actin reverse: TGTAGTTTCATGGATGCCACAG mouse IL10 forward: GCTCTTACTGACTGGCATGAG mouse IL10 reverse: CGCAGCTCTAGGAGCATGTG mouse Cd3 forward: ATGCGGTGGAACACTTTCTGG mouse Cd3 reverse: GCACGTCAACTCTACACTGGT mouse Cd4 forward: TCCTAGCTGTCACTCAAGGGA mouse Cd4 reverse: TCAGAGAACTTCCAGGTGAAGA mouse Cox2 forward: TGAGCAACTATTCCAAACCAGC mouse Cox2 reverse: GCACGTAGTCTTCGATCACTATC mouse Cd68 forward: TGTCTGATCTTGCTAGGACCG mouse Cd68 reverse: GAGAGTAACGGCCTTTTTGTGA mouse vWF forward: CTTCTGTACGCCTCAGCTATG mouse vWF reverse: GCCGTTGTAATTCCCACACAAG mouse Tie-2 forward: GAGTCAGCTTGCTCCTTTATGG mouse Tie-2 reverse: AGACACAAGAGGTAGGGAATTGA mouse smMHC forward: AAGCTGCGGCTAGAGGTCA mouse smMHC reverse: CCCTCCCTTTGATGGCTGAG mouse IPOA1 forward: ATGTCCACGAACGAGAATGCT mouse IPOA1 reverse: AAGGAGCTGACGTTTCTTCTTTT mouse IPOA3 forward: CCAGTGATCGAAATCCACCAA mouse IPOA3 reverse: CGTTTGTTCAGACGTTCCAGAT mouse IPOA4 forward: TCGGGAACTTCTGCACAGAC mouse IPOA4 reverse: ACACCGCTTGTTCACAAACATT mouse IPOA5 forward: ACCAGGAAAAGAGAACTTTCGC mouse IPOA5 reverse: GTCAGAGGTGATGACACCCC mouse IPOA7 forward: AAGAACAATGCCTTAAACCCTGA mouse IPOA7 reverse: AGCAGACTATCAAACATGGCAG mouse PROX1 forward: AGAAGGGTTGACATTGGAGTGA mouse PROX1 reverse: TGCGTGTTGCACCACAGAATA mouse AID forward: ACCTTCGCAACAAGTCTGGCT mouse AID reverse: AGCCTTGCGGTCTTCACAGAA mouse NRP1 forward: GACAAATGTGGCGGGACCATA mouse NRP1 reverse: TGGATTAGCCATTCACACTTCTC .

Page 15 mouse PTEN forward: TGGATTCGACTTAGACTTGACCT mouse PTEN reverse: GCGGTGTCATAATGTCTCTCAG mouse Ptpn22 forward: CAGCAACTACTGAAAGAAGCCC mouse Ptpn22 reverse: AGGATAGATTTTGTCGGCCTTG mouse Ptpn11 forward: AGAGGGAAGAGCAAATGTGTCA mouse Ptpn11 reverse: CTGTGTTTCCTTGTCCGACCT mouse DUSP6 forward: ATAGATACGCTCAGACCCGTG mouse DUSP6 reverse: ATCAGCAGAAGCCGTTCGTT mouse CYLD forward: ATTTCCAGGAGTTGTACGCTTC mouse CYLD reverse: CGTGAAACCTTGACCACGAC .